version
PlantPromoterDB promoter information of Os04g0476000

Summary of Gene (Os04g0476000)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0476000        NCBI 
Gene model Os04g0476000  
Description Tetratricopeptide-like helical domain containing protein.  
#
#

Overview

Focused view (chromosome 4: 24224154-24225353)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os04g0476000                     5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os04g0476000

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+24225067-87

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTCC+2422502924225038-125-116
Y PatchCCCTCTCT+2422508724225094-67-60
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCCCAATA+2422495624224968-198-186
 OsREG441ACCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG639   GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596     GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGTTCGTGGGCCCCACACG+2422497024224986-184-168
 OsREG529TTCGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG601 TCGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG611       GCCCCACA   PPDB Motif  PLACE Motif 
 OsREG535        CCCCACAC  PPDB Motif  PLACE Motif 
 OsREG526         CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCATT+2422501524225024-139-130
 OsREG435ACAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.