version
PlantPromoterDB promoter information of Os05g0377000

Summary of Gene (Os05g0377000)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0377000        NCBI 
Gene model Os05g0377000  
Description Similar to Acyl carrier protein (ACP).  
#
#

Overview

Focused view (chromosome 5: 18200985-18199786)

Genome position     
from initiation codon
                    
Os05g0378300        
TSS from cDNA
TSS information
Os05g0377000                     5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os05g0377000

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-18200046-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTGGGCCAGATGGGCCGGA-1820009518200114-110-129
 OsREG620GCTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG577  TGGGCCAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG638   GGGCCAGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG456        AGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590         GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490          ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542           TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644            GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGACCGGCCCATCA-1820012418200135-139-150
 OsREG440ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607    GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGCCCATGAAGTTGGGCT-1820013918200155-154-170
 OsREG609GCCCATGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG479        AGTTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG458         GTTGGGCT PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGTGAGGGAC-1820019018200197-205-212
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGCGCCACGTC-1820031418200322-329-337
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.