version
PlantPromoterDB promoter information of Os03g0138600

Summary of Gene (Os03g0138600)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0138600        NCBI 
Gene model Os03g0138600  
Description Protein of unknown function DUF810 family protein.  
#
#

Overview

Focused view (chromosome 3: 2109050-2107851)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os03g0138600                     5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os03g0138600

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-2107841-41

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGGCCCCACCAC-21078852107899-85-99
 OsREG616GCCGGGCC        PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC      PPDB MotifACGGGC  PLACE Motif 
 OsREG641   GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG527       CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCGGGTGGGGCC-21079162107926-116-126
 OsREG528CGGGTGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC  PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC PPDB Motif  PLACE Motif 
REGACGTGTCG-21079552107962-155-162
 OsREG452ACGTGTCG PPDB MotifACGT  PLACE MotifACGTGKC 
REGAGTTGGGCCGAAGAAGCCCATA-21079822108003-182-203
 OsREG479AGTTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC              PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA            PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG582            GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429             AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG465              AGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGTTTCGGCC-21080192108026-219-226
 OsREG634TTTCGGCC PPDB Motif  PLACE Motif 
REGAGATGGGCCAT-21080462108056-246-256
 OsREG456AGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487   TGGGCCAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.