PlantPromoterDB promoter information of Os05g0445400

Summary of Gene (Os05g0445400)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0445400        NCBI 
Gene model Os05g0445400  
Description NONE  


Focused view (chromosome 5: 21881443-21880244)

Genome position     
from initiation codon
TSS from cDNA
TSS information
Os05g0445400                     5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of Os05g0445400

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+21881246AK121459, 009-129-D11, J023107J19, J023143J09, AK121459, 009-169-C11, 009-021-C05, 009-147-E04, J023001K23, J065049D04, J065188H04, J065092I06, D21114

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCGCTATATATG+2188120221881213009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
Y PatchTCCTCCCCT+2188125821881266009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
Y PatchTCTTCCCC+2188128421881291009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04

REG information

TypeSequenceAnnotationGenome positionGene model
REGTTGTGGGCT+2188095321880961009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
REGTCATGGGCT+2188096721880975009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
REGTCTGGCCCATT+2188098221880992009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
REGGCAGCCCATG+2188101221881021009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
REGTCCGGCCCATGGGCCGTGGGCCTC+2188109321881116009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
 OsREG644TCCGGCCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA                PPDB MotifGCCCA  PLACE Motif 
 OsREG445         TGGGCCGT        PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504          GGGCCGTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG521           GGCCGTGG      PPDB Motif  PLACE Motif 
 OsREG547             CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571              CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472               GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587                TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGATCCAACGG+2188114621881154009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04
REGCGTTCCGT+2188119321881200009-021-C05, 009-129-D11, 009-147-E04, 009-169-C11, AK121459, D21114, J023001K23, J023107J19, J023143J09, J065049D04, J065092I06, J065188H04

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.