
Summary of CNGTTR (All list)

Organism Arabidopsis thaliana
Description Binding site for all animal MYB and at least two plant MYB proteins ATMYB1 and ATMYB2, both isolated from Arabidopsis; ATMYB2 is involved in regulation of genes that are responsive to water stress in Arabidopsis; A petunia MYB protein (MYB.Ph3) is involved in regulation of flavonoid biosynthesis (Solano et al. EMBO J 14:1773 (1995)); See S000355;
Total Entry Count 1680

Entry Sequences (1680 entries)

LocusGene modelSequenceDescription
AT1G01500AT1G01500.1TAAGCCCATTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01620AT1G01620.1TCCAACGGTCa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT1G01620.2TCCAACGGTCa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT1G01910AT1G01910.1TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.2TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.3TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.4TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.5TTTAACCGanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G02160AT1G02160.1TAACCGGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02160.2TAACCGGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02305AT1G02305.1CAACGGTCcathepsin B-like cysteine protease, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis, regulation of catalytic activity; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Peptidase C1A, cathepsin B (InterPro:IPR015643), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169), Peptidase C1A, propeptide (InterPro:IPR012599); BEST Arabidopsis thaliana protein match is: cathepsin B-like cysteine protease, putative (TAIR:AT1G02300.1); Has 5940 Blast hits to 5910 proteins in 586 species: Archae - 35; Bacteria - 87; Metazoa - 2802; Fungi - 4; Plants - 1108; Viruses - 129; Other Eukaryotes - 1775 (source: NCBI BLink).
AT1G02360AT1G02360.1CCGTTAAAGTCAAAAGTCAAchitinase, putative; FUNCTIONS IN: chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: stem, leaf whorl, cotyledon, root; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 19 (InterPro:IPR016283), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT4G01700.1); Has 1395 Blast hits to 1389 proteins in 323 species: Archae - 0; Bacteria - 316; Metazoa - 35; Fungi - 2; Plants - 988; Viruses - 2; Other Eukaryotes - 52 (source: NCBI BLink).
AT1G02890AT1G02890.1CCGTTGGATAAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), SMAD/FHA domain (InterPro:IPR008984), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT4G02480.1); Has 23205 Blast hits to 21556 proteins in 1781 species: Archae - 951; Bacteria - 7411; Metazoa - 4074; Fungi - 2356; Plants - 1493; Viruses - 28; Other Eukaryotes - 6892 (source: NCBI BLink).
AT1G02890.2CCGTTGGATAAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), SMAD/FHA domain (InterPro:IPR008984), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT4G02480.1); Has 23205 Blast hits to 21556 proteins in 1781 species: Archae - 951; Bacteria - 7411; Metazoa - 4074; Fungi - 2356; Plants - 1493; Viruses - 28; Other Eukaryotes - 6892 (source: NCBI BLink).
AT1G03250AT1G03250.1TTAACCGGAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 65 Blast hits to 65 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 29; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G03475AT1G03475.1GCCCGTTAEncodes coproporphyrinogen III oxidase, a key enzyme in the biosynthetic pathway of chlorophyll and heme, a tetrapyrrole pathway. Mutants express cytological and molecular markers associated with the defense responses, usually activated by pathogen infection.
AT1G03780AT1G03780.1ACCGTTAGHomolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.
AT1G03780.2ACCGTTAGHomolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.
AT1G03890AT1G03890.1TTTCCGGTTAAAcupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf, seed; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S plant seed storage protein (InterPro:IPR006044); BEST Arabidopsis thaliana protein match is: CRA1 (CRUCIFERINA); nutrient reservoir (TAIR:AT5G44120.3); Has 691 Blast hits to 656 proteins in 126 species: Archae - 0; Bacteria - 61; Metazoa - 2; Fungi - 0; Plants - 627; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G04070AT1G04070.1GGCCCGTTASubunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.
AT1G04080AT1G04080.1TAACGGGCCPRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink).
AT1G04130AT1G04130.1ATAACCGGTtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink).
AT1G04690AT1G04690.1CTTAACCGGAAPOTASSIUM CHANNEL BETA SUBUNIT (KAB1); FUNCTIONS IN: oxidoreductase activity, potassium channel activity; INVOLVED IN: oxidation reduction, potassium ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Potassium channel, voltage-dependent, beta subunit, KCNAB-related (InterPro:IPR005399); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G60690.1); Has 17446 Blast hits to 17422 proteins in 1383 species: Archae - 314; Bacteria - 9995; Metazoa - 800; Fungi - 1248; Plants - 507; Viruses - 0; Other Eukaryotes - 4582 (source: NCBI BLink).
AT1G04780AT1G04780.1TTTAACGGankyrin repeat family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT3G24210.1); Has 832 Blast hits to 578 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 576; Fungi - 12; Plants - 146; Viruses - 2; Other Eukaryotes - 88 (source: NCBI BLink).
AT1G04820AT1G04820.1CGGTTAAGEncodes an alpha tubulin isoform that is expressed in roots, leaves and flowers.
AT1G04940AT1G04940.1ACCGTTAGTic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation.
AT1G05010AT1G05010.1CGGTTAAAEncodes 1-aminocyclopropane-1-carboxylate oxidase
AT1G05150AT1G05150.1GACCGTTGcalcium-binding EF hand family protein; FUNCTIONS IN: binding, zinc ion binding, calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), EF hand (InterPro:IPR018248), Tetratricopeptide TPR2 (InterPro:IPR013105), EF-HAND 2 (InterPro:IPR018249), Tetratricopeptide region (InterPro:IPR013026), Zinc finger, ZZ-type (InterPro:IPR000433); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT2G32450.1); Has 27369 Blast hits to 12594 proteins in 993 species: Archae - 1214; Bacteria - 11971; Metazoa - 3725; Fungi - 450; Plants - 518; Viruses - 0; Other Eukaryotes - 9491 (source: NCBI BLink).
AT1G05220AT1G05220.1TGGTTCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 103 Blast hits to 103 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 10; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G05220.2TGGTTCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 103 Blast hits to 103 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 10; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G05270AT1G05270.1ATCCGGTTAAATraB family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pheromone shutdown-related, TraB (InterPro:IPR002816); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32340.1); Has 515 Blast hits to 497 proteins in 174 species: Archae - 89; Bacteria - 148; Metazoa - 111; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G05360AT1G05360.1ATAACCGGTAAACCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT1G05430AT1G05430.1ACCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05430.1TCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05720AT1G05720.1ATAACCGGAselenoprotein family protein; FUNCTIONS IN: selenium binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sep15/SelM redox (InterPro:IPR014912); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G05720.1CGGTTAAGselenoprotein family protein; FUNCTIONS IN: selenium binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sep15/SelM redox (InterPro:IPR014912); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G05850AT1G05850.1ATCCAACGGEncodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants.
AT1G06070AT1G06070.1ATCCAACGGTCbZIP transcription factor, putative (bZIP69); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP transcription factor (POSF21) (TAIR:AT2G31370.5); Has 38161 Blast hits to 16134 proteins in 672 species: Archae - 6; Bacteria - 1085; Metazoa - 14914; Fungi - 4009; Plants - 2167; Viruses - 428; Other Eukaryotes - 15552 (source: NCBI BLink).
AT1G06515AT1G06515.1ATCCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30942.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 10; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G06650AT1G06650.1GTCCGGTTAencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase
AT1G06650.2GTCCGGTTAencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase
AT1G06690AT1G06690.1ACCGGTTATaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink).
AT1G07110AT1G07110.1ATAACCGGAAEncodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase.
AT1G07110.1ATCCGGTTATEncodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase.
AT1G07280AT1G07280.1CCGTTGGATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G29670.1); Has 381 Blast hits to 218 proteins in 33 species: Archae - 4; Bacteria - 98; Metazoa - 1; Fungi - 2; Plants - 229; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G07280.2CCGTTGGATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G29670.1); Has 381 Blast hits to 218 proteins in 33 species: Archae - 4; Bacteria - 98; Metazoa - 1; Fungi - 2; Plants - 229; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G07280.3CCGTTGGATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT2G29670.1); Has 381 Blast hits to 218 proteins in 33 species: Archae - 4; Bacteria - 98; Metazoa - 1; Fungi - 2; Plants - 229; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G07430AT1G07430.1CAACGGTCprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G29380.1); Has 4401 Blast hits to 4389 proteins in 274 species: Archae - 0; Bacteria - 82; Metazoa - 1419; Fungi - 539; Plants - 1372; Viruses - 7; Other Eukaryotes - 982 (source: NCBI BLink).
AT1G07510AT1G07510.1ATAACCGGTencodes an FtsH protease that is localized to the mitochondrion
AT1G07570AT1G07570.1ATCCAACGGProtein kinase capable of phosphorylating tyrosine, serine, and threonine residues
AT1G07570.2ATCCAACGGProtein kinase capable of phosphorylating tyrosine, serine, and threonine residues
AT1G07660AT1G07660.1GACCGTTGhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07660.2GACCGTTGhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07960AT1G07960.1CCGTTGGAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07960.2CCGTTGGAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07960.3CCGTTGGAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G08030AT1G08030.1ATAACCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G08490AT1G08490.1TTTAACCGGTTTGChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation.
AT1G08570AT1G08570.1ACCGTTAGEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08570.2ACCGTTAGEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08570.3ACCGTTAGEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08570.4ACCGTTAGEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G09140AT1G09140.1ATCCGGTTAEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09140.2ATCCGGTTAEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09150AT1G09150.1TAACCGGATpseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).
AT1G09190AT1G09190.1TTTAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: shoot apex, sperm cell, embryo, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G56310.1); Has 12606 Blast hits to 4809 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 33; Plants - 12368; Viruses - 0; Other Eukaryotes - 192 (source: NCBI BLink).
AT1G09590AT1G09590.1ACAGGCCCGTTA60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G09630AT1G09630.1TTTCCGGTTAAGEncodes a putative GTP-binding protein. Associates with organelles on a pathway from the Golgi to the plasma membrane in interphase. In dividing cells acts at the cell plate.
AT1G09640AT1G09640.1CTTAACCGGAAAelongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell, pollen tube, leaf, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G57720.2); Has 6774 Blast hits to 6759 proteins in 920 species: Archae - 2; Bacteria - 2995; Metazoa - 1594; Fungi - 400; Plants - 499; Viruses - 0; Other Eukaryotes - 1284 (source: NCBI BLink).
AT1G09690AT1G09690.1TGTGGGCCGGTTAT60S ribosomal protein L21 (RPL21C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: juvenile leaf, pollen tube; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21A) (TAIR:AT1G09590.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G09840AT1G09840.1ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).
AT1G09840.2ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).
AT1G09840.3ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).
AT1G09840.4ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).
AT1G09840.5ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).
AT1G09840.6ATCCGGTTASHAGGY-LIKE PROTEIN KINASE 41 (ATSK41); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK42 (ARABIDOPSIS SHAGGY-LIKE KINASE 42); ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G57870.2); Has 75349 Blast hits to 74533 proteins in 2475 species: Archae - 36; Bacteria - 5917; Metazoa - 32063; Fungi - 7729; Plants - 14097; Viruses - 329; Other Eukaryotes - 15178 (source: NCBI BLink).
AT1G09932AT1G09932.1CGGTTAAAphosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G09932.2CGGTTAAAphosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G10020AT1G10020.1CTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1005 (InterPro:IPR010410); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29310.1); Has 93 Blast hits to 93 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 6; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G10090AT1G10090.1CTAACGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G10430AT1G10430.1AAACCGAACCTTAACCGGGTCEncodes one of two isoforms of the catalytic subunit of protein phosphatase 2A.
AT1G10660AT1G10660.1GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10660.2GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10660.3GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10660.4GTCCGGTTATunknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 90 Blast hits to 89 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 1; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10865AT1G10865.1ACCCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G10865.2ACCCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G10910AT1G10910.1TATGGCCCGTTAINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G11000AT1G11000.1GACCGTTGGAA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO4 belongs to the clade I, with AtMLO11 and AtMLO14. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of root, cotyledons and young leaves, it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G11190AT1G11190.1TTCCGGTTAAEncodes a bifunctional nuclease that acts on both RNA and DNA involved in nucleic acid degradation to facilitate nucleotide and phosphate recovery during senescence. It has mismatch-specific endonuclease activity with wide recognition of single base mismatches as well as the ability to cleave indel types of mismatches (heteroduplexes with loops).
AT1G11210AT1G11210.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF761, plant (InterPro:IPR008480); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11220.1); Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G11320AT1G11320.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G11360AT1G11360.1CTAACGGTuniversal stress protein (USP) family protein; INVOLVED IN: response to stress; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G54430.1); Has 714 Blast hits to 713 proteins in 147 species: Archae - 6; Bacteria - 231; Metazoa - 42; Fungi - 27; Plants - 403; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G11360.2CTAACGGTuniversal stress protein (USP) family protein; INVOLVED IN: response to stress; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G54430.1); Has 714 Blast hits to 713 proteins in 147 species: Archae - 6; Bacteria - 231; Metazoa - 42; Fungi - 27; Plants - 403; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G11360.3CTAACGGTuniversal stress protein (USP) family protein; INVOLVED IN: response to stress; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G54430.1); Has 714 Blast hits to 713 proteins in 147 species: Archae - 6; Bacteria - 231; Metazoa - 42; Fungi - 27; Plants - 403; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G11700AT1G11700.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61930.1); Has 197 Blast hits to 197 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 196; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G11710AT1G11710.1CTTAACCGGTCpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G01110.1); Has 19625 Blast hits to 5674 proteins in 176 species: Archae - 2; Bacteria - 23; Metazoa - 403; Fungi - 262; Plants - 18143; Viruses - 0; Other Eukaryotes - 792 (source: NCBI BLink).
AT1G12030AT1G12030.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62420.1); Has 213 Blast hits to 213 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 211; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G12270AT1G12270.1ATAACCGGstress-inducible protein, putative; FUNCTIONS IN: binding; INVOLVED IN: response to stress; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 29103 Blast hits to 13265 proteins in 843 species: Archae - 964; Bacteria - 7395; Metazoa - 8026; Fungi - 1794; Plants - 2170; Viruses - 39; Other Eukaryotes - 8715 (source: NCBI BLink).
AT1G12390AT1G12390.1TTTAACCGGAAAcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT1G12410AT1G12410.1CGGTTAAGEncodes a ClpP-related sequence. Though similar to ClpP proteins, this does not contains the highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G12440AT1G12440.1CCGTTGGATzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G12440.2CCGTTGGATzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G12450AT1G12450.1CTAACGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22850.1); Has 1233 Blast hits to 1230 proteins in 347 species: Archae - 2; Bacteria - 557; Metazoa - 104; Fungi - 72; Plants - 132; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink).
AT1G12500AT1G12500.1ATCCAACGGphosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620), Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT3G11320.1); Has 1798 Blast hits to 1797 proteins in 187 species: Archae - 4; Bacteria - 13; Metazoa - 544; Fungi - 288; Plants - 744; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).
AT1G12530AT1G12530.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56420.1); Has 29 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G12820AT1G12820.1CAACGGTCAUXIN SIGNALING F-BOX 3 (AFB3); FUNCTIONS IN: auxin binding, ubiquitin-protein ligase activity; INVOLVED IN: stamen development, pollen maturation, response to molecule of bacterial origin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AFB2 (AUXIN SIGNALING F-BOX 2); auxin binding / ubiquitin-protein ligase (TAIR:AT3G26810.1); Has 1735 Blast hits to 1177 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 751; Fungi - 96; Plants - 802; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).
AT1G12820.1CCGTTGGATAUXIN SIGNALING F-BOX 3 (AFB3); FUNCTIONS IN: auxin binding, ubiquitin-protein ligase activity; INVOLVED IN: stamen development, pollen maturation, response to molecule of bacterial origin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AFB2 (AUXIN SIGNALING F-BOX 2); auxin binding / ubiquitin-protein ligase (TAIR:AT3G26810.1); Has 1735 Blast hits to 1177 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 751; Fungi - 96; Plants - 802; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).
AT1G13220AT1G13220.1TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13220.2TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13350AT1G13350.1ATCCGGTTAAGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink).
AT1G13480AT1G13480.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1262 (InterPro:IPR010683); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G13520.1); Has 67 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13670AT1G13670.1TTAACCGGTTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13830AT1G13830.1CGGTTAAAbeta-1,3-glucanase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family protein 17 (TAIR:AT2G03505.1); Has 1380 Blast hits to 1160 proteins in 181 species: Archae - 6; Bacteria - 192; Metazoa - 167; Fungi - 74; Plants - 795; Viruses - 45; Other Eukaryotes - 101 (source: NCBI BLink).
AT1G13970AT1G13970.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29180.1); Has 129 Blast hits to 129 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 114; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G14400AT1G14400.1ACGGTTTAATTCCGGTTAubiquitin carrier protein
AT1G14400.1CCGGTTAAAubiquitin carrier protein
AT1G14400.2ACGGTTTAATTCCGGTTAubiquitin carrier protein
AT1G14400.2CCGGTTAAAubiquitin carrier protein
AT1G14650AT1G14650.1GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G14650.2GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G14900AT1G14900.1CCGTTGGATEncodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA.
AT1G15270AT1G15270.1TTTAACGGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G15280AT1G15280.1TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.2TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15370AT1G15370.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); Has 48 Blast hits to 48 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G15810AT1G15810.1TAACCGGAAAAGTCAAribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink).
AT1G15930AT1G15930.1CCGTTAAA40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).
AT1G15930.2CCGTTAAA40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).
AT1G16010AT1G16010.1ATAACCGGTmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G16010.1TTCCGGTTAAmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G16010.2ATAACCGGTmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G16010.2TTCCGGTTAAmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G16020AT1G16020.1CTTAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G16020.2CTTAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G16070AT1G16070.1GACCGTTGMember of TLP family
AT1G16070.2GACCGTTGMember of TLP family
AT1G16080AT1G16080.1CAACGGTCunknown protein; LOCATED IN: apoplast, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 18 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G16210AT1G16210.1CCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1014 (InterPro:IPR010422); Has 15664 Blast hits to 7512 proteins in 781 species: Archae - 22; Bacteria - 2461; Metazoa - 4728; Fungi - 1475; Plants - 417; Viruses - 118; Other Eukaryotes - 6443 (source: NCBI BLink).
AT1G16700AT1G16700.1ATAACCGGTTTGNADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink).
AT1G16700.1CCGGTTATNADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink).
AT1G16700.1GTCCGGTTANADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink).
AT1G17120AT1G17120.1GACCGTTGEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs.
AT1G17130AT1G17130.1CGACCCGGTTAAcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink).
AT1G17130.2CGACCCGGTTAAcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink).
AT1G17270AT1G17270.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G50420.1); Has 68 Blast hits to 68 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G17430AT1G17430.1TTTAACCGGAATTAACCGGAChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G72620.1); Has 3179 Blast hits to 3177 proteins in 659 species: Archae - 36; Bacteria - 2008; Metazoa - 134; Fungi - 8; Plants - 175; Viruses - 0; Other Eukaryotes - 818 (source: NCBI BLink).
AT1G17490AT1G17490.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72690.1); Has 29 Blast hits to 23 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17710AT1G17710.1CCGTTGGATphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G17710.1CTAACGGTTCAAphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G17710.2CCGTTGGATphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G17710.2CTAACGGTTCAAphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G17880AT1G17880.1ACCGTTAGnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G17880.1ATCCAACGGnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G18300AT1G18300.1ATAACCGGArabidopsis thaliana Nudix hydrolase homolog 4 (atnudt4); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol; EXPRESSED IN: stem, root, leaf; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt21 (Arabidopsis thaliana Nudix hydrolase homolog 21); hydrolase (TAIR:AT1G73540.1); Has 801 Blast hits to 799 proteins in 226 species: Archae - 1; Bacteria - 254; Metazoa - 216; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).
AT1G18500AT1G18500.1CCGTTAAAEncodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040).
AT1G18540AT1G18540.1TTTAACGG60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT1G18630AT1G18630.1CAACGGTCencodes a glycine-rich RNA binding protein.
AT1G18710AT1G18710.1ATCCAACGGMember of the R2R3 factor gene family.
AT1G18840AT1G18840.1ATCCAACGGIQD30; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD31 (IQ-domain 31); calmodulin binding (TAIR:AT1G74690.1); Has 2925 Blast hits to 2231 proteins in 269 species: Archae - 4; Bacteria - 220; Metazoa - 845; Fungi - 205; Plants - 455; Viruses - 13; Other Eukaryotes - 1183 (source: NCBI BLink).
AT1G18840.2ATCCAACGGIQD30; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD31 (IQ-domain 31); calmodulin binding (TAIR:AT1G74690.1); Has 2925 Blast hits to 2231 proteins in 269 species: Archae - 4; Bacteria - 220; Metazoa - 845; Fungi - 205; Plants - 455; Viruses - 13; Other Eukaryotes - 1183 (source: NCBI BLink).
AT1G19110AT1G19110.1CTAAACCGTTGGATinter-alpha-trypsin inhibitor heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G72500.1); Has 1260 Blast hits to 1251 proteins in 217 species: Archae - 8; Bacteria - 393; Metazoa - 471; Fungi - 34; Plants - 117; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).
AT1G19310AT1G19310.1ATCCAACGGTTAAGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G23780.1); Has 3650 Blast hits to 3643 proteins in 226 species: Archae - 0; Bacteria - 2; Metazoa - 2420; Fungi - 377; Plants - 427; Viruses - 21; Other Eukaryotes - 403 (source: NCBI BLink).
AT1G19330AT1G19330.1TCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G19330.2TCCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G19360AT1G19360.1CTAACGGTTAAGLOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: RRA2 (REDUCED RESIDUAL ARABINOSE 2) (TAIR:AT1G75110.1); Has 165 Blast hits to 162 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 152; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G19400AT1G19400.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75180.3); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G19400.2TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75180.3); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G19870AT1G19870.1TTTAACCGIQ-domain 32 (iqd32); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus, plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD31 (IQ-domain 31); calmodulin binding (TAIR:AT1G74690.1); Has 7574 Blast hits to 5259 proteins in 449 species: Archae - 14; Bacteria - 667; Metazoa - 3528; Fungi - 829; Plants - 616; Viruses - 32; Other Eukaryotes - 1888 (source: NCBI BLink).
AT1G19960AT1G19960.1ACCGTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: transmembrane receptor (TAIR:AT2G32140.1); Has 41 Blast hits to 41 proteins in 16 species: Archae - 0; Bacteria - 2; Metazoa - 25; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G19990AT1G19990.1TTTAACCGGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11600.1); Has 10416 Blast hits to 6328 proteins in 368 species: Archae - 4; Bacteria - 381; Metazoa - 4559; Fungi - 839; Plants - 384; Viruses - 34; Other Eukaryotes - 4215 (source: NCBI BLink).
AT1G20070AT1G20070.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20220AT1G20220.1TTTAACCGGTTTAAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G76010.1); Has 42345 Blast hits to 16680 proteins in 1015 species: Archae - 19; Bacteria - 12355; Metazoa - 15425; Fungi - 3233; Plants - 4676; Viruses - 581; Other Eukaryotes - 6056 (source: NCBI BLink).
AT1G20730AT1G20730.1ATAACCGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF833 (InterPro:IPR008551), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20740.1); Has 303 Blast hits to 300 proteins in 118 species: Archae - 0; Bacteria - 180; Metazoa - 8; Fungi - 0; Plants - 63; Viruses - 2; Other Eukaryotes - 50 (source: NCBI BLink).
AT1G20770AT1G20770.1ATAACCGGTTTGACCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20780AT1G20780.1TTCGGGTCAAACCGGTTATEncodes a protein containing a U-box and an ARM domain.
AT1G20823AT1G20823.1CTTAACCGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ATL8; protein binding / zinc ion binding (TAIR:AT1G76410.1); Has 6059 Blast hits to 6039 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 2063; Fungi - 426; Plants - 2686; Viruses - 21; Other Eukaryotes - 863 (source: NCBI BLink).
AT1G21010AT1G21010.1TTAAACCGTAACCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76600.1); Has 113 Blast hits to 113 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 113; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21700AT1G21700.1TTGACTTTAACCGa member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003).
AT1G21710AT1G21710.1CGGTTAAAGTCAAEncodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme.
AT1G21930AT1G21930.1CGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G42150.3); Has 24 Blast hits to 24 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21930.1TTTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G42150.3); Has 24 Blast hits to 24 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22040AT1G22040.1ATCCAACGGTCkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G55270.1); Has 8530 Blast hits to 4244 proteins in 221 species: Archae - 18; Bacteria - 386; Metazoa - 6931; Fungi - 33; Plants - 777; Viruses - 68; Other Eukaryotes - 317 (source: NCBI BLink).
AT1G22310AT1G22310.1ATAACCGGTTTAAProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT1G22310.1TTTAACCGGProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT1G22310.2ATAACCGGTTTAAProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT1G22310.2TTTAACCGGProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT1G22410AT1G22410.1CCGGTTAT2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative; FUNCTIONS IN: 3-deoxy-7-phosphoheptulonate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DAHP synthetase, class II (InterPro:IPR002480); BEST Arabidopsis thaliana protein match is: DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1); 3-deoxy-7-phosphoheptulonate synthase (TAIR:AT4G39980.1); Has 3140 Blast hits to 3125 proteins in 395 species: Archae - 0; Bacteria - 662; Metazoa - 0; Fungi - 68; Plants - 129; Viruses - 0; Other Eukaryotes - 2281 (source: NCBI BLink).
AT1G22885AT1G22885.1ATAACCGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22885.2ATAACCGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22960AT1G22960.1TTGAACCGGTCCGGTTAAGpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink).
AT1G22960.1TTTAACCGpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink).
AT1G22960.1TTTAACCGGTCpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink).
AT1G22960.1TTTAACGGpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 24639 Blast hits to 6022 proteins in 188 species: Archae - 4; Bacteria - 28; Metazoa - 847; Fungi - 689; Plants - 21875; Viruses - 0; Other Eukaryotes - 1196 (source: NCBI BLink).
AT1G23060AT1G23060.1CGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70950.1); Has 368 Blast hits to 334 proteins in 83 species: Archae - 0; Bacteria - 32; Metazoa - 145; Fungi - 21; Plants - 89; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink).
AT1G23060.2CGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70950.1); Has 368 Blast hits to 334 proteins in 83 species: Archae - 0; Bacteria - 32; Metazoa - 145; Fungi - 21; Plants - 89; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink).
AT1G23190AT1G23190.1ATCCAACGGphosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative; FUNCTIONS IN: intramolecular transferase activity, phosphotransferases, magnesium ion binding, phosphoglucomutase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, plasma membrane, chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-D-phosphohexomutase, C-terminal (InterPro:IPR005843), Alpha-D-phosphohexomutase, conserved site (InterPro:IPR016066), Alpha-D-phosphohexomutase, alpha/beta/alpha I, II and III (InterPro:IPR016055), Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (InterPro:IPR005846), Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (InterPro:IPR005845), Alpha-D-phosphohexomutase, N-terminal (InterPro:IPR005841), Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (InterPro:IPR005844); BEST Arabidopsis thaliana protein match is: phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative (TAIR:AT1G70730.3); Has 4473 Blast hits to 4462 proteins in 1171 species: Archae - 68; Bacteria - 2876; Metazoa - 457; Fungi - 136; Plants - 117; Viruses - 0; Other Eukaryotes - 819 (source: NCBI BLink).
AT1G23780AT1G23780.1CTAACGGTF-box family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G23770.1); Has 177 Blast hits to 177 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G24265AT1G24265.1GTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G24265.2GTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24267.1); Has 115 Blast hits to 113 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G24706AT1G24706.1CTTAACCGGACCCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink).
AT1G24800AT1G24800.1TTTAACCGCONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25211.1); Has 745 Blast hits to 722 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G25211AT1G25211.1TTTAACCGCONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25055.1); Has 745 Blast hits to 722 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 743; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G25370AT1G25370.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68340.1); Has 144 Blast hits to 144 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 143; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G25370.1CGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68340.1); Has 144 Blast hits to 144 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 143; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G25375AT1G25375.1ACGGTTTAACCGmetallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 3890 Blast hits to 3889 proteins in 863 species: Archae - 83; Bacteria - 2082; Metazoa - 121; Fungi - 86; Plants - 75; Viruses - 0; Other Eukaryotes - 1443 (source: NCBI BLink).
AT1G25380AT1G25380.1CGGTTAAACCGTmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G47490.1); Has 21875 Blast hits to 10577 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10770; Fungi - 5942; Plants - 2991; Viruses - 5; Other Eukaryotes - 2167 (source: NCBI BLink).
AT1G26180AT1G26180.1CCAAACCGGATTTTAACCGunknown protein; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 229 Blast hits to 229 proteins in 65 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT1G27060AT1G27060.1ATCCGGTTAregulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: Ran GTPase binding / chromatin binding / zinc ion binding (TAIR:AT5G12350.1); Has 15042 Blast hits to 4459 proteins in 302 species: Archae - 65; Bacteria - 1621; Metazoa - 6396; Fungi - 635; Plants - 1177; Viruses - 2; Other Eukaryotes - 5146 (source: NCBI BLink).
AT1G27100AT1G27100.1ATAACCGGATACCGGTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF569 (InterPro:IPR007679), Actin_cross-linking (InterPro:IPR008999); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69900.1); Has 184 Blast hits to 118 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 8; Plants - 166; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G27190AT1G27190.1TCCAACGGTGTCGTTTTleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT1G69990.1); Has 68357 Blast hits to 43210 proteins in 1433 species: Archae - 27; Bacteria - 4242; Metazoa - 15832; Fungi - 1729; Plants - 40190; Viruses - 134; Other Eukaryotes - 6203 (source: NCBI BLink).
AT1G27310AT1G27310.1TAACGGGCCCAACTEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.
AT1G27540AT1G27540.1CCGTTAAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27540.2CCGTTAAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27650AT1G27650.1TTAACCGGTTCAAU2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.
AT1G27650.2TTAACCGGTTCAAU2 auxiliary factor small subunit. The atU2AF35a protein and its homolog, atU2AF35b, contain most of the conserved domains of hsU2AF35, including the psiRRM, one RS domain, two zinc fingers, and the two regions for interacting with U2AF large subunit. Both proteins lack the stretch of glycines present in human U2AF35. The sequences are overall 83% identical, and each Arabidopsis homolog shows approximately 70% similarity to hsU2AF35. U2AF(35) homologs were also identified from maize, rice and other plants with large-scale EST projects. Both genes are expressed in all major tissues, with atU2AF(35)a expressed at a higher level than atU2AF(35)b in most tissues. The expression patterns were different in roots: atU2AF(35)b expressed strongly in whole young roots and root tips and atU2AF(35)a limited to root vascular regions.
