version
PlantPromoterDB promoter information of Os03g0716200

Summary of Gene (Os03g0716200)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0716200        NCBI 
Gene model Os03g0716200  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 3: 29753272-29752073)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os03g0716200                     5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os03g0716200

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-29752289-17

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGGCCCAA-2975232929752337-57-65
 OsREG618GCGGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA PPDB MotifGCCCA  PLACE Motif 
REGGCGACGCGCACCGCACCGC-2975239229752410-120-138
 OsREG559GCGACGCG            PPDB Motif  PLACE MotifCGACG 
 OsREG554      CGCACCGCACCGC PPDB Motif  PLACE Motif 
 OsREG500        CACCGCAC    PPDB Motif  PLACE Motif 
REGGGCCCCACC-2975246229752470-190-198
 OsREG631GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612 GCCCCACC PPDB Motif  PLACE Motif 
REGATGGCCCACCGGAGTGGGCCCCACA-2975253529752559-263-287
 OsREG487ATGGCCCA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC                PPDB MotifGCCCA  PLACE Motif 
 OsREG532          GGAGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG478            AGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640             GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647              TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641               GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631                GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611                 GCCCCACA PPDB Motif  PLACE Motif 
REGGCCCACCT-2975258129752588-309-316
 OsREG476GCCCACCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.