PlantPromoterDB promoter information of Os03g0581700

Summary of Gene (Os03g0581700)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0581700        NCBI 
Gene model Os03g0581700  
Description NONE  


Focused view (chromosome 3: 22138568-22137369)

Genome position     
from initiation codon
TSS from cDNA
TSS information
Os03g0581700                     5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of Os03g0581700

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+22138320AK121839, 009-177-G11, J100028F10, J023110K21, AK059201, J065205K10, J033120D11, J100080O13, J065102G22, J065044P15, J065149N14, J065201L18, J075035D19, J075073E06, J075134M11, J090004P12, J090070H20, J023022K06, J100036M18, J100065C24, J090087B04, AK121839, J033100N18

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGCGCCACGT+2213803122138038009-177-G11, AK059201, AK121839, J023022K06, J023110K21, J033100N18, J033120D11, J065044P15, J065102G22, J065149N14, J065201L18, J065205K10, J075035D19, J075073E06, J075134M11, J090004P12, J090070H20, J090087B04, J100028F10, J100036M18, J100065C24, J100080O13
REGTGAGGGACCCG+2213809622138106009-177-G11, AK059201, AK121839, J023022K06, J023110K21, J033100N18, J033120D11, J065044P15, J065102G22, J065149N14, J065201L18, J065205K10, J075035D19, J075073E06, J075134M11, J090004P12, J090070H20, J090087B04, J100028F10, J100036M18, J100065C24, J100080O13
REGTAAGCCCATCCGGCCCAAAT+2213819122138210009-177-G11, AK059201, AK121839, J023022K06, J023110K21, J033100N18, J033120D11, J065044P15, J065102G22, J065149N14, J065201L18, J065205K10, J075035D19, J075073E06, J075134M11, J090004P12, J090070H20, J090087B04, J100028F10, J100036M18, J100065C24, J100080O13
 OsREG655TAAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG608   GCCCATCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG644        TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542         CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563          CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625           GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493            GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.