AT1G28281AT1G28281.1TTAACCGGGTTunknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT1G29060AT1G29060.1ATCGGCCCGTTAAAAAAGCCCATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G29240AT1G29240.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF688 (InterPro:IPR007789); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G34170.2); Has 42 Blast hits to 42 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G29390AT1G29390.1TTTAACGGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29390.2TTTAACGGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29395AT1G29395.1TCCAACGGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. Possibly targeted to thylakoid membrane.
AT1G29960AT1G29960.1ATAACCGGpeptidase/ serine-type peptidase; FUNCTIONS IN: serine-type peptidase activity, peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927), Peptidase S26A, signal peptidase I (InterPro:IPR000223), Peptidase S26A (InterPro:IPR014037); BEST Arabidopsis thaliana protein match is: signal peptidase-related (TAIR:AT1G23465.1); Has 2938 Blast hits to 2935 proteins in 757 species: Archae - 0; Bacteria - 1866; Metazoa - 211; Fungi - 145; Plants - 138; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink).
AT1G29990AT1G29990.1ATATTGGGCCGTTAAAEncodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.
AT1G29990.1GGGCTTTAACGGEncodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.
AT1G30230AT1G30230.1CTTAACCGGTTTATelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30230.2CTTAACCGGTTTATelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30540AT1G30540.1TTTAACCGATPase, BadF/BadG/BcrA/BcrD-type family; FUNCTIONS IN: ATPase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, BadF/BadG/BcrA/BcrD type (InterPro:IPR002731); Has 975 Blast hits to 975 proteins in 386 species: Archae - 31; Bacteria - 696; Metazoa - 107; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).
AT1G30690AT1G30690.1ATCCAACGGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G30690.1GACCGTTGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G30690.1GACCGTTGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G30690.2ATCCAACGGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G30690.2GACCGTTGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G30690.2GACCGTTGSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G30730AT1G30730.1CCGTTAAAFAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT1G30720.1); Has 2836 Blast hits to 2826 proteins in 501 species: Archae - 26; Bacteria - 1106; Metazoa - 7; Fungi - 1085; Plants - 423; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).
AT1G31180AT1G31180.1ATAACCGGTCThe AtIMD3 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids.
AT1G31190AT1G31190.1GACCGGTTATEncodes a myo-inositol monophosphatase IMPL1 (myo-Inositol monophosphatase like 1).
AT1G31580AT1G31580.1CCGTTAAAEncodes cell wall protein. ECS1 is not a Xcc750 resistance gene, but the genetic data indicate that ECS1 is linked to a locus influencing resistance to Xcc750.
AT1G31730AT1G31730.1AAAACCGGATTCCGGTTAAAepsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink).
AT1G31814AT1G31814.1TTAACCGGAAfamily member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885
AT1G32260AT1G32260.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35480.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32410AT1G32410.1GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.2GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.3GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.4GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.5GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32920AT1G32920.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32928.1); Has 14 Blast hits to 14 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G33120AT1G33120.1TTTAACGGGCCATGGGCTTAT60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G33265AT1G33265.1TAACCGGTTTGGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); Has 119 Blast hits to 119 proteins in 43 species: Archae - 0; Bacteria - 27; Metazoa - 33; Fungi - 2; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G33400AT1G33400.1ACCGGTTAAAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), SET (InterPro:IPR001214), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: TTL4 (Tetratricopetide-repeat Thioredoxin-Like 4); binding (TAIR:AT3G58620.1); Has 5453 Blast hits to 4652 proteins in 333 species: Archae - 109; Bacteria - 690; Metazoa - 2585; Fungi - 539; Plants - 720; Viruses - 0; Other Eukaryotes - 810 (source: NCBI BLink).
AT1G33780AT1G33780.1TTTAACCGAACCAAACCGunknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink).
AT1G34120AT1G34120.1TTTAACCGCCGGTTCGEncodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2.
AT1G34120.2TTTAACCGCCGGTTCGEncodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2.
AT1G34120.3TTTAACCGCCGGTTCGEncodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2.
AT1G34350AT1G34350.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 140 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT1G35160AT1G35160.1ATCCAACGGTCGF14 protein phi chain member of 14-3-3 protein family. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1
AT1G35340AT1G35340.1CTTAACCGGATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G35340.2CTTAACCGGATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G35340.3CTTAACCGGATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 65; Metazoa - 1; Fungi - 8; Plants - 34; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G35460AT1G35460.1ACCGTTAGbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT4G09180.1); Has 1117 Blast hits to 1117 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 1112; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G35580AT1G35580.1ACCGGTTATAACCGGTEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35580.1CCGTTAAAEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35580.2ACCGGTTATAACCGGTEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35580.2CCGTTAAAEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35580.3ACCGGTTATAACCGGTEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35580.3CCGTTAAAEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G42960AT1G42960.1ATAACCGGATexpressed protein localized to the inner membrane of the chloroplast.
AT1G44750AT1G44750.2ATAACCGGMember of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G44750.3ATAACCGGMember of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G48430AT1G48430.1TTTAACGGdihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink).
AT1G48440AT1G48440.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G48450AT1G48450.1TAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G48450.2TAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.1); Has 87 Blast hits to 87 proteins in 19 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G48460AT1G48460.1TTAAACCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63040.2); Has 36 Blast hits to 36 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G48620AT1G48620.1CAACGGTCThis gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation.
AT1G48860AT1G48860.1ATAACCGGTATGGCCCAAG3-phosphoshikimate 1-carboxyvinyltransferase, putative / 5-enolpyruvylshikimate-3-phosphate, putative / EPSP synthase, putative; FUNCTIONS IN: 3-phosphoshikimate 1-carboxyvinyltransferase activity, catalytic activity, transferase activity, transferring alkyl or aryl (other than methyl) groups; INVOLVED IN: glyphosate metabolic process, aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: 3-phosphoshikimate 1-carboxyvinyltransferase, core (InterPro:IPR001986), 3-phosphoshikimate 1-carboxyvinyltransferase, subgroup (InterPro:IPR006264), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); BEST Arabidopsis thaliana protein match is: 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase (TAIR:AT2G45300.1); Has 9038 Blast hits to 9035 proteins in 1558 species: Archae - 140; Bacteria - 5092; Metazoa - 4; Fungi - 108; Plants - 172; Viruses - 0; Other Eukaryotes - 3522 (source: NCBI BLink).
AT1G48860.2ATAACCGGTATGGCCCAAG3-phosphoshikimate 1-carboxyvinyltransferase, putative / 5-enolpyruvylshikimate-3-phosphate, putative / EPSP synthase, putative; FUNCTIONS IN: 3-phosphoshikimate 1-carboxyvinyltransferase activity, catalytic activity, transferase activity, transferring alkyl or aryl (other than methyl) groups; INVOLVED IN: glyphosate metabolic process, aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: 3-phosphoshikimate 1-carboxyvinyltransferase, core (InterPro:IPR001986), 3-phosphoshikimate 1-carboxyvinyltransferase, subgroup (InterPro:IPR006264), RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta (InterPro:IPR013792); BEST Arabidopsis thaliana protein match is: 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase (TAIR:AT2G45300.1); Has 9038 Blast hits to 9035 proteins in 1558 species: Archae - 140; Bacteria - 5092; Metazoa - 4; Fungi - 108; Plants - 172; Viruses - 0; Other Eukaryotes - 3522 (source: NCBI BLink).
AT1G48900AT1G48900.1TAACCGGTACCGGTTTsignal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).
AT1G48900.2TAACCGGTACCGGTTTsignal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).
AT1G48920AT1G48920.1CCGTTGGATEncodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants.
AT1G49240AT1G49240.1ATCCAACGGMember of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen.
AT1G49340AT1G49340.1GACCGGTTATEncodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots.
AT1G49340.2GACCGGTTATEncodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots.
AT1G49670AT1G49670.1CCGTTAAAmolecular function has not been defined. Was shown involved in oxidative stress tolerance.
AT1G49730AT1G49730.3CCGTTAAAprotein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G19300.1); Has 85260 Blast hits to 84273 proteins in 3053 species: Archae - 50; Bacteria - 7603; Metazoa - 37593; Fungi - 6568; Plants - 18776; Viruses - 486; Other Eukaryotes - 14184 (source: NCBI BLink).
AT1G49760AT1G49760.1ATCCAACGGpolyadenylate-binding protein, putative / PABP, putative, similar to poly(A)-binding protein GB:AAF66825 GI:7673359 from (Nicotiana tabacum). Highly and ubiquitously expressed. Member of the class II PABP family.
AT1G49840AT1G49840.1ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19540.1); Has 110 Blast hits to 108 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G50380AT1G50380.1TAACCGGAAprolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink).
AT1G50740AT1G50740.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G20510.1); Has 275 Blast hits to 275 proteins in 68 species: Archae - 0; Bacteria - 25; Metazoa - 142; Fungi - 4; Plants - 97; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G50900AT1G50900.1CTAACGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G51060AT1G51060.1CTAACGGTEncodes HTA10, a histone H2A protein.
AT1G51390AT1G51390.1TGGTTCGGTTAAATCCGGTTAAAEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion.
AT1G51630AT1G51630.1ATCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plant-type cell wall; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21190.1); Has 396 Blast hits to 395 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 396; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G51630.1ATCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plant-type cell wall; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21190.1); Has 396 Blast hits to 395 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 396; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G51650AT1G51650.1CTTAATGGGCCGTTAAAATP synthase epsilon chain, mitochondrial; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP biosynthetic process, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, epsilon subunit, mitochondrial (InterPro:IPR006721); Has 170 Blast hits to 170 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 3; Plants - 40; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT1G52200AT1G52200.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: plasma membrane; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18470.1); Has 371 Blast hits to 370 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 47; Plants - 295; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G52870AT1G52870.1ACCGTTAGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT1G52870.1CGGTTAAAperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT1G52870.2ACCGTTAGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT1G52870.2CGGTTAAAperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT1G53140AT1G53140.1GACCGTTGEncodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis.
AT1G53633AT1G53633.1CTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown.
AT1G54130AT1G54130.1TTTAACGGGCRELA/SPOT HOMOLOG 3 (RSH3); FUNCTIONS IN: GTP diphosphokinase activity; INVOLVED IN: guanosine tetraphosphate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH2 (RELA-SPOT HOMOLOG 2); GTP diphosphokinase (TAIR:AT3G14050.1); Has 8993 Blast hits to 8061 proteins in 1317 species: Archae - 2; Bacteria - 4486; Metazoa - 300; Fungi - 18; Plants - 129; Viruses - 2; Other Eukaryotes - 4056 (source: NCBI BLink).
AT1G54870AT1G54870.1ATCCGGTTAbinding / catalytic/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G05260.1); Has 83077 Blast hits to 82922 proteins in 2231 species: Archae - 482; Bacteria - 45268; Metazoa - 5002; Fungi - 4212; Plants - 1573; Viruses - 5; Other Eukaryotes - 26535 (source: NCBI BLink).
AT1G55490AT1G55490.1ATCCAACGGencodes the beta subunit of the chloroplast chaperonin 60, a homologue of bacterial GroEL. Mutants in this gene develops lesions on its leaves, expresses systemic acquired resistance (SAR) and develops accelerated cell death to heat shock stress. The protein has molecular chaperone activity for suppressing protein aggregation in vitro.
AT1G55490.2ATCCAACGGencodes the beta subunit of the chloroplast chaperonin 60, a homologue of bacterial GroEL. Mutants in this gene develops lesions on its leaves, expresses systemic acquired resistance (SAR) and develops accelerated cell death to heat shock stress. The protein has molecular chaperone activity for suppressing protein aggregation in vitro.
AT1G55630AT1G55630.1TTTAACCGpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G60050.1); Has 18827 Blast hits to 5565 proteins in 174 species: Archae - 4; Bacteria - 21; Metazoa - 383; Fungi - 322; Plants - 17397; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).
AT1G56280AT1G56280.1ATAACCGGAAEncodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal
AT1G56280.1TTAACCGGTCEncodes a gene whose transcript level in root and leaves increases to progressive drought stress. The increase in transcript level is independent from abscisic acid level. Sequence is not similar to any protein of known function. It appears to be a member of plant-specific gene family. It's phosphorylated by AtCPK11 in a Ca(2+)-dependent manner at Thr105 and Ser107 within the AtDi19 bipartite nuclear localization signal
AT1G56290AT1G56290.1GACCGGTTAACwfJ-like family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein / zinc finger (CCCH-type) family protein (TAIR:AT5G56900.2); Has 2202 Blast hits to 1747 proteins in 222 species: Archae - 2; Bacteria - 25; Metazoa - 988; Fungi - 216; Plants - 103; Viruses - 2; Other Eukaryotes - 866 (source: NCBI BLink).
AT1G56290.1GACCGGTTATCwfJ-like family protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein / zinc finger (CCCH-type) family protein (TAIR:AT5G56900.2); Has 2202 Blast hits to 1747 proteins in 222 species: Archae - 2; Bacteria - 25; Metazoa - 988; Fungi - 216; Plants - 103; Viruses - 2; Other Eukaryotes - 866 (source: NCBI BLink).
AT1G60070AT1G60070.1CCGTTAAAbinding / clathrin binding / protein binding / protein transporter; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: membrane coat, Golgi apparatus part, Golgi apparatus, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Adaptor protein complex AP-1, gamma subunit (InterPro:IPR017107), Armadillo-like helical (InterPro:IPR011989), Clathrin adaptor, gamma-adaptin, appendage (InterPro:IPR008153), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 2625 Blast hits to 2575 proteins in 190 species: Archae - 0; Bacteria - 4; Metazoa - 1290; Fungi - 597; Plants - 203; Viruses - 0; Other Eukaryotes - 531 (source: NCBI BLink).
AT1G60380AT1G60380.1ACCGGTTAapical meristem formation protein-related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac024 (Arabidopsis NAC domain containing protein 24); transcription factor (TAIR:AT1G60350.1); Has 227 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G60380.1TTCCGGTTAAapical meristem formation protein-related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac024 (Arabidopsis NAC domain containing protein 24); transcription factor (TAIR:AT1G60350.1); Has 227 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G60770AT1G60770.1ACCGTTAGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02370.1); Has 9197 Blast hits to 3516 proteins in 140 species: Archae - 2; Bacteria - 22; Metazoa - 95; Fungi - 82; Plants - 8677; Viruses - 0; Other Eukaryotes - 319 (source: NCBI BLink).
AT1G61620AT1G61620.1ACCGTTAGphosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Nitric oxide synthase-interacting (InterPro:IPR016818), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 380 Blast hits to 380 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 84; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G61795AT1G61795.1CCGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: PAK-box/P21-Rho-binding (InterPro:IPR000095); BEST Arabidopsis thaliana protein match is: RIC10 (ROP-INTERACTIVE CRIB MOTIF-CONTAINING PROTEIN 10) (TAIR:AT4G04900.1); Has 94 Blast hits to 94 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G61900AT1G61900.1ATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G61900.2ATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G64350AT1G64350.1CTAACGGTseh1-like protein
AT1G64550AT1G64550.1TTAACCGGATmember of GCN subfamily
AT1G64628AT1G64628.1GCCCGTTAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF57 represents a conserved upstream opening reading frame relative to major ORF AT1G64630.1
AT1G64630AT1G64630.1GCCCGTTAWITH NO LYSINE KINASE 10 (WNK10); FUNCTIONS IN: transcription factor activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: WNK8 (WITH NO LYSINE (K) KINASE 8); kinase/ protein kinase (TAIR:AT5G41990.1); Has 77185 Blast hits to 76497 proteins in 1905 species: Archae - 28; Bacteria - 5972; Metazoa - 32664; Fungi - 6701; Plants - 16849; Viruses - 382; Other Eukaryotes - 14589 (source: NCBI BLink).
AT1G65020AT1G65020.1AAAACCGGTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NERD (InterPro:IPR011528); Has 53 Blast hits to 53 proteins in 19 species: Archae - 0; Bacteria - 18; Metazoa - 9; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G65030AT1G65030.1TAACCGGTTTTThis gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT1G65150AT1G65150.1TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G65150.2TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G66160AT1G66160.1CAACGGTCU-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT5G37490.1); Has 1387 Blast hits to 1378 proteins in 121 species: Archae - 0; Bacteria - 14; Metazoa - 190; Fungi - 41; Plants - 975; Viruses - 3; Other Eukaryotes - 164 (source: NCBI BLink).
AT1G66160.2CAACGGTCU-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT5G37490.1); Has 1387 Blast hits to 1378 proteins in 121 species: Archae - 0; Bacteria - 14; Metazoa - 190; Fungi - 41; Plants - 975; Viruses - 3; Other Eukaryotes - 164 (source: NCBI BLink).
AT1G66270AT1G66270.1CAACGGTCBGLU21; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: cellular response to phosphate starvation, response to salt stress; LOCATED IN: vacuole, membrane; EXPRESSED IN: root, callus, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU22; catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G66280.1); Has 5737 Blast hits to 5514 proteins in 796 species: Archae - 98; Bacteria - 3130; Metazoa - 592; Fungi - 134; Plants - 849; Viruses - 0; Other Eukaryotes - 934 (source: NCBI BLink).
AT1G66270.2CAACGGTCBGLU21; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: cellular response to phosphate starvation, response to salt stress; LOCATED IN: vacuole, membrane; EXPRESSED IN: root, callus, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU22; catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G66280.1); Has 5737 Blast hits to 5514 proteins in 796 species: Archae - 98; Bacteria - 3130; Metazoa - 592; Fungi - 134; Plants - 849; Viruses - 0; Other Eukaryotes - 934 (source: NCBI BLink).
AT1G67090AT1G67090.1ATCCAACGGRIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).
AT1G67090.2ATCCAACGGRIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).
AT1G67360AT1G67360.1CCGTTGGATrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67360.2CCGTTGGATrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67570AT1G67570.1CCGTTAAAunknown protein; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50630.1); Has 81 Blast hits to 81 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G67790AT1G67790.1ATAACCGGTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf apex, hypocotyl, flower; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01670.1); Has 98 Blast hits to 57 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67920AT1G67920.1CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24600.1); Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G68010AT1G68010.1GACCGTTGGATEncodes hydroxypyruvate reductase.
AT1G68100AT1G68100.1TTTAACGGmember of IAA-alanine resistance protein 1
AT1G68350AT1G68350.1TCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G68680AT1G68680.1TCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; Has 12 Blast hits to 12 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G69330AT1G69330.1TTTAACCGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ubiquitin-protein ligase (TAIR:AT3G29270.2); Has 225 Blast hits to 225 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G69340AT1G69340.1CGGTTAAAappr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT2G40600.1); Has 2230 Blast hits to 2187 proteins in 671 species: Archae - 43; Bacteria - 984; Metazoa - 848; Fungi - 95; Plants - 99; Viruses - 7; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G69460AT1G69460.1TTTAACCGemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1075 Blast hits to 1073 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 308; Plants - 128; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).
AT1G69490AT1G69490.1TTTAACCGEncodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence.
AT1G69640AT1G69640.1CCGTTAAAEncodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth.
AT1G70700AT1G70700.1TTAACCGGTTTAAJAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
AT1G70700.2TTAACCGGTTTAAJAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
AT1G70710AT1G70710.1ACCGGTTATendo-1,4-beta-glucanase. Involved in cell elongation.
AT1G71260AT1G71260.1TAAAGGCCCATTGGGCCGTTAAAEncodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus.
AT1G71270AT1G71270.1TTTAACGGCCCAATGGGCCTTTAEncodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network.
AT1G71430AT1G71430.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G71750AT1G71750.1CGGTTAAGphosphoribosyltransferase family protein; FUNCTIONS IN: transferase activity, hypoxanthine phosphoribosyltransferase activity; INVOLVED IN: nucleoside metabolic process, purine ribonucleoside salvage; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Hypoxanthine phosphoribosyl transferase (InterPro:IPR005904); Has 3239 Blast hits to 3239 proteins in 1142 species: Archae - 35; Bacteria - 2162; Metazoa - 212; Fungi - 2; Plants - 19; Viruses - 0; Other Eukaryotes - 809 (source: NCBI BLink).
AT1G72260AT1G72260.1CCGTTAAAEncodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660.
AT1G72470AT1G72470.1CGGTTAAAA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT1G73060AT1G73060.1TTCCGGTTCAATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48790.1); Has 45 Blast hits to 45 proteins in 18 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G73090AT1G73090.1ACCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G73230AT1G73230.1GACCGTTGGATnascent polypeptide-associated complex (NAC) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative (TAIR:AT1G17880.1); Has 618 Blast hits to 618 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 331; Fungi - 126; Plants - 89; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G73540AT1G73540.1CTTAACCGAACArabidopsis thaliana Nudix hydrolase homolog 21 (atnudt21); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt4 (Arabidopsis thaliana Nudix hydrolase homolog 4); hydrolase (TAIR:AT1G18300.1); Has 819 Blast hits to 817 proteins in 227 species: Archae - 3; Bacteria - 284; Metazoa - 212; Fungi - 79; Plants - 132; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).
AT1G73790AT1G73790.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09550.1); Has 149 Blast hits to 149 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 45; Fungi - 35; Plants - 40; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G74045AT1G74045.1GACCGTTGMember of TETRASPANIN family
AT1G74230AT1G74230.1TTTAACCGGGTCencodes a glycine-rich RNA binding protein.
AT1G74240AT1G74240.1TCCGGTTAmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 19112 Blast hits to 10154 proteins in 360 species: Archae - 0; Bacteria - 0; Metazoa - 9866; Fungi - 4980; Plants - 2508; Viruses - 0; Other Eukaryotes - 1758 (source: NCBI BLink).
AT1G74380AT1G74380.1CGGTTAAAXYLOGLUCAN XYLOSYLTRANSFERASE 5 (XXT5); FUNCTIONS IN: xyloglucan 6-xylosyltransferase activity, transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: N-terminal protein myristoylation, root hair elongation; LOCATED IN: Golgi apparatus, Golgi membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Galactosyl transferase (InterPro:IPR008630); BEST Arabidopsis thaliana protein match is: galactosyl transferase GMA12/MNN10 family protein (TAIR:AT5G07720.1); Has 301 Blast hits to 301 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 117; Plants - 172; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G74430AT1G74430.1ATCCAACGGEncodes a putative transcription factor (MYB95).
AT1G74450AT1G74450.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF793 (InterPro:IPR008511); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G18740.1); Has 121 Blast hits to 121 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 121; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G74470AT1G74470.1ATCCAACGGEncodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate.
AT1G74690AT1G74690.1ATCCAACGGIQ-domain 31 (IQD31); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD30; calmodulin binding (TAIR:AT1G18840.2); Has 7267 Blast hits to 5232 proteins in 414 species: Archae - 15; Bacteria - 567; Metazoa - 3152; Fungi - 664; Plants - 611; Viruses - 38; Other Eukaryotes - 2220 (source: NCBI BLink).
AT1G74950AT1G74950.1CCGTTAAATIFY10B; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to jasmonic acid stimulus, response to wounding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ1 (JASMONATE-ZIM-DOMAIN PROTEIN 1); protein binding (TAIR:AT1G19180.1); Has 249 Blast hits to 244 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 249; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G75280AT1G75280.1TTCCGGTTAAisoflavone reductase, putative, identical to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-) {Arabidopsis thaliana}; contains Pfam profile PF02716: isoflavone reductase. Involved in response to oxidative stress.
AT1G75630AT1G75630.1TTTAACCGvacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA,
AT1G75670AT1G75670.1GACCGGTTADNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G75670.2GACCGGTTADNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G75690AT1G75690.1CCGTTGGATchaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 326 Blast hits to 308 proteins in 90 species: Archae - 4; Bacteria - 115; Metazoa - 13; Fungi - 12; Plants - 104; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).
AT1G75780AT1G75780.1CGGTTAAAbeta tubulin gene downregulated by phytochrome A (phyA)-mediated far-red light high-irradiance and the phytochrome B (phyB)-mediated red light high-irradiance responses
AT1G75800AT1G75800.1CGGTTAAApathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G20030.2); Has 1077 Blast hits to 1068 proteins in 152 species: Archae - 2; Bacteria - 22; Metazoa - 59; Fungi - 47; Plants - 930; Viruses - 4; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G76650AT1G76650.1CCGTTAAACALMODULIN-LIKE 38 (CML38); FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to wounding; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin-related protein, putative (TAIR:AT1G76640.1); Has 11212 Blast hits to 8813 proteins in 1020 species: Archae - 0; Bacteria - 34; Metazoa - 5021; Fungi - 1984; Plants - 2417; Viruses - 0; Other Eukaryotes - 1756 (source: NCBI BLink).
AT1G76650.2CCGTTAAACALMODULIN-LIKE 38 (CML38); FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to wounding; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin-related protein, putative (TAIR:AT1G76640.1); Has 11212 Blast hits to 8813 proteins in 1020 species: Archae - 0; Bacteria - 34; Metazoa - 5021; Fungi - 1984; Plants - 2417; Viruses - 0; Other Eukaryotes - 1756 (source: NCBI BLink).
AT1G76940AT1G76940.1GCCCGTTAATCCAACGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G77122AT1G77122.1CCGTTGGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0090 (InterPro:IPR003728); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69210.1); Has 5575 Blast hits to 1500 proteins in 157 species: Archae - 0; Bacteria - 130; Metazoa - 4006; Fungi - 245; Plants - 178; Viruses - 112; Other Eukaryotes - 904 (source: NCBI BLink).
AT1G77420AT1G77420.1CCGGTTATAAATGGGhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).
AT1G77590AT1G77590.1ATCCAACGGTCEncodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids.
AT1G78100AT1G78100.1CCGGTTATF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G22220.1); Has 82 Blast hits to 81 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78100.1GACCGTTGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G22220.1); Has 82 Blast hits to 81 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78140AT1G78140.1TTTAACGGmethyltransferase-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase-related (TAIR:AT2G41040.1); Has 3459 Blast hits to 3458 proteins in 853 species: Archae - 143; Bacteria - 2524; Metazoa - 44; Fungi - 102; Plants - 117; Viruses - 0; Other Eukaryotes - 529 (source: NCBI BLink).
AT1G78150AT1G78150.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78150.2CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78300AT1G78300.1ATCCAACGGCCCAGAG-box binding factor GF14 omega encoding a 14-3-3 protein
AT1G78700AT1G78700.1ATAACCGGAAAbrassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink).
AT1G78890AT1G78890.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16840.4); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G79010AT1G79010.1CGGTTAAGNADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY); FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative (TAIR:AT1G16700.1); Has 7771 Blast hits to 7380 proteins in 1556 species: Archae - 918; Bacteria - 3924; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink).
AT1G79270AT1G79270.1ATCCAACGGTCevolutionarily conserved C-terminal region 8 (ECT8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT6 (evolutionarily conserved C-terminal region 6) (TAIR:AT3G17330.1); Has 700 Blast hits to 699 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 84; Plants - 193; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).
AT1G79440AT1G79440.1CGGTTAAACTGCCACGTGGATEncodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004).
AT1G79850AT1G79850.1TCCAACGGCACGnuclear-encoded 30S chloroplast ribosomal protein S17
AT1G80380AT1G80380.1ATCCAACGGencodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle.
AT1G80380.2ATCCAACGGencodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle.
AT1G80380.3ATCCAACGGencodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle.
AT1G80480AT1G80480.1CCGTTGGAPLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink).
AT1G80500AT1G80500.1GCCCGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20930.1); Has 437 Blast hits to 435 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 248; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G80910AT1G80910.1ATAACCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16020.2); Has 140 Blast hits to 140 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G80940AT1G80940.1CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 52 Blast hits to 52 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G80940.2CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 52 Blast hits to 52 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G80950AT1G80950.1TCTGACGGTTAAGphospholipid/glycerol acyltransferase family protein; FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: calcineurin B subunit-related (TAIR:AT2G45670.1); Has 2991 Blast hits to 2990 proteins in 864 species: Archae - 0; Bacteria - 1576; Metazoa - 549; Fungi - 76; Plants - 104; Viruses - 0; Other Eukaryotes - 686 (source: NCBI BLink).
AT2G01090AT2G01090.1TAACGGGCubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT1G15120.1); Has 95 Blast hits to 95 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT2G01120AT2G01120.1CCGTTAAAOrigin Recognition Complex subunit 4. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b.
AT2G01290AT2G01290.1GACCGTTGribose-5-phosphate isomerase; FUNCTIONS IN: ribose-5-phosphate isomerase activity; INVOLVED IN: glucose catabolic process to lactate and acetate, 5-phosphoribose 1-diphosphate biosynthetic process, reductive pentose-phosphate cycle, D-ribose catabolic process, pentose-phosphate shunt, non-oxidative branch; LOCATED IN: cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribose 5-phosphate isomerase (InterPro:IPR004788); BEST Arabidopsis thaliana protein match is: RSW10 (RADIAL SWELLING 10); ribose-5-phosphate isomerase (TAIR:AT1G71100.1); Has 3193 Blast hits to 3193 proteins in 1122 species: Archae - 153; Bacteria - 1919; Metazoa - 91; Fungi - 101; Plants - 85; Viruses - 0; Other Eukaryotes - 844 (source: NCBI BLink).
AT2G01320AT2G01320.1TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01320.2TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01320.3TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01320.4TTTAACCGABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01520AT2G01520.1TTTAACCGMLP-LIKE PROTEIN 328 (MLP328); FUNCTIONS IN: copper ion binding; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP329 (MLP-LIKE PROTEIN 329); copper ion binding (TAIR:AT2G01530.1); Has 232 Blast hits to 210 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 232; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G01680AT2G01680.1CAACGGTCankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G07710.1); Has 30422 Blast hits to 14426 proteins in 498 species: Archae - 36; Bacteria - 1652; Metazoa - 16352; Fungi - 2182; Plants - 1476; Viruses - 164; Other Eukaryotes - 8560 (source: NCBI BLink).
AT2G01735AT2G01735.1TAACCGGATencodes a RING-H2 zinc finger protein essential for seed development.
AT2G02760AT2G02760.1CGGTTAAGubiquitin conjugating enzyme UBC2. Homolog of the yeast RAD6 gene.
AT2G02860AT2G02860.1ATCCAACGGencodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding.
AT2G02910AT2G02910.1TAACGGGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 191 Blast hits to 191 proteins in 22 species: Archae - 6; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).
AT2G03000AT2G03000.1ATAACCGGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14200.1); Has 26327 Blast hits to 13071 proteins in 591 species: Archae - 30; Bacteria - 2310; Metazoa - 9727; Fungi - 4737; Plants - 2646; Viruses - 535; Other Eukaryotes - 6342 (source: NCBI BLink).
AT2G03150AT2G03150.1TAACGGGCCembryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink).
AT2G03440AT2G03440.1GACCGGTTATInduced at the transcriptional level by Pseudomonas syringae pv. tomato infection.
AT2G03470AT2G03470.1TTCGGTTTATAAACCGGTTAAmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink).
