version

Summary of CAACA (All list)

Organism Arabidopsis thaliana
PLACE Motif CAACA
Description Binding consensus sequence of Arabidopsis (A.t.) transcription factor, RAV1; RAV1 specifically binds to DNA with bipartite sequence motifs of RAV1-A (CAACA) and RAV1-B (CACCTG); RAV1 protein contain AP2-like and B3-like domains; The AP2-like and B3-like domains recognize the CAACA and CACCTG motifs, respectively; The expression level of RAV1 were relatively high in rosette leaves and roots; See S000315(CACCTG);
Total Entry Count 207

Entry Sequences (207 entries)

LocusGene modelSequenceDescription
AT1G02080AT1G02080.1GCCCAACAtranscriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink).
AT1G02180AT1G02180.1GAGCCCAACAferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02770AT1G02770.1CAAGGCCCAACAAAAGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19060.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03200AT1G03200.1CAAAGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G04170AT1G04170.1TGTTGGGCCAAprotein synthesis initiation factor eIF2 gamma
AT1G04985AT1G04985.1TGTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05940AT1G05940.1TGTTGGGCCCAATGEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.
AT1G08130AT1G08130.1TTGGCCCAACAEncodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. Indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus.
AT1G12730AT1G12730.1AGCCCAACAcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT1G12730.2AGCCCAACAcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT1G14340AT1G14340.1TTAAAGGCCCAACARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / oxidoreductase (TAIR:AT3G01210.1); Has 201 Blast hits to 201 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 59; Plants - 135; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G15420AT1G15420.1TAAGTCGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function NUC189, C-terminal (InterPro:IPR012979); Has 698 Blast hits to 572 proteins in 149 species: Archae - 0; Bacteria - 42; Metazoa - 236; Fungi - 117; Plants - 61; Viruses - 27; Other Eukaryotes - 215 (source: NCBI BLink).
AT1G15440AT1G15440.1GCCCAACAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15440.2GCCCAACAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15460AT1G15460.1GTAGGCCCAACAEncodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions.
AT1G16790AT1G16790.1TGGGCCCAAGCCCAACAribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23750AT1G23750.1ATAAGCCCAACADNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G25490AT1G25490.1TTAAAGCCCAACAOne of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem
AT1G25530AT1G25530.1GAGCCCAACAlysine and histidine specific transporter, putative; FUNCTIONS IN: amino acid transmembrane transporter activity; INVOLVED IN: amino acid transport; LOCATED IN: membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: lysine and histidine specific transporter, putative (TAIR:AT1G67640.1); Has 2150 Blast hits to 2144 proteins in 183 species: Archae - 2; Bacteria - 19; Metazoa - 787; Fungi - 349; Plants - 832; Viruses - 0; Other Eukaryotes - 161 (source: NCBI BLink).
AT1G26230AT1G26230.1TCGGCCCAACAchaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24360 Blast hits to 24320 proteins in 5137 species: Archae - 390; Bacteria - 14007; Metazoa - 1488; Fungi - 952; Plants - 459; Viruses - 2; Other Eukaryotes - 7062 (source: NCBI BLink).
AT1G26230.1TGTTGGGCCCGAACCAchaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24360 Blast hits to 24320 proteins in 5137 species: Archae - 390; Bacteria - 14007; Metazoa - 1488; Fungi - 952; Plants - 459; Viruses - 2; Other Eukaryotes - 7062 (source: NCBI BLink).
AT1G28120AT1G28120.1TGTTGGGCCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin thioesterase Otubain (InterPro:IPR016615), Ovarian tumour, otubain (InterPro:IPR003323); Has 295 Blast hits to 295 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 50; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G32310AT1G32310.1TGTTGGGCTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G33250AT1G33250.1TGTTGGGCTTTfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G43170AT1G43170.1TGTTGGGCTTTAGGCCCAAAAEncodes a cytoplasmic ribosomal protein.
AT1G43170.2TGTTGGGCTTTAGGCCCAAAAEncodes a cytoplasmic ribosomal protein.
AT1G43170.3TGTTGGGCTTTAGGCCCAAAAEncodes a cytoplasmic ribosomal protein.
AT1G43170.4TGTTGGGCTTTAGGCCCAAAAEncodes a cytoplasmic ribosomal protein.
AT1G44835AT1G44835.1TGTTGGGCCTTTTYbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
AT1G44835.2TGTTGGGCCTTTTYbaK/prolyl-tRNA synthetase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YbaK/aminoacyl-tRNA synthetase associated region (InterPro:IPR007214); Has 745 Blast hits to 744 proteins in 221 species: Archae - 0; Bacteria - 335; Metazoa - 45; Fungi - 5; Plants - 21; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink).
AT1G50120AT1G50120.1TGTTGGGCTCATGTTGGGCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rgp1 (InterPro:IPR014848), Immunoglobulin E-set (InterPro:IPR014756); Has 110 Blast hits to 108 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 10; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G52270AT1G52270.1TGAGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28310.1); Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G61770AT1G61770.1ATGGCCCAACAJ domain protein.
