version
PlantPromoterDB promoter information of Os07g0611800

Summary of Gene (Os07g0611800)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0611800        NCBI 
Gene model Os07g0611800  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 25856173-25857372)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os07g0611800                     5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os07g0611800

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+25855746-977

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC+2585573025855737-993-986
Y PatchCTCTCCTC+2585578325855790-940-933
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAGCCCATACTGGCCCAATT+2585551425855534-1209-1189
 OsREG582GAAGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA            PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG577          CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659           TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492            GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433             GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGCGCACGGCCCATG+2585553825855556-1185-1167
 OsREG555CGCGTGCG            PPDB Motif  PLACE Motif 
 OsREG504        CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445         ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490          CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517           GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCCCACTCC+2585568225855689-1041-1034
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.