AT2G03470.2TTCGGTTTATAAACCGGTTAAmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink).
AT2G03800AT2G03800.1TTTAACCGencodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype.
AT2G04230AT2G04230.1TTAACCGGTCF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G49030.1); Has 1566 Blast hits to 1530 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 1562; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G04410AT2G04410.1TAACGGGCCCATTAAGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G04540AT2G04540.1CTTAACCG3-oxoacyl-(acyl-carrier-protein) synthase II, putative; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, fatty-acid synthase activity, catalytic activity; INVOLVED IN: biosynthetic process, fatty acid biosynthetic process, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-ketoacyl synthase (InterPro:IPR000794), Thiolase-like (InterPro:IPR016039), Beta-ketoacyl synthase, C-terminal (InterPro:IPR014031), 3-oxoacyl-[acyl-carrier-protein] synthase 2 (InterPro:IPR017568), Beta-ketoacyl synthase, N-terminal (InterPro:IPR014030), Thiolase-like, subgroup (InterPro:IPR016038), Beta-ketoacyl synthase, active site (InterPro:IPR018201); BEST Arabidopsis thaliana protein match is: FAB1 (FATTY ACID BIOSYNTHESIS 1); 3-oxoacyl-[acyl-carrier-protein] synthase/ fatty-acid synthase (TAIR:AT1G74960.2); Has 19605 Blast hits to 17878 proteins in 2069 species: Archae - 5; Bacteria - 11810; Metazoa - 457; Fungi - 1652; Plants - 223; Viruses - 0; Other Eukaryotes - 5458 (source: NCBI BLink).
AT2G04570AT2G04570.1AAAGTCAATCCAACGGGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT2G42990.1); Has 1917 Blast hits to 1901 proteins in 192 species: Archae - 0; Bacteria - 317; Metazoa - 1; Fungi - 22; Plants - 1561; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT2G04700AT2G04700.1TTCCGGTTATTTCCGGTTTGferredoxin thioredoxin reductase catalytic beta chain family protein; FUNCTIONS IN: ferredoxin:thioredoxin reductase activity, ferredoxin reductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin thioredoxin reductase, beta subunit (InterPro:IPR004209); Has 204 Blast hits to 204 proteins in 84 species: Archae - 14; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).
AT2G04880AT2G04880.1ACCGTTAGEncodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.
AT2G04880.2ACCGTTAGEncodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.
AT2G05220AT2G05220.1TTTCCGGTTAAA40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT2G05220.2TTTCCGGTTAAA40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT2G05755AT2G05755.1TTTAACGGintegral membrane family protein; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); Has 3626 Blast hits to 3626 proteins in 569 species: Archae - 28; Bacteria - 1049; Metazoa - 210; Fungi - 97; Plants - 13; Viruses - 0; Other Eukaryotes - 2229 (source: NCBI BLink).
AT2G05920AT2G05920.1CTAACGGTCACACGTsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink).
AT2G06025AT2G06025.1ACCGTTAGGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT4G28030.1); Has 565 Blast hits to 565 proteins in 223 species: Archae - 42; Bacteria - 278; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT2G06925AT2G06925.1AACCCGGTTAAGEncodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine.
AT2G11890AT2G11890.1TTTAACGGadenylate cyclase
AT2G11890.2TTTAACGGadenylate cyclase
AT2G13540AT2G13540.1TTTAACGGEncodes a nuclear cap-binding protein that forms a heterodimeric complex with CBP20 and is involved in ABA signaling and flowering. Mutants are early flowering and exhibit hypersensitive response to ABA in germination inhibition.Loss of ABH1 function results in abnormal processing of mRNAs for several important floral regulators (FLC, CO, FLM). Analysis of loss of function mutations suggests a role in pri-miRNA processing and mRNA splicing. Note that two different mutant alleles were given the same name abh1-7 (Kuhn et al 2007; Kim et al 2008). To avoid confusion, abh1-7 described in Kim et al (2008) has been renamed abh1-107 (other names: ensalada-1, ens-1).
AT2G13560AT2G13560.1ACGGTTTACTTAACCGGTTCmalate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: response to salt stress, malate metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT4G00570.1); Has 5981 Blast hits to 5971 proteins in 1332 species: Archae - 86; Bacteria - 3249; Metazoa - 553; Fungi - 152; Plants - 269; Viruses - 0; Other Eukaryotes - 1672 (source: NCBI BLink).
AT2G14170AT2G14170.2CTAACGGTArabidopsis thaliana methylmalonate-semialdehyde dehydrogenase
AT2G14910AT2G14910.1ATAACCGGTCunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink).
AT2G14910.2ATAACCGGTCunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink).
AT2G16600AT2G16600.1CAACGGTCEncodes cytosolic cyclophilin ROC3.
AT2G16600.2CAACGGTCEncodes cytosolic cyclophilin ROC3.
AT2G16640AT2G16640.1GACCGTTGMULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink).
AT2G17130AT2G17130.1CGGTTAAANAD+ dependent isocitrate dehydrogenase subunit 2 (IDH2)
AT2G17130.2CGGTTAAANAD+ dependent isocitrate dehydrogenase subunit 2 (IDH2)
AT2G17265AT2G17265.1TTAAACCGTTGGATEncodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts.
AT2G17380AT2G17380.1TTTAACGGEncodes clathrin assembly protein AP19.
AT2G17510AT2G17510.1CTAAACCGGTTTTAACCGEMBRYO DEFECTIVE 2763 (EMB2763); FUNCTIONS IN: ribonuclease activity, RNA binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide binding protein, PINc (InterPro:IPR006596), Ribonuclease II and R (InterPro:IPR001900); BEST Arabidopsis thaliana protein match is: ribonuclease II family protein (TAIR:AT1G77680.1); Has 5395 Blast hits to 5320 proteins in 1284 species: Archae - 25; Bacteria - 2941; Metazoa - 370; Fungi - 272; Plants - 61; Viruses - 2; Other Eukaryotes - 1724 (source: NCBI BLink).
AT2G17790AT2G17790.1ACCGTTAGVPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT2G17790.1CGGTTAAAVPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT2G17850AT2G17850.1ATCCAACGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66170.2); Has 1960 Blast hits to 1954 proteins in 396 species: Archae - 22; Bacteria - 1018; Metazoa - 11; Fungi - 7; Plants - 116; Viruses - 0; Other Eukaryotes - 786 (source: NCBI BLink).
AT2G17880AT2G17880.1CTTAACCGGACDNAJ heat shock protein, putative; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (J11) (TAIR:AT4G36040.1); Has 13518 Blast hits to 13518 proteins in 1859 species: Archae - 87; Bacteria - 4830; Metazoa - 2737; Fungi - 1089; Plants - 967; Viruses - 5; Other Eukaryotes - 3803 (source: NCBI BLink).
AT2G17972AT2G17972.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 19 Blast hits to 19 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G18465AT2G18465.1TTAAACCGGTCCGGTTADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G42080.1); Has 685 Blast hits to 685 proteins in 152 species: Archae - 6; Bacteria - 112; Metazoa - 268; Fungi - 15; Plants - 75; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink).
AT2G18940AT2G18940.1TTCCGGTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G02860.1); Has 28771 Blast hits to 6230 proteins in 192 species: Archae - 4; Bacteria - 37; Metazoa - 1100; Fungi - 676; Plants - 25361; Viruses - 0; Other Eukaryotes - 1593 (source: NCBI BLink).
AT2G18960AT2G18960.1CAACGGTCEncodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA.
AT2G19120AT2G19120.1ATCCAACGGTCtRNA-splicing endonuclease positive effector-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: tRNA-splicing endonuclease positive effector-related (TAIR:AT4G30100.1); Has 3923 Blast hits to 3750 proteins in 664 species: Archae - 125; Bacteria - 877; Metazoa - 1082; Fungi - 610; Plants - 307; Viruses - 175; Other Eukaryotes - 747 (source: NCBI BLink).
AT2G20190AT2G20190.1GAACCGGCGGTTAAGEncodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability.
AT2G20400AT2G20400.1CCGGTTTAACCGmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 913 Blast hits to 906 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 900; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G20450AT2G20450.1TTTAACCGAACCA60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT2G20760AT2G20760.1CCGTTAAAprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 1552 Blast hits to 1056 proteins in 209 species: Archae - 0; Bacteria - 461; Metazoa - 500; Fungi - 90; Plants - 101; Viruses - 0; Other Eukaryotes - 400 (source: NCBI BLink).
AT2G20920AT2G20920.1CTAACGGTunknown protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 178 Blast hits to 177 proteins in 58 species: Archae - 0; Bacteria - 89; Metazoa - 0; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
AT2G20930AT2G20930.1CGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); Has 370 Blast hits to 370 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 55; Plants - 47; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT2G21195AT2G21195.1AATAGGCCGGTTAATTACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G21195.2AATAGGCCGGTTAATTACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G21195.3AATAGGCCGGTTAATTACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G21340AT2G21340.1TAACCGGTTAantiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: EDS5 (ENHANCED DISEASE SUSCEPTIBILITY 5); antiporter/ multidrug efflux pump/ transporter (TAIR:AT4G39030.1); Has 4153 Blast hits to 4145 proteins in 897 species: Archae - 89; Bacteria - 3108; Metazoa - 25; Fungi - 26; Plants - 225; Viruses - 0; Other Eukaryotes - 680 (source: NCBI BLink).
AT2G21340.2TAACCGGTTAantiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: EDS5 (ENHANCED DISEASE SUSCEPTIBILITY 5); antiporter/ multidrug efflux pump/ transporter (TAIR:AT4G39030.1); Has 4153 Blast hits to 4145 proteins in 897 species: Archae - 89; Bacteria - 3108; Metazoa - 25; Fungi - 26; Plants - 225; Viruses - 0; Other Eukaryotes - 680 (source: NCBI BLink).
AT2G21500AT2G21500.1TTTAACCGGTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT2G21500.2TTTAACCGGTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT2G21510AT2G21510.1TTAACCGGTDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT4G39150.1); Has 16200 Blast hits to 16136 proteins in 1943 species: Archae - 111; Bacteria - 5305; Metazoa - 3371; Fungi - 1470; Plants - 1201; Viruses - 18; Other Eukaryotes - 4724 (source: NCBI BLink).
AT2G22122AT2G22122.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G22170AT2G22170.1TCCAACGGlipid-associated family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976); BEST Arabidopsis thaliana protein match is: lipid-associated family protein (TAIR:AT4G39730.1); Has 113 Blast hits to 108 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G22300AT2G22300.1TTTAACCGEncodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.
AT2G22300.2TTTAACCGEncodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.
AT2G22425AT2G22425.1GCCGGTTCACCCGGTTATpeptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT2G22425.2GCCGGTTCACCCGGTTATpeptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, signal peptidase complex, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT4G40042.1); Has 209 Blast hits to 209 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT2G23080AT2G23080.1GTCCGGTTATcasein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink).
AT2G23080.2GTCCGGTTATcasein kinase II alpha chain, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CKA1 (CASEIN KINASE ALPHA 1); kinase (TAIR:AT5G67380.1); Has 63676 Blast hits to 62976 proteins in 1522 species: Archae - 29; Bacteria - 5523; Metazoa - 27776; Fungi - 7535; Plants - 8124; Viruses - 270; Other Eukaryotes - 14419 (source: NCBI BLink).
AT2G23090AT2G23090.1TTTAACGGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 33; Plants - 46; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT2G23130AT2G23130.1CAACGGTCAGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers.
AT2G23130.1TCCAACGGAGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers.
AT2G23130.2CAACGGTCAGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers.
AT2G23130.2TCCAACGGAGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers.
AT2G23350AT2G23350.1CCGTTAAApolyadenylate-binding protein, putative / PABP, putative.Member of the Class II family of PABP proteins. Highly and ubiquitously expressed.
AT2G24040AT2G24040.1CGGTTAAAhydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT4G28088.1); Has 526 Blast hits to 526 proteins in 160 species: Archae - 0; Bacteria - 141; Metazoa - 39; Fungi - 151; Plants - 185; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT2G24090AT2G24090.1TAACCGGAATAAACCGAAGTAAACCGGATribosomal protein L35 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35, conserved site (InterPro:IPR018265), Ribosomal protein L35 (InterPro:IPR001706); Has 3401 Blast hits to 3401 proteins in 1037 species: Archae - 0; Bacteria - 2119; Metazoa - 6; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1232 (source: NCBI BLink).
AT2G24170AT2G24170.1ATCCAACGGendomembrane protein 70, putative; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G10840.1); Has 1023 Blast hits to 1007 proteins in 164 species: Archae - 0; Bacteria - 2; Metazoa - 447; Fungi - 144; Plants - 237; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).
AT2G24240AT2G24240.1ATCCAACGGpotassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT4G30940.1); Has 748 Blast hits to 733 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 614; Fungi - 2; Plants - 67; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT2G24240.1CCGTTGGATpotassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT4G30940.1); Has 748 Blast hits to 733 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 614; Fungi - 2; Plants - 67; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT2G24250AT2G24250.1CTTAACCGGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G24250.2CTTAACCGGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G64840.1); Has 60 Blast hits to 58 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G25060AT2G25060.1CTAACGGTplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT4G31840.1); Has 808 Blast hits to 799 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 808; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G25625AT2G25625.1TCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G25625.2TCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G26330AT2G26330.1CGGTTAAAHomologous to receptor protein kinases. Involved in specification of organs originating from the shoot apical meristem. Contains a cytoplasmic protein kinase catalytic domain, a transmembrane region, and an extracellular leucine-rich repeat. ER has been identified as a quantitative trait locus for transpiration efficiency by influencing epidermal and mesophyll development, stomatal density and porosity of leaves. It has been implicated in resistance to the bacterium Ralstonia solanacearum and to the necrotrophic fungus Plectosphaerella cucumerina. Together with ERL1 and ERL2, ER governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes.
AT2G26810AT2G26810.1CAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).
AT2G26810.2CAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).
AT2G26810.3CAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26200.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 9; Bacteria - 84; Metazoa - 522; Fungi - 217; Plants - 135; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).
AT2G27020AT2G27020.1ATAAAGCCCGTTAEncodes 20S proteasome subunit PAG1 (PAG1).
AT2G27020.1CCGTTAAAEncodes 20S proteasome subunit PAG1 (PAG1).
AT2G27040AT2G27040.1TTTAACGGAGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation and increased susceptibility to bacterial pathogens.
AT2G27830AT2G27830.1ACCGGTTAAAFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G22760.1); Has 68 Blast hits to 68 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G27960AT2G27960.1TAACCGGTTTATcatalytic subunit of cyclin dependent kinase 1. physically interact with cyclin-dependent kinases (CDKs) and play an essential, but yet not entirely resolved, role in the regulation of the cell cycle
AT2G28620AT2G28620.1CAACGGTCkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT3G45850.1); Has 38255 Blast hits to 26694 proteins in 1178 species: Archae - 315; Bacteria - 3865; Metazoa - 19131; Fungi - 3066; Plants - 1862; Viruses - 111; Other Eukaryotes - 9905 (source: NCBI BLink).
AT2G28690AT2G28690.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1635 (InterPro:IPR012862); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59760.1); Has 49 Blast hits to 49 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT2G29510AT2G29510.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59020.1); Has 3816 Blast hits to 613 proteins in 107 species: Archae - 0; Bacteria - 39; Metazoa - 471; Fungi - 67; Plants - 91; Viruses - 10; Other Eukaryotes - 3138 (source: NCBI BLink).
AT2G29550AT2G29550.1CCGTTAAAEncodes a beta-tubulin that is expressed in leaves, roots and flowers.
AT2G29670AT2G29670.1ATAACCGGCTTTAAbinding; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G07280.3); Has 351 Blast hits to 210 proteins in 32 species: Archae - 10; Bacteria - 88; Metazoa - 2; Fungi - 0; Plants - 203; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT2G29670.1GACCGTTGbinding; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G07280.3); Has 351 Blast hits to 210 proteins in 32 species: Archae - 10; Bacteria - 88; Metazoa - 2; Fungi - 0; Plants - 203; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT2G29670.1TCCGGTTAAbinding; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G07280.3); Has 351 Blast hits to 210 proteins in 32 species: Archae - 10; Bacteria - 88; Metazoa - 2; Fungi - 0; Plants - 203; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT2G30260AT2G30260.1TTCCGGTTAAencodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus.
AT2G30530AT2G30530.1ATAACCGGAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01970.1); Has 5828 Blast hits to 755 proteins in 128 species: Archae - 0; Bacteria - 29; Metazoa - 881; Fungi - 129; Plants - 81; Viruses - 12; Other Eukaryotes - 4696 (source: NCBI BLink).
AT2G31340AT2G31340.1ATAACCGGAAembryo defective 1381 (emb1381); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G31725AT2G31725.1TTAACCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05730.1); Has 199 Blast hits to 199 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G31725.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05730.1); Has 199 Blast hits to 199 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G32430AT2G32430.1ATAAACCGGAACGGTTAAGgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G05170.2); Has 1014 Blast hits to 1008 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 686; Fungi - 0; Plants - 313; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT2G32690AT2G32690.1AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid.
AT2G32690.2AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid.
AT2G32690.3AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid.
AT2G32690.4AAAACCGGTTATGlycine-rich protein similar in structure to GRP5. The expression of GRP23 is induced by HPA (cutin monomer, salicylic acid, and abscisic acid.
AT2G33840AT2G33840.1TAACCGGATtRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tyrosine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, tyrosyl-tRNA aminoacylation; LOCATED IN: cytoplasm; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosine tRNA ligase, archaeal/eukaryotic (InterPro:IPR016485), Tyrosyl-tRNA synthetase, class Ib, archaeal/eukaryotic cytosolic (InterPro:IPR015624), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); BEST Arabidopsis thaliana protein match is: ATP binding / aminoacyl-tRNA ligase/ nucleotide binding / tyrosine-tRNA ligase (TAIR:AT1G28350.1); Has 3646 Blast hits to 3629 proteins in 1010 species: Archae - 254; Bacteria - 1669; Metazoa - 303; Fungi - 167; Plants - 79; Viruses - 5; Other Eukaryotes - 1169 (source: NCBI BLink).
AT2G33855AT2G33855.1TTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G33855.1TTTAACCGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G34190AT2G34190.1CTAACGGTxanthine/uracil permease family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Xanthine/uracil permease (InterPro:IPR006042), Xanthine/uracil/vitamin C permease (InterPro:IPR006043); BEST Arabidopsis thaliana protein match is: xanthine/uracil permease family protein (TAIR:AT2G05760.1); Has 4705 Blast hits to 4685 proteins in 930 species: Archae - 37; Bacteria - 3266; Metazoa - 310; Fungi - 84; Plants - 292; Viruses - 1; Other Eukaryotes - 715 (source: NCBI BLink).
AT2G34770AT2G34770.1CAACGGTCencodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death.
AT2G35260AT2G35260.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17840.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G35410AT2G35410.1CGGTTAAG33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G09040.2); Has 19540 Blast hits to 13531 proteins in 594 species: Archae - 12; Bacteria - 1397; Metazoa - 10397; Fungi - 2454; Plants - 3010; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink).
AT2G35660AT2G35660.1CTTAACCGEncodes a member of a novel gene family with homology to known proteins involved in hydroxylation and oxidation of an aromatic ring.
AT2G35660.2CTTAACCGEncodes a member of a novel gene family with homology to known proteins involved in hydroxylation and oxidation of an aromatic ring.
AT2G35660.3CTTAACCGEncodes a member of a novel gene family with homology to known proteins involved in hydroxylation and oxidation of an aromatic ring.
AT2G35840AT2G35840.1CCGTTGGATsucrose-phosphatase 1 (SPP1); FUNCTIONS IN: phosphatase activity, magnesium ion binding, sucrose-phosphatase activity, catalytic activity; INVOLVED IN: response to cadmium ion, sucrose biosynthetic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sucrose-6F-phosphate phosphohydrolase, plant and cyanobacteria (InterPro:IPR006380), Sucrose-6-phosphate phosphohydrolase C-terminal (InterPro:IPR013679), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Sucrose phosphatase, plant and cyanobacteria (InterPro:IPR012847), Sucrose-phosphate phosphatase (InterPro:IPR006378); BEST Arabidopsis thaliana protein match is: SPP1 (SUCROSE-PHOSPHATASE 1); catalytic/ magnesium ion binding / phosphatase/ sucrose-phosphatase (TAIR:AT1G51420.1); Has 758 Blast hits to 754 proteins in 266 species: Archae - 0; Bacteria - 574; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT2G35840.2CCGTTGGATsucrose-phosphatase 1 (SPP1); FUNCTIONS IN: phosphatase activity, magnesium ion binding, sucrose-phosphatase activity, catalytic activity; INVOLVED IN: response to cadmium ion, sucrose biosynthetic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sucrose-6F-phosphate phosphohydrolase, plant and cyanobacteria (InterPro:IPR006380), Sucrose-6-phosphate phosphohydrolase C-terminal (InterPro:IPR013679), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Sucrose phosphatase, plant and cyanobacteria (InterPro:IPR012847), Sucrose-phosphate phosphatase (InterPro:IPR006378); BEST Arabidopsis thaliana protein match is: SPP1 (SUCROSE-PHOSPHATASE 1); catalytic/ magnesium ion binding / phosphatase/ sucrose-phosphatase (TAIR:AT1G51420.1); Has 758 Blast hits to 754 proteins in 266 species: Archae - 0; Bacteria - 574; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT2G36000AT2G36000.1ATAAACCGGTTAAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
AT2G36000.2ATAAACCGGTTAAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G34620.1); Has 385 Blast hits to 273 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 337; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
AT2G36050AT2G36050.1CTTAACCGGARABIDOPSIS THALIANA OVATE FAMILY PROTEIN 15 (OFP15); LOCATED IN: chloroplast; EXPRESSED IN: sepal, carpel, stamen; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623, plant (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: OFP18 (OVATE FAMILY PROTEIN 18) (TAIR:AT3G52540.1); Has 131 Blast hits to 131 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G36360AT2G36360.1ATAACCGGATkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink).
AT2G36360.2ATAACCGGATkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74150.1); Has 6904 Blast hits to 2957 proteins in 231 species: Archae - 8; Bacteria - 233; Metazoa - 2896; Fungi - 817; Plants - 1292; Viruses - 0; Other Eukaryotes - 1658 (source: NCBI BLink).
AT2G36530AT2G36530.1ATCCAACGGInvolved in light-dependent cold tolerance and encodes an enolase. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT2G36530.1ATCCAACGGInvolved in light-dependent cold tolerance and encodes an enolase. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT2G36830AT2G36830.1TAACCGGTCencodes a tonoplast intrinsic protein, which functions as water channel. highly expressed in root, stem, cauline leaves and flowers. Complete knock out mutants have no detectable phenotype from the wild type.
AT2G36880AT2G36880.1CAACGGTCmethionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).
AT2G36880.2CAACGGTCmethionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).
AT2G37040AT2G37040.1CTAACGGTencodes a protein similar to phenylalanine ammonia-lyase
AT2G37160AT2G37160.1GACCGTTGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink).
AT2G37160.2GACCGTTGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G53390.2); Has 13878 Blast hits to 7458 proteins in 380 species: Archae - 36; Bacteria - 3543; Metazoa - 4573; Fungi - 2572; Plants - 1053; Viruses - 0; Other Eukaryotes - 2101 (source: NCBI BLink).
AT2G37340AT2G37340.1CCGTTGGATencodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks.
AT2G37585AT2G37585.1ATCCAACGGglycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT5G39990.1); Has 608 Blast hits to 607 proteins in 70 species: Archae - 0; Bacteria - 8; Metazoa - 401; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT2G37585.1CCGTTAAAglycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT5G39990.1); Has 608 Blast hits to 607 proteins in 70 species: Archae - 0; Bacteria - 8; Metazoa - 401; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT2G37680AT2G37680.1CGGTTAAGCONTAINS InterPro DOMAIN/s: Vacuolar import and degradation protein Vid24 (InterPro:IPR018618); Has 214 Blast hits to 214 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 124; Plants - 31; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G38470AT2G38470.1CAACGGTCMember of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress.
AT2G38960AT2G38960.1CCGTTGGATendoplasmic reticulum oxidoreductin
AT2G38960.2CCGTTGGATendoplasmic reticulum oxidoreductin
AT2G39210AT2G39210.1CAACGGTCnodulin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT2G28120.1); Has 2013 Blast hits to 1929 proteins in 375 species: Archae - 16; Bacteria - 607; Metazoa - 34; Fungi - 183; Plants - 318; Viruses - 0; Other Eukaryotes - 855 (source: NCBI BLink).
AT2G39580AT2G39580.1CGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 122 Blast hits to 101 proteins in 42 species: Archae - 0; Bacteria - 69; Metazoa - 26; Fungi - 4; Plants - 12; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT2G40070AT2G40070.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G09000.1); Has 94255 Blast hits to 49644 proteins in 1573 species: Archae - 225; Bacteria - 11215; Metazoa - 37735; Fungi - 21320; Plants - 3339; Viruses - 2662; Other Eukaryotes - 17759 (source: NCBI BLink).
AT2G40070.2TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G09000.1); Has 94255 Blast hits to 49644 proteins in 1573 species: Archae - 225; Bacteria - 11215; Metazoa - 37735; Fungi - 21320; Plants - 3339; Viruses - 2662; Other Eukaryotes - 17759 (source: NCBI BLink).
AT2G40650AT2G40650.1CTAACGGTpre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink).
AT2G40660AT2G40660.1ACCGTTAGtRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink).
AT2G40995AT2G40995.1TTTAACCGEncodes a defensin-like (DEFL) family protein.
AT2G41560AT2G41560.1CCGTTGGAencodes a calmodulin-regulated Ca(2+)-ATPase that improves salt tolerance in yeast. localized to the vacuole.
AT2G41600AT2G41600.1TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G41600.2TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G41600.3TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G41600.4TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G41600.5TTCGGTTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 144 Blast hits to 143 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 56; Plants - 67; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G41680AT2G41680.1ATCCAACGGEncodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage.
AT2G42070AT2G42070.1TGAACCGGTTAAARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 23 (ATNUDX23); FUNCTIONS IN: hydrolase activity, FAD diphosphatase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 4344 Blast hits to 4344 proteins in 924 species: Archae - 91; Bacteria - 3112; Metazoa - 94; Fungi - 31; Plants - 36; Viruses - 0; Other Eukaryotes - 980 (source: NCBI BLink).
AT2G42120AT2G42120.1TTAACCGGGTTDNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).
AT2G42120.2TTAACCGGGTTDNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).
AT2G42130AT2G42130.1AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G42130.2AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G42130.3AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G42130.4AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G42130.5AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G42370AT2G42370.1ACCGGTTATunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58110.1); Has 174 Blast hits to 159 proteins in 47 species: Archae - 3; Bacteria - 17; Metazoa - 67; Fungi - 5; Plants - 22; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G42790AT2G42790.1ACCGTTAGEncodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.
AT2G42790.1ACGCCGTTGGATEncodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.
AT2G42820AT2G42820.1TCCAACGGHVA22-LIKE PROTEIN F (HVA22F); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: TB2/DP1 and HVA22 related protein (InterPro:IPR004345); BEST Arabidopsis thaliana protein match is: ATHVA22A (TAIR:AT1G74520.1); Has 1062 Blast hits to 1061 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 550; Fungi - 144; Plants - 303; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT2G43360AT2G43360.1TCCAACGGCatalyzes the conversion of dethiobiotin to biotin.
AT2G43370AT2G43370.1CCGTTGGAU1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink).
AT2G43510AT2G43510.1TTTAACGGMember of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory.
AT2G43550AT2G43550.1ATCCAACGGEncodes a defensin-like (DEFL) family protein.
AT2G43990AT2G43990.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; Has 1359 Blast hits to 445 proteins in 113 species: Archae - 0; Bacteria - 186; Metazoa - 289; Fungi - 92; Plants - 21; Viruses - 2; Other Eukaryotes - 769 (source: NCBI BLink).
AT2G44530AT2G44530.1TTTAACGGribose-phosphate pyrophosphokinase, putative / phosphoribosyl diphosphate synthetase, putative; FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2) (TAIR:AT1G32380.1); Has 7996 Blast hits to 7829 proteins in 1556 species: Archae - 171; Bacteria - 3334; Metazoa - 500; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3398 (source: NCBI BLink).
AT2G44530.2TTTAACGGribose-phosphate pyrophosphokinase, putative / phosphoribosyl diphosphate synthetase, putative; FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2) (TAIR:AT1G32380.1); Has 7996 Blast hits to 7829 proteins in 1556 species: Archae - 171; Bacteria - 3334; Metazoa - 500; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3398 (source: NCBI BLink).
AT2G44640AT2G44640.1CCGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G44640.1CGGTTAAAACCGGTTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plasma membrane, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PDE320 (PIGMENT DEFECTIVE 320) (TAIR:AT3G06960.1); Has 25 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G44710AT2G44710.1CTAACGGTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G00830.2); Has 47292 Blast hits to 28612 proteins in 1155 species: Archae - 101; Bacteria - 5221; Metazoa - 22079; Fungi - 5075; Plants - 5572; Viruses - 985; Other Eukaryotes - 8259 (source: NCBI BLink).
AT2G44870AT2G44870.1TTAACCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G45470AT2G45470.1TTTAACCGFASCICLIN-LIKE ARABINOGALACTAN PROTEIN 8 (FLA8); LOCATED IN: anchored to plasma membrane, apoplast, plasma membrane, anchored to membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA10 (TAIR:AT3G60900.1); Has 13304 Blast hits to 6149 proteins in 712 species: Archae - 78; Bacteria - 4055; Metazoa - 1332; Fungi - 777; Plants - 1681; Viruses - 864; Other Eukaryotes - 4517 (source: NCBI BLink).
AT2G45500AT2G45500.1TTTAACGGATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink).
AT2G45500.2TTTAACGGATP binding / nucleoside-triphosphatase/ nucleotide binding; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA-type, conserved site (InterPro:IPR003960), MIT (InterPro:IPR007330); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G27120.1); Has 24223 Blast hits to 22559 proteins in 1837 species: Archae - 865; Bacteria - 8540; Metazoa - 4161; Fungi - 2341; Plants - 1523; Viruses - 17; Other Eukaryotes - 6776 (source: NCBI BLink).
AT2G45620AT2G45620.1CCGTTAAAnucleotidyltransferase family protein; FUNCTIONS IN: nucleotidyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotidyltransferase (InterPro:IPR002934), PAP/25A-associated (InterPro:IPR002058); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45750.1); Has 1532 Blast hits to 1443 proteins in 168 species: Archae - 0; Bacteria - 5; Metazoa - 813; Fungi - 252; Plants - 82; Viruses - 0; Other Eukaryotes - 380 (source: NCBI BLink).
