version
PlantPromoterDB promoter information of Os03g0284000

Summary of Gene (Os03g0284000)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0284000        NCBI 
Gene model Os03g0284000  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 3: 9806669-9807868)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os03g0284000                     5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os03g0284000

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+9807559-110

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGGCCCGGCC+98073779807388-292-281
 OsREG504CACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG    PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG   PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC  PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC PPDB Motif  PLACE Motif 
REGCTTGGGCCGTGCTTGGGCTGC+98073989807418-271-251
 OsREG581CTTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT            PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504   GGGCCGTG           PPDB MotifGCCCA  PLACE Motif 
 OsREG459           CTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG511            TTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591             TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGCACGTGGGCCGGAACGGCCCG+98074279807447-242-222
 OsREG508CACGTGGG              PPDB MotifACGT  PLACE Motif 
 OsREG449 ACGTGGGC             PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571  CGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG564   GTGGGCCG           PPDB MotifGCCCA  PLACE Motif 
 OsREG542    TGGGCCGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG644     GGGCCGGA         PPDB MotifGCCCA  PLACE Motif 
 OsREG423            AACGGCCC  PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG446             ACGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGGAGGCGTG+98074549807461-215-208
 OsREG503GAGGCGTG PPDB Motif  PLACE Motif 
REGCCTGGGCCAT+98074739807482-196-187
 OsREG550CCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487  TGGGCCAT PPDB MotifGCCCA  PLACE Motif 
REGGGCGTGGA+98074929807499-177-170
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.