version
PlantPromoterDB promoter information of Os12g0188801

Summary of Gene (Os12g0188801)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0188801        NCBI 
Gene model Os12g0188801  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 4469471-4468272)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
Os12g0188801                     5'->3' (-)
Promoter sequence

 
012-030-C08         
J013027N23          
J013156K23          
J023134K02          
J033051M18          
J033143K05          
J080003C24          
J080004K05          
J080009D14          
J080014L12          
J080020E23          
J080021K20          
J080024B19          
J080024C12          
J080031K10          
J080034G09          
J080036C10          
J080037K18          
J080039J17          
J080040A20          
J080042B06          
J080046P07          
J080047G02          
J080049E12          
J080056N14          
J080059K10          
J080064F05          
J080064I04          
J080064K17          
J080069A15          
J080071E22          
J080071M24          
J080074C17          
J080075J07          
J080079F11          
J080083F15          
J080084N21          
J080086O03          
J080089K02          
J080092K22          
J080093P09          
J090001N04          
J090041M02          
J090076M01          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of Os12g0188801

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+4468961J013027N23, J013156K23, J090001N04, J023134K02, J033051M18, J013027N23, J090041M02, 012-030-C08, J033143K05, J080003C24, J080004K05, J080009D14, J080014L12, J080020E23, J080021K20, J080024B19, J080024C12, J080031K10, J080034G09, J080036C10, J080037K18, J080039J17, J080040A20, J080042B06, J080046P07, J080047G02, J080049E12, J080056N14, J080059K10, J080064F05, J080064I04, J080064K17, J080069A15, J080071E22, J080071M24, J080074C17, J080075J07, J080079F11, J080083F15, J080084N21, J080086O03, J080089K02, J080092K22, J080093P09

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCGGGCCCGC+44688004468810012-030-C08, J013027N23, J013156K23, J023134K02, J033051M18, J033143K05, J080003C24, J080004K05, J080009D14, J080014L12, J080020E23, J080021K20, J080024B19, J080024C12, J080031K10, J080034G09, J080036C10, J080037K18, J080039J17, J080040A20, J080042B06, J080046P07, J080047G02, J080049E12, J080056N14, J080059K10, J080064F05, J080064I04, J080064K17, J080069A15, J080071E22, J080071M24, J080074C17, J080075J07, J080079F11, J080083F15, J080084N21, J080086O03, J080089K02, J080092K22, J080093P09, J090001N04, J090041M02
 OsREG616GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG619   GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCCCG+44688254468835012-030-C08, J013027N23, J013156K23, J023134K02, J033051M18, J033143K05, J080003C24, J080004K05, J080009D14, J080014L12, J080020E23, J080021K20, J080024B19, J080024C12, J080031K10, J080034G09, J080036C10, J080037K18, J080039J17, J080040A20, J080042B06, J080046P07, J080047G02, J080049E12, J080056N14, J080059K10, J080064F05, J080064I04, J080064K17, J080069A15, J080071E22, J080071M24, J080074C17, J080075J07, J080079F11, J080083F15, J080084N21, J080086O03, J080089K02, J080092K22, J080093P09, J090001N04, J090041M02
 OsREG553CGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGGCCCGGCCC+44688414468849012-030-C08, J013027N23, J013156K23, J023134K02, J033051M18, J033143K05, J080003C24, J080004K05, J080009D14, J080014L12, J080020E23, J080021K20, J080024B19, J080024C12, J080031K10, J080034G09, J080036C10, J080037K18, J080039J17, J080040A20, J080042B06, J080046P07, J080047G02, J080049E12, J080056N14, J080059K10, J080064F05, J080064I04, J080064K17, J080069A15, J080071E22, J080071M24, J080074C17, J080075J07, J080079F11, J080083F15, J080084N21, J080086O03, J080089K02, J080092K22, J080093P09, J090001N04, J090041M02
 OsREG614GCCCGGCC  PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCAAG+44688524468862012-030-C08, J013027N23, J013156K23, J023134K02, J033051M18, J033143K05, J080003C24, J080004K05, J080009D14, J080014L12, J080020E23, J080021K20, J080024B19, J080024C12, J080031K10, J080034G09, J080036C10, J080037K18, J080039J17, J080040A20, J080042B06, J080046P07, J080047G02, J080049E12, J080056N14, J080059K10, J080064F05, J080064I04, J080064K17, J080069A15, J080071E22, J080071M24, J080074C17, J080075J07, J080079F11, J080083F15, J080084N21, J080086O03, J080089K02, J080092K22, J080093P09, J090001N04, J090041M02
 OsREG538CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCC+44689004468907012-030-C08, J013027N23, J013156K23, J023134K02, J033051M18, J033143K05, J080003C24, J080004K05, J080009D14, J080014L12, J080020E23, J080021K20, J080024B19, J080024C12, J080031K10, J080034G09, J080036C10, J080037K18, J080039J17, J080040A20, J080042B06, J080046P07, J080047G02, J080049E12, J080056N14, J080059K10, J080064F05, J080064I04, J080064K17, J080069A15, J080071E22, J080071M24, J080074C17, J080075J07, J080079F11, J080083F15, J080084N21, J080086O03, J080089K02, J080092K22, J080093P09, J090001N04, J090041M02
 OsREG419AAAAGCCC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.