AT2G45680AT2G45680.1GACCGTTGTCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G51910.2); Has 1037 Blast hits to 398 proteins in 90 species: Archae - 0; Bacteria - 18; Metazoa - 101; Fungi - 57; Plants - 215; Viruses - 0; Other Eukaryotes - 646 (source: NCBI BLink).
AT2G45730AT2G45730.1TTTAACCGeukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).
AT2G45960AT2G45960.1CTTAACCGGa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT2G45960.2CTTAACCGGa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT2G45960.3CTTAACCGGa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT2G46150AT2G46150.1CCGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G54200.1); Has 137 Blast hits to 136 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 133; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46260AT2G46260.1CCAAACCGGTTAAABTB/POZ domain-containing protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: ATPOB1; protein binding (TAIR:AT3G61600.1); Has 3167 Blast hits to 3141 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 3012; Fungi - 0; Plants - 79; Viruses - 9; Other Eukaryotes - 67 (source: NCBI BLink).
AT2G46330AT2G46330.1ATAACCGGTEncodes arabinogalactan protein (AGP16).
AT2G46330.1TTTAACCGGTCEncodes arabinogalactan protein (AGP16).
AT2G46330.2ATAACCGGTEncodes arabinogalactan protein (AGP16).
AT2G46330.2TTTAACCGGTCEncodes arabinogalactan protein (AGP16).
AT2G46470AT2G46470.1ACCGTTAGGCCTATAINNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae - 0; Bacteria - 2560; Metazoa - 212; Fungi - 138; Plants - 111; Viruses - 0; Other Eukaryotes - 1362 (source: NCBI BLink).
AT2G46520AT2G46520.1AATAGCCCATTTAACCGACTTAcellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), CAS/CSE, C-terminal (InterPro:IPR005043), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Exportin, Cse1-like (InterPro:IPR013713); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G59020.2); Has 841 Blast hits to 834 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 412; Fungi - 251; Plants - 70; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT2G46535AT2G46535.1CCGTTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61840.1); Has 22 Blast hits to 22 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46550AT2G46550.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01240.3); Has 47 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46600AT2G46600.1ATCCAACGGcalcium-binding protein, putative; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: PBP1 (PINOID-BINDING PROTEIN 1); calcium ion binding / protein binding (TAIR:AT5G54490.1); Has 2155 Blast hits to 2154 proteins in 355 species: Archae - 0; Bacteria - 4; Metazoa - 957; Fungi - 168; Plants - 633; Viruses - 0; Other Eukaryotes - 393 (source: NCBI BLink).
AT2G46900AT2G46900.1ACCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink).
AT2G46910AT2G46910.1CGGTTAAGplastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 169 Blast hits to 169 proteins in 57 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G47060AT2G47060.1ATCCAACGGserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT3G62220.1); Has 80619 Blast hits to 79720 proteins in 3178 species: Archae - 48; Bacteria - 7478; Metazoa - 35837; Fungi - 5878; Plants - 17627; Viruses - 326; Other Eukaryotes - 13425 (source: NCBI BLink).
AT2G47060.2ATCCAACGGserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT3G62220.1); Has 80619 Blast hits to 79720 proteins in 3178 species: Archae - 48; Bacteria - 7478; Metazoa - 35837; Fungi - 5878; Plants - 17627; Viruses - 326; Other Eukaryotes - 13425 (source: NCBI BLink).
AT2G47060.3ATCCAACGGserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT3G62220.1); Has 80619 Blast hits to 79720 proteins in 3178 species: Archae - 48; Bacteria - 7478; Metazoa - 35837; Fungi - 5878; Plants - 17627; Viruses - 326; Other Eukaryotes - 13425 (source: NCBI BLink).
AT2G47060.4ATCCAACGGserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT3G62220.1); Has 80619 Blast hits to 79720 proteins in 3178 species: Archae - 48; Bacteria - 7478; Metazoa - 35837; Fungi - 5878; Plants - 17627; Viruses - 326; Other Eukaryotes - 13425 (source: NCBI BLink).
AT2G47250AT2G47250.1TAACGGGCCTTGRNA helicase, putative; FUNCTIONS IN: in 7 functions; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT3G62310.1); Has 7386 Blast hits to 6689 proteins in 1000 species: Archae - 0; Bacteria - 1927; Metazoa - 2123; Fungi - 842; Plants - 395; Viruses - 601; Other Eukaryotes - 1498 (source: NCBI BLink).
AT2G47440AT2G47440.1CCGTTAAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT3G62570.1); Has 245 Blast hits to 237 proteins in 72 species: Archae - 0; Bacteria - 6; Metazoa - 75; Fungi - 36; Plants - 107; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT3G01230AT3G01230.1ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01240.1); Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G01280AT3G01280.1ATCCAACGGEncodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.
AT3G01430AT3G01430.1CGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT5G14890.1); Has 48 Blast hits to 48 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G01450AT3G01450.1CCGTTGGATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G14790.1); Has 188 Blast hits to 188 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 6; Plants - 61; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT3G01610AT3G01610.1TCCAACGGAAA-type ATPase - Over 90% homologous to CDC48a
AT3G01800AT3G01800.1ACCGGTTAribosome recycling factor family protein / ribosome releasing factor family protein; INVOLVED IN: translation; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosome recycling factor, bacterial-like (InterPro:IPR015998), Ribosome recycling factor (InterPro:IPR002661); BEST Arabidopsis thaliana protein match is: RRF (RIBOSOME RECYCLING FACTOR, CHLOROPLAST PRECURSOR) (TAIR:AT3G63190.1); Has 5299 Blast hits to 5299 proteins in 1469 species: Archae - 0; Bacteria - 2911; Metazoa - 102; Fungi - 44; Plants - 57; Viruses - 0; Other Eukaryotes - 2185 (source: NCBI BLink).
AT3G02120AT3G02120.1CTAACGGThydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cyclopentenone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 9 Blast hits to 9 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G02120.1GACCGTTGhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cyclopentenone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 9 Blast hits to 9 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G02190AT3G02190.1TAACCGGAA60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).
AT3G02190.1TCCAACGGTC60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).
AT3G02190.1TTTCCGGTTAAA60S ribosomal protein L39 (RPL39B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 607 Blast hits to 607 proteins in 229 species: Archae - 157; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).
AT3G02200AT3G02200.1GACCGTTGGAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02200.1TTCCGGTTAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02200.1TTTAACCGGAAAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02200.2GACCGTTGGAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02200.2TTCCGGTTAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02200.2TTTAACCGGAAAproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02520AT3G02520.1ACCGTTAGEncodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν).
AT3G02520.1TTTAACGGEncodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν).
AT3G02555AT3G02555.1AAATGGGCCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G02560AT3G02560.1TTTAACGGCCCATTT40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT3G02560.2TTTAACGGCCCATTT40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT3G02640AT3G02640.1CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16250.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G02660AT3G02660.1ACCGGTTATEMBRYO DEFECTIVE 2768 (emb2768); FUNCTIONS IN: RNA binding, tyrosine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), RNA-binding S4 (InterPro:IPR002942), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6358 Blast hits to 6354 proteins in 1524 species: Archae - 11; Bacteria - 2982; Metazoa - 99; Fungi - 101; Plants - 19; Viruses - 0; Other Eukaryotes - 3146 (source: NCBI BLink).
AT3G02660.1CTTAACCGEMBRYO DEFECTIVE 2768 (emb2768); FUNCTIONS IN: RNA binding, tyrosine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), RNA-binding S4 (InterPro:IPR002942), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6358 Blast hits to 6354 proteins in 1524 species: Archae - 11; Bacteria - 2982; Metazoa - 99; Fungi - 101; Plants - 19; Viruses - 0; Other Eukaryotes - 3146 (source: NCBI BLink).
AT3G02660.1TTTAACGGGCCGTAEMBRYO DEFECTIVE 2768 (emb2768); FUNCTIONS IN: RNA binding, tyrosine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), RNA-binding S4 (InterPro:IPR002942), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6358 Blast hits to 6354 proteins in 1524 species: Archae - 11; Bacteria - 2982; Metazoa - 99; Fungi - 101; Plants - 19; Viruses - 0; Other Eukaryotes - 3146 (source: NCBI BLink).
AT3G02840AT3G02840.1CAACGGTCimmediate-early fungal elicitor family protein; FUNCTIONS IN: binding; INVOLVED IN: response to other organism, response to ozone; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT5G37490.1); Has 219 Blast hits to 219 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 218; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G03120AT3G03120.1CAAACCGGTTATAAACCGGTCA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins.
AT3G03130AT3G03130.1CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17160.1); Has 6511 Blast hits to 3260 proteins in 393 species: Archae - 10; Bacteria - 2333; Metazoa - 1613; Fungi - 601; Plants - 171; Viruses - 56; Other Eukaryotes - 1727 (source: NCBI BLink).
AT3G03190AT3G03190.1TCCAACGGEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT3G03270AT3G03270.1CAAACCGGTTATuniversal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G03270.2CAAACCGGTTATuniversal stress protein (USP) family protein / early nodulin ENOD18 family protein; INVOLVED IN: response to stress; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G53990.1); Has 331 Blast hits to 331 proteins in 36 species: Archae - 0; Bacteria - 4; Metazoa - 8; Fungi - 10; Plants - 307; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G03490AT3G03490.1CCGTTGGATperoxin 19-1 (PEX19-1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); BEST Arabidopsis thaliana protein match is: PEX19-2 (TAIR:AT5G17550.1); Has 444 Blast hits to 432 proteins in 147 species: Archae - 3; Bacteria - 58; Metazoa - 156; Fungi - 107; Plants - 19; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).
AT3G03810AT3G03810.1CCGGTTATembryo sac development arrest 30 (EDA30); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, polar nucleus fusion, pollen tube development; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G30300.1); Has 433 Blast hits to 418 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 433; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G04130AT3G04130.1TAACCGGTTTTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).
AT3G04130.2TAACCGGTTTTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).
AT3G04230AT3G04230.1CCGGTTAA40S ribosomal protein S16 (RPS16B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16C) (TAIR:AT5G18380.1); Has 4667 Blast hits to 4667 proteins in 1442 species: Archae - 152; Bacteria - 2454; Metazoa - 279; Fungi - 125; Plants - 110; Viruses - 0; Other Eukaryotes - 1547 (source: NCBI BLink).
AT3G04410AT3G04410.1CGGTTAAAtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC004 (Arabidopsis NAC domain containing protein 4); transcription factor (TAIR:AT1G02230.1); Has 26 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G04410.1CTTAACCGtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ANAC004 (Arabidopsis NAC domain containing protein 4); transcription factor (TAIR:AT1G02230.1); Has 26 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G04590AT3G04590.1CTAACGGTDNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT5G28590.1); Has 2965 Blast hits to 2644 proteins in 187 species: Archae - 0; Bacteria - 45; Metazoa - 1692; Fungi - 274; Plants - 459; Viruses - 15; Other Eukaryotes - 480 (source: NCBI BLink).
AT3G04590.2CTAACGGTDNA-binding family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), AT hook, DNA-binding, conserved site (InterPro:IPR017956); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT5G28590.1); Has 2965 Blast hits to 2644 proteins in 187 species: Archae - 0; Bacteria - 45; Metazoa - 1692; Fungi - 274; Plants - 459; Viruses - 15; Other Eukaryotes - 480 (source: NCBI BLink).
AT3G04660AT3G04660.1CAACGGTCF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 3 (InterPro:IPR013187), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein-related (TAIR:AT2G13630.1); Has 747 Blast hits to 721 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 747; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G04680AT3G04680.1TTAACCGGAAAEncodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression.
AT3G04680.2TTAACCGGAAAEncodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression.
AT3G04830AT3G04830.1GACCCGGTTATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G04830.2GACCCGGTTATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G05020AT3G05020.1ATCCGGTTAAAencodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light.
AT3G05100AT3G05100.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 12 (InterPro:IPR013217); Has 53 Blast hits to 53 proteins in 21 species: Archae - 2; Bacteria - 27; Metazoa - 0; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT3G05190AT3G05190.1TTTCCGGTTATaminotransferase class IV family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544), Aminotransferase, class IV, conserved site (InterPro:IPR018300); BEST Arabidopsis thaliana protein match is: aminotransferase class IV family protein (TAIR:AT5G27410.1); Has 9097 Blast hits to 9096 proteins in 1178 species: Archae - 99; Bacteria - 4133; Metazoa - 10; Fungi - 55; Plants - 190; Viruses - 0; Other Eukaryotes - 4610 (source: NCBI BLink).
AT3G05330AT3G05330.1GACCGTTGEncodes a protein with moderate sequence similarity to the maize microtubule-binding protein TANGLED1. A single base-pair deletion (-A) at position Chr3:1519176 in Columbia relative to the Landsberg erecta and Achkarren-2 ecotype (see ESTs DR378436 and CB26450) introduces a frame-shift and premature termination codon. The protein encoded from the Columbia gene is truncated by 29 amino acids relative to the Landsberg erecta and Achkarren-2 encoded proteins. Involved in the identification of the division plane during mitosis amd cytokinesis
AT3G06240AT3G06240.1TTGAACCGTTTAACCGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G23880.1); Has 1173 Blast hits to 1161 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1171; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G06300AT3G06300.1GACCGTTGEncodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins.
AT3G06960AT3G06960.1ATAACCGGAAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G06960.1TTTAACCGTTAGPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G06960.2ATAACCGGAAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G06960.2TTTAACCGTTAGPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G07170AT3G07170.1CAAACCGGTTATsterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT3G07170.1TTTAACCGCGTsterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT3G07500AT3G07500.1ATCCAACGGfar-red impaired responsive family protein / FAR1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcription factor, FAR1-related (InterPro:IPR004330); BEST Arabidopsis thaliana protein match is: far-red impaired responsive family protein / FAR1 family protein (TAIR:AT2G43280.1); Has 470 Blast hits to 432 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 470; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G07780AT3G07780.1ACCGTTAGEncodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems.
AT3G07910AT3G07910.1GTTAGGCCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reactive oxygen species modulator 1 (InterPro:IPR018450); Has 146 Blast hits to 146 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 6; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT3G08580AT3G08580.1ATCCAACGGmitochondrial ADP/ATP carrier
AT3G08580.1CTAACGGTmitochondrial ADP/ATP carrier
AT3G08580.2ATCCAACGGmitochondrial ADP/ATP carrier
AT3G08580.2CTAACGGTmitochondrial ADP/ATP carrier
AT3G08670AT3G08670.1CGGTTAAGunknown protein; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G51540.1); Has 42170 Blast hits to 24550 proteins in 1008 species: Archae - 36; Bacteria - 4261; Metazoa - 16862; Fungi - 10439; Plants - 1834; Viruses - 857; Other Eukaryotes - 7881 (source: NCBI BLink).
AT3G08780AT3G08780.1TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G08780.2TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G09070AT3G09070.1CCGTTGGAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF740 (InterPro:IPR008004); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT5G01170.1); Has 902 Blast hits to 759 proteins in 116 species: Archae - 0; Bacteria - 44; Metazoa - 442; Fungi - 57; Plants - 103; Viruses - 31; Other Eukaryotes - 225 (source: NCBI BLink).
AT3G09200AT3G09200.1ACCGTTAG60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).
AT3G09200.2ACCGTTAG60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).
AT3G09210AT3G09210.1CCGGTTAAAPLASTID TRANSCRIPTIONALLY ACTIVE13 (PTAC13); FUNCTIONS IN: transcription elongation regulator activity; INVOLVED IN: positive regulation of RNA elongation from RNA polymerase II promoter; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Transcription antitermination protein, NusG, N-terminal (InterPro:IPR006645), Translation protein SH3-like, subgroup (InterPro:IPR014722), KOW (InterPro:IPR005824); Has 2507 Blast hits to 2507 proteins in 692 species: Archae - 0; Bacteria - 1288; Metazoa - 0; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 1201 (source: NCBI BLink).
AT3G09360AT3G09360.1CGGTTAAARNA polymerase II transcription factor/ protein binding / transcription activator/ transcription regulator/ translation initiation factor/ zinc ion binding; FUNCTIONS IN: in 6 functions; INVOLVED IN: translational initiation, positive regulation of transcription, regulation of transcription, DNA-dependent, transcription initiation; LOCATED IN: transcription factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Brf1-like TBP-binding (InterPro:IPR011665), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: MEE65 (maternal effect embryo arrest 65); RNA polymerase II transcription factor/ cation:chloride symporter (TAIR:AT2G01280.1); Has 20399 Blast hits to 12051 proteins in 760 species: Archae - 341; Bacteria - 837; Metazoa - 8420; Fungi - 1909; Plants - 698; Viruses - 262; Other Eukaryotes - 7932 (source: NCBI BLink).
AT3G09410AT3G09410.1TTCCGGTTAAApectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).
AT3G09410.3TTCCGGTTAAApectinacetylesterase family protein; FUNCTIONS IN: carboxylesterase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09405.1); Has 403 Blast hits to 396 proteins in 77 species: Archae - 0; Bacteria - 38; Metazoa - 115; Fungi - 0; Plants - 161; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).
AT3G09580AT3G09580.1CAACGGTCamine oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amine oxidase (InterPro:IPR002937); Has 2076 Blast hits to 2076 proteins in 439 species: Archae - 18; Bacteria - 842; Metazoa - 222; Fungi - 27; Plants - 205; Viruses - 0; Other Eukaryotes - 762 (source: NCBI BLink).
AT3G10140AT3G10140.1CCGTTAAArecA homolog 3 (RECA3); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA-dependent ATPase activity, DNA binding, nucleotide binding, ATP binding; INVOLVED IN: DNA repair, SOS response, DNA recombination, DNA metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), RecA (InterPro:IPR013765), RecA bacterial DNA recombination (InterPro:IPR001553); BEST Arabidopsis thaliana protein match is: recA family protein (TAIR:AT2G19490.1); Has 13670 Blast hits to 13583 proteins in 3361 species: Archae - 216; Bacteria - 8994; Metazoa - 140; Fungi - 177; Plants - 138; Viruses - 71; Other Eukaryotes - 3934 (source: NCBI BLink).
AT3G10610AT3G10610.1TTTAACGG40S ribosomal protein S17 (RPS17C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17B) (TAIR:AT2G05220.2); Has 727 Blast hits to 727 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT3G10620AT3G10620.1CGGTTAAGARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26 (ATNUDX26); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX27 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT5G06340.1); Has 3528 Blast hits to 3526 proteins in 752 species: Archae - 0; Bacteria - 1779; Metazoa - 13; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 1695 (source: NCBI BLink).
AT3G10620.1TTTAACGGARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26 (ATNUDX26); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX27 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT5G06340.1); Has 3528 Blast hits to 3526 proteins in 752 species: Archae - 0; Bacteria - 1779; Metazoa - 13; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 1695 (source: NCBI BLink).
AT3G10720AT3G10720.2CGGTTAAApectinesterase, putative; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase, putative (TAIR:AT5G04970.1); Has 3431 Blast hits to 1956 proteins in 277 species: Archae - 0; Bacteria - 297; Metazoa - 196; Fungi - 470; Plants - 1442; Viruses - 376; Other Eukaryotes - 650 (source: NCBI BLink).
AT3G11100AT3G11100.1ATAACCGGTTTTtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT5G05550.1); Has 522 Blast hits to 488 proteins in 92 species: Archae - 2; Bacteria - 29; Metazoa - 76; Fungi - 65; Plants - 221; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).
AT3G11100.1TTTAACCGtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT5G05550.1); Has 522 Blast hits to 488 proteins in 92 species: Archae - 2; Bacteria - 29; Metazoa - 76; Fungi - 65; Plants - 221; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).
AT3G11240AT3G11240.1CTAACGGTEncodes an arginyl-tRNA:protein arginyltransferase (ATE2), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination.
AT3G11250AT3G11250.1ACCGTTAG60S acidic ribosomal protein P0 (RPP0C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, translation; LOCATED IN: cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0B) (TAIR:AT3G09200.1); Has 1503 Blast hits to 1500 proteins in 380 species: Archae - 223; Bacteria - 1; Metazoa - 578; Fungi - 277; Plants - 141; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink).
AT3G11330AT3G11330.1TTTAACCGleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT5G05850.1); Has 56721 Blast hits to 22652 proteins in 869 species: Archae - 19; Bacteria - 4682; Metazoa - 27023; Fungi - 1823; Plants - 19445; Viruses - 12; Other Eukaryotes - 3717 (source: NCBI BLink).
AT3G11400AT3G11400.1TTCCGGTTAOne of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3).
AT3G11400.2TTCCGGTTAOne of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3).
AT3G11410AT3G11410.1GCCCGTTAATTACGEncodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA.
AT3G11470AT3G11470.1ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT3G11470.2ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT3G11470.3ATCCGGTTAAA4'-phosphopantetheinyl transferase family protein; FUNCTIONS IN: holo-[acyl-carrier-protein] synthase activity, magnesium ion binding, transferase activity; INVOLVED IN: metabolic process, macromolecule biosynthetic process; CONTAINS InterPro DOMAIN/s: 4'-phosphopantetheinyl transferase (InterPro:IPR008278); BEST Arabidopsis thaliana protein match is: holo-[acyl-carrier-protein] synthase/ magnesium ion binding (TAIR:AT2G02770.1); Has 1071 Blast hits to 1071 proteins in 436 species: Archae - 4; Bacteria - 863; Metazoa - 85; Fungi - 9; Plants - 35; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT3G11520AT3G11520.1ACCGTTAGEncodes a B-type mitotic cyclin.
AT3G11520.1ATCCAACGGEncodes a B-type mitotic cyclin.
AT3G11730AT3G11730.1CGGTTAAGEncodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein.
AT3G11820AT3G11820.1TTTAACGGEncodes a syntaxin localized at the plasma membrane (SYR1, Syntaxin Related Protein 1, also known as SYP121, PENETRATION1/PEN1). SYR1/PEN1 is a member of the SNARE superfamily proteins. SNARE proteins are involved in cell signaling, vesicle traffic, growth and development. SYR1/PEN1 functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew, Blumeria graminis sp. hordei. SYR1/PEN1 is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance.
AT3G11820.2TTTAACGGEncodes a syntaxin localized at the plasma membrane (SYR1, Syntaxin Related Protein 1, also known as SYP121, PENETRATION1/PEN1). SYR1/PEN1 is a member of the SNARE superfamily proteins. SNARE proteins are involved in cell signaling, vesicle traffic, growth and development. SYR1/PEN1 functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew, Blumeria graminis sp. hordei. SYR1/PEN1 is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance.
AT3G11940AT3G11940.1TTAACCGGOne of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant.
AT3G11940.2TTAACCGGOne of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant.
AT3G11945AT3G11945.1TTAACCGGGTTEncodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950.
AT3G11945.2TTAACCGGGTTEncodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950.
AT3G12170AT3G12170.1ATAACCGGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: ATJ6 (Arabidopsis J-domain protein 6); heat shock protein binding / unfolded protein binding (TAIR:AT5G06910.1); Has 16438 Blast hits to 16435 proteins in 1943 species: Archae - 109; Bacteria - 5179; Metazoa - 3539; Fungi - 1500; Plants - 1231; Viruses - 45; Other Eukaryotes - 4835 (source: NCBI BLink).
AT3G12250AT3G12250.1CCGTTAAAbasic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT3G12250.2CCGTTAAAbasic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT3G12250.4CCGTTAAAbasic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT3G12260AT3G12260.1TAACCGGAAATAATTACGcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 192 Blast hits to 192 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 33; Plants - 31; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT3G12490AT3G12490.1CTTAACCGEncodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmitic, cold stress).
AT3G12490.2CTTAACCGEncodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmitic, cold stress).
AT3G12550AT3G12550.1TCCGGTTAAXH/XS domain-containing protein / XS zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT3G48670.2); Has 23408 Blast hits to 15451 proteins in 943 species: Archae - 218; Bacteria - 2032; Metazoa - 11697; Fungi - 1231; Plants - 587; Viruses - 80; Other Eukaryotes - 7563 (source: NCBI BLink).
AT3G12560AT3G12560.1TTAACCGGAEncodes a telomeric DNA-binding protein.
AT3G12580AT3G12580.1ATCCAACGGheat shock protein 70 (HSP70); FUNCTIONS IN: ATP binding; INVOLVED IN: in 8 processes; LOCATED IN: cytosol, mitochondrion, cell wall, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24865 Blast hits to 24554 proteins in 3102 species: Archae - 103; Bacteria - 9662; Metazoa - 3184; Fungi - 1196; Plants - 727; Viruses - 243; Other Eukaryotes - 9750 (source: NCBI BLink).
AT3G12650AT3G12650.1GAACCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12990AT3G12990.1ACCGTTAGEncodes a 3'-5' exoribonuclease, partially redundant with CER7. Involved in epicuticular wax biosynthesis.
AT3G12990.2ACCGTTAGEncodes a 3'-5' exoribonuclease, partially redundant with CER7. Involved in epicuticular wax biosynthesis.
AT3G13275AT3G13275.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 13 Blast hits to 13 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13410AT3G13410.1AAACCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13410.1GACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13470AT3G13470.1ATCCAACGGchaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60, conserved site (InterPro:IPR018370), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24486 Blast hits to 24452 proteins in 5132 species: Archae - 390; Bacteria - 14009; Metazoa - 1525; Fungi - 954; Plants - 450; Viruses - 2; Other Eukaryotes - 7156 (source: NCBI BLink).
AT3G14000AT3G14000.1CAACGGTCBelongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity.
AT3G14000.2CAACGGTCBelongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity.
AT3G14130AT3G14130.1CCGTTGGA(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14150.2); Has 9793 Blast hits to 9779 proteins in 1166 species: Archae - 155; Bacteria - 3369; Metazoa - 366; Fungi - 469; Plants - 174; Viruses - 0; Other Eukaryotes - 5260 (source: NCBI BLink).
AT3G14330AT3G14330.1TTTAACCGGAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 13083 Blast hits to 5154 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 59; Fungi - 57; Plants - 12750; Viruses - 0; Other Eukaryotes - 217 (source: NCBI BLink).
AT3G15090AT3G15090.1GTAAACCGGTTAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink).
AT3G15220AT3G15220.1TATATGGGCCGTTAAAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: spindle, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATMAP4K ALPHA1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G53165.2); Has 97460 Blast hits to 95819 proteins in 3033 species: Archae - 88; Bacteria - 8614; Metazoa - 42541; Fungi - 8570; Plants - 18723; Viruses - 614; Other Eukaryotes - 18310 (source: NCBI BLink).
AT3G15355AT3G15355.1CCGTTAAAUBIQUITIN-CONJUGATING ENZYME 25 (UBC25); FUNCTIONS IN: small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC26 (UBIQUITIN-CONJUGATING ENZYME 26); ubiquitin-protein ligase (TAIR:AT1G53020.1); Has 4538 Blast hits to 4520 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 2098; Fungi - 838; Plants - 798; Viruses - 13; Other Eukaryotes - 791 (source: NCBI BLink).
AT3G15480AT3G15480.1CCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52910.1); Has 159 Blast hits to 159 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 159; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G15640AT3G15640.1TCACACGTACCGGTTAAcytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).
AT3G15640.2TCACACGTACCGGTTAAcytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity, metal ion binding; LOCATED IN: mitochondrial envelope, mitochondrion, chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT1G80230.1); Has 343 Blast hits to 343 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 191; Fungi - 63; Plants - 56; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).
AT3G16050AT3G16050.1ATCCAACGGEncodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation.
AT3G16200AT3G16200.1TAACCGGTTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 70 Blast hits to 70 proteins in 9 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT3G16640AT3G16640.1CCGTTGGAEncodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well.
AT3G16650AT3G16650.1TCCAACGGPP1/PP2A phosphatases pleiotropic regulator 2 (PRL2); FUNCTIONS IN: nucleotide binding; INVOLVED IN: response to salt stress; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PRL1 (PLEIOTROPIC REGULATORY LOCUS 1); basal transcription repressor/ nucleotide binding / protein binding (TAIR:AT4G15900.1); Has 58179 Blast hits to 24123 proteins in 639 species: Archae - 64; Bacteria - 6308; Metazoa - 27345; Fungi - 10914; Plants - 5200; Viruses - 0; Other Eukaryotes - 8348 (source: NCBI BLink).
AT3G16840AT3G16840.1TAACCGGTTTAAATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink).
AT3G16840.1TTAACCGGATATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (RH10) (TAIR:AT5G60990.1); Has 47629 Blast hits to 37227 proteins in 1876 species: Archae - 406; Bacteria - 10857; Metazoa - 14354; Fungi - 5782; Plants - 2214; Viruses - 278; Other Eukaryotes - 13738 (source: NCBI BLink).
AT3G16910AT3G16910.1TAACCGGAAAEncodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle.
AT3G17040AT3G17040.1CCGGTTATIt is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis.
AT3G17070AT3G17070.1CGGTTAAAperoxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G40150.1); Has 3116 Blast hits to 3101 proteins in 241 species: Archae - 0; Bacteria - 4; Metazoa - 2; Fungi - 305; Plants - 2754; Viruses - 0; Other Eukaryotes - 51 (source: NCBI BLink).
AT3G17365AT3G17365.1TTCCGGTTATcatalytic/ methyltransferase; FUNCTIONS IN: methyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: catalytic/ methyltransferase (TAIR:AT3G60910.1); Has 889 Blast hits to 888 proteins in 188 species: Archae - 17; Bacteria - 122; Metazoa - 263; Fungi - 34; Plants - 84; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink).
AT3G17365.1TTTAACGGcatalytic/ methyltransferase; FUNCTIONS IN: methyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: catalytic/ methyltransferase (TAIR:AT3G60910.1); Has 889 Blast hits to 888 proteins in 188 species: Archae - 17; Bacteria - 122; Metazoa - 263; Fungi - 34; Plants - 84; Viruses - 0; Other Eukaryotes - 369 (source: NCBI BLink).
AT3G17390AT3G17390.1ATCCAACGGTTTAAS-adenosylmethionine synthetase
AT3G17790AT3G17790.1TTTAACCGPAP17; FUNCTIONS IN: phosphatase activity, protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: response to hydrogen peroxide, cellular phosphate ion homeostasis; LOCATED IN: cell surface; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP3 (PURPLE ACID PHOSPHATASE 3); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT1G14700.1); Has 911 Blast hits to 906 proteins in 224 species: Archae - 2; Bacteria - 200; Metazoa - 324; Fungi - 6; Plants - 95; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink).
AT3G17790.1TTTAACCGPAP17; FUNCTIONS IN: phosphatase activity, protein serine/threonine phosphatase activity, acid phosphatase activity; INVOLVED IN: response to hydrogen peroxide, cellular phosphate ion homeostasis; LOCATED IN: cell surface; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP3 (PURPLE ACID PHOSPHATASE 3); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT1G14700.1); Has 911 Blast hits to 906 proteins in 224 species: Archae - 2; Bacteria - 200; Metazoa - 324; Fungi - 6; Plants - 95; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink).