AT1G66730AT1G66730.1TGTTGGGCTTTGATP dependent DNA ligase family protein; FUNCTIONS IN: DNA binding, DNA ligase (ATP) activity, ATP binding; INVOLVED IN: DNA repair, DNA replication, DNA recombination; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), DNA ligase, N-terminal (InterPro:IPR012308), ATP dependent DNA ligase, central (InterPro:IPR012310), ATP-dependent DNA ligase, conserved site (InterPro:IPR016059), DNA repair metallo-beta-lactamase (InterPro:IPR011084), ATP dependent DNA ligase, C-terminal (InterPro:IPR012309), ATP-dependent DNA ligase (InterPro:IPR000977); BEST Arabidopsis thaliana protein match is: ATLIG1 (ARABIDOPSIS THALIANA DNA LIGASE 1); ATP binding / DNA binding / DNA ligase (ATP) (TAIR:AT1G08130.1); Has 3133 Blast hits to 3071 proteins in 628 species: Archae - 227; Bacteria - 996; Metazoa - 564; Fungi - 431; Plants - 130; Viruses - 148; Other Eukaryotes - 637 (source: NCBI BLink).
AT1G67320AT1G67320.1ATATGGGCCCATTAATAGGCCCAACADNA primase, large subunit family; FUNCTIONS IN: DNA primase activity; INVOLVED IN: DNA replication, synthesis of RNA primer; LOCATED IN: alpha DNA polymerase:primase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA primase, large subunit, eukaryotic (InterPro:IPR016558), DNA primase, large subunit, eukaryotic/archaeal (InterPro:IPR007238); Has 329 Blast hits to 325 proteins in 153 species: Archae - 6; Bacteria - 0; Metazoa - 133; Fungi - 93; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT1G67970AT1G67970.1TGTTGGGCCAAmember of Heat Stress Transcription Factor (Hsf) family
AT1G68720AT1G68720.1GAAGCCCAACATRNA ARGININE ADENOSINE DEAMINASE (TADA); FUNCTIONS IN: hydrolase activity, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT5G28050.1); Has 19163 Blast hits to 15661 proteins in 1596 species: Archae - 115; Bacteria - 4851; Metazoa - 4895; Fungi - 796; Plants - 406; Viruses - 57; Other Eukaryotes - 8043 (source: NCBI BLink).
AT1G70730AT1G70730.1TGTTGGGCCTTGphosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative; FUNCTIONS IN: intramolecular transferase activity, phosphotransferases, magnesium ion binding, phosphoglucomutase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-D-phosphohexomutase, conserved site (InterPro:IPR016066), Alpha-D-phosphohexomutase, C-terminal (InterPro:IPR005843), Alpha-D-phosphohexomutase, alpha/beta/alpha I, II and III (InterPro:IPR016055), Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (InterPro:IPR005846), Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (InterPro:IPR005845), Alpha-D-phosphohexomutase, N-terminal (InterPro:IPR005841), Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (InterPro:IPR005844); BEST Arabidopsis thaliana protein match is: phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative (TAIR:AT1G23190.1).
AT1G71100AT1G71100.1TGTTGGGCTCEncodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis.
AT1G72710AT1G72710.1TACGGCCCAACAEncodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus.
AT1G74410AT1G74410.1GTGGCCCAACAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G66070.1); Has 5472 Blast hits to 5456 proteins in 200 species: Archae - 0; Bacteria - 2; Metazoa - 1838; Fungi - 348; Plants - 2530; Viruses - 21; Other Eukaryotes - 733 (source: NCBI BLink).
AT1G76860AT1G76860.1TGTTGGGCTsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G21190.1); Has 944 Blast hits to 944 proteins in 205 species: Archae - 232; Bacteria - 0; Metazoa - 303; Fungi - 144; Plants - 105; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT1G77690AT1G77690.1TATGGCCCATAAGCCCAACAEncodes an auxin influx carrier LAX3 (Like Aux1) that promotes lateral root emergence. Auxin-induced expression of LAX3 in turn induces a selection of cell-wall-remodelling enzymes, which are likely to promote cell separation in advance of developing lateral root primordia.
AT1G77750AT1G77750.1CAAAGCCCAACACGTCA30S ribosomal protein S13, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: mitochondrion, small ribosomal subunit, chloroplast, mitochondrial small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast (CS13) (TAIR:AT5G14320.1); Has 5725 Blast hits to 5725 proteins in 1762 species: Archae - 116; Bacteria - 2963; Metazoa - 147; Fungi - 105; Plants - 348; Viruses - 0; Other Eukaryotes - 2046 (source: NCBI BLink).
AT1G78590AT1G78590.1TGTTGGGCTCEncodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate.
AT1G78800AT1G78800.1TGTTGGGCTglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: SUS5; UDP-glycosyltransferase/ sucrose synthase (TAIR:AT5G37180.1); Has 9928 Blast hits to 9895 proteins in 1204 species: Archae - 399; Bacteria - 5805; Metazoa - 243; Fungi - 183; Plants - 319; Viruses - 0; Other Eukaryotes - 2979 (source: NCBI BLink).
AT1G79280AT1G79280.1GAAGCCCAACAEncodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development.
AT1G79340AT1G79340.1TGTTGGGCTTAmetacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).
AT1G80080AT1G80080.1AATAGCCCAACAEncodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development.
AT1G80080.1TAGGGCCCAACAEncodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development.
AT1G80230AT1G80230.1CCAGGCCCAACAcytochrome c oxidase family protein; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrial envelope, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT3G15640.1); Has 341 Blast hits to 341 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 189; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT2G01140AT2G01140.1GCCCAACAfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: response to oxidative stress, response to cadmium ion, pentose-phosphate shunt; LOCATED IN: mitochondrion, chloroplast, plastoglobule; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4200 Blast hits to 4196 proteins in 676 species: Archae - 0; Bacteria - 431; Metazoa - 1018; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2410 (source: NCBI BLink).
AT2G24490AT2G24490.1GCCCAACAEncodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1.
AT2G24490.2GCCCAACAEncodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1.
AT2G28230AT2G28230.1TGTTGGGCCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TATA-binding related factor (InterPro:IPR013921); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09070.1); Has 43 Blast hits to 43 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G28390AT2G28390.1AAAAGCCCAACASAND family protein; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar fusion protein MON1 (InterPro:IPR004353); Has 646 Blast hits to 487 proteins in 169 species: Archae - 4; Bacteria - 33; Metazoa - 275; Fungi - 161; Plants - 29; Viruses - 2; Other Eukaryotes - 142 (source: NCBI BLink).
AT2G32980AT2G32980.1TGTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 31; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G35750AT2G35750.1ATGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G36230AT2G36230.1TGTTGGGCEncodes a BBMII isomerase involved in histidine biosynthesis.
AT2G36885AT2G36885.1TGTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT2G36885.2TGTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT2G36990AT2G36990.1ATTTGGGCTTTTAAGCCCAATATAAGGCCCAACAEncodes a general sigma factor in chloroplasts and is probably responsible for the recognition of sigma 70 type standard bacteria-type multi-subunit RNA polymerase (PEP) promoters in young cotyledons.
AT2G37270AT2G37270.1AAAAGCCCAACATAAGCCCAATAAOne of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A.
AT2G37270.2AAAAGCCCAACATAAGCCCAATAAOne of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A.
AT2G37340AT2G37340.1ATAAGGCCCAACAencodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks.
AT2G39445AT2G39445.1TTAAAGGCCCATTCGAGGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: PIG-P (InterPro:IPR013717), Phosphatidylinositol N-acetylglucosaminyltransferase, GPI19/PIG-P subunit (InterPro:IPR016542); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61280.1); Has 228 Blast hits to 228 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 60; Plants - 24; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT2G40020AT2G40020.1GCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink).
AT2G40020.2GCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink).
AT2G40020.3GCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WIYLD domain (InterPro:IPR018848); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G45248.5); Has 5871 Blast hits to 3101 proteins in 244 species: Archae - 15; Bacteria - 225; Metazoa - 2760; Fungi - 445; Plants - 149; Viruses - 184; Other Eukaryotes - 2093 (source: NCBI BLink).
AT2G42000AT2G42000.1TGTTGGGCTTGplant EC metallothionein-like family 15 protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Plant EC metallothionein-like protein, family 15 (InterPro:IPR000316); BEST Arabidopsis thaliana protein match is: plant EC metallothionein-like family 15 protein (TAIR:AT2G23240.1); Has 244 Blast hits to 203 proteins in 65 species: Archae - 0; Bacteria - 4; Metazoa - 92; Fungi - 4; Plants - 97; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT2G42160AT2G42160.1TGTTGGGCzinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).
AT2G42700AT2G42700.1AAAAAGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport, vesicle docking during exocytosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Sec1-like protein (InterPro:IPR001619); Has 95 Blast hits to 92 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT2G43360AT2G43360.1AAAAAGCCCAACACatalyzes the conversion of dethiobiotin to biotin.
AT2G43370AT2G43370.1TGTTGGGCTTTTTU1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink).
AT2G44520AT2G44520.1ATGGCCCAACAcytochrome c oxidase 10 (COX10); FUNCTIONS IN: protoheme IX farnesyltransferase activity, prenyltransferase activity; INVOLVED IN: heme biosynthetic process; LOCATED IN: integral to membrane, mitochondrial membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protohaem IX farnesyltransferase, mitochondria (InterPro:IPR016315), Protohaem IX farnesyltransferase (InterPro:IPR006369), UbiA prenyltransferase (InterPro:IPR000537); Has 6172 Blast hits to 6172 proteins in 1140 species: Archae - 109; Bacteria - 2789; Metazoa - 160; Fungi - 121; Plants - 40; Viruses - 0; Other Eukaryotes - 2953 (source: NCBI BLink).
AT2G44920AT2G44920.1TGTTGGGCCTAAAthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink).
AT2G44920.2TGTTGGGCCTAAAthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink).
AT2G45300AT2G45300.1TTAAGGCCCAACAencodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis
AT2G45690AT2G45690.1TGTTGGGCTATTTAATTGGGCCTAAAEncodes a protein with similarity to yeast Pep16p, a membrane localized protein involved in peroxisome assembly and protein-trafficking. SSE1 mutant seeds do not accumulate oils and dessicated seeds have a shrunken appearance. Involved in protein and oil body biogenesis. SSE is expressed during seed development, reaching the highest peak in mature siliques. Expression in leaves and roots is low compared to cotyledons and flowers. Located in peroxisomes and endoplasmic reticulum. Homologous to the peroxin PEX16 and complements the pex16 mutants of the yeast Yarrowia lipolytica.
AT2G47170AT2G47170.1AAAAGCCCAACAGene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.
AT3G02160AT3G02160.1TGTTGGGCCAADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15570.1); Has 126 Blast hits to 126 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT3G03100AT3G03100.1AGCCCAACANADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 1253 Blast hits to 1253 proteins in 224 species: Archae - 0; Bacteria - 240; Metazoa - 121; Fungi - 52; Plants - 29; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).
AT3G03100.2AGCCCAACANADH:ubiquinone oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH:ubiquinone oxidoreductase 17.2 kD subunit (InterPro:IPR007763); Has 1253 Blast hits to 1253 proteins in 224 species: Archae - 0; Bacteria - 240; Metazoa - 121; Fungi - 52; Plants - 29; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).
AT3G03250AT3G03250.1TGTTGGGCTATTIs thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding.
AT3G05700AT3G05700.1GTGGCCCAACAINVOLVED IN: response to water deprivation; CONTAINS InterPro DOMAIN/s: Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT5G26990.1); Has 167 Blast hits to 167 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 0; Plants - 128; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G06300AT3G06300.1TGTTGGGCCTTTTEncodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins.
AT3G06455AT3G06455.1GAAGCCCAACAsplicing factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT4G01000.1); Has 5886 Blast hits to 2871 proteins in 525 species: Archae - 0; Bacteria - 0; Metazoa - 2661; Fungi - 609; Plants - 1364; Viruses - 154; Other Eukaryotes - 1098 (source: NCBI BLink).
AT3G06455.1TTAGCCCAACAsplicing factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT4G01000.1); Has 5886 Blast hits to 2871 proteins in 525 species: Archae - 0; Bacteria - 0; Metazoa - 2661; Fungi - 609; Plants - 1364; Viruses - 154; Other Eukaryotes - 1098 (source: NCBI BLink).
AT3G06455.1TTAGCCCAACAsplicing factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT4G01000.1); Has 5886 Blast hits to 2871 proteins in 525 species: Archae - 0; Bacteria - 0; Metazoa - 2661; Fungi - 609; Plants - 1364; Viruses - 154; Other Eukaryotes - 1098 (source: NCBI BLink).
AT3G06540AT3G06540.1AGATGGGCCATGTTGGGCCGATGDP dissociation inhibitor family protein / Rab GTPase activator family protein; FUNCTIONS IN: RAB GDP-dissociation inhibitor activity; INVOLVED IN: intracellular protein transport, regulation of GTPase activity, protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rab GTPase activator (InterPro:IPR002005), Rab protein geranylgeranyltransferase component A, eukaryota (InterPro:IPR016664), Yeast Mrs6p protein (InterPro:IPR000632), GDP dissociation inhibitor (InterPro:IPR018203); BEST Arabidopsis thaliana protein match is: ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation inhibitor (TAIR:AT2G44100.2); Has 948 Blast hits to 858 proteins in 184 species: Archae - 0; Bacteria - 2; Metazoa - 512; Fungi - 195; Plants - 103; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink).
AT3G09200AT3G09200.1AAAAGGCCCAACA60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).
AT3G09200.2AAAAGGCCCAACA60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).
AT3G09470AT3G09470.1ATTGGCCCAGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).
AT3G09470.2ATTGGCCCAGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF895, eukaryotic (InterPro:IPR010291), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); Has 638 Blast hits to 624 proteins in 112 species: Archae - 2; Bacteria - 10; Metazoa - 433; Fungi - 116; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).
AT3G10160AT3G10160.1TGTTGGGCTTAGGCCCAAGEncodes a protein with tetrahydrofolylpolyglutamate synthase activity that is located in the mitochondrial matrix.
AT3G13360AT3G13360.1TGTTGGGCTCAWPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT3G16190AT3G16190.1TGTTGGGCCGAAisochorismatase hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); Has 3706 Blast hits to 3703 proteins in 851 species: Archae - 95; Bacteria - 2998; Metazoa - 0; Fungi - 127; Plants - 43; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink).
AT3G16640AT3G16640.1AGCCCAACAEncodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well.
AT3G16650AT3G16650.1TGTTGGGCTPP1/PP2A phosphatases pleiotropic regulator 2 (PRL2); FUNCTIONS IN: nucleotide binding; INVOLVED IN: response to salt stress; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PRL1 (PLEIOTROPIC REGULATORY LOCUS 1); basal transcription repressor/ nucleotide binding / protein binding (TAIR:AT4G15900.1); Has 58179 Blast hits to 24123 proteins in 639 species: Archae - 64; Bacteria - 6308; Metazoa - 27345; Fungi - 10914; Plants - 5200; Viruses - 0; Other Eukaryotes - 8348 (source: NCBI BLink).
AT3G17680AT3G17680.1TAAGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48405.1); Has 75 Blast hits to 73 proteins in 16 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 2; Plants - 52; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT3G17890AT3G17890.1TTGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 6 species: Archae - 0; Bacteria - 4; Metazoa - 5; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G19520AT3G19520.1AAGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G19520.2AAGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G21790AT3G21790.1ATCGGCCCAACAUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B8 (UDP-GLUCOSYL TRANSFERASE 71B8); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 4'-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G21800.1); Has 4493 Blast hits to 4475 proteins in 265 species: Archae - 0; Bacteria - 82; Metazoa - 1698; Fungi - 10; Plants - 2668; Viruses - 11; Other Eukaryotes - 24 (source: NCBI BLink).
AT3G24860AT3G24860.1TGTTGGGCCCAAAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT2G44730.1); Has 700 Blast hits to 557 proteins in 131 species: Archae - 0; Bacteria - 29; Metazoa - 100; Fungi - 40; Plants - 346; Viruses - 61; Other Eukaryotes - 124 (source: NCBI BLink).
AT3G26340AT3G26340.1ATGGCCCATGAAGCCCAACA20S proteasome beta subunit E, putative; FUNCTIONS IN: endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), 20S proteasome, A and B subunits (InterPro:IPR001353); BEST Arabidopsis thaliana protein match is: PBE1; endopeptidase/ peptidase/ threonine-type endopeptidase (TAIR:AT1G13060.1); Has 4428 Blast hits to 4424 proteins in 409 species: Archae - 476; Bacteria - 181; Metazoa - 1589; Fungi - 914; Plants - 555; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).
AT3G26400AT3G26400.1CTAATGGGCTATTGTTGGGCTCmember of eIF4B - eukaryotic initiation factor 4B
AT3G27020AT3G27020.1TGAGCCCAACAArabidopsis thaliana metal-nicotianamine transporter YSL6
AT3G27300AT3G27300.1TGTTGGGCglucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).
AT3G27300.2TGTTGGGCglucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).
AT3G27300.3TGTTGGGCglucose-6-phosphate dehydrogenase 5 (G6PD5); FUNCTIONS IN: glucose-6-phosphate dehydrogenase activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt, oxidative branch, glucose metabolic process; LOCATED IN: cytosol, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose-6-phosphate dehydrogenase (InterPro:IPR001282); BEST Arabidopsis thaliana protein match is: G6PD6 (GLUCOSE-6-PHOSPHATE DEHYDROGENASE 6); glucose-6-phosphate dehydrogenase (TAIR:AT5G40760.1); Has 5512 Blast hits to 5496 proteins in 1288 species: Archae - 0; Bacteria - 3299; Metazoa - 673; Fungi - 121; Plants - 283; Viruses - 2; Other Eukaryotes - 1134 (source: NCBI BLink).
AT3G45030AT3G45030.1GTTGGGCCCAACAAGCCCATATA40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).
AT3G49680AT3G49680.1TGTTGGGCTEncodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT3G49680.1TGTTGGGCTEncodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT3G49680.2TGTTGGGCTEncodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT3G49680.2TGTTGGGCTEncodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT3G51110AT3G51110.1TGTTGGGCCTTATcrooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3183 Blast hits to 1420 proteins in 170 species: Archae - 2; Bacteria - 8; Metazoa - 1451; Fungi - 897; Plants - 412; Viruses - 0; Other Eukaryotes - 413 (source: NCBI BLink).
AT3G51880AT3G51880.1GCCCAACAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G51880.2GCCCAACAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G51880.3GCCCAACAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G54440AT3G54440.1TGTTGGGCTTAglycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).
AT3G54440.2TGTTGGGCTTAglycoside hydrolase family 2 protein; FUNCTIONS IN: carbohydrate binding, cation binding, beta-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, guard cell; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase family 2, immunoglobulin-like beta-sandwich (InterPro:IPR006102), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 42, domain 5 (InterPro:IPR004199), Glycoside hydrolase family 2, TIM barrel (InterPro:IPR006103), Glycoside hydrolase, family 2 (InterPro:IPR006101), Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718), Glycoside hydrolase family 2, carbohydrate-binding (InterPro:IPR006104), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Glycoside hydrolase, families 2 and 20, immunoglobulin-like beta-sandwich (InterPro:IPR013812), Galactose-binding like (InterPro:IPR008979); Has 3912 Blast hits to 3882 proteins in 802 species: Archae - 5; Bacteria - 2505; Metazoa - 162; Fungi - 155; Plants - 26; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).
AT3G57490AT3G57490.1TGTTGGGCCTTAG40S ribosomal protein S2 (RPS2D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 6002 Blast hits to 5992 proteins in 1677 species: Archae - 183; Bacteria - 2906; Metazoa - 580; Fungi - 160; Plants - 108; Viruses - 0; Other Eukaryotes - 2065 (source: NCBI BLink).
AT4G00170AT4G00170.1TGTTGGGCTAAvesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT4G00170.1TGTTGGGCTTATvesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 758 Blast hits to 742 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 363; Fungi - 101; Plants - 232; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT4G00250AT4G00250.1TGTTGGGCTTADNA-binding storekeeper protein-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: DNA-binding storekeeper protein-related (TAIR:AT4G00238.1); Has 484 Blast hits to 439 proteins in 80 species: Archae - 0; Bacteria - 4; Metazoa - 135; Fungi - 94; Plants - 162; Viruses - 0; Other Eukaryotes - 89 (source: NCBI BLink).
AT4G00290AT4G00290.1TAAGCCCAACAmechanosensitive ion channel domain-containing protein / MS ion channel domain-containing protein; LOCATED IN: chloroplast, membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mechanosensitive ion channel MscS, transmembrane-2 (InterPro:IPR011014), Mechanosensitive ion channel MscS (InterPro:IPR006685), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00234.1); Has 8044 Blast hits to 8044 proteins in 1230 species: Archae - 282; Bacteria - 5483; Metazoa - 2; Fungi - 2; Plants - 99; Viruses - 0; Other Eukaryotes - 2176 (source: NCBI BLink).
AT4G02820AT4G02820.1CAAGGCCCAACApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02150.1); Has 6981 Blast hits to 3279 proteins in 125 species: Archae - 0; Bacteria - 14; Metazoa - 76; Fungi - 59; Plants - 6627; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).
AT4G04670AT4G04670.1TGTTGGGCTTTTTMet-10+ like family protein / kelch repeat-containing protein; INVOLVED IN: wybutosine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Protein of unknown function Met10 (InterPro:IPR003402), Kelch-type beta propeller (InterPro:IPR015915), tRNA wybutosine-synthesizing protein (InterPro:IPR003827); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G18610.1); Has 8151 Blast hits to 4692 proteins in 304 species: Archae - 337; Bacteria - 119; Metazoa - 3836; Fungi - 887; Plants - 1022; Viruses - 20; Other Eukaryotes - 1930 (source: NCBI BLink).
AT4G08500AT4G08500.1GAAGCCCAACAMember of MAP Kinase Kinase gene family. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates AtMEK1.
AT4G08940AT4G08940.1TTAGCCCATATCAAAGGCCCAACAubiquitin thiolesterase; FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: response to oxidative stress; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase (TAIR:AT4G01037.1); Has 214 Blast hits to 214 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G10050AT4G10050.1ATATGGGCCTAAAATGGCCCAACAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073), Protein phosphatase methylesterase, eukaryotic (InterPro:IPR016812); Has 5040 Blast hits to 5015 proteins in 887 species: Archae - 30; Bacteria - 3229; Metazoa - 308; Fungi - 169; Plants - 67; Viruses - 7; Other Eukaryotes - 1230 (source: NCBI BLink).
AT4G12510AT4G12510.1GCCCAACAprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: lipid transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT4G12520.1); Has 534 Blast hits to 530 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 534; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G16180AT4G16180.1ATGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown.
AT4G16180.2ATGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown.
AT4G17650AT4G17650.1ATAAAGCCCATTGGGCCCAACAaromatic-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Has 1885 Blast hits to 1881 proteins in 667 species: Archae - 0; Bacteria - 1017; Metazoa - 157; Fungi - 73; Plants - 26; Viruses - 1; Other Eukaryotes - 611 (source: NCBI BLink).
AT4G18975AT4G18975.1TGTTGGGCTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G18975.2TGTTGGGCTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G18975.3TGTTGGGCTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: emb1417 (embryo defective 1417) (TAIR:AT4G21190.1); Has 60 Blast hits to 60 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G21660AT4G21660.1TGTTGGGCCTATTproline-rich spliceosome-associated (PSP) family protein; INVOLVED IN: mRNA processing; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Protein of unknown function DUF382 (InterPro:IPR007180); BEST Arabidopsis thaliana protein match is: pliceosome associated protein-related (TAIR:AT1G11520.1); Has 12288 Blast hits to 5916 proteins in 388 species: Archae - 20; Bacteria - 224; Metazoa - 7139; Fungi - 832; Plants - 388; Viruses - 239; Other Eukaryotes - 3446 (source: NCBI BLink).
AT4G24440AT4G24440.1TATATGGGCCTTGTGTTGGGCCTTtranscription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G24440.2TATATGGGCCTTGTGTTGGGCCTTtranscription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G25500AT4G25500.1TGTTGGGCTTCencodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined.
AT4G26870AT4G26870.1TGTGGGCCTTTCAAGCCCAACAaspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G31180.2); Has 18508 Blast hits to 15212 proteins in 1719 species: Archae - 299; Bacteria - 10385; Metazoa - 672; Fungi - 662; Plants - 233; Viruses - 0; Other Eukaryotes - 6257 (source: NCBI BLink).
AT4G26940AT4G26940.1TTAGCCCAACAgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G05170.1); Has 879 Blast hits to 874 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 544; Fungi - 7; Plants - 299; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT4G26940.2TTAGCCCAACAgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G05170.1); Has 879 Blast hits to 874 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 544; Fungi - 7; Plants - 299; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT4G27090AT4G27090.1TGTTGGGCCTTTG60S ribosomal protein L14 (RPL14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14A) (TAIR:AT2G20450.1); Has 520 Blast hits to 520 proteins in 229 species: Archae - 47; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT4G28060AT4G28060.1GAGCCCAACAcytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT5G57815.1); Has 406 Blast hits to 406 proteins in 117 species: Archae - 0; Bacteria - 0; Metazoa - 235; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT4G34620AT4G34620.1TGGCCCAACATGGCCCATCTEncodes ribosomal protein S16, has embryo-defective lethal mutant phenotype
AT4G38170AT4G38170.1TGTTGGGCCTACFAR1-related sequence 9 (FRS9); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PMZ-type (InterPro:IPR006564), MULE transposase, conserved domain (InterPro:IPR018289), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS5 (FAR1-related sequence 5); zinc ion binding (TAIR:AT4G38180.1); Has 575 Blast hits to 561 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 571; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G02100AT5G02100.1ATAAAGCCCAACAEncodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent.
AT5G02410AT5G02410.1TAAAAGCCCAACADIE2/ALG10 family; FUNCTIONS IN: transferase activity, transferring hexosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-1, 2 glucosyltransferase Alg10 (InterPro:IPR016900), Glycosyltransferase, ALG10 (InterPro:IPR007006); Has 269 Blast hits to 222 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 103; Fungi - 131; Plants - 14; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT5G02450AT5G02450.1GTTTGGGCCCAACA60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT5G03495AT5G03495.1CAAGGCCCAACAnucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT5G03480.1); Has 94 Blast hits to 60 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT5G03740AT5G03740.1TGTTGGGCTAAHD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression
AT5G04130AT5G04130.1TGTTGGGCTTTGDNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink).
AT5G04130.2TGTTGGGCTTTGDNA topoisomerase, ATP-hydrolyzing, putative / DNA topoisomerase II, putative / DNA gyrase, putative; FUNCTIONS IN: DNA topoisomerase (ATP-hydrolyzing) activity, DNA binding, ATP binding; INVOLVED IN: DNA topological change, DNA metabolic process; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IIA, conserved site (InterPro:IPR018522), DNA topoisomerase, type IIA, subunit B, region 2 (InterPro:IPR013506), DNA topoisomerase, type IIA, subunit B (InterPro:IPR000565), ATP-binding region, ATPase-like (InterPro:IPR003594), DNA topoisomerase, type IIA, subunit B, C-terminal (InterPro:IPR002288), DNA topoisomerase, type IIA, subunit B or N-terminal (InterPro:IPR001241), DNA topoisomerase, type IIA, subunit B or N-terminal, alpha-beta (InterPro:IPR013759), TOPRIM (InterPro:IPR006171), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), DNA topoisomerase, type IIA, central (InterPro:IPR013760); BEST Arabidopsis thaliana protein match is: ATP binding / DNA binding / DNA topoisomerase (ATP-hydrolyzing) (TAIR:AT3G10270.1); Has 23506 Blast hits to 21729 proteins in 4482 species: Archae - 75; Bacteria - 14076; Metazoa - 167; Fungi - 179; Plants - 62; Viruses - 72; Other Eukaryotes - 8875 (source: NCBI BLink).
AT5G04440AT5G04440.1TGTTGGGCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31115.2); Has 213 Blast hits to 213 proteins in 56 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT5G04800AT5G04800.1AATAGGCCCAACA40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT5G04800.2AATAGGCCCAACA40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT5G04800.3AATAGGCCCAACA40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT5G04800.4AATAGGCCCAACA40S ribosomal protein S17 (RPS17D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17A) (TAIR:AT2G04390.1); Has 727 Blast hits to 727 proteins in 257 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 98; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT5G06460AT5G06460.1CAAAGCCCAACAEncodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined.
AT5G07840AT5G07840.1GTAGGCCCAACAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT5G61230.1); Has 50208 Blast hits to 17627 proteins in 653 species: Archae - 46; Bacteria - 2813; Metazoa - 29912; Fungi - 2863; Plants - 1606; Viruses - 449; Other Eukaryotes - 12519 (source: NCBI BLink).
AT5G07842AT5G07842.1GTAGGCCCAACAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF16 represents a conserved upstream opening reading frame relative to major ORF AT5G07840.1
AT5G08415AT5G08415.1TGTTGGGCTTTAAlipoic acid synthase family protein; FUNCTIONS IN: lipoic acid synthase activity, iron-sulfur cluster binding, lipoate synthase activity, catalytic activity; INVOLVED IN: lipoic acid biosynthetic process, lipoate biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Lipoate synthase (InterPro:IPR003698), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase (TAIR:AT2G20860.1); Has 5746 Blast hits to 5746 proteins in 1192 species: Archae - 36; Bacteria - 2422; Metazoa - 113; Fungi - 91; Plants - 53; Viruses - 0; Other Eukaryotes - 3031 (source: NCBI BLink).
AT5G08420AT5G08420.1TTAAAGCCCAACARNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); Has 2056 Blast hits to 1575 proteins in 229 species: Archae - 85; Bacteria - 30; Metazoa - 600; Fungi - 242; Plants - 75; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink).
AT5G10630AT5G10630.1TATAGGCCCGTTAAAAGCCCAACAelongation factor 1-alpha, putative / EF-1-alpha, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Zinc finger, RanBP2-type (InterPro:IPR001876), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: EF-1-alpha-related GTP-binding protein, putative (TAIR:AT1G18070.2); Has 58110 Blast hits to 58057 proteins in 13368 species: Archae - 652; Bacteria - 20622; Metazoa - 14216; Fungi - 8620; Plants - 1274; Viruses - 3; Other Eukaryotes - 12723 (source: NCBI BLink).
AT5G11900AT5G11900.1GAAGCCCAACAeukaryotic translation initiation factor SUI1 family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor SUI1 (InterPro:IPR001950), Density-regulated protein DRP1 (InterPro:IPR005873); Has 351 Blast hits to 351 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 157; Fungi - 113; Plants - 29; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT5G13640AT5G13640.1TGAGGCCCAACAarabidopsis phospholipid:diacylglycerol acyltransferase (PDAT)
AT5G14320AT5G14320.1CAAAGCCCAACA30S ribosomal protein S13, chloroplast (CS13); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast, putative (TAIR:AT1G77750.1); Has 5735 Blast hits to 5735 proteins in 1744 species: Archae - 113; Bacteria - 2978; Metazoa - 171; Fungi - 134; Plants - 251; Viruses - 0; Other Eukaryotes - 2088 (source: NCBI BLink).
AT5G14320.2CAAAGCCCAACA30S ribosomal protein S13, chloroplast (CS13); FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast, putative (TAIR:AT1G77750.1); Has 5735 Blast hits to 5735 proteins in 1744 species: Archae - 113; Bacteria - 2978; Metazoa - 171; Fungi - 134; Plants - 251; Viruses - 0; Other Eukaryotes - 2088 (source: NCBI BLink).
AT5G14590AT5G14590.1TACTGGGCCTTATGTTGGGCCTACisocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; INVOLVED IN: isocitrate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative (TAIR:AT1G65930.1); Has 4142 Blast hits to 4125 proteins in 584 species: Archae - 19; Bacteria - 563; Metazoa - 433; Fungi - 160; Plants - 265; Viruses - 0; Other Eukaryotes - 2702 (source: NCBI BLink).
AT5G14600AT5G14600.1GTAGGCCCAACATAAGGCCCAGTAtRNA (adenine-N1-)-methyltransferase; FUNCTIONS IN: tRNA (adenine-N1-)-methyltransferase activity; INVOLVED IN: tRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: tRNA methyltransferase complex GCD14 subunit (InterPro:IPR014816); Has 1145 Blast hits to 1142 proteins in 382 species: Archae - 132; Bacteria - 313; Metazoa - 135; Fungi - 115; Plants - 30; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink).
AT5G17190AT5G17190.1TGTTGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G19680AT5G19680.1TGTTGGGCCTATTleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G15410.1); Has 29854 Blast hits to 15686 proteins in 655 species: Archae - 20; Bacteria - 8097; Metazoa - 15577; Fungi - 752; Plants - 2607; Viruses - 68; Other Eukaryotes - 2733 (source: NCBI BLink).
AT5G21274AT5G21274.1TGTTGGGCTCEncodes a calmodulin isoform. Expressed in leaves.
AT5G23405AT5G23405.1GCCCAACAhigh mobility group (HMG1/2) family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); BEST Arabidopsis thaliana protein match is: HMGB6; transcription factor (TAIR:AT5G23420.1); Has 524 Blast hits to 488 proteins in 110 species: Archae - 0; Bacteria - 10; Metazoa - 200; Fungi - 37; Plants - 158; Viruses - 7; Other Eukaryotes - 112 (source: NCBI BLink).
AT5G23405.2GCCCAACAhigh mobility group (HMG1/2) family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group, superfamily (InterPro:IPR009071), High mobility group, HMG1/HMG2 (InterPro:IPR000910); BEST Arabidopsis thaliana protein match is: HMGB6; transcription factor (TAIR:AT5G23420.1); Has 524 Blast hits to 488 proteins in 110 species: Archae - 0; Bacteria - 10; Metazoa - 200; Fungi - 37; Plants - 158; Viruses - 7; Other Eukaryotes - 112 (source: NCBI BLink).
AT5G23550AT5G23550.1ATAAGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SFT2-like (InterPro:IPR011691); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24170.1); Has 455 Blast hits to 455 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 96; Plants - 62; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT5G23740AT5G23740.1TTGGCCCAAAAGGGCCCAACAEncodes a putative ribosomal protein S11 (RPS11-beta).
AT5G24130AT5G24130.1ATTGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G24810AT5G24810.1AAAAAGCCCAACAABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink).
AT5G28540AT5G28540.1ACTGGGCCCAACAEncodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner.
AT5G39510AT5G39510.1CAAGCCCAACAEncodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12.
AT5G40930AT5G40930.1TGTTGGGCTGAForm of TOM20, which is a component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins
AT5G41960AT5G41960.1TGTTGGGCTAATGGGCTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G42020AT5G42020.1TGGCCCAACAluminal binding protein (BiP)
AT5G42020.2TGGCCCAACAluminal binding protein (BiP)
AT5G43680AT5G43680.1GAGCCCAACAunknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 56 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT5G44500AT5G44500.1CAAAGCCCAACAsmall nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: smB (small nuclear ribonucleoprotein associated protein B) (TAIR:AT4G20440.4); Has 53621 Blast hits to 25379 proteins in 1012 species: Archae - 54; Bacteria - 5505; Metazoa - 29637; Fungi - 5515; Plants - 6455; Viruses - 1288; Other Eukaryotes - 5167 (source: NCBI BLink).
AT5G44500.2CAAAGCCCAACAsmall nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: smB (small nuclear ribonucleoprotein associated protein B) (TAIR:AT4G20440.4); Has 53621 Blast hits to 25379 proteins in 1012 species: Archae - 54; Bacteria - 5505; Metazoa - 29637; Fungi - 5515; Plants - 6455; Viruses - 1288; Other Eukaryotes - 5167 (source: NCBI BLink).
AT5G47090AT5G47090.1ATGGCCCAAGAAAGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2052, coiled-coil (InterPro:IPR018613); Has 8880 Blast hits to 4216 proteins in 240 species: Archae - 24; Bacteria - 100; Metazoa - 5830; Fungi - 499; Plants - 280; Viruses - 264; Other Eukaryotes - 1883 (source: NCBI BLink).
AT5G47630AT5G47630.1TGTTGGGCCTACEncodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis.
AT5G47630.2TGTTGGGCCTACEncodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis.
AT5G49930AT5G49930.1TCGGCCCAACAembryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fibronectin-binding A, N-terminal (InterPro:IPR008616), Zinc finger, CCHC-type (InterPro:IPR001878), Protein of unknown function DUF814 (InterPro:IPR008532); Has 2906 Blast hits to 2454 proteins in 381 species: Archae - 144; Bacteria - 336; Metazoa - 995; Fungi - 294; Plants - 92; Viruses - 7; Other Eukaryotes - 1038 (source: NCBI BLink).
AT5G50810AT5G50810.1TGTTGGGCTTTTAATGGGEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.
AT5G51070AT5G51070.1TGAGCCCAACAATP-dependent Clp protease regulatory subunit
AT5G52960AT5G52960.1ATGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT5G53620AT5G53620.1TCAGCCCAATAGGCCCAACAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).
AT5G53620.2TCAGCCCAATAGGCCCAACAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).
AT5G53620.3TCAGCCCAATAGGCCCAACAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).
AT5G53940AT5G53940.1AAATGGGCCCAGTTAAGGCCCAACAyippee family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT2G40110.1); Has 696 Blast hits to 696 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT5G59890AT5G59890.1TTAGCCCAACAactin depolymerizing factor 4 (ADF4) mRNA, complete cds
AT5G59890.2TTAGCCCAACAactin depolymerizing factor 4 (ADF4) mRNA, complete cds
AT5G62300AT5G62300.1GTTTGGGCCCAACA40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).
AT5G62300.2GTTTGGGCCCAACA40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink).


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.