AT3G17810AT3G17810.1CCGTTGGAdihydroorotate dehydrogenase family protein / dihydroorotate oxidase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, catalytic activity, dihydroorotate oxidase activity, dihydroorotate dehydrogenase activity; INVOLVED IN: 'de novo' pyrimidine base biosynthetic process, UMP biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Dihydroorotate dehydrogenase, classes 1 and 2 (InterPro:IPR012135), Dihydroorotate dehydrogenase, class 1, core (InterPro:IPR005720); Has 3539 Blast hits to 3539 proteins in 1009 species: Archae - 112; Bacteria - 2115; Metazoa - 241; Fungi - 79; Plants - 25; Viruses - 0; Other Eukaryotes - 967 (source: NCBI BLink).
AT3G17860AT3G17860.1TTTAACCGACTJAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine.
AT3G17880AT3G17880.1CGGTTAAGEncodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX.
AT3G17880.2CGGTTAAGEncodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX.
AT3G18100AT3G18100.1TAACCGGTTTATMember of the R2R3 transcription factor gene family.
AT3G18100.1TTTAACCGMember of the R2R3 transcription factor gene family.
AT3G18160AT3G18160.1TGGTTCGGTTAAGTTCGGTTAAAperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1).
AT3G18160.2TGGTTCGGTTAAGTTCGGTTAAAperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1).
AT3G18160.3TGGTTCGGTTAAGTTCGGTTAAAperoxin-3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome, integral to peroxisomal membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peroxin-3 (InterPro:IPR006966); BEST Arabidopsis thaliana protein match is: peroxin-3 family protein (TAIR:AT1G48635.1).
AT3G18190AT3G18190.1TTTAACCGchaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae - 394; Bacteria - 6460; Metazoa - 1798; Fungi - 981; Plants - 478; Viruses - 2; Other Eukaryotes - 4321 (source: NCBI BLink).
AT3G18210AT3G18210.1ATAACCGGTTCGoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink).
AT3G18210.2ATAACCGGTTCGoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink).
AT3G18215AT3G18215.1CGAACCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24600.1); Has 180 Blast hits to 180 proteins in 49 species: Archae - 0; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G18430AT3G18430.1TTTAACGGcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: CAM9 (CALMODULIN 9); calcium ion binding (TAIR:AT3G51920.1); Has 3772 Blast hits to 3771 proteins in 389 species: Archae - 0; Bacteria - 11; Metazoa - 2178; Fungi - 257; Plants - 701; Viruses - 0; Other Eukaryotes - 625 (source: NCBI BLink).
AT3G18800AT3G18800.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; Has 37 Blast hits to 37 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G19190AT3G19190.1ATCCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT3G19190.1TAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATG2, C-terminal (InterPro:IPR015412); Has 603 Blast hits to 514 proteins in 156 species: Archae - 0; Bacteria - 19; Metazoa - 326; Fungi - 168; Plants - 38; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT3G19508AT3G19508.1TTTAACCGGTCunknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G19540AT3G19540.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49840.1); Has 153 Blast hits to 150 proteins in 31 species: Archae - 0; Bacteria - 3; Metazoa - 14; Fungi - 12; Plants - 117; Viruses - 5; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G19640AT3G19640.1CTTAACCGmagnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).
AT3G19920AT3G19920.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G64230.1); Has 113 Blast hits to 113 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G20250AT3G20250.1CCGTTAAAArabidopsis Pumilio 5 (APUM5); FUNCTIONS IN: RNA binding, binding; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM6 (Arabidopsis Pumilio 6); RNA binding / binding (TAIR:AT4G25880.1); Has 3518 Blast hits to 1808 proteins in 189 species: Archae - 0; Bacteria - 5; Metazoa - 931; Fungi - 953; Plants - 586; Viruses - 0; Other Eukaryotes - 1043 (source: NCBI BLink).
AT3G20510AT3G20510.1GACCGTTGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G50740.1); Has 312 Blast hits to 312 proteins in 83 species: Archae - 0; Bacteria - 25; Metazoa - 175; Fungi - 10; Plants - 97; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G20670AT3G20670.1ATCCAACGGEncodes HTA13, a histone H2A protein.
AT3G20920AT3G20920.1TTAACCGGTCtranslocation protein-related; FUNCTIONS IN: protein transporter activity; INVOLVED IN: protein transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocation protein Sec62 (InterPro:IPR004728); Has 185 Blast hits to 185 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 46; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).
AT3G20920.2TTAACCGGTCtranslocation protein-related; FUNCTIONS IN: protein transporter activity; INVOLVED IN: protein transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocation protein Sec62 (InterPro:IPR004728); Has 185 Blast hits to 185 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 80; Fungi - 46; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).
AT3G20935AT3G20935.1GACCGTTGCYP705A28; FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, heme binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, E-class, group I (InterPro:IPR002401), Cytochrome P450, C-terminal region (InterPro:IPR017973), Cytochrome P450, conserved site (InterPro:IPR017972); BEST Arabidopsis thaliana protein match is: CYP705A30; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding (TAIR:AT3G20940.1).
AT3G21200AT3G21200.1ATAACCGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 97 Blast hits to 97 proteins in 25 species: Archae - 0; Bacteria - 24; Metazoa - 0; Fungi - 0; Plants - 49; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT3G21640AT3G21640.1ACGCCGTTAAAencodes a 42 kDa FK506-binding protein (AtFKBP42) that possesses similarity to multidomain peptidyl-prolyl cis/trans isomerases (PPIases, EC, which are known to be components of mammalian steroid hormone receptor complexes. The protein appears to be localized to the plasma membrane by electron microscopy and binds to HSP90.1 and calmodulin in vitro. It also aggregates citrate synthase in vitro but does NOT show PPIase activity in vivo. Mutants are reduced in size and exhibit disoriented growth in all organs.
AT3G22160AT3G22160.1CAACGGTCVQ motif-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: stem, inflorescence meristem, sepal, stamen, leaf; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: VQ (InterPro:IPR008889); BEST Arabidopsis thaliana protein match is: VQ motif-containing protein (TAIR:AT4G15120.1); Has 217 Blast hits to 196 proteins in 42 species: Archae - 0; Bacteria - 10; Metazoa - 35; Fungi - 23; Plants - 91; Viruses - 8; Other Eukaryotes - 50 (source: NCBI BLink).
AT3G22380AT3G22380.1GACCGTTGGATEncodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action.
AT3G22380.2GACCGTTGGATEncodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action.
AT3G22410AT3G22410.1TTTAACGGCGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05370.1); Has 1032 Blast hits to 1032 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 245; Fungi - 243; Plants - 390; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).
AT3G22425AT3G22425.1CTTAACCGEncodes imidazoleglycerolphosphate dehydratase.
AT3G22425.1GACCGGTTATEncodes imidazoleglycerolphosphate dehydratase.
AT3G22425.2CTTAACCGEncodes imidazoleglycerolphosphate dehydratase.
AT3G22425.2GACCGGTTATEncodes imidazoleglycerolphosphate dehydratase.
AT3G22450AT3G22450.1CAACGGTCstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G08845.2); Has 216 Blast hits to 216 proteins in 58 species: Archae - 0; Bacteria - 58; Metazoa - 40; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT3G22840AT3G22840.1GACCGTTGEncodes an early light-inducible protein.
AT3G22970AT3G22970.1TTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G22970.2TTCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G23450AT3G23450.1CGGTTAAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages.
AT3G23600AT3G23600.1ACCGTTAGdienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: response to salt stress; LOCATED IN: apoplast, nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT3G23570.1); Has 675 Blast hits to 673 proteins in 155 species: Archae - 2; Bacteria - 132; Metazoa - 54; Fungi - 330; Plants - 132; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT3G23600.1ACCGTTAGdienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: response to salt stress; LOCATED IN: apoplast, nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT3G23570.1); Has 675 Blast hits to 673 proteins in 155 species: Archae - 2; Bacteria - 132; Metazoa - 54; Fungi - 330; Plants - 132; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT3G23600.2ACCGTTAGdienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: response to salt stress; LOCATED IN: apoplast, nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT3G23570.1); Has 675 Blast hits to 673 proteins in 155 species: Archae - 2; Bacteria - 132; Metazoa - 54; Fungi - 330; Plants - 132; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT3G23600.2ACCGTTAGdienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: response to salt stress; LOCATED IN: apoplast, nucleus, plasma membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT3G23570.1); Has 675 Blast hits to 673 proteins in 155 species: Archae - 2; Bacteria - 132; Metazoa - 54; Fungi - 330; Plants - 132; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT3G23750AT3G23750.1TTTAACGGleucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: TMK1 (TRANSMEMBRANE KINASE 1); transmembrane receptor protein serine/threonine kinase (TAIR:AT1G66150.1); Has 123032 Blast hits to 100120 proteins in 3534 species: Archae - 85; Bacteria - 9593; Metazoa - 49390; Fungi - 7521; Plants - 38429; Viruses - 417; Other Eukaryotes - 17597 (source: NCBI BLink).
AT3G23920AT3G23920.1CTTAACCGEncodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.
AT3G23930AT3G23930.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13540.1); Has 9839 Blast hits to 6470 proteins in 434 species: Archae - 58; Bacteria - 550; Metazoa - 4915; Fungi - 656; Plants - 186; Viruses - 86; Other Eukaryotes - 3388 (source: NCBI BLink).
AT3G23940AT3G23940.1ATAACCGGTTATdehydratase family; FUNCTIONS IN: catalytic activity, dihydroxy-acid dehydratase activity; INVOLVED IN: branched chain family amino acid biosynthetic process, isoleucine biosynthetic process, metabolic process, valine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dihydroxy-acid dehydratase (InterPro:IPR004404), Dihydroxy-acid and 6-phosphogluconate dehydratase (InterPro:IPR000581); Has 10437 Blast hits to 10433 proteins in 1298 species: Archae - 138; Bacteria - 4265; Metazoa - 2; Fungi - 197; Plants - 21; Viruses - 0; Other Eukaryotes - 5814 (source: NCBI BLink).
AT3G24150AT3G24150.1AACCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G24160AT3G24160.1ATAACCGGGTTEncodes a putative Type 1 membrane protein (PMP).
AT3G24315AT3G24315.1ATAACCGGGTTAtSec20; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sec20 (InterPro:IPR005606); Has 205 Blast hits to 205 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 64; Plants - 27; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT3G24490AT3G24490.1CGGTTAAAtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MADF domain (InterPro:IPR006578); BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 2488 Blast hits to 1665 proteins in 165 species: Archae - 0; Bacteria - 71; Metazoa - 1163; Fungi - 123; Plants - 222; Viruses - 36; Other Eukaryotes - 873 (source: NCBI BLink).
AT3G25070AT3G25070.1ATAAAGCCGCCTTTAACGGEncodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation.
AT3G25800AT3G25800.1TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit
AT3G25800.2TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit
AT3G25860AT3G25860.1ATCCGGTTATNuclear encoded dihydrolipoamide S-acetyltransferase (LTA2) that encodes teh Pyruvate Decarboxylase E2 subunit. Mutant has embryo defect.
AT3G25950AT3G25950.1ATCCAACGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: stem, male gametophyte, sepal, pedicel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: DNA-binding storekeeper protein-related (TAIR:AT5G14280.1); Has 41 Blast hits to 41 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G26020AT3G26020.1GACCGTTGGATserine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).
AT3G26020.2GACCGTTGGATserine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).
AT3G26020.3GACCGTTGGATserine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).
AT3G26020.4GACCGTTGGATserine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative (TAIR:AT1G13460.2).
AT3G26100AT3G26100.2CCGTTGGATregulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G15430.2); Has 13018 Blast hits to 3813 proteins in 266 species: Archae - 62; Bacteria - 1274; Metazoa - 6169; Fungi - 625; Plants - 1234; Viruses - 2; Other Eukaryotes - 3652 (source: NCBI BLink).
AT3G26170AT3G26170.1TTTAACCGputative cytochrome P450
AT3G26240AT3G26240.1TTTAACCGGDC1 domain-containing protein; INVOLVED IN: intracellular signaling cascade; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT3G26250.1); Has 1177 Blast hits to 494 proteins in 22 species: Archae - 0; Bacteria - 6; Metazoa - 8; Fungi - 2; Plants - 1157; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT3G26740AT3G26740.1CCGTTGGATtranscripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant.
AT3G26810AT3G26810.1ACCGTTAGAUXIN SIGNALING F-BOX 2 (AFB2); FUNCTIONS IN: auxin binding, ubiquitin-protein ligase activity; INVOLVED IN: stamen development, pollen maturation, response to molecule of bacterial origin; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AFB3 (AUXIN SIGNALING F-BOX 3); auxin binding / ubiquitin-protein ligase (TAIR:AT1G12820.1); Has 2003 Blast hits to 1306 proteins in 118 species: Archae - 0; Bacteria - 2; Metazoa - 844; Fungi - 94; Plants - 935; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT3G26810.1CAACGGTCAUXIN SIGNALING F-BOX 2 (AFB2); FUNCTIONS IN: auxin binding, ubiquitin-protein ligase activity; INVOLVED IN: stamen development, pollen maturation, response to molecule of bacterial origin; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AFB3 (AUXIN SIGNALING F-BOX 3); auxin binding / ubiquitin-protein ligase (TAIR:AT1G12820.1); Has 2003 Blast hits to 1306 proteins in 118 species: Archae - 0; Bacteria - 2; Metazoa - 844; Fungi - 94; Plants - 935; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT3G27260AT3G27260.1ACCGTTAGKinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain
AT3G27260.1CCGTTAAAKinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain
AT3G27300AT3G27300.1CTAACGGTglucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).
AT3G27300.2CTAACGGTglucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).
AT3G27300.3CTAACGGTglucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).
AT3G28715AT3G28715.1TTTAACCGGGTH+-transporting two-sector ATPase, putative; FUNCTIONS IN: hydrogen ion transmembrane transporter activity, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ATPase, V0/A0 complex, subunit C/D (InterPro:IPR002843), ATPase, V0 complex, subunit D (InterPro:IPR016727); BEST Arabidopsis thaliana protein match is: H+-transporting two-sector ATPase, putative (TAIR:AT3G28710.1); Has 448 Blast hits to 447 proteins in 191 species: Archae - 19; Bacteria - 1; Metazoa - 206; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G43520AT3G43520.1CCGGTTAAGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G26240.1); Has 432 Blast hits to 415 proteins in 105 species: Archae - 4; Bacteria - 70; Metazoa - 210; Fungi - 11; Plants - 99; Viruses - 7; Other Eukaryotes - 31 (source: NCBI BLink).
AT3G44100AT3G44100.1ACCGTTAGMD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT3G11780.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 77; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT3G44100.1GACCGTTGGATMD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT3G11780.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 77; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT3G44310AT3G44310.2TTTAACGGCGTMutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes.
AT3G44340AT3G44340.1ATAACCGGAThomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.
AT3G44340.2ATAACCGGAThomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.
AT3G44890AT3G44890.1TTTAACCGTTAAAPlastid ribosomal protein CL9
AT3G45630AT3G45630.1TTTAACCGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: protein binding, RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding / protein binding / zinc ion binding (TAIR:AT5G60170.1); Has 1885 Blast hits to 933 proteins in 202 species: Archae - 0; Bacteria - 444; Metazoa - 427; Fungi - 276; Plants - 89; Viruses - 2; Other Eukaryotes - 647 (source: NCBI BLink).
AT3G46020AT3G46020.1CTAACGGTRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink).
AT3G46020.1GCCCGTTAAARNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink).
AT3G46030AT3G46030.1CTAACGGTHTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink).
AT3G46030.1GCCCGTTAAAHTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink).
AT3G46040AT3G46040.1TTTAACGGGCRegulated by TCP20.
AT3G46100AT3G46100.1TTTAACCGGAChistidyl-tRNA synthetase
AT3G46510AT3G46510.1TAACCGGTCEncodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT3G46630AT3G46630.1CCGTTGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: defective chloroplasts and leaves protein-related / DCL protein-related (TAIR:AT1G45230.1); Has 102 Blast hits to 102 proteins in 23 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT3G47000AT3G47000.1ACCGGTTAAglycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G47010.1); Has 6353 Blast hits to 5926 proteins in 906 species: Archae - 20; Bacteria - 3224; Metazoa - 6; Fungi - 919; Plants - 287; Viruses - 0; Other Eukaryotes - 1897 (source: NCBI BLink).
AT3G47000.1CCGTTAAACGCTGglycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G47010.1); Has 6353 Blast hits to 5926 proteins in 906 species: Archae - 20; Bacteria - 3224; Metazoa - 6; Fungi - 919; Plants - 287; Viruses - 0; Other Eukaryotes - 1897 (source: NCBI BLink).
AT3G47070AT3G47070.1ATCCAACGGunknown protein; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G47340AT3G47340.1ATCCGGTTAencodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.
AT3G47340.2ATCCGGTTAencodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.
AT3G47340.3ATCCGGTTAencodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.
AT3G47390AT3G47390.1CCGTTAAAcytidine/deoxycytidylate deaminase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: riboflavin biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02464 (InterPro:IPR012816), CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193), Riboflavin-specific deaminase, C-terminal (InterPro:IPR011549), Bacterial bifunctional deaminase-reductase, C-terminal (InterPro:IPR002734), Riboflavin biosynthesis protein RibD (InterPro:IPR004794); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT4G20960.1); Has 5155 Blast hits to 5155 proteins in 1224 species: Archae - 129; Bacteria - 2674; Metazoa - 23; Fungi - 93; Plants - 54; Viruses - 14; Other Eukaryotes - 2168 (source: NCBI BLink).
AT3G47450AT3G47450.1TTCCGGTTATEncodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. In Arabidopsis, mutant analyses show that this protein regulates growth and hormonal signaling in plants. It also attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence and cell death. This gene product is also involved in nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts.
AT3G47450.2TTCCGGTTATEncodes a protein with similarity to the bacterial YqeH GTPase required for proper ribosome assembly. In Arabidopsis, mutant analyses show that this protein regulates growth and hormonal signaling in plants. It also attenuates oxidative stress and reactive oxygen species (ROS). It also seems to be involved in regulating leaf senescence and cell death. This gene product is also involved in nitric oxide biosynthesis in response to ABA but not exogenous H2O2. This protein also appears to be required for proper plastid biogenesis. Levels of several plastid-localized proteins, including RBCL, ClpP1, and the MEP biosynthesis enzymes DXS and DXR are altered in rif1-1 mutants. This protein was originally characterized as a mitrochondrial-localized nitric oxide synthase, but, the synthase activity was later disproven. In addition, new studies with GFP fusion proteins and chloroplast import assays suggest that this protein is found in chloroplasts.
AT3G47470AT3G47470.1ATCCAACGGEncodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins.
AT3G47550AT3G47550.1CCGTTAAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to salt stress; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G62460.1); Has 1346 Blast hits to 1345 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 706; Fungi - 79; Plants - 322; Viruses - 29; Other Eukaryotes - 210 (source: NCBI BLink).
AT3G47550.2CCGTTAAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to salt stress; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G62460.1); Has 1346 Blast hits to 1345 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 706; Fungi - 79; Plants - 322; Viruses - 29; Other Eukaryotes - 210 (source: NCBI BLink).
AT3G47550.3CCGTTAAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to salt stress; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G62460.1); Has 1346 Blast hits to 1345 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 706; Fungi - 79; Plants - 322; Viruses - 29; Other Eukaryotes - 210 (source: NCBI BLink).
AT3G47550.6CCGTTAAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to salt stress; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G62460.1); Has 1346 Blast hits to 1345 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 706; Fungi - 79; Plants - 322; Viruses - 29; Other Eukaryotes - 210 (source: NCBI BLink).
AT3G47650AT3G47650.1AAAACCGGTTAAbundle-sheath defective protein 2 family / bsd2 family; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 47 Blast hits to 47 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT3G47836AT3G47836.1CCGTTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G47836.2CCGTTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G48000AT3G48000.1CCGTTGGATEncodes a putative (NAD+) aldehyde dehydrogenase.
AT3G48890AT3G48890.1CAACGGTCputative progesterone-binding protein homolog (Atmp2) mRNA,
AT3G49260AT3G49260.1AACGGCGTTTAACCGAACCCCACGTGACIQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT3G49260.2AACGGCGTTTAACCGAACCCCACGTGACIQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT3G49540AT3G49540.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; Has 8326 Blast hits to 4596 proteins in 687 species: Archae - 16; Bacteria - 1991; Metazoa - 1984; Fungi - 842; Plants - 266; Viruses - 74; Other Eukaryotes - 3153 (source: NCBI BLink).
AT3G50630AT3G50630.1TTTAACGGKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation.
AT3G50670AT3G50670.1ATCCGGTTAEncodes U1 snRNP 70K
AT3G50670.2ATCCGGTTAEncodes U1 snRNP 70K
AT3G50690AT3G50690.1ATCCAACGGTTTATleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink).
AT3G51240AT3G51240.1CCGTTAAAEncodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and chalcone isomerases. Regulates flavonoid biosynthesis.
AT3G51280AT3G51280.1CAACGGTCmale sterility MS5, putative; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATSDI1 (SULPHUR DEFICIENCY-INDUCED 1); binding (TAIR:AT5G48850.1); Has 753 Blast hits to 582 proteins in 92 species: Archae - 6; Bacteria - 185; Metazoa - 0; Fungi - 1; Plants - 101; Viruses - 0; Other Eukaryotes - 460 (source: NCBI BLink).
AT3G51440AT3G51440.1GTCCGGTTAstrictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).
AT3G51440.1TTTAACCGstrictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 1156 Blast hits to 1151 proteins in 269 species: Archae - 13; Bacteria - 456; Metazoa - 195; Fungi - 19; Plants - 279; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).
AT3G51500AT3G51500.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G51510AT3G51510.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G51720AT3G51720.1ATCCAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38370.1); Has 5187 Blast hits to 4108 proteins in 541 species: Archae - 110; Bacteria - 625; Metazoa - 2648; Fungi - 294; Plants - 305; Viruses - 9; Other Eukaryotes - 1196 (source: NCBI BLink).
AT3G51720.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38370.1); Has 5187 Blast hits to 4108 proteins in 541 species: Archae - 110; Bacteria - 625; Metazoa - 2648; Fungi - 294; Plants - 305; Viruses - 9; Other Eukaryotes - 1196 (source: NCBI BLink).
AT3G51800AT3G51800.1TGACGTGGGCTTATATGGGCCCGGTTAAGGGTAputative nuclear DNA-binding protein G2p (AtG2) mRNA,
AT3G51800.2TGACGTGGGCTTATATGGGCCCGGTTAAGGGTAputative nuclear DNA-binding protein G2p (AtG2) mRNA,
AT3G51840AT3G51840.1CCGACTTAACCGGGTCGGEncodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis.
AT3G51880AT3G51880.1CTTAACCGGEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G51880.2CTTAACCGGEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G51880.3CTTAACCGGEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G52155AT3G52155.1CAACGGTCLOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); Has 1050 Blast hits to 1050 proteins in 239 species: Archae - 0; Bacteria - 476; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 552 (source: NCBI BLink).
AT3G52480AT3G52480.1AAATGGGCCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G52610AT3G52610.1CTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 38 Blast hits to 37 proteins in 11 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G52730AT3G52730.1CCGTTAAAubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G52880AT3G52880.1CAACGGTCEncodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2
AT3G52880.2CAACGGTCEncodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2
AT3G52930AT3G52930.1ATCCAACGGfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, response to salt stress, pentose-phosphate shunt; LOCATED IN: in 7 components; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4403 Blast hits to 4398 proteins in 740 species: Archae - 0; Bacteria - 427; Metazoa - 1257; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2378 (source: NCBI BLink).
AT3G53210AT3G53210.1CCGGTTAAnodulin MtN21 family protein; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT1G75500.1); Has 2469 Blast hits to 2459 proteins in 336 species: Archae - 6; Bacteria - 855; Metazoa - 4; Fungi - 0; Plants - 649; Viruses - 0; Other Eukaryotes - 955 (source: NCBI BLink).
AT3G53235AT3G53235.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT3G53320AT3G53320.1ATCCAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37070.1); Has 10077 Blast hits to 5050 proteins in 411 species: Archae - 0; Bacteria - 1106; Metazoa - 4046; Fungi - 1512; Plants - 226; Viruses - 108; Other Eukaryotes - 3079 (source: NCBI BLink).
AT3G53380AT3G53380.1CCGTTGGAlectin protein kinase family protein; FUNCTIONS IN: carbohydrate binding, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase-related (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: lectin protein kinase family protein (TAIR:AT5G03140.1); Has 89055 Blast hits to 87935 proteins in 3185 species: Archae - 51; Bacteria - 7859; Metazoa - 38715; Fungi - 7038; Plants - 19887; Viruses - 400; Other Eukaryotes - 15105 (source: NCBI BLink).
AT3G53470AT3G53470.1CCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G53470.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G53470.2CCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G53470.2TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G53710AT3G53710.1CCGTTAAAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT3G53710.2CCGTTAAAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT3G53730AT3G53730.1ATCCAACGGTChistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2716 Blast hits to 2716 proteins in 361 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 282; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT3G53740AT3G53740.1CGGTTAAG60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).
AT3G53740.2CGGTTAAG60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).
AT3G53740.3CGGTTAAG60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).
AT3G53740.4CGGTTAAG60S ribosomal protein L36 (RPL36B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36A) (TAIR:AT2G37600.2); Has 586 Blast hits to 586 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink).
AT3G53750AT3G53750.1CTTAACCGMember of the Actin gene family. Expressed in mature pollen.
AT3G53800AT3G53800.1CTTAACCGarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 461 Blast hits to 458 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 134; Plants - 93; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT3G53890AT3G53890.1TTCCGGTTA40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).
AT3G53890.2TTCCGGTTA40S ribosomal protein S21 (RPS21B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S21e (InterPro:IPR001931), Ribosomal protein S21e, conserved site (InterPro:IPR018279); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT5G27700.1); Has 478 Blast hits to 478 proteins in 194 species: Archae - 0; Bacteria - 0; Metazoa - 224; Fungi - 90; Plants - 74; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).
AT3G54560AT3G54560.1TTTAACCGEncodes HTA11, a histone H2A protein.
AT3G54690AT3G54690.1CCGTTAAAsugar isomerase (SIS) domain-containing protein / CBS domain-containing protein; FUNCTIONS IN: isomerase activity, sugar binding; INVOLVED IN: carbohydrate metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: KpsF/GutQ (InterPro:IPR004800), Sugar isomerase (SIS) (InterPro:IPR001347), Cystathionine beta-synthase, core (InterPro:IPR000644); Has 5872 Blast hits to 5870 proteins in 1010 species: Archae - 105; Bacteria - 3081; Metazoa - 10; Fungi - 90; Plants - 20; Viruses - 2; Other Eukaryotes - 2564 (source: NCBI BLink).
AT3G54840AT3G54840.1CGGTTAAAEncodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome.
AT3G54840.2CGGTTAAAEncodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome.
AT3G54850AT3G54850.1TTTAACGGEncodes a protein with ubiquitin ligase activity.
AT3G55050AT3G55050.1CCGTTAAAGTCAAserine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).
AT3G55050.2CCGTTAAAGTCAAserine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).
AT3G55140AT3G55140.1CCGTTAAApectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).
AT3G55140.2CCGTTAAApectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G09540.1); Has 992 Blast hits to 988 proteins in 172 species: Archae - 0; Bacteria - 486; Metazoa - 0; Fungi - 93; Plants - 380; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).
AT3G55660AT3G55660.1TTTAACGGEncodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT3G55850AT3G55850.1TAACGGGCTTTAEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.
AT3G55850.1TTCCGGTTATGACCGGTTEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.
AT3G55850.1TTTAACGGEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.
AT3G55850.1TTTCCGGTTATEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.
AT3G56110AT3G56110.1CTAACGGTGTCGTTTTPRENYLATED RAB ACCEPTOR 1.B1 (PRA1.B1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.B2 (PRENYLATED RAB ACCEPTOR 1.B2) (TAIR:AT2G40380.1); Has 388 Blast hits to 388 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 73; Plants - 185; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT3G56360AT3G56360.1ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G05250.1); Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G56460AT3G56460.1ATCCAACGGoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 27533 Blast hits to 27426 proteins in 1649 species: Archae - 279; Bacteria - 14496; Metazoa - 1760; Fungi - 2501; Plants - 878; Viruses - 3; Other Eukaryotes - 7616 (source: NCBI BLink).
AT3G57110AT3G57110.1CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G60370.1); Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G57340AT3G57340.1TAACCGGAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink).
AT3G57340.2TAACCGGAADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Protein of unknown function DUF1977, DnaJ-like (InterPro:IPR015399), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G05750.1); Has 16943 Blast hits to 16932 proteins in 1979 species: Archae - 123; Bacteria - 5258; Metazoa - 3696; Fungi - 1547; Plants - 1286; Viruses - 20; Other Eukaryotes - 5013 (source: NCBI BLink).
AT3G57470AT3G57470.1CCGTTGGATpeptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink).
AT3G57470.1CCGTTGGATpeptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink).
AT3G57470.2CCGTTGGATpeptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink).
AT3G57470.2CCGTTGGATpeptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 1962 Blast hits to 1906 proteins in 499 species: Archae - 0; Bacteria - 815; Metazoa - 327; Fungi - 126; Plants - 77; Viruses - 0; Other Eukaryotes - 617 (source: NCBI BLink).
AT3G57800AT3G57800.1ACCGGTTAAAGCCCAAAAGGCCCAAGbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G57800.2ACCGGTTAAAGCCCAAAAGGCCCAAGbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G58090AT3G58090.1TTTAACGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein (TAIR:AT1G65870.1).
AT3G58620AT3G58620.1TTTAACGGTetratricopetide-repeat Thioredoxin-Like 4 (TTL4); FUNCTIONS IN: binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Tetratricopeptide TPR-1 (InterPro:IPR001440), Thioredoxin fold (InterPro:IPR012335), Tetratricopeptide-like helical (InterPro:IPR011990), Thioredoxin domain (InterPro:IPR013766), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: TTL3 (TETRATRICOPETIDE-REPEAT THIOREDOXIN-LIKE 3); binding / protein binding (TAIR:AT2G42580.1); Has 16554 Blast hits to 9684 proteins in 742 species: Archae - 566; Bacteria - 4295; Metazoa - 4899; Fungi - 1375; Plants - 1338; Viruses - 3; Other Eukaryotes - 4078 (source: NCBI BLink).
AT3G58900AT3G58900.1ATAACCGGTCF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G58900.2ATAACCGGTCF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G58900.3ATAACCGGTCF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G58860.1); Has 1272 Blast hits to 1243 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 1261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G59010AT3G59010.1TAACGGGCpectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: ATPMEPCRD; enzyme inhibitor/ pectinesterase (TAIR:AT2G43050.1); Has 1273 Blast hits to 1240 proteins in 183 species: Archae - 0; Bacteria - 250; Metazoa - 1; Fungi - 133; Plants - 888; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G59070AT3G59070.1GACCGGTTATauxin-responsive protein, putative; INVOLVED IN: multicellular organismal development; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT5G48750.1); Has 350 Blast hits to 350 proteins in 61 species: Archae - 0; Bacteria - 4; Metazoa - 80; Fungi - 13; Plants - 243; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT3G59280AT3G59280.1CAACGGTCmutant exhibited resistance to growth on media containing thaxtomin due to a difference in the rate of uptake of the toxin.We proposed that TXR1 is a component of, or regulator of, a dispensable transport mechanism.
AT3G59970AT3G59970.1ACCGGTTAmethylenetetrahydrofolate reductase MTHFR1 mRNA, complete
AT3G59970.2ACCGGTTAmethylenetetrahydrofolate reductase MTHFR1 mRNA, complete
AT3G59970.3ACCGGTTAmethylenetetrahydrofolate reductase MTHFR1 mRNA, complete
AT3G60180AT3G60180.1ACCGTTAGuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60180.2ACCGTTAGuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60690AT3G60690.1ATCCAACGGauxin-responsive family protein; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein-related (TAIR:AT2G45210.1); Has 696 Blast hits to 685 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 695; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G60750AT3G60750.1ATCCAACGGTCtransketolase, putative; FUNCTIONS IN: catalytic activity, transketolase activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial transketolase (InterPro:IPR005478), Transketolase, N-terminal (InterPro:IPR005474), Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: transketolase, putative (TAIR:AT2G45290.1); Has 13810 Blast hits to 13750 proteins in 1529 species: Archae - 132; Bacteria - 6298; Metazoa - 281; Fungi - 206; Plants - 110; Viruses - 0; Other Eukaryotes - 6783 (source: NCBI BLink).
AT3G61060AT3G61060.1CGGTTAAAArabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G61060.2CGGTTAAAArabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G61260AT3G61260.1TTTAACCGDNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink).
AT3G61430AT3G61430.1CGGTTAAAa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT3G61430.2CGGTTAAAa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT3G62020AT3G62020.2CGGTTAAAgermin-like protein (GLP10)
AT3G62220AT3G62220.1CGGTTAAGserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G47060.2); Has 82520 Blast hits to 81517 proteins in 3289 species: Archae - 50; Bacteria - 7570; Metazoa - 36328; Fungi - 6173; Plants - 18156; Viruses - 365; Other Eukaryotes - 13878 (source: NCBI BLink).
AT3G62260AT3G62260.1ACCGGTTAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).
AT3G62260.2ACCGGTTAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).
AT3G62710AT3G62710.1CCGTTGGAglycosyl hydrolase family 3 protein; FUNCTIONS IN: xylan 1,4-beta-xylosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 3 protein (TAIR:AT5G20950.2); Has 6428 Blast hits to 6087 proteins in 963 species: Archae - 22; Bacteria - 3408; Metazoa - 6; Fungi - 874; Plants - 276; Viruses - 0; Other Eukaryotes - 1842 (source: NCBI BLink).
AT3G62907AT3G62907.1TTTAACCGunknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT3G63140AT3G63140.1GACCGTTGGATEncodes a protein with ribonuclease activity that is involved in plastid rRNA maturation.
AT4G00335AT4G00335.1CTTAACCGACGTCGTRHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink).
AT4G00335.2CTTAACCGACGTCGTRHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink).
AT4G00335.3CTTAACCGACGTCGTRHB1A; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G41350.1); Has 3768 Blast hits to 3762 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 1338; Fungi - 286; Plants - 1392; Viruses - 4; Other Eukaryotes - 748 (source: NCBI BLink).
AT4G00570AT4G00570.1CTAACGGTmalate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: oxidation reduction, malate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT2G13560.1); Has 5867 Blast hits to 5857 proteins in 1333 species: Archae - 86; Bacteria - 3255; Metazoa - 553; Fungi - 155; Plants - 271; Viruses - 0; Other Eukaryotes - 1547 (source: NCBI BLink).
AT4G00990AT4G00990.1TTTAACCGGTtranscription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: protein binding, transcription factor activity, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G62310.1); Has 700 Blast hits to 466 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 459; Fungi - 31; Plants - 147; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT4G01060AT4G01060.1CCGTTGGACCGTTGEncodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering.
AT4G01060.2CCGTTGGACCGTTGEncodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering.
AT4G01060.3CCGTTGGACCGTTGEncodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering.
AT4G01400AT4G01400.2ATAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink).
AT4G01560AT4G01560.1GCCCGTTAmaternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT4G01570AT4G01570.1TAACGGGCpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink).
AT4G01810AT4G01810.1TTTAACCGprotein transport protein-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895); BEST Arabidopsis thaliana protein match is: transport protein, putative (TAIR:AT2G21630.1); Has 7526 Blast hits to 4938 proteins in 507 species: Archae - 16; Bacteria - 861; Metazoa - 2084; Fungi - 961; Plants - 2123; Viruses - 449; Other Eukaryotes - 1032 (source: NCBI BLink).
AT4G02195AT4G02195.1TAACCGGTCmember of SYP4 Gene Family
AT4G02200AT4G02200.1GACCGGTTAdrought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1).
AT4G02200.2GACCGGTTAdrought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1).
AT4G02200.3GACCGGTTAdrought-responsive family protein; INVOLVED IN: response to water deprivation; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G02750.1).
AT4G02460AT4G02460.1TAACGGGCEncodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination.
AT4G02500AT4G02500.1CAACGGTCEncodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides.
AT4G02580AT4G02580.1TCCAACGGNADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae - 12; Bacteria - 1956; Metazoa - 160; Fungi - 76; Plants - 28; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT4G02890AT4G02890.1ATAACCGGPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.2ATAACCGGPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.3ATAACCGGPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.4ATAACCGGPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G03100AT4G03100.1GACCGTTGrac GTPase activating protein, putative; FUNCTIONS IN: Rac GTPase activator activity; INVOLVED IN: signal transduction; LOCATED IN: intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: PAK-box/P21-Rho-binding (InterPro:IPR000095), Rho GTPase activation protein (InterPro:IPR008936), RhoGAP (InterPro:IPR000198); BEST Arabidopsis thaliana protein match is: rac GTPase activating protein, putative (TAIR:AT2G46710.1); Has 3126 Blast hits to 3120 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 2422; Fungi - 299; Plants - 105; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink).
AT4G03330AT4G03330.1CGGTTAAGTGGGCTmember of SYP12 Gene Family
AT4G03380AT4G03380.1TTTCCGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: NAF1 (NUCLEAR ASSEMBLY FACTOR 1) (TAIR:AT1G03530.1); Has 13 Blast hits to 13 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G03390AT4G03390.1CGGTTTAGACCCGGTTAASTRUBBELIG-RECEPTOR FAMILY 3 (SRF3); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF1 (strubbelig receptor family 1); kinase (TAIR:AT2G20850.1); Has 104562 Blast hits to 78934 proteins in 2893 species: Archae - 52; Bacteria - 7276; Metazoa - 35203; Fungi - 5374; Plants - 43078; Viruses - 296; Other Eukaryotes - 13283 (source: NCBI BLink).
AT4G03410AT4G03410.1ACCGGTTATperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).
AT4G03410.1TTTAACCGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).
AT4G03410.2ACCGGTTATperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).
AT4G03410.2TTTAACCGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT1G52870.2); Has 960 Blast hits to 960 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 502; Fungi - 220; Plants - 169; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink).
AT4G03430AT4G03430.1CTAACGGTEncodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes.
AT4G04850AT4G04850.1ATAACCGGTTAACGGTTTAAmember of Putative potassium transporter family
AT4G04870AT4G04870.1TTCCGGTTAAEncodes a protein with cardiolipin synthase activity that is localized to the mitochondiria.
AT4G04955AT4G04955.1CTAACGGTEncodes an allantoinase which is involved in allantoin degradation and assimilation. Gene expression was induced when allantoin was added to the medium. The insertion mutant, ataln m2-1, did not grow well on the MS medium where allantoin, instead of ammonium nitrate, was supplied.
AT4G05070AT4G05070.1ATCCAACGGAAAACGACACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G05180AT4G05180.1TTTAACCGEncodes the PsbQ subunit of the oxygen evolving complex of photosystem II.
AT4G05320AT4G05320.1ACCGTTAGOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.2ACCGTTAGOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.3ACCGTTAGOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.4ACCGTTAGOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.5ACCGTTAGOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.6ACCGTTAGOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05410AT4G05410.1GTCCGGTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink).
AT4G07390AT4G07390.1TTTAACGGPQ-loop repeat family protein / transmembrane family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Mannose-P-dolichol utilization defect 1 protein (InterPro:IPR016817); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT5G59470.1); Has 451 Blast hits to 449 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 81; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT4G08170AT4G08170.2ACCGTTAGinositol 1,3,4-trisphosphate 5/6-kinase family protein; FUNCTIONS IN: magnesium ion binding, inositol-1,3,4-trisphosphate 5/6-kinase activity, catalytic activity, ATP binding, inositol tetrakisphosphate 1-kinase activity; INVOLVED IN: response to wounding; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Inositol-tetrakisphosphate 1-kinase (InterPro:IPR017427), Inositol 1, 3, 4-trisphosphate 56-kinase (InterPro:IPR008656), ATP-grasp fold (InterPro:IPR011761); BEST Arabidopsis thaliana protein match is: inositol 1,3,4-trisphosphate 5/6-kinase family protein (TAIR:AT4G33770.1); Has 285 Blast hits to 285 proteins in 54 species: Archae - 0; Bacteria - 2; Metazoa - 78; Fungi - 0; Plants - 170; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT4G08310AT4G08310.1TTTAACCGAACCCGACCCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink).
AT4G09200AT4G09200.1ACCGGTTAASPla/RYanodine receptor (SPRY) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: B302 (SPRY)-like (InterPro:IPR001870), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144), SPla/RYanodine receptor SPRY (InterPro:IPR003877); BEST Arabidopsis thaliana protein match is: SPla/RYanodine receptor (SPRY) domain-containing protein (TAIR:AT4G09310.1); Has 620 Blast hits to 608 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 119; Plants - 93; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink).
AT4G09510AT4G09510.1ACCGGTTAAbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT4G09510.1CTTAACCGGTbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT4G09510.2ACCGGTTAAbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT4G09510.2CTTAACCGGTbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: CINV1 (cytosolic invertase 1); beta-fructofuranosidase (TAIR:AT1G35580.2); Has 527 Blast hits to 526 proteins in 78 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 174; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT4G10080AT4G10080.1TTTAACCGunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G13530.1); Has 73 Blast hits to 67 proteins in 15 species: Archae - 2; Bacteria - 1; Metazoa - 0; Fungi - 12; Plants - 54; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT4G10120AT4G10120.1TTTAACGGEncodes a protein with putative sucrose-phosphate synthase activity.
AT4G10120.2TTTAACGGEncodes a protein with putative sucrose-phosphate synthase activity.
AT4G10380AT4G10380.1ATCCAACGGEssential for efficient Boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance.
AT4G10610AT4G10610.1CGGTTAAARNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif).
AT4G10610.2CGGTTAAARNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif).
AT4G11130AT4G11130.1CAACGGTCEncodes RNA-dependent RNA polymerase that is required for endogenous siRNA (but not miRNA) formation. Nomenclature according to Xie, et al. (2004).
AT4G11130.1TCCGGTTAEncodes RNA-dependent RNA polymerase that is required for endogenous siRNA (but not miRNA) formation. Nomenclature according to Xie, et al. (2004).
AT4G11380AT4G11380.1ATCGGCCCGTTAbeta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink).
AT4G12040AT4G12040.1ATCCAACGGzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G22820.2); Has 767 Blast hits to 766 proteins in 111 species: Archae - 2; Bacteria - 0; Metazoa - 379; Fungi - 2; Plants - 271; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink).
AT4G12040.2ATCCAACGGzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G22820.2); Has 767 Blast hits to 766 proteins in 111 species: Archae - 2; Bacteria - 0; Metazoa - 379; Fungi - 2; Plants - 271; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink).
AT4G12310AT4G12310.1TTTAACGGmember of CYP706A
AT4G12720AT4G12720.1CGGTTAAAEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death.
AT4G12720.2CGGTTAAAEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death.
AT4G12720.3CGGTTAAAEncodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death.
AT4G12960AT4G12960.1CTAACGGTgamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911); BEST Arabidopsis thaliana protein match is: gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein (TAIR:AT4G12900.1).
AT4G12960.2CTAACGGTgamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911); BEST Arabidopsis thaliana protein match is: gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein (TAIR:AT4G12900.1).
AT4G13180AT4G13180.1GACCGTTGshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: response to arsenic; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G03980.1); Has 81708 Blast hits to 81560 proteins in 2189 species: Archae - 473; Bacteria - 45253; Metazoa - 5067; Fungi - 4039; Plants - 1546; Viruses - 2; Other Eukaryotes - 25328 (source: NCBI BLink).
AT4G13270AT4G13270.1ATCCAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52330.1); Has 109 Blast hits to 109 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 109; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G13770AT4G13770.1CGGTTAAGTTCGGTTTEncodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis.
AT4G13780AT4G13780.1CTTAACCGGATmethionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative; FUNCTIONS IN: methionine-tRNA ligase activity, tRNA binding, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, methionyl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413), Methionyl-tRNA synthetase, class Ia (InterPro:IPR002304), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methionyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR014758), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: tRNA-binding region domain-containing protein (TAIR:AT2G40660.1); Has 12421 Blast hits to 12391 proteins in 1665 species: Archae - 324; Bacteria - 5389; Metazoa - 513; Fungi - 358; Plants - 127; Viruses - 3; Other Eukaryotes - 5707 (source: NCBI BLink).
AT4G13940AT4G13940.1GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.2GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.3GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.4GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G14210AT4G14210.1CCGTTAAAEncodes phytoene desaturase (phytoene dehydrogenase), an enzyme that catalyzes the desaturation of phytoene to zeta-carotene during carotenoid biosynthesis. Processed protein is localized to the plastid.
AT4G14210.2CCGTTAAAEncodes phytoene desaturase (phytoene dehydrogenase), an enzyme that catalyzes the desaturation of phytoene to zeta-carotene during carotenoid biosynthesis. Processed protein is localized to the plastid.
AT4G14270AT4G14270.1ATAACCGGATProtein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.
AT4G14270.2ATAACCGGATProtein containing PAM2 motif which mediates interaction with the PABC domain of polyadenyl binding proteins.
AT4G14300AT4G14300.1GACCGTTGheterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: heterogeneous nuclear ribonucleoprotein, putative / hnRNP, putative (TAIR:AT2G33410.1); Has 82956 Blast hits to 37358 proteins in 1472 species: Archae - 56; Bacteria - 18252; Metazoa - 33610; Fungi - 7047; Plants - 9752; Viruses - 546; Other Eukaryotes - 13693 (source: NCBI BLink).
AT4G14540AT4G14540.1GAACCGGTTATNUCLEAR FACTOR Y, SUBUNIT B3 (NF-YB3); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB2 (NUCLEAR FACTOR Y, SUBUNIT B2); transcription factor (TAIR:AT5G47640.1); Has 1011 Blast hits to 1011 proteins in 186 species: Archae - 0; Bacteria - 1; Metazoa - 394; Fungi - 233; Plants - 298; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).
AT4G14560AT4G14560.1GACCGTTGauxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein.
AT4G14600AT4G14600.1ATCCAACGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G14600.1TTTAACCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G14880AT4G14880.1TTAACCGGACEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA.
AT4G14880.2TTAACCGGACEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA.
AT4G14960AT4G14960.1TTCCGGTTAAGEncodes an alpha-tubulin isoform required for right handed helical growth.
AT4G14960.2TTCCGGTTAAGEncodes an alpha-tubulin isoform required for right handed helical growth.
AT4G15520AT4G15520.1ACCGGTTATtRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 4370 Blast hits to 4370 proteins in 1038 species: Archae - 9; Bacteria - 2930; Metazoa - 62; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1322 (source: NCBI BLink).
AT4G15520.1TGAACCGGTTAAtRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 4370 Blast hits to 4370 proteins in 1038 species: Archae - 9; Bacteria - 2930; Metazoa - 62; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1322 (source: NCBI BLink).
AT4G15830AT4G15830.1CAACGGTCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT4G15830.1GACCGTTGGAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT3G01450.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT4G15840AT4G15840.1GACCGTTGprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT4G15840.1TCCAACGGTCprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), BTB/POZ fold (InterPro:IPR011333), Kelch related (InterPro:IPR013089), BTB/POZ-like (InterPro:IPR000210); Has 305 Blast hits to 303 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 265; Fungi - 12; Plants - 22; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT4G15955AT4G15955.1ACCGGTTAepoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).
AT4G15955.2ACCGGTTAepoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).
AT4G15955.3ACCGGTTAepoxide hydrolase-related; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: catalytic/ epoxide hydrolase (TAIR:AT4G15960.1).
AT4G17060AT4G17060.1CTTAACCGGTEncodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time.
AT4G17140AT4G17140.1ACCGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G48090.2).
AT4G17140.2ACCGGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G48090.2).
AT4G17240AT4G17240.1CCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 43 Blast hits to 43 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT4G17310AT4G17310.1ATCCGGTTAAGunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47455.7); Has 115 Blast hits to 115 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G17310.2ATCCGGTTAAGunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47455.7); Has 115 Blast hits to 115 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G17330AT4G17330.1TTTAACGGgene of unknown function expressed in seedlings, flower buds and stems
AT4G17510AT4G17510.1CCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17520AT4G17520.1TAACGGGCCCGGCCCAATAAnuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 13357 Blast hits to 8375 proteins in 750 species: Archae - 13; Bacteria - 2605; Metazoa - 5274; Fungi - 1340; Plants - 1789; Viruses - 136; Other Eukaryotes - 2200 (source: NCBI BLink).
AT4G17840AT4G17840.1ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 1905 Blast hits to 183 proteins in 52 species: Archae - 0; Bacteria - 24; Metazoa - 708; Fungi - 70; Plants - 25; Viruses - 2; Other Eukaryotes - 1076 (source: NCBI BLink).
AT4G17840.1ATCCAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 1905 Blast hits to 183 proteins in 52 species: Archae - 0; Bacteria - 24; Metazoa - 708; Fungi - 70; Plants - 25; Viruses - 2; Other Eukaryotes - 1076 (source: NCBI BLink).
AT4G17940AT4G17940.1ATCCAACGGTCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G20190.1); Has 378 Blast hits to 251 proteins in 46 species: Archae - 2; Bacteria - 99; Metazoa - 16; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT4G18570AT4G18570.1TCCAACGGTCproline-rich family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: CHUP1 (CHLOROPLAST UNUSUAL POSITIONING 1) (TAIR:AT3G25690.1); Has 38999 Blast hits to 20613 proteins in 981 species: Archae - 88; Bacteria - 4167; Metazoa - 15425; Fungi - 4272; Plants - 8442; Viruses - 1480; Other Eukaryotes - 5125 (source: NCBI BLink).
AT4G18593AT4G18593.1GTCCGGTTAAACCGGdual specificity protein phosphatase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 272 Blast hits to 272 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 76; Plants - 42; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT4G18810AT4G18810.1ACCGGTTAATTAAACCGGAAAbinding / catalytic/ transcription repressor; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NADH:ubiquinone oxidoreductase complex I intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor (TAIR:AT1G16720.1); Has 1715 Blast hits to 1540 proteins in 261 species: Archae - 12; Bacteria - 728; Metazoa - 8; Fungi - 25; Plants - 255; Viruses - 0; Other Eukaryotes - 687 (source: NCBI BLink).
AT4G18810.1TCCAACGGbinding / catalytic/ transcription repressor; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NADH:ubiquinone oxidoreductase complex I intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor (TAIR:AT1G16720.1); Has 1715 Blast hits to 1540 proteins in 261 species: Archae - 12; Bacteria - 728; Metazoa - 8; Fungi - 25; Plants - 255; Viruses - 0; Other Eukaryotes - 687 (source: NCBI BLink).
AT4G19070AT4G19070.1ACCGGTTATcadmium-responsive protein / cadmium induced protein (AS8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 110 Blast hits to 61 proteins in 24 species: Archae - 2; Bacteria - 7; Metazoa - 10; Fungi - 0; Plants - 32; Viruses - 47; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G19150AT4G19150.1ATAACCGGankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT3G09890.1); Has 67868 Blast hits to 22594 proteins in 807 species: Archae - 53; Bacteria - 4070; Metazoa - 36594; Fungi - 4728; Plants - 2294; Viruses - 864; Other Eukaryotes - 19265 (source: NCBI BLink).
AT4G19150.2ATAACCGGankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT3G09890.1); Has 67868 Blast hits to 22594 proteins in 807 species: Archae - 53; Bacteria - 4070; Metazoa - 36594; Fungi - 4728; Plants - 2294; Viruses - 864; Other Eukaryotes - 19265 (source: NCBI BLink).
AT4G19600AT4G19600.1TTTAACGGEncodes a cyclin T partner CYCT1;4. Plays important roles in infection with Cauliflower mosaic virus (CaMV).
AT4G19985AT4G19985.1ATAACCGGATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT4G19985.1ATAACCGGATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT4G19985.1TCCGGTTATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: ATNSI (NUCLEAR SHUTTLE INTERACTING); N-acetyltransferase (TAIR:AT1G32070.3); Has 192 Blast hits to 192 proteins in 68 species: Archae - 6; Bacteria - 114; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT4G20330AT4G20330.1TAACCGGAtranscription initiation factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor TFIIE, beta subunit (InterPro:IPR016656), Transcription factor TFIIE beta subunit-like, DNA-binding (InterPro:IPR017935); BEST Arabidopsis thaliana protein match is: transcription initiation factor-related (TAIR:AT4G21010.1); Has 212 Blast hits to 212 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 68; Plants - 35; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT4G20960AT4G20960.1CTTAACCGACTencodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis
AT4G20960.1TTTCCGGTTAencodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis
AT4G21580AT4G21580.1CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink).
AT4G21580.1CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink).
AT4G21580.2CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink).
AT4G21580.2CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink).
AT4G21580.3CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink).
AT4G21580.3CGGTTAAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Quinone oxidoreductase putative, PIG3 (InterPro:IPR014189), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: NADP-dependent oxidoreductase, putative (TAIR:AT5G61510.1); Has 31612 Blast hits to 31503 proteins in 1766 species: Archae - 322; Bacteria - 16846; Metazoa - 1920; Fungi - 2837; Plants - 1211; Viruses - 0; Other Eukaryotes - 8476 (source: NCBI BLink).
AT4G21600AT4G21600.1CGGTTAAAEncodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops).
AT4G21710AT4G21710.1CAAACCGGTTATEncodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit.
AT4G21710.1CAAACCGGTTATEncodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit.
AT4G21790AT4G21790.1CCGTTGGATencodes a host factor that is required for TMV virus multiplication.
AT4G21940AT4G21940.1CAACGGTCmember of Calcium Dependent Protein Kinase
AT4G22350AT4G22350.1GGCCTTTTAACCGubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink).
AT4G22580AT4G22580.1ACCGTTAGexostosin family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT4G13990.1); Has 375 Blast hits to 373 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 4; Plants - 340; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT4G22670AT4G22670.1TTATTGGGCCTTATTAACGGGCTTATArabidopsis thaliana Hsp70-interacting protein 1 (AtHip1); FUNCTIONS IN: binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATTDX (TETRATICOPEPTIDE DOMAIN-CONTAINING THIOREDOXIN); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / protein binding (TAIR:AT3G17880.2); Has 104992 Blast hits to 32574 proteins in 1569 species: Archae - 323; Bacteria - 31113; Metazoa - 46021; Fungi - 5704; Plants - 7149; Viruses - 884; Other Eukaryotes - 13798 (source: NCBI BLink).
AT4G22820AT4G22820.1CGGTTAAGzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT1G12440.2); Has 766 Blast hits to 761 proteins in 109 species: Archae - 2; Bacteria - 0; Metazoa - 378; Fungi - 2; Plants - 273; Viruses - 6; Other Eukaryotes - 105 (source: NCBI BLink).
AT4G22820.2CGGTTAAGzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT1G12440.2); Has 766 Blast hits to 761 proteins in 109 species: Archae - 2; Bacteria - 0; Metazoa - 378; Fungi - 2; Plants - 273; Viruses - 6; Other Eukaryotes - 105 (source: NCBI BLink).
AT4G22860AT4G22860.1ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11990.1); Has 69 Blast hits to 62 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 2; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G22860.2ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11990.1); Has 69 Blast hits to 62 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 2; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G23670AT4G23670.1TTTAACCGmajor latex protein-related / MLP-related; FUNCTIONS IN: copper ion binding; INVOLVED IN: response to cadmium ion, response to salt stress, defense response to bacterium; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT4G23680.1); Has 228 Blast hits to 209 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 228; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G23800AT4G23800.1GACCGTTGhigh mobility group (HMG1/2) family protein; FUNCTIONS IN: transcription factor activity; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); BEST Arabidopsis thaliana protein match is: high mobility group (HMG1/2) family protein (TAIR:AT4G11080.1); Has 62445 Blast hits to 32833 proteins in 1549 species: Archae - 256; Bacteria - 4440; Metazoa - 33253; Fungi - 3596; Plants - 1795; Viruses - 218; Other Eukaryotes - 18887 (source: NCBI BLink).
AT4G23890AT4G23890.1ACCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 252 Blast hits to 252 proteins in 67 species: Archae - 0; Bacteria - 101; Metazoa - 15; Fungi - 4; Plants - 21; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).
AT4G23890.1TTAACCGGTTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 252 Blast hits to 252 proteins in 67 species: Archae - 0; Bacteria - 101; Metazoa - 15; Fungi - 4; Plants - 21; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).
AT4G23910AT4G23910.1ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10970.4); Has 29 Blast hits to 29 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G23910.1TAACCGGTTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10970.4); Has 29 Blast hits to 29 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G24570AT4G24570.1ATAACCGGmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink).
AT4G24644AT4G24644.1ATCCAACGGunknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT4G24800AT4G24800.1GACCGTTGMA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT5G63190.2); Has 1429 Blast hits to 596 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 943; Fungi - 14; Plants - 365; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).
AT4G24800.2GACCGTTGMA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT5G63190.2); Has 1429 Blast hits to 596 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 943; Fungi - 14; Plants - 365; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).
AT4G24805AT4G24805.1TCCAACGGmethyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT1G24480.1); Has 180 Blast hits to 180 proteins in 30 species: Archae - 4; Bacteria - 27; Metazoa - 0; Fungi - 2; Plants - 109; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT4G24830AT4G24830.1TTTAACCGGTTTarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink).
AT4G24830.1TTTAACGGarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink).
AT4G24830.2TTTAACCGGTTTarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink).
AT4G24830.2TTTAACGGarginosuccinate synthase family; FUNCTIONS IN: argininosuccinate synthase activity, ATP binding; INVOLVED IN: arginine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Argininosuccinate synthase, conserved site (InterPro:IPR018223), Argininosuccinate synthase (InterPro:IPR001518); Has 6083 Blast hits to 6076 proteins in 1351 species: Archae - 136; Bacteria - 2563; Metazoa - 143; Fungi - 94; Plants - 33; Viruses - 0; Other Eukaryotes - 3114 (source: NCBI BLink).
AT4G24840AT4G24840.1CGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT4G24972AT4G24972.1TTTAACGGEncodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1.
AT4G25200AT4G25200.1GATGGGCCGTAGCCCGTTAAtHSP23.6-mito mRNA, nuclear gene encoding mitochondrial
AT4G25650AT4G25650.1TTAACCGGTTTAGSimilar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment.
AT4G25650.2TTAACCGGTTTAGSimilar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment.
AT4G25660AT4G25660.1ATCCAACGGTTCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25680.1); Has 499 Blast hits to 499 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 37; Plants - 181; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT4G25660.1CTAAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25680.1); Has 499 Blast hits to 499 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 37; Plants - 181; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT4G25740AT4G25740.1GAACCGGTTAA40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink).
AT4G25740.1TAACCGGAC40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink).
AT4G25740.2GAACCGGTTAA40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink).
AT4G25740.2TAACCGGAC40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink).
AT4G26840AT4G26840.1CCGTTGGATEncodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets.
AT4G26840.1CCGTTGGATEncodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets.
AT4G26910AT4G26910.1ACCGGTTAA2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink).
AT4G26910.1TAACCGGAA2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink).
AT4G26910.2ACCGGTTAA2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink).
AT4G26910.2TAACCGGAA2-oxoacid dehydrogenase family protein; FUNCTIONS IN: dihydrolipoyllysine-residue succinyltransferase activity, acyltransferase activity; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Dihydrolipoamide succinyltransferase (InterPro:IPR006255), 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: 2-oxoacid dehydrogenase family protein (TAIR:AT5G55070.1); Has 18235 Blast hits to 15642 proteins in 1359 species: Archae - 63; Bacteria - 8371; Metazoa - 692; Fungi - 350; Plants - 255; Viruses - 3; Other Eukaryotes - 8501 (source: NCBI BLink).
AT4G26970AT4G26970.1ATCCAACGGTTAAAaconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); BEST Arabidopsis thaliana protein match is: aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative (TAIR:AT2G05710.1); Has 15496 Blast hits to 15351 proteins in 1535 species: Archae - 312; Bacteria - 6112; Metazoa - 484; Fungi - 449; Plants - 132; Viruses - 0; Other Eukaryotes - 8007 (source: NCBI BLink).
AT4G26970.1CAACGGTCaconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); BEST Arabidopsis thaliana protein match is: aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative (TAIR:AT2G05710.1); Has 15496 Blast hits to 15351 proteins in 1535 species: Archae - 312; Bacteria - 6112; Metazoa - 484; Fungi - 449; Plants - 132; Viruses - 0; Other Eukaryotes - 8007 (source: NCBI BLink).
AT4G27000AT4G27000.1CTTAACCGGGTTATRBP45C; FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45A (RNA-binding protein 45A); RNA binding (TAIR:AT5G54900.1); Has 24066 Blast hits to 14859 proteins in 588 species: Archae - 10; Bacteria - 1237; Metazoa - 14401; Fungi - 2729; Plants - 3582; Viruses - 5; Other Eukaryotes - 2102 (source: NCBI BLink).
AT4G27130AT4G27130.1ATAACCGGAAeukaryotic translation initiation factor SUI1, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, translation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Eukaryotic translation initiation factor SUI1 (InterPro:IPR005874); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1, putative (TAIR:AT5G54760.2); Has 620 Blast hits to 617 proteins in 201 species: Archae - 6; Bacteria - 1; Metazoa - 295; Fungi - 109; Plants - 120; Viruses - 3; Other Eukaryotes - 86 (source: NCBI BLink).
AT4G27380AT4G27380.1TCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT4G27570AT4G27570.1TTTAACGGglycosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: N-terminal protein myristoylation, metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: glycosyltransferase family protein (TAIR:AT4G27560.1); Has 2822 Blast hits to 2801 proteins in 194 species: Archae - 0; Bacteria - 20; Metazoa - 193; Fungi - 9; Plants - 2596; Viruses - 3; Other Eukaryotes - 1 (source: NCBI BLink).
AT4G27720AT4G27720.1TCCAACGGACCGTCAGLOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64650.1); Has 496 Blast hits to 491 proteins in 183 species: Archae - 5; Bacteria - 234; Metazoa - 75; Fungi - 33; Plants - 96; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT4G27940AT4G27940.1GTTCGGTTAAGmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G46320.1); Has 13258 Blast hits to 8472 proteins in 324 species: Archae - 0; Bacteria - 0; Metazoa - 6659; Fungi - 3535; Plants - 2092; Viruses - 0; Other Eukaryotes - 972 (source: NCBI BLink).
AT4G28010AT4G28010.1TAACGGGCTTTApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62670.1); Has 27713 Blast hits to 6108 proteins in 193 species: Archae - 5; Bacteria - 29; Metazoa - 747; Fungi - 685; Plants - 24892; Viruses - 0; Other Eukaryotes - 1355 (source: NCBI BLink).
AT4G28150AT4G28150.1CCGTTGGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G03420.1); Has 148 Blast hits to 148 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 146; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT4G28150.2CCGTTGGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G03420.1); Has 148 Blast hits to 148 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 146; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT4G28230AT4G28230.1ATCCAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; Has 385 Blast hits to 299 proteins in 88 species: Archae - 0; Bacteria - 7; Metazoa - 168; Fungi - 23; Plants - 22; Viruses - 2; Other Eukaryotes - 163 (source: NCBI BLink).
AT4G28250AT4G28250.1CAACGGTCputative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT4G28250.2CAACGGTCputative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT4G28260AT4G28260.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G28260.2ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G28360AT4G28360.1TAACGGGCTCGGCCCAAATribosomal protein L22 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22, bacterial-type (InterPro:IPR005727); BEST Arabidopsis thaliana protein match is: ribosomal protein L22 family protein (TAIR:AT1G52370.3); Has 5503 Blast hits to 5503 proteins in 1687 species: Archae - 0; Bacteria - 3089; Metazoa - 109; Fungi - 48; Plants - 431; Viruses - 0; Other Eukaryotes - 1826 (source: NCBI BLink).
AT4G28630AT4G28630.1AAAACCGGTTAThalf-molecule ABC transporter ATM1
AT4G28630.1ACCGGTTAThalf-molecule ABC transporter ATM1
AT4G28630.1GACCGTTGhalf-molecule ABC transporter ATM1
AT4G29120AT4G29120.1TTTAACCGAACCA6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, phosphogluconate dehydrogenase (decarboxylating) activity, binding, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 12459 Blast hits to 12442 proteins in 1308 species: Archae - 93; Bacteria - 6200; Metazoa - 393; Fungi - 342; Plants - 184; Viruses - 2; Other Eukaryotes - 5245 (source: NCBI BLink).
AT4G29160AT4G29160.1TAACCGGTTCSNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).
AT4G29160.1TGGTTCGGTTAAASNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).
AT4G29160.2TGGTTCGGTTAAASNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).
AT4G29160.3TAACCGGTTCSNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).
AT4G29160.3TGGTTCGGTTAAASNF7.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: SNF7.2 (TAIR:AT2G19830.1); Has 1405 Blast hits to 1405 proteins in 174 species: Archae - 0; Bacteria - 25; Metazoa - 599; Fungi - 312; Plants - 280; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink).
AT4G29350AT4G29350.1TTTAACCGGATEncodes profilin2, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Expressed in vegetative organs. The first intron of PRF2 enhances gene expression.
AT4G29390AT4G29390.1CTAACGGT40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G29400AT4G29400.1ACCGTTAGunknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink).
AT4G29480AT4G29480.1TTTCCGGTTAmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G29510AT4G29510.1TAACCGGTTTGGHas arginine N-methyltransferase activity. Modifies AtMBD7.
AT4G29720AT4G29720.1CTTAACCGPolyamine oxidase 5 (ATPAO5); FUNCTIONS IN: electron carrier activity, amine oxidase activity, oxidoreductase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amine oxidase (InterPro:IPR002937); BEST Arabidopsis thaliana protein match is: LDL3 (LSD1-LIKE3); amine oxidase/ electron carrier/ oxidoreductase (TAIR:AT4G16310.1); Has 2218 Blast hits to 1911 proteins in 307 species: Archae - 0; Bacteria - 461; Metazoa - 888; Fungi - 335; Plants - 243; Viruses - 0; Other Eukaryotes - 291 (source: NCBI BLink).
AT4G29810AT4G29810.1TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2.
AT4G29810.2TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2.
AT4G29810.3TTAACCGGTTTGTTTCCGGTTAAAencodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2.
AT4G30010AT4G30010.1TTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G30190AT4G30190.1CAACGGTCbelongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal dom
AT4G30310AT4G30310.1ATCCGGTTATribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).
AT4G30310.2ATCCGGTTATribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).
AT4G30310.3ATCCGGTTATribitol kinase, putative; FUNCTIONS IN: carbohydrate kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY-related (InterPro:IPR006003); Has 9520 Blast hits to 8571 proteins in 1304 species: Archae - 98; Bacteria - 6578; Metazoa - 414; Fungi - 208; Plants - 50; Viruses - 0; Other Eukaryotes - 2172 (source: NCBI BLink).
AT4G31360AT4G31360.1CTAACGGTselenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT4G31430AT4G31430.1TTTAACCGunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 1991 Blast hits to 609 proteins in 150 species: Archae - 0; Bacteria - 281; Metazoa - 325; Fungi - 191; Plants - 52; Viruses - 14; Other Eukaryotes - 1128 (source: NCBI BLink).
AT4G31430.2TTTAACCGunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 1991 Blast hits to 609 proteins in 150 species: Archae - 0; Bacteria - 281; Metazoa - 325; Fungi - 191; Plants - 52; Viruses - 14; Other Eukaryotes - 1128 (source: NCBI BLink).
AT4G31430.3TTTAACCGunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 1991 Blast hits to 609 proteins in 150 species: Archae - 0; Bacteria - 281; Metazoa - 325; Fungi - 191; Plants - 52; Viruses - 14; Other Eukaryotes - 1128 (source: NCBI BLink).
AT4G31770AT4G31770.1TTTAACGGcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT4G31840AT4G31840.1TCCAACGGplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT2G25060.1); Has 804 Blast hits to 795 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 804; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G31880AT4G31880.1TTTAACGGLOCATED IN: cytosol, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G15940.1); Has 114836 Blast hits to 56273 proteins in 1914 species: Archae - 187; Bacteria - 15478; Metazoa - 53116; Fungi - 16017; Plants - 4342; Viruses - 719; Other Eukaryotes - 24977 (source: NCBI BLink).
AT4G32020AT4G32020.1AGTCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25250.1); Has 34 Blast hits to 34 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 5; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G32270AT4G32270.1CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 99 Blast hits to 97 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G32270.2CGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25340.1); Has 99 Blast hits to 97 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G32400AT4G32400.1CGGTTAAAEncodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol.
AT4G32680AT4G32680.1ATTGGCCCGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G32690AT4G32690.1TAACGGGCCAATEncodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast.
AT4G32760AT4G32760.1CAACGGTCprotein transporter; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT3G08790.1); Has 18386 Blast hits to 12933 proteins in 541 species: Archae - 4; Bacteria - 507; Metazoa - 7666; Fungi - 3474; Plants - 2212; Viruses - 64; Other Eukaryotes - 4459 (source: NCBI BLink).
AT4G32860AT4G32860.1TTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G32915AT4G32915.1GACCGGTTAAAACCGGTTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of translational fidelity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glu-tRNAGln amidotransferase, C subunit (InterPro:IPR003837); Has 1227 Blast hits to 1227 proteins in 425 species: Archae - 17; Bacteria - 884; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 309 (source: NCBI BLink).
AT4G33400AT4G33400.1CCGGTTAAdem protein-related / defective embryo and meristems protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Vacuolar import and degradation, Vid27-related (InterPro:IPR013863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19240.1); Has 171 Blast hits to 171 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 88; Plants - 38; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).
AT4G33430AT4G33430.1CAACGGTCLeu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome.
AT4G33530AT4G33530.1CGGTTAAGpotassium transporter
AT4G33530.1CGGTTAAGpotassium transporter
AT4G33540AT4G33540.1CTTAACCGmetallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1070 Blast hits to 1070 proteins in 241 species: Archae - 64; Bacteria - 439; Metazoa - 27; Fungi - 6; Plants - 47; Viruses - 0; Other Eukaryotes - 487 (source: NCBI BLink).
AT4G33540.1CTTAACCGmetallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1070 Blast hits to 1070 proteins in 241 species: Archae - 64; Bacteria - 439; Metazoa - 27; Fungi - 6; Plants - 47; Viruses - 0; Other Eukaryotes - 487 (source: NCBI BLink).
AT4G33640AT4G33640.1CAAACCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 141 Blast hits to 141 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G33760AT4G33760.1CTTAACCGGTTCGtRNA synthetase class II (D, K and N) family protein; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast, membrane, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type (InterPro:IPR004524), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150), Aspartyl-tRNA synthetase, class IIb, bacterial/mitochondrial type, C-terminal (InterPro:IPR018153), GAD (InterPro:IPR004115); BEST Arabidopsis thaliana protein match is: OVA5 (OVULE ABORTION 5); ATP binding / aminoacyl-tRNA ligase/ lysine-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT3G13490.1); Has 20510 Blast hits to 15912 proteins in 1700 species: Archae - 534; Bacteria - 11175; Metazoa - 763; Fungi - 675; Plants - 169; Viruses - 0; Other Eukaryotes - 7194 (source: NCBI BLink).
AT4G33945AT4G33945.1TCCAACGGarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); Has 252 Blast hits to 236 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 5; Plants - 68; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT4G34110AT4G34110.1ATCCAACGGPutative poly-A binding protein. Member of a gene family .Expressed in stele and root meristem and post-fertilization ovules.Member of the class II family of PABP proteins.
AT4G34700AT4G34700.1TCCAACGGcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT4G34870AT4G34870.1CAACGGTCbelongs to cyclophilin family
AT4G34880AT4G34880.1CAACGGTCamidase family protein; FUNCTIONS IN: amidase activity, carbon-nitrogen ligase activity, with glutamine as amido-N-donor; INVOLVED IN: acrylonitrile catabolic process, aldoxime metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Amidase signature enzyme (InterPro:IPR000120); BEST Arabidopsis thaliana protein match is: amidase family protein (TAIR:AT5G07360.2); Has 10946 Blast hits to 10880 proteins in 1379 species: Archae - 132; Bacteria - 5130; Metazoa - 366; Fungi - 337; Plants - 155; Viruses - 0; Other Eukaryotes - 4826 (source: NCBI BLink).
AT4G34960AT4G34960.1TTTAGGCCCGTTApeptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP5 (CYCLOPHILIN 5); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G29960.1); Has 11230 Blast hits to 11218 proteins in 1505 species: Archae - 82; Bacteria - 3582; Metazoa - 2365; Fungi - 952; Plants - 729; Viruses - 4; Other Eukaryotes - 3516 (source: NCBI BLink).
AT4G35090AT4G35090.1TAACCGGTEncodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene.
AT4G35090.2TAACCGGTEncodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene.
AT4G35550AT4G35550.1GCCGTTTAACCGEncodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT4G35800AT4G35800.1AGGCCCGTTAEncodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit.
AT4G35850AT4G35850.1CAAACCGGTTAApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G02150.1); Has 6373 Blast hits to 2522 proteins in 127 species: Archae - 1; Bacteria - 4; Metazoa - 104; Fungi - 77; Plants - 5853; Viruses - 0; Other Eukaryotes - 334 (source: NCBI BLink).
AT4G36210AT4G36210.1GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT4G36210.2GACCGTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT4G36800AT4G36800.1AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.
AT4G36800.2AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.
AT4G36910AT4G36910.1CAACGGTCHas a cystathionine Beta-synthase domain.
AT4G37110AT4G37110.1GACCGTTGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Cell division cycle-associated protein (InterPro:IPR018866); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23530.1); Has 269 Blast hits to 266 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 26; Plants - 106; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT4G37190AT4G37190.1ACCCGGTTATINVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G37190.2ACCCGGTTATINVOLVED IN: protein polymerization; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta tubulin, autoregulation binding site (InterPro:IPR013838), Tubulin/FtsZ, GTPase (InterPro:IPR003008); Has 251 Blast hits to 250 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 89; Plants - 28; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G37210AT4G37210.1ACCGTTAGtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 580 Blast hits to 491 proteins in 143 species: Archae - 4; Bacteria - 39; Metazoa - 258; Fungi - 121; Plants - 40; Viruses - 8; Other Eukaryotes - 110 (source: NCBI BLink).
AT4G37210.1CAACGGTCtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 580 Blast hits to 491 proteins in 143 species: Archae - 4; Bacteria - 39; Metazoa - 258; Fungi - 121; Plants - 40; Viruses - 8; Other Eukaryotes - 110 (source: NCBI BLink).
AT4G37210.2ACCGTTAGtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 580 Blast hits to 491 proteins in 143 species: Archae - 4; Bacteria - 39; Metazoa - 258; Fungi - 121; Plants - 40; Viruses - 8; Other Eukaryotes - 110 (source: NCBI BLink).
AT4G37210.2CAACGGTCtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 580 Blast hits to 491 proteins in 143 species: Archae - 4; Bacteria - 39; Metazoa - 258; Fungi - 121; Plants - 40; Viruses - 8; Other Eukaryotes - 110 (source: NCBI BLink).
AT4G37870AT4G37870.1ACCGGTTATEncodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent).
AT4G37880AT4G37880.1ATCCAACGGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22690.2); Has 631 Blast hits to 627 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 324; Fungi - 158; Plants - 74; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT4G37990AT4G37990.1TTTAACGGEncodes an aromatic alcohol:NADP+ oxidoreductase whose mRNA levels are increased in response to treatment with a variety of phytopathogenic bacteria. Though similar to mannitol dehydrogenases, this enzyme does not have mannitol dehydrogenase activity.
AT4G38020AT4G38020.1CCGTTAAAtRNA/rRNA methyltransferase (SpoU) family protein; FUNCTIONS IN: RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA/rRNA methyltransferase, SpoU (InterPro:IPR001537); Has 7116 Blast hits to 7116 proteins in 1450 species: Archae - 3; Bacteria - 4784; Metazoa - 124; Fungi - 58; Plants - 45; Viruses - 0; Other Eukaryotes - 2102 (source: NCBI BLink).
AT4G38060AT4G38060.1CCGTTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65480.1); Has 38 Blast hits to 38 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G38060.2CCGTTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65480.1); Has 38 Blast hits to 38 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G38430AT4G38430.1ATCCAACGGMember of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity.
AT4G38430.1CCGTTAAAMember of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity.
AT4G38580AT4G38580.1ACCGTTAGputative farnesylated protein (At4g38580) mRNA, complete
AT4G38740AT4G38740.1CGGTTAAGEncodes cytosolic cyclophilin ROC1.
AT4G38740.1CTTAACCGGTEncodes cytosolic cyclophilin ROC1.
AT4G38940AT4G38940.1CCGTTAAAkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G10510.1); Has 722 Blast hits to 701 proteins in 54 species: Archae - 4; Bacteria - 27; Metazoa - 128; Fungi - 0; Plants - 558; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G39150AT4G39150.1GTGGGCCTAACGGGCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G21510.1); Has 15752 Blast hits to 15663 proteins in 1939 species: Archae - 106; Bacteria - 5221; Metazoa - 3289; Fungi - 1398; Plants - 1148; Viruses - 18; Other Eukaryotes - 4572 (source: NCBI BLink).
AT4G39480AT4G39480.1GACCGTTGmember of CYP96A
AT4G39550AT4G39550.1CGGTTAAAkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2334 Blast hits to 1835 proteins in 108 species: Archae - 6; Bacteria - 90; Metazoa - 1470; Fungi - 6; Plants - 681; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink).
AT4G39610AT4G39610.1CTTAACCGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G21990.1); Has 140 Blast hits to 140 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G39940AT4G39940.1ATAACCGGTadenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete
AT4G39940.1TTAACCGGTadenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete
AT4G39980AT4G39980.1TTTAACGGEncodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae.
AT4G40040AT4G40040.1GACCGTTGhistone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).
AT4G40040.2GACCGTTGhistone H3.2; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).
AT4G40042AT4G40042.1CAACGGTCpeptidase; FUNCTIONS IN: peptidase activity; INVOLVED IN: signal peptide processing; LOCATED IN: endomembrane system, integral to membrane, signal peptidase complex; CONTAINS InterPro DOMAIN/s: Microsomal signal peptidase 12 kDa subunit (InterPro:IPR009542); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT2G22425.2); Has 218 Blast hits to 218 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 56; Plants - 39; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT5G01420AT5G01420.1GACCGTTGglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT5G03870.1); Has 300 Blast hits to 300 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 0; Plants - 195; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT5G01510AT5G01510.1ATAAACCGAATTTAACCGGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT5G01510.1GCCCGTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT5G01530AT5G01530.1ATCCAACGGTCchlorophyll A-B binding protein CP29 (LHCB4); FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light, response to red light, response to far red light, photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); BEST Arabidopsis thaliana protein match is: LHCB4.2 (light harvesting complex PSII); chlorophyll binding (TAIR:AT3G08940.2); Has 1770 Blast hits to 1698 proteins in 193 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 1503; Viruses - 0; Other Eukaryotes - 265 (source: NCBI BLink).
AT5G01600AT5G01600.1ATCCAACGGEncodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT5G01610AT5G01610.1ATCCAACGGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08890.2); Has 251 Blast hits to 251 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 250; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G02100AT5G02100.1CCGTTAAAEncodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent.
AT5G02370AT5G02370.1CTAACGGTkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink).
AT5G02490AT5G02490.1ATCCAACGGheat shock cognate 70 kDa protein 2 (HSC70-2) (HSP70-2); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to heat, response to bacterium; LOCATED IN: cytosol, cell wall, plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24929 Blast hits to 24652 proteins in 3112 species: Archae - 103; Bacteria - 9641; Metazoa - 3128; Fungi - 1215; Plants - 726; Viruses - 241; Other Eukaryotes - 9875 (source: NCBI BLink).
AT5G02680AT5G02680.1GACCGTTGGATATP binding / aminoacyl-tRNA ligase/ nucleotide binding; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT1G10310.1); Has 160 Blast hits to 160 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 90; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT5G02680.1GACCGTTGGATATP binding / aminoacyl-tRNA ligase/ nucleotide binding; FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I (M) (InterPro:IPR015413); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT1G10310.1); Has 160 Blast hits to 160 proteins in 54 species: Archae - 0; Bacteria - 16; Metazoa - 90; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT5G02870AT5G02870.1AACCCGGTTAA60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).
AT5G02870.2AACCCGGTTAA60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).
AT5G02880AT5G02880.1CCGTTGGATencodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis.
AT5G02960AT5G02960.1ATCCAACGGTTTAG40S ribosomal protein S23 (RPS23B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S23, eukaryotic/archaeal (InterPro:IPR005680), Ribosomal protein S12/S23 (InterPro:IPR006032), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S23 (RPS23A) (TAIR:AT3G09680.1); Has 6124 Blast hits to 6121 proteins in 1817 species: Archae - 180; Bacteria - 2807; Metazoa - 329; Fungi - 198; Plants - 755; Viruses - 0; Other Eukaryotes - 1855 (source: NCBI BLink).
AT5G02970AT5G02970.1CTTAACCGhydrolase, alpha/beta fold family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT3G09690.2); Has 537 Blast hits to 531 proteins in 131 species: Archae - 2; Bacteria - 272; Metazoa - 8; Fungi - 13; Plants - 197; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).
AT5G03270AT5G03270.1CTTAACCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lysine biosynthetic process via diaminopimelate; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP00730 (InterPro:IPR005269); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37210.1); Has 2763 Blast hits to 2762 proteins in 711 species: Archae - 6; Bacteria - 1568; Metazoa - 10; Fungi - 79; Plants - 188; Viruses - 0; Other Eukaryotes - 912 (source: NCBI BLink).
AT5G03360AT5G03360.1GACCGTTGDC1 domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, hypocotyl, root, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT4G26380.1); Has 2474 Blast hits to 510 proteins in 22 species: Archae - 2; Bacteria - 7; Metazoa - 3; Fungi - 0; Plants - 2453; Viruses - 4; Other Eukaryotes - 5 (source: NCBI BLink).
AT5G03380AT5G03380.1CCGGTTAAAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink).
AT5G03380.2CCGGTTAAAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink).
AT5G03630AT5G03630.1CTAACGGTTTAAATMDAR2; FUNCTIONS IN: monodehydroascorbate reductase (NADH) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), FAD/NAD-linked reductase, dimerisation (InterPro:IPR016156); BEST Arabidopsis thaliana protein match is: MDHAR (MONODEHYDROASCORBATE REDUCTASE); monodehydroascorbate reductase (NADH) (TAIR:AT3G09940.1); Has 15548 Blast hits to 15528 proteins in 1711 species: Archae - 317; Bacteria - 10742; Metazoa - 673; Fungi - 378; Plants - 332; Viruses - 0; Other Eukaryotes - 3106 (source: NCBI BLink).
AT5G03660AT5G03660.1ATCCAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09980.1); Has 5235 Blast hits to 3832 proteins in 426 species: Archae - 74; Bacteria - 462; Metazoa - 2482; Fungi - 239; Plants - 192; Viruses - 22; Other Eukaryotes - 1764 (source: NCBI BLink).
AT5G03660.1ATCCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF662 (InterPro:IPR007033); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G09980.1); Has 5235 Blast hits to 3832 proteins in 426 species: Archae - 74; Bacteria - 462; Metazoa - 2482; Fungi - 239; Plants - 192; Viruses - 22; Other Eukaryotes - 1764 (source: NCBI BLink).
AT5G03740AT5G03740.1CCGTTAAAAAAAGCCHD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression
AT5G03900AT5G03900.1TAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT5G03900.2TAACCGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361); Has 104 Blast hits to 104 proteins in 40 species: Archae - 0; Bacteria - 55; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT5G03970AT5G03970.1ATAACCGGTTCAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G03970.1ATCCGGTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G03970.2ATAACCGGTTCAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G03970.2ATCCGGTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G04140AT5G04140.1CAAACCGGTTAAEncodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation.
AT5G04140.2CAAACCGGTTAAEncodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation.
AT5G04480AT5G04480.1CCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT4G01210.1); Has 241 Blast hits to 238 proteins in 81 species: Archae - 4; Bacteria - 156; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT5G04590AT5G04590.1CCGTTGGATA.thaliana gene encoding sulfite reductase.
AT5G04830AT5G04830.1CCGTTGGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 53 Blast hits to 51 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 21; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G04830.2CCGTTGGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 53 Blast hits to 51 proteins in 20 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 21; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G04910AT5G04910.1CTAAACCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 38 Blast hits to 38 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT5G05080AT5G05080.1CTAACGGTubiquitin-conjugating enzyme 22 (UBC22); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2 (UBIQUITING-CONJUGATING ENZYME 2); ubiquitin-protein ligase (TAIR:AT2G02760.1); Has 6968 Blast hits to 6959 proteins in 301 species: Archae - 0; Bacteria - 0; Metazoa - 3369; Fungi - 1306; Plants - 1062; Viruses - 19; Other Eukaryotes - 1212 (source: NCBI BLink).
AT5G05080.2CTAACGGTubiquitin-conjugating enzyme 22 (UBC22); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: ATUBC2 (UBIQUITING-CONJUGATING ENZYME 2); ubiquitin-protein ligase (TAIR:AT2G02760.1); Has 6968 Blast hits to 6959 proteins in 301 species: Archae - 0; Bacteria - 0; Metazoa - 3369; Fungi - 1306; Plants - 1062; Viruses - 19; Other Eukaryotes - 1212 (source: NCBI BLink).
AT5G05200AT5G05200.1TTAACCGGAAAABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT4G31390.1); Has 7063 Blast hits to 7031 proteins in 1099 species: Archae - 67; Bacteria - 2625; Metazoa - 361; Fungi - 314; Plants - 339; Viruses - 14; Other Eukaryotes - 3343 (source: NCBI BLink).
AT5G05210AT5G05210.1TTTCCGGTTAAnucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).
AT5G05210.2TTTCCGGTTAAnucleolar matrix protein-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 6 (InterPro:IPR007019); BEST Arabidopsis thaliana protein match is: nucleolar matrix protein-related (TAIR:AT2G27750.1); Has 28916 Blast hits to 17867 proteins in 915 species: Archae - 105; Bacteria - 2236; Metazoa - 12711; Fungi - 2263; Plants - 727; Viruses - 134; Other Eukaryotes - 10740 (source: NCBI BLink).
AT5G05290AT5G05290.1CCGTTGGAEncodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT5G05310AT5G05310.1TTTAACGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).
AT5G05310.2TTTAACGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).
AT5G05310.3TTTAACGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 533 Blast hits to 527 proteins in 89 species: Archae - 0; Bacteria - 190; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 318 (source: NCBI BLink).
AT5G05520AT5G05520.1ACCGGTTAAouter membrane OMP85 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial surface antigen (D15) (InterPro:IPR000184), Surface antigen variable number (InterPro:IPR010827); BEST Arabidopsis thaliana protein match is: outer membrane OMP85 family protein (TAIR:AT3G11070.1); Has 1168 Blast hits to 1166 proteins in 370 species: Archae - 0; Bacteria - 488; Metazoa - 132; Fungi - 88; Plants - 38; Viruses - 4; Other Eukaryotes - 418 (source: NCBI BLink).
AT5G05520.1ATAACCGGTTCAouter membrane OMP85 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial surface antigen (D15) (InterPro:IPR000184), Surface antigen variable number (InterPro:IPR010827); BEST Arabidopsis thaliana protein match is: outer membrane OMP85 family protein (TAIR:AT3G11070.1); Has 1168 Blast hits to 1166 proteins in 370 species: Archae - 0; Bacteria - 488; Metazoa - 132; Fungi - 88; Plants - 38; Viruses - 4; Other Eukaryotes - 418 (source: NCBI BLink).
AT5G06150AT5G06150.1ACCGTTAGEncodes a cyclin whose expression is reduced in response to high salt.
AT5G06150.1GACCGTTGGAEncodes a cyclin whose expression is reduced in response to high salt.
AT5G06150.1TCCAACGGEncodes a cyclin whose expression is reduced in response to high salt.
AT5G06550AT5G06550.1TTCCGGTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell surface receptor linked signal transduction; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT1G78280.1); Has 1299 Blast hits to 1289 proteins in 204 species: Archae - 0; Bacteria - 195; Metazoa - 777; Fungi - 106; Plants - 94; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).
AT5G06580AT5G06580.1TTAACCGGAEncodes a protein with glycolate dehydrogenase activity, which was shown to complement various subunits of the E. coli glycolate oxidase complex. It has not been ruled out that the enzyme might be involved in other catalytic activities in vivo.
AT5G06830AT5G06830.1ATAACCGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF773 (InterPro:IPR008491); Has 301 Blast hits to 298 proteins in 82 species: Archae - 7; Bacteria - 7; Metazoa - 191; Fungi - 5; Plants - 24; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT5G06860AT5G06860.1ACCGGTTATEncodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection.
AT5G07230AT5G07230.1TAACCGGATprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, sepal, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G62080.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G07290AT5G07290.1ATCCAACGGAML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices.
AT5G08040AT5G08040.1ACCGGTTATMITOCHONDRIAL IMPORT RECEPTOR SUBUNIT TOM5 HOMOLOG (TOM5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G08050AT5G08050.1ATAACCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500), Uncharacterised conserved protein UCP022207 (InterPro:IPR016801); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G08080AT5G08080.1CGGTTAAGmember of SYP13 Gene Family
AT5G08080.2CGGTTAAGmember of SYP13 Gene Family
AT5G08130AT5G08130.1ACCGTTAGArabidopsis thaliana basic helix-loop-helix (bHLH) family protein involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG).
AT5G08130.3ACCGTTAGArabidopsis thaliana basic helix-loop-helix (bHLH) family protein involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG).
AT5G08250AT5G08250.1ACCGTTAGcytochrome P450 family protein; FUNCTIONS IN: electron carrier activity, monooxygenase activity, iron ion binding, oxygen binding, heme binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128), Cytochrome P450, C-terminal region (InterPro:IPR017973), Cytochrome P450, conserved site (InterPro:IPR017972), Cytochrome P450, E-class, group I (InterPro:IPR002401); BEST Arabidopsis thaliana protein match is: CYP86B1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding (TAIR:AT5G23190.1); Has 19626 Blast hits to 19569 proteins in 1041 species: Archae - 19; Bacteria - 1421; Metazoa - 8932; Fungi - 3724; Plants - 4759; Viruses - 3; Other Eukaryotes - 768 (source: NCBI BLink).
AT5G08335AT5G08335.1ATAACCGGAAEncodes an isoprenyl cysteine methylatransferase (ICMT) involved in the post-translational processing of proteins that have a C-terminal CaaX box. This protein appears to have higher catalytic activity and a higher transcript expression level than the other ICMT present in Arabidopsis (At5g23320). Analysis of ICMT RNAi lines suggests that this protein is involved in flower and stem development.
AT5G08360AT5G08360.1ATAACCGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF789 (InterPro:IPR008507); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G23380.1); Has 132 Blast hits to 132 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 131; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G08400AT5G08400.1TTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29400.1); Has 258 Blast hits to 258 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT5G08400.2TTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29400.1); Has 258 Blast hits to 258 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT5G08580AT5G08580.1ATCCAACGGcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT4G27790.1); Has 1683 Blast hits to 1652 proteins in 245 species: Archae - 0; Bacteria - 5; Metazoa - 858; Fungi - 86; Plants - 540; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).
AT5G08590AT5G08590.1CCGTTGGATEncodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily.
AT5G08740AT5G08740.1TTTAACCGNAD(P)H dehydrogenase C1 (NDC1); FUNCTIONS IN: NADH dehydrogenase activity; LOCATED IN: intrinsic to mitochondrial inner membrane, cell wall, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027); BEST Arabidopsis thaliana protein match is: NDA2 (ALTERNATIVE NAD(P)H DEHYDROGENASE 2); FAD binding / NADH dehydrogenase/ oxidoreductase (TAIR:AT2G29990.1); Has 6169 Blast hits to 6166 proteins in 1233 species: Archae - 193; Bacteria - 4156; Metazoa - 270; Fungi - 344; Plants - 171; Viruses - 0; Other Eukaryotes - 1035 (source: NCBI BLink).
AT5G09290AT5G09290.1TCCGGTTAT3'(2'),5'-bisphosphate nucleotidase, putative / inositol polyphosphate 1-phosphatase, putative; FUNCTIONS IN: 3'(2'),5'-bisphosphate nucleotidase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: sulfur metabolic process; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase (InterPro:IPR000760), 3(2),5 -bisphosphate nucleotidase HAL2 (InterPro:IPR006239); BEST Arabidopsis thaliana protein match is: SAL2; 3'(2'),5'-bisphosphate nucleotidase/ inositol or phosphatidylinositol phosphatase (TAIR:AT5G64000.1); Has 7391 Blast hits to 7391 proteins in 1133 species: Archae - 37; Bacteria - 3751; Metazoa - 361; Fungi - 190; Plants - 183; Viruses - 0; Other Eukaryotes - 2869 (source: NCBI BLink).
AT5G09400AT5G09400.1TAACCGGTTCApotassium transporter
AT5G09660AT5G09660.1CAACGGTCencodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.
AT5G09660.2CAACGGTCencodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.
AT5G09660.3CAACGGTCencodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.
AT5G09660.4CAACGGTCencodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA.
AT5G09740AT5G09740.1TTTAACGGCCCATAAEncodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.
AT5G09740.2TTTAACGGCCCATAAEncodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2.
AT5G09760AT5G09760.1CTTAACCGGACpectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, chloroplast, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT5G64640.1); Has 1447 Blast hits to 1415 proteins in 271 species: Archae - 0; Bacteria - 416; Metazoa - 1; Fungi - 117; Plants - 911; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G10240AT5G10240.1CAACGGTCEncodes asparagine synthetase (ASN3).
AT5G10240.2CAACGGTCEncodes asparagine synthetase (ASN3).
AT5G10270AT5G10270.1TTTAACGGEncodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development.
AT5G10280AT5G10280.1CCGTTGGAEncodes a putative transcription factor (MYB92).
AT5G10390AT5G10390.1ATCCAACGGhistone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10280 Blast hits to 10277 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7396; Fungi - 1309; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink).
AT5G10630AT5G10630.1TATAGGCCCGTTAAAAGCCCAACAelongation factor 1-alpha, putative / EF-1-alpha, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Zinc finger, RanBP2-type (InterPro:IPR001876), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: EF-1-alpha-related GTP-binding protein, putative (TAIR:AT1G18070.2); Has 58110 Blast hits to 58057 proteins in 13368 species: Archae - 652; Bacteria - 20622; Metazoa - 14216; Fungi - 8620; Plants - 1274; Viruses - 3; Other Eukaryotes - 12723 (source: NCBI BLink).
AT5G10650AT5G10650.1CAACGGTCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 8469 Blast hits to 6498 proteins in 243 species: Archae - 0; Bacteria - 110; Metazoa - 2635; Fungi - 536; Plants - 2504; Viruses - 44; Other Eukaryotes - 2640 (source: NCBI BLink).
AT5G10650.2CAACGGTCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G24870.2); Has 8469 Blast hits to 6498 proteins in 243 species: Archae - 0; Bacteria - 110; Metazoa - 2635; Fungi - 536; Plants - 2504; Viruses - 44; Other Eukaryotes - 2640 (source: NCBI BLink).
AT5G10920AT5G10920.1GACCGGTTAAAargininosuccinate lyase, putative / arginosuccinase, putative; FUNCTIONS IN: argininosuccinate lyase activity, catalytic activity; INVOLVED IN: arginine biosynthetic process via ornithine, arginine biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Argininosuccinate lyase (InterPro:IPR009049), L-Aspartase-like (InterPro:IPR008948), Delta crystallin (InterPro:IPR003031), Fumarate lyase (InterPro:IPR000362); Has 10040 Blast hits to 10035 proteins in 1495 species: Archae - 255; Bacteria - 5320; Metazoa - 254; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 3997 (source: NCBI BLink).
AT5G11090AT5G11090.1CCGTTGGATserine-rich protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: serine-rich protein-related (TAIR:AT5G25280.2); Has 1617 Blast hits to 241 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 631; Fungi - 53; Plants - 88; Viruses - 0; Other Eukaryotes - 841 (source: NCBI BLink).
AT5G11240AT5G11240.1ATAAGGCCCGTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink).
AT5G11440AT5G11440.1ATAACCGGGTInteracts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain.
AT5G11440.1CCGGTTAAAInteracts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain.
AT5G11450AT5G11450.1ACCCGGTTAToxygen-evolving complex-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 81 Blast hits to 81 proteins in 22 species: Archae - 0; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G11450.1TTTAACCGGoxygen-evolving complex-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 81 Blast hits to 81 proteins in 22 species: Archae - 0; Bacteria - 22; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G11740AT5G11740.1GACCGTTGEncodes arabinogalactan protein (AGP15).
AT5G11850AT5G11850.1TTTAACCGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G73660.1); Has 91962 Blast hits to 90314 proteins in 3336 species: Archae - 43; Bacteria - 7366; Metazoa - 41562; Fungi - 7560; Plants - 19045; Viruses - 454; Other Eukaryotes - 15932 (source: NCBI BLink).
AT5G11970AT5G11970.1CAACGGTCAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19460.1); Has 127 Blast hits to 127 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G11980AT5G11980.1CGGTTAAAconserved oligomeric Golgi complex component-related / COG complex component-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved oligomeric Golgi complex, COG8 (InterPro:IPR016632), Dor1-like protein (InterPro:IPR007255); Has 311 Blast hits to 311 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 82; Plants - 28; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT5G12170AT5G12170.2TAACGGGCunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19380.1); Has 139 Blast hits to 139 proteins in 40 species: Archae - 0; Bacteria - 11; Metazoa - 7; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT5G12230AT5G12230.1ACCGGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19480.2); Has 22700 Blast hits to 10061 proteins in 421 species: Archae - 37; Bacteria - 1646; Metazoa - 10568; Fungi - 2003; Plants - 1402; Viruses - 41; Other Eukaryotes - 7003 (source: NCBI BLink).
AT5G12250AT5G12250.1ATCCAACGGEncodes a beta-tubulin. Expression of TUB6 has been shown to decrease in response to cold treatment.
AT5G12250.1CCGTTGGATEncodes a beta-tubulin. Expression of TUB6 has been shown to decrease in response to cold treatment.
AT5G12290AT5G12290.1TTAACCGGAAAEncodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background.
AT5G12370AT5G12370.1TTAACCGGCCGGTTTAGEXOCYST COMPLEX COMPONENT SEC10 (SEC10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: exocytosis, vesicle docking; LOCATED IN: plasma membrane, membrane, exocyst; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exocyst complex component Sec10 (InterPro:IPR009976); Has 369 Blast hits to 344 proteins in 119 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 164; Plants - 31; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT5G12370.2TTAACCGGCCGGTTTAGEXOCYST COMPLEX COMPONENT SEC10 (SEC10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: exocytosis, vesicle docking; LOCATED IN: plasma membrane, membrane, exocyst; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exocyst complex component Sec10 (InterPro:IPR009976); Has 369 Blast hits to 344 proteins in 119 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 164; Plants - 31; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT5G12370.3TTAACCGGCCGGTTTAGEXOCYST COMPLEX COMPONENT SEC10 (SEC10); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: exocytosis, vesicle docking; LOCATED IN: plasma membrane, membrane, exocyst; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exocyst complex component Sec10 (InterPro:IPR009976); Has 369 Blast hits to 344 proteins in 119 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 164; Plants - 31; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT5G12850AT5G12850.1ATCCAACGGzinc finger (CCCH-type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G41900.1); Has 2352 Blast hits to 1824 proteins in 179 species: Archae - 4; Bacteria - 93; Metazoa - 1168; Fungi - 124; Plants - 283; Viruses - 12; Other Eukaryotes - 668 (source: NCBI BLink).
AT5G12860AT5G12860.1ATCCAACGGTCdicarboxylate transporter 1 (DiT1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: N-terminal protein myristoylation, malate transport, response to nematode; LOCATED IN: mitochondrion, chloroplast, plastid, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DIT2.1 (DICARBOXYLATE TRANSPORT 2.1); oxoglutarate:malate antiporter (TAIR:AT5G64290.1); Has 3501 Blast hits to 3480 proteins in 730 species: Archae - 45; Bacteria - 2714; Metazoa - 82; Fungi - 3; Plants - 82; Viruses - 1; Other Eukaryotes - 574 (source: NCBI BLink).
AT5G12860.2ATCCAACGGTCdicarboxylate transporter 1 (DiT1); FUNCTIONS IN: oxoglutarate:malate antiporter activity; INVOLVED IN: N-terminal protein myristoylation, malate transport, response to nematode; LOCATED IN: mitochondrion, chloroplast, plastid, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sodium/sulphate symporter (InterPro:IPR001898); BEST Arabidopsis thaliana protein match is: DIT2.1 (DICARBOXYLATE TRANSPORT 2.1); oxoglutarate:malate antiporter (TAIR:AT5G64290.1); Has 3501 Blast hits to 3480 proteins in 730 species: Archae - 45; Bacteria - 2714; Metazoa - 82; Fungi - 3; Plants - 82; Viruses - 1; Other Eukaryotes - 574 (source: NCBI BLink).
AT5G13280AT5G13280.1ATAACCGGAAAsp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH).
AT5G13340AT5G13340.1GTCCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G10890.1); Has 84499 Blast hits to 39808 proteins in 1650 species: Archae - 415; Bacteria - 7950; Metazoa - 42451; Fungi - 5813; Plants - 2221; Viruses - 437; Other Eukaryotes - 25212 (source: NCBI BLink).
AT5G13350AT5G13350.1TTAACCGGACauxin-responsive GH3 family protein; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: GH3 auxin-responsive promoter (InterPro:IPR004993); BEST Arabidopsis thaliana protein match is: auxin-responsive GH3 family protein (TAIR:AT5G13370.1); Has 800 Blast hits to 739 proteins in 112 species: Archae - 0; Bacteria - 240; Metazoa - 51; Fungi - 2; Plants - 218; Viruses - 0; Other Eukaryotes - 289 (source: NCBI BLink).
AT5G13490AT5G13490.1CTAACGGTEncodes mitochondrial ADP/ATP carrier
AT5G13490.2CTAACGGTEncodes mitochondrial ADP/ATP carrier
AT5G13500AT5G13500.1ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25265.1); Has 112 Blast hits to 97 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT5G13500.2ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25265.1); Has 112 Blast hits to 97 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT5G13500.3ACCGTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25265.1); Has 112 Blast hits to 97 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT5G13520AT5G13520.1CTAACGGTpeptidase M1 family protein; FUNCTIONS IN: metallopeptidase activity, binding, zinc ion binding; INVOLVED IN: proteolysis, leukotriene biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M1, membrane alanine aminopeptidase (InterPro:IPR001930), Peptidase M1, membrane alanine aminopeptidase, N-terminal (InterPro:IPR014782), Peptidase M1, leukotriene A4 hydrolase, aminopeptidase C-terminal (InterPro:IPR015211), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APM1 (AMINOPEPTIDASE M1); aminopeptidase (TAIR:AT4G33090.1); Has 5405 Blast hits to 5373 proteins in 1099 species: Archae - 78; Bacteria - 2335; Metazoa - 1533; Fungi - 322; Plants - 75; Viruses - 0; Other Eukaryotes - 1062 (source: NCBI BLink).
AT5G13680AT5G13680.1ATAACCGGTA subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.
AT5G13690AT5G13690.1ACCGGTTATalpha-N-acetylglucosaminidase family / NAGLU family; FUNCTIONS IN: alpha-N-acetylglucosaminidase activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-N-acetylglucosaminidase (InterPro:IPR007781); Has 254 Blast hits to 246 proteins in 93 species: Archae - 0; Bacteria - 100; Metazoa - 87; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT5G13840AT5G13840.1GACCGTTGGAFIZZY-RELATED 3 (FZR3); FUNCTIONS IN: signal transducer activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: FZR2 (FIZZY-RELATED 2); signal transducer (TAIR:AT4G22910.1); Has 36052 Blast hits to 18440 proteins in 539 species: Archae - 52; Bacteria - 4990; Metazoa - 16346; Fungi - 7057; Plants - 2837; Viruses - 0; Other Eukaryotes - 4770 (source: NCBI BLink).
AT5G13890AT5G13890.1TAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G13890.2TAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G13890.3TAACCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF716 (InterPro:IPR006904); Has 120 Blast hits to 118 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G13990AT5G13990.1AAAGTCAACGGTCA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G14100AT5G14100.1CCGTTAAAmember of NAP subfamily
AT5G14220AT5G14220.1CAAAGGCCCGTTAEncodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development.
AT5G14240AT5G14240.1CGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Phosducin (InterPro:IPR001200), Thioredoxin-like fold (InterPro:IPR012336); Has 750 Blast hits to 750 proteins in 282 species: Archae - 0; Bacteria - 2; Metazoa - 486; Fungi - 126; Plants - 51; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).
AT5G14250AT5G14250.1CTTAACCGEncodes subunit 3 of the COP9 signalosome.
AT5G14250.2CTTAACCGEncodes subunit 3 of the COP9 signalosome.
AT5G14430AT5G14430.1TTTAACCGCGTdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT5G14430.2TTTAACCGCGTdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT5G14450AT5G14450.1ACCGTTAGGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT3G26430.1); Has 1630 Blast hits to 1608 proteins in 80 species: Archae - 0; Bacteria - 59; Metazoa - 1; Fungi - 11; Plants - 1557; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G14640AT5G14640.1CTTAACCGSHAGGY-LIKE KINASE 13 (SK13); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATSK11; protein kinase/ protein serine/threonine kinase (TAIR:AT5G26751.1); Has 77993 Blast hits to 77020 proteins in 2468 species: Archae - 36; Bacteria - 6200; Metazoa - 32731; Fungi - 7832; Plants - 15487; Viruses - 357; Other Eukaryotes - 15350 (source: NCBI BLink).
AT5G14720AT5G14720.1CGGTTAAACCGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G79640.1); Has 89319 Blast hits to 87983 proteins in 2109 species: Archae - 58; Bacteria - 7891; Metazoa - 38520; Fungi - 7962; Plants - 17967; Viruses - 455; Other Eukaryotes - 16466 (source: NCBI BLink).
AT5G15020AT5G15020.1TTTAACGGCCCAAAAEncodes a homolog of the transcriptional repressor SIN3 (AT1G24190).
AT5G15350AT5G15350.1AAAACGCGGTTAAAplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, vacuole, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT4G12880.1); Has 768 Blast hits to 760 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 768; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G15400AT5G15400.1CGGTTAAGU-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 761 Blast hits to 744 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 440; Fungi - 133; Plants - 86; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT5G15500AT5G15500.1CCGTTGGATankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink).
AT5G15500.2CCGTTGGATankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink).
AT5G15610AT5G15610.1ACCGTTAGproteasome family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT3G02200.2); Has 290 Blast hits to 290 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 68; Plants - 36; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).
AT5G15610.2ACCGTTAGproteasome family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT3G02200.2); Has 290 Blast hits to 290 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 68; Plants - 36; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).
AT5G15920AT5G15920.1ATAACCGGACstructural maintenance of chromosomes (SMC) family protein (MSS2); FUNCTIONS IN: ATP binding; INVOLVED IN: chromosome segregation; LOCATED IN: chromosome, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395); BEST Arabidopsis thaliana protein match is: MIM (hypersensitive to MMS, irradiation and MMC); ATP binding (TAIR:AT5G61460.1); Has 53696 Blast hits to 28151 proteins in 1680 species: Archae - 715; Bacteria - 7485; Metazoa - 25639; Fungi - 3625; Plants - 1389; Viruses - 117; Other Eukaryotes - 14726 (source: NCBI BLink).
AT5G16130AT5G16130.1TTTAACGGCCCATAT40S ribosomal protein S7 (RPS7C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 221 species: Archae - 0; Bacteria - 0; Metazoa - 253; Fungi - 94; Plants - 107; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT5G16250AT5G16250.1CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G16260AT5G16260.1GACCGTTGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).
AT5G16290AT5G16290.1GTCCGGTTATacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink).
AT5G16290.2GTCCGGTTATacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink).
AT5G16300AT5G16300.1CCGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.1TAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.1TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.2CCGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.2TAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.2TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.3CCGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.3TAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16300.3TTTAACCGGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Vps51/Vps67 (InterPro:IPR014812); Has 204 Blast hits to 183 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 34; Plants - 24; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G16510AT5G16510.1CTTAACCGGGCTTTGreversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G16510.2CTTAACCGGGCTTTGreversibly glycosylated polypeptide, putative; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: response to salt stress; LOCATED IN: Golgi apparatus, cell junction, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1,4-glucan-protein synthase, UDP-forming (InterPro:IPR004901); BEST Arabidopsis thaliana protein match is: RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1); cellulose synthase (UDP-forming) (TAIR:AT3G02230.1); Has 134 Blast hits to 133 proteins in 31 species: Archae - 12; Bacteria - 3; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G16780AT5G16780.1ATAACCGGTCEncodes a protein belonging to SART-1 family. The gene is expressed in the basal region of the developing embryo during heart stage. Phenotypic analyses of dot2 mutants suggest that this protein plays a role in root, shoot, and flower development. dot2 mutants are dwarved plants that display an aberrant spurred leaf venation pattern and fail to flower. In the roots DOT2 appears to be require for normal meristem organization and maintenance and the proper expression of PIN and PLT genes.
AT5G16820AT5G16820.1TTTAACGGEncodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.
AT5G16820.2TTTAACGGEncodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes.
AT5G16890AT5G16890.1CGGTTAAGexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: ARAD1 (ARABINAN DEFICIENT 1); catalytic/ transferase, transferring glycosyl groups (TAIR:AT2G35100.1); Has 910 Blast hits to 909 proteins in 85 species: Archae - 0; Bacteria - 8; Metazoa - 213; Fungi - 4; Plants - 599; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT5G17010AT5G17010.1ATCCAACGGsugar transporter family protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtVGT1 (Arabidopsis thaliana vacuolar glucose transporter 1); carbohydrate transmembrane transporter/ fructose transmembrane transporter/ glucose transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G03090.1); Has 31731 Blast hits to 31285 proteins in 1543 species: Archae - 504; Bacteria - 18458; Metazoa - 4219; Fungi - 5272; Plants - 1381; Viruses - 2; Other Eukaryotes - 1895 (source: NCBI BLink).
AT5G17010.2ATCCAACGGsugar transporter family protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtVGT1 (Arabidopsis thaliana vacuolar glucose transporter 1); carbohydrate transmembrane transporter/ fructose transmembrane transporter/ glucose transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G03090.1); Has 31731 Blast hits to 31285 proteins in 1543 species: Archae - 504; Bacteria - 18458; Metazoa - 4219; Fungi - 5272; Plants - 1381; Viruses - 2; Other Eukaryotes - 1895 (source: NCBI BLink).
AT5G17010.3ATCCAACGGsugar transporter family protein; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtVGT1 (Arabidopsis thaliana vacuolar glucose transporter 1); carbohydrate transmembrane transporter/ fructose transmembrane transporter/ glucose transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G03090.1); Has 31731 Blast hits to 31285 proteins in 1543 species: Archae - 504; Bacteria - 18458; Metazoa - 4219; Fungi - 5272; Plants - 1381; Viruses - 2; Other Eukaryotes - 1895 (source: NCBI BLink).
AT5G17160AT5G17160.1CAACGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03130.1); Has 12169 Blast hits to 8569 proteins in 601 species: Archae - 46; Bacteria - 1807; Metazoa - 3709; Fungi - 1234; Plants - 314; Viruses - 113; Other Eukaryotes - 4946 (source: NCBI BLink).
AT5G17270AT5G17270.1TTTAACCGGTTCGtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G37130.1); Has 5379 Blast hits to 3587 proteins in 480 species: Archae - 397; Bacteria - 1752; Metazoa - 604; Fungi - 281; Plants - 148; Viruses - 0; Other Eukaryotes - 2197 (source: NCBI BLink).
AT5G17290AT5G17290.1GACCGGTTAAAutophagy protein ATG5. Forms a conjugate with ATG12 with an essential role in plant nutrient recycling. Mutants missing ATG5 display early senescence and are hypersensitive to nitrogen or carbon starvation, accompanied by a more rapid loss of organellar and cytoplasmic proteins.
AT5G17360AT5G17360.1CGGTTAAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: ATP dependent DNA ligase family protein (TAIR:AT1G66730.1); Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G17550AT5G17550.1CCGTTGGATPEX19-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome; CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); BEST Arabidopsis thaliana protein match is: PEX19-1 (peroxin 19-1) (TAIR:AT3G03490.1); Has 291 Blast hits to 285 proteins in 122 species: Archae - 0; Bacteria - 4; Metazoa - 130; Fungi - 93; Plants - 19; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).
AT5G17560AT5G17560.1ATCCAACGGBolA-like family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BolA-like protein (InterPro:IPR002634); BEST Arabidopsis thaliana protein match is: BolA-like family protein (TAIR:AT1G55805.1); Has 1368 Blast hits to 1368 proteins in 267 species: Archae - 2; Bacteria - 509; Metazoa - 31; Fungi - 15; Plants - 67; Viruses - 0; Other Eukaryotes - 744 (source: NCBI BLink).
AT5G17710AT5G17710.1ATCCAACGGTTAAAembryo defective 1241 (EMB1241); FUNCTIONS IN: protein binding, adenyl-nucleotide exchange factor activity, chaperone binding, protein homodimerization activity; INVOLVED IN: embryonic development ending in seed dormancy, protein folding; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GrpE nucleotide exchange factor (InterPro:IPR000740), GrpE nucleotide exchange factor, coiled-coil (InterPro:IPR013805), GrpE nucleotide exchange factor, head (InterPro:IPR009012); BEST Arabidopsis thaliana protein match is: co-chaperone grpE family protein (TAIR:AT1G36390.2); Has 5868 Blast hits to 5837 proteins in 1527 species: Archae - 92; Bacteria - 2831; Metazoa - 204; Fungi - 113; Plants - 94; Viruses - 7; Other Eukaryotes - 2527 (source: NCBI BLink).
AT5G17710.1CAACGGTCembryo defective 1241 (EMB1241); FUNCTIONS IN: protein binding, adenyl-nucleotide exchange factor activity, chaperone binding, protein homodimerization activity; INVOLVED IN: embryonic development ending in seed dormancy, protein folding; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GrpE nucleotide exchange factor (InterPro:IPR000740), GrpE nucleotide exchange factor, coiled-coil (InterPro:IPR013805), GrpE nucleotide exchange factor, head (InterPro:IPR009012); BEST Arabidopsis thaliana protein match is: co-chaperone grpE family protein (TAIR:AT1G36390.2); Has 5868 Blast hits to 5837 proteins in 1527 species: Archae - 92; Bacteria - 2831; Metazoa - 204; Fungi - 113; Plants - 94; Viruses - 7; Other Eukaryotes - 2527 (source: NCBI BLink).
AT5G17710.2ATCCAACGGTTAAAembryo defective 1241 (EMB1241); FUNCTIONS IN: protein binding, adenyl-nucleotide exchange factor activity, chaperone binding, protein homodimerization activity; INVOLVED IN: embryonic development ending in seed dormancy, protein folding; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GrpE nucleotide exchange factor (InterPro:IPR000740), GrpE nucleotide exchange factor, coiled-coil (InterPro:IPR013805), GrpE nucleotide exchange factor, head (InterPro:IPR009012); BEST Arabidopsis thaliana protein match is: co-chaperone grpE family protein (TAIR:AT1G36390.2); Has 5868 Blast hits to 5837 proteins in 1527 species: Archae - 92; Bacteria - 2831; Metazoa - 204; Fungi - 113; Plants - 94; Viruses - 7; Other Eukaryotes - 2527 (source: NCBI BLink).
AT5G17710.2CAACGGTCembryo defective 1241 (EMB1241); FUNCTIONS IN: protein binding, adenyl-nucleotide exchange factor activity, chaperone binding, protein homodimerization activity; INVOLVED IN: embryonic development ending in seed dormancy, protein folding; LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GrpE nucleotide exchange factor (InterPro:IPR000740), GrpE nucleotide exchange factor, coiled-coil (InterPro:IPR013805), GrpE nucleotide exchange factor, head (InterPro:IPR009012); BEST Arabidopsis thaliana protein match is: co-chaperone grpE family protein (TAIR:AT1G36390.2); Has 5868 Blast hits to 5837 proteins in 1527 species: Archae - 92; Bacteria - 2831; Metazoa - 204; Fungi - 113; Plants - 94; Viruses - 7; Other Eukaryotes - 2527 (source: NCBI BLink).
AT5G17840AT5G17840.1CCGGTATAGTCCGGTTATchaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 67 Blast hits to 67 proteins in 19 species: Archae - 0; Bacteria - 13; Metazoa - 3; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT5G18100AT5G18100.1CTTAACCGA putative peroxisomal CuZnSOD inducible by a high-light pulse.
AT5G18100.2CTTAACCGA putative peroxisomal CuZnSOD inducible by a high-light pulse.
AT5G18140AT5G18140.1TTTAACGGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G22360.1); Has 15420 Blast hits to 15415 proteins in 1898 species: Archae - 116; Bacteria - 5110; Metazoa - 3216; Fungi - 1289; Plants - 1204; Viruses - 8; Other Eukaryotes - 4477 (source: NCBI BLink).
AT5G18290AT5G18290.1ACCGTTAGBelongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER
AT5G18440AT5G18440.1TTAACCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink).
AT5G18440.2TTAACCGGTTTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink).
AT5G19770AT5G19770.1CGGTTAAGtubulin 3
AT5G19990AT5G19990.1TCCAACGG26S proteasome AAA-ATPase subunit
AT5G20010AT5G20010.1ATCCAACGGA member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression.
AT5G20010.1ATCCAACGGA member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression.
AT5G20020AT5G20020.1ATCCAACGGA member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression.
AT5G20020.1CTAACGGTA member of RAN GTPase gene family. Encodes a small soluble GTP-binding protein. Likely to be involved in nuclear translocation of proteins. May also be involved in cell cycle progression.
AT5G20140AT5G20140.1TTTAACCGSOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2358 (InterPro:IPR018790), SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT3G10130.1); Has 1348 Blast hits to 1346 proteins in 137 species: Archae - 10; Bacteria - 204; Metazoa - 88; Fungi - 0; Plants - 111; Viruses - 0; Other Eukaryotes - 935 (source: NCBI BLink).
AT5G20160AT5G20160.1CGGTTAAGribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT5G20160.2CGGTTAAGribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT5G20160.3CGGTTAAGribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT5G20510AT5G20510.1TTTAACGGAL5 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.
AT5G20790AT5G20790.1ATCCAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43110.1); Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G23290AT5G23290.1TAACGGGCPREFOLDIN 5 (PDF5); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin alpha subunit (InterPro:IPR011599); Has 365 Blast hits to 365 proteins in 170 species: Archae - 46; Bacteria - 3; Metazoa - 137; Fungi - 83; Plants - 26; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).
AT5G23300AT5G23300.1CAAACCGGTTAAdihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis
AT5G23300.1CCGGTTAAdihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis
AT5G23310AT5G23310.1TTAACCGGFe superoxide dismutase
AT5G23400AT5G23400.1ATCCAACGGTCdisease resistance family protein / LRR family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction, defense response; LOCATED IN: cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G33600.1); Has 65319 Blast hits to 21698 proteins in 820 species: Archae - 33; Bacteria - 4034; Metazoa - 25349; Fungi - 927; Plants - 30158; Viruses - 6; Other Eukaryotes - 4812 (source: NCBI BLink).
AT5G23740AT5G23740.1CCGGTTAAEncodes a putative ribosomal protein S11 (RPS11-beta).
AT5G23830AT5G23830.1CCGTTAAAMD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G23830.2CCGTTAAAMD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G23840.1); Has 35 Blast hits to 35 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G24020AT5G24020.1ATAAACCGTTAAAEncodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor.
AT5G24020.1TTAAACCGGTTAAGEncodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor.
AT5G24080AT5G24080.1TCCGGTTATprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: S-locus lectin protein kinase family protein (TAIR:AT2G19130.1); Has 83012 Blast hits to 81933 proteins in 3234 species: Archae - 50; Bacteria - 7141; Metazoa - 37012; Fungi - 6145; Plants - 18411; Viruses - 299; Other Eukaryotes - 13954 (source: NCBI BLink).
AT5G24360AT5G24360.1TTTAACCGATCCGGTTATINOSITOL REQUIRING 1-1 (IRE1-1); FUNCTIONS IN: endoribonuclease activity, producing 5'-phosphomonoesters, protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, mRNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyrrolo-quinoline quinone beta-propeller repeat (InterPro:IPR018391), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Ribonuclease L (InterPro:IPR010513), PUG (InterPro:IPR006567), Quinonprotein alcohol dehydrogenase-like (InterPro:IPR011047); BEST Arabidopsis thaliana protein match is: IRE1A; endoribonuclease/ kinase (TAIR:AT2G17520.1); Has 75799 Blast hits to 75146 proteins in 2975 species: Archae - 53; Bacteria - 6775; Metazoa - 33392; Fungi - 6711; Plants - 14901; Viruses - 376; Other Eukaryotes - 13591 (source: NCBI BLink).
AT5G24450AT5G24450.1CGAACCGGTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49410.1); Has 598 Blast hits to 569 proteins in 160 species: Archae - 0; Bacteria - 19; Metazoa - 191; Fungi - 117; Plants - 57; Viruses - 10; Other Eukaryotes - 204 (source: NCBI BLink).
AT5G24710AT5G24710.1ATCCAACGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 46946 Blast hits to 23834 proteins in 1336 species: Archae - 160; Bacteria - 9572; Metazoa - 15324; Fungi - 6794; Plants - 1938; Viruses - 1106; Other Eukaryotes - 12052 (source: NCBI BLink).
AT5G24750AT5G24750.1TAACCGGTTTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 976 Blast hits to 975 proteins in 299 species: Archae - 0; Bacteria - 617; Metazoa - 1; Fungi - 251; Plants - 63; Viruses - 14; Other Eukaryotes - 30 (source: NCBI BLink).
AT5G25070AT5G25070.1TTTCCGGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae - 1252; Bacteria - 11295; Metazoa - 39436; Fungi - 6166; Plants - 3117; Viruses - 367; Other Eukaryotes - 20051 (source: NCBI BLink).
AT5G25240AT5G25240.1CAACGGTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT5G14890.1); Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G25475AT5G25475.1TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G25475.2TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G25475.3TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis th