
Summary of ACGTG (All list)

Organism Arabidopsis thaliana
Description ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;
Total Entry Count 3874

Entry Sequences (3874 entries)

LocusGene modelSequenceDescription
AT1G01060AT1G01060.1ACCACGTGTCGLHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1
AT1G01060.2ACCACGTGTCGLHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1
AT1G01060.3ACCACGTGTCGLHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1
AT1G01060.4ACCACGTGTCGLHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1
AT1G01140AT1G01140.1TACGTGGCATEncodes a CBL-interacting protein kinase with similarity to SOS2
AT1G01140.2TACGTGGCATEncodes a CBL-interacting protein kinase with similarity to SOS2
AT1G01140.3TACGTGGCATEncodes a CBL-interacting protein kinase with similarity to SOS2
AT1G01180AT1G01180.1AGACACGTAAAGTCAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: sperm cell, hypocotyl; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19270.1); Has 228 Blast hits to 228 proteins in 32 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).
AT1G01240AT1G01240.1AACACGTGTTunknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 70 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G01240.2AACACGTGTTunknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 70 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G01240.3AACACGTGTTunknown protein; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1); Has 70 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 11; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G01470AT1G01470.1AGACACGTAEncodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against dessication.
AT1G01470.1TCACACGTEncodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against dessication.
AT1G01500AT1G01500.1TCACACGTGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01630AT1G01630.1CTGACGTGGGCTCASEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).
AT1G01670AT1G01670.1CGTGACGTGTCGTU-box domain-containing protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: protein ubiquitination; LOCATED IN: ubiquitin ligase complex; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: U-box domain-containing protein (TAIR:AT1G01680.1); Has 2979 Blast hits to 2299 proteins in 198 species: Archae - 2; Bacteria - 86; Metazoa - 849; Fungi - 177; Plants - 922; Viruses - 10; Other Eukaryotes - 933 (source: NCBI BLink).
AT1G01710AT1G01710.1AACACGTGAacyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).
AT1G01710.1CGAACCGAGTCCACGTacyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).
AT1G01720AT1G01720.1ACGTGTCCBelongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.
AT1G01720.1CCCACGTGTGBelongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.
AT1G01720.1CGACACGTGTCCBelongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.
AT1G01720.1TCGCCACGTCAGCBelongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA.
AT1G01750AT1G01750.1ACGTGACAACTIN DEPOLYMERIZING FACTOR 11 (ADF11); FUNCTIONS IN: actin binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Actin-binding, cofilin/tropomyosin type (InterPro:IPR002108); BEST Arabidopsis thaliana protein match is: ADF8 (ACTIN DEPOLYMERIZING FACTOR 8); actin binding (TAIR:AT4G00680.1); Has 1202 Blast hits to 1183 proteins in 208 species: Archae - 0; Bacteria - 3; Metazoa - 637; Fungi - 111; Plants - 307; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink).
AT1G01830AT1G01830.1TACGTGGCTarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT2G45720.2); Has 1987 Blast hits to 1326 proteins in 150 species: Archae - 2; Bacteria - 14; Metazoa - 434; Fungi - 322; Plants - 999; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink).
AT1G01830.2TACGTGGCTarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT2G45720.2); Has 1987 Blast hits to 1326 proteins in 150 species: Archae - 2; Bacteria - 14; Metazoa - 434; Fungi - 322; Plants - 999; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink).
AT1G01830.3TACGTGGCTarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo (InterPro:IPR000225), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT2G45720.2); Has 1987 Blast hits to 1326 proteins in 150 species: Archae - 2; Bacteria - 14; Metazoa - 434; Fungi - 322; Plants - 999; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink).
AT1G01900AT1G01900.1TCACACGTCACEncodes AtSBT1.1, a subtilisin-like serine protease. Cleaves the phytosulfokine AtPSK4, a growth promoting peptide.
AT1G02020AT1G02020.1GTGACGTGGnitroreductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, nitrogenous group as acceptor, oxidoreductase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitroreductase (InterPro:IPR000415); Has 465 Blast hits to 402 proteins in 182 species: Archae - 87; Bacteria - 350; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G02020.2GTGACGTGGnitroreductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, nitrogenous group as acceptor, oxidoreductase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitroreductase (InterPro:IPR000415); Has 465 Blast hits to 402 proteins in 182 species: Archae - 87; Bacteria - 350; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G02260AT1G02260.1GACGTGGCAGtransmembrane protein, putative; FUNCTIONS IN: citrate transmembrane transporter activity, transporter activity; INVOLVED IN: citrate transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Divalent ion symporter (InterPro:IPR004680); Has 5612 Blast hits to 3945 proteins in 1017 species: Archae - 185; Bacteria - 4274; Metazoa - 237; Fungi - 56; Plants - 87; Viruses - 2; Other Eukaryotes - 771 (source: NCBI BLink).
AT1G02340AT1G02340.1ACGTGGCACEncodes a light-inducible, nuclear bHLH protein involved in phytochrome signaling. Mutants exhibit a long-hypocotyl phenotype only under far-red light but not under red light and are defective in other phytochrome A-related responses. Mutants also show blue light response defects. HFR1 interacts with COP1, co-localizes to the nuclear specks and is ubiquinated by COP1.
AT1G02390AT1G02390.1ACGTGTACEncodes a member of a family of proteins with glycerol-3-phosphate acyltransferase activity.
AT1G02560AT1G02560.1AACACGTGACAOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G02660AT1G02660.1AACACGTGTTlipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G02660.1GTGGGTCCCACGTGGGlipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G02700AT1G02700.1AACACGTGTCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02140.1); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G02700.1CCGCCACGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02140.1); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G02816AT1G02816.1ATGACACGTGTCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G02840AT1G02840.1CACGTGACSR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.
AT1G02840.1CACGTGACSR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.
AT1G02840.2CACGTGACSR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.
AT1G02840.2CACGTGACSR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.
AT1G02840.3CACGTGACSR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.
AT1G02840.3CACGTGACSR1 is a plant homologue of the human general/alternative splicing factor SF2/ASF.
AT1G02930AT1G02930.1ATCCACGTGGACEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G02950AT1G02950.1ACGTGGATEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G02950.2ACGTGGATEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G02950.3ACGTGGATEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G02950.4ACGTGGATEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G02990AT1G02990.1CACACGTGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).
AT1G02990.1TGTCACGTGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).
AT1G02990.2CACACGTGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).
AT1G02990.2TGTCACGTGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).
AT1G03030AT1G03030.1ATGACACGTGTCTphosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: kinase activity, phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uridine kinase (InterPro:IPR000764); Has 1794 Blast hits to 1794 proteins in 581 species: Archae - 7; Bacteria - 1124; Metazoa - 151; Fungi - 173; Plants - 39; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink).
AT1G03070AT1G03070.1GCCACGTGGTglutamate binding; FUNCTIONS IN: glutamate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT4G02690.1); Has 3927 Blast hits to 3927 proteins in 938 species: Archae - 0; Bacteria - 1737; Metazoa - 709; Fungi - 89; Plants - 119; Viruses - 54; Other Eukaryotes - 1219 (source: NCBI BLink).
AT1G03090AT1G03090.1ATGCCACGTCACMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.
AT1G03090.2ATGCCACGTCACMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.
AT1G03400AT1G03400.1GTCCACGTTCGGTTA single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers.
AT1G03470AT1G03470.1TACGTGGCAATkinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G03470.2TACGTGGCAATkinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G03520AT1G03520.1GACGTGTCTglycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT4G03340.1); Has 691 Blast hits to 688 proteins in 86 species: Archae - 0; Bacteria - 14; Metazoa - 462; Fungi - 0; Plants - 190; Viruses - 14; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G03520.2GACGTGTCTglycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT4G03340.1); Has 691 Blast hits to 688 proteins in 86 species: Archae - 0; Bacteria - 14; Metazoa - 462; Fungi - 0; Plants - 190; Viruses - 14; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G03600AT1G03600.1GGACACGTGTCAphotosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).
AT1G03630AT1G03630.1AGACACGTGTCACEncodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.
AT1G03630.2AGACACGTGTCACEncodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.
AT1G03905AT1G03905.1ATGACGTGGATABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink).
AT1G03905.1CTGACGTGGCGAABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink).
AT1G03905.1CTGACGTGGCGAABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink).
AT1G04010AT1G04010.1AGACACGTGTACphosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G04020AT1G04020.1GTACACGTGTCTEncodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression.
AT1G04020.2GTACACGTGTCTEncodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression.
AT1G04250AT1G04250.1ATCCACGTGTCTTranscription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.
AT1G04270AT1G04270.1TACGTGTCACEncodes cytosolic ribosomal protein S15.
AT1G04270.2TACGTGTCACEncodes cytosolic ribosomal protein S15.
AT1G04310AT1G04310.1GTCCACGTAGencodes an ethylene receptor related to bacterial two-component histidine kinases.
AT1G04410AT1G04410.1GATGACGTGGCGGmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink).
AT1G04420AT1G04420.1CCGCCACGTCATCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink).
AT1G04560AT1G04560.1AGACACGTGTCCAWPM-19-like membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: AWPM-19-like (InterPro:IPR008390); BEST Arabidopsis thaliana protein match is: AWPM-19-like membrane family protein (TAIR:AT1G29520.1); Has 99 Blast hits to 99 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 99; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G04630AT1G04630.1CACGTGACTCCACGTGACmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G04635AT1G04635.1GTCACGTGGAGTCACGTGEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G04770AT1G04770.1TACGTGGCACmale sterility MS5 family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATSDI1 (SULPHUR DEFICIENCY-INDUCED 1); binding (TAIR:AT5G48850.1); Has 145 Blast hits to 145 proteins in 21 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 98; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).
AT1G04820AT1G04820.1TACACGTGTCGTTEncodes an alpha tubulin isoform that is expressed in roots, leaves and flowers.
AT1G04920AT1G04920.1AACACGTGTCATEncodes a protein with putative sucrose-phosphate synthase activity.
AT1G04920.1TTGCCACGTAATTAEncodes a protein with putative sucrose-phosphate synthase activity.
AT1G04985AT1G04985.1TACACGTGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G04985.1TACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05350AT1G05350.1ACGTGACAthiF family protein; FUNCTIONS IN: binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), UBA/THIF-type NAD/FAD binding fold (InterPro:IPR000594), Molybdenum cofactor biosynthesis, MoeB (InterPro:IPR009036), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: SAE2 (SUMO-ACTIVATING ENZYME 2); SUMO activating enzyme (TAIR:AT2G21470.2); Has 7901 Blast hits to 7756 proteins in 1322 species: Archae - 133; Bacteria - 4223; Metazoa - 801; Fungi - 447; Plants - 189; Viruses - 0; Other Eukaryotes - 2108 (source: NCBI BLink).
AT1G05360AT1G05360.1ATGACACGTGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT1G05360.1TGTCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT1G05500AT1G05500.1ATGACGTGTCATNTMC2T2.1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: SYTD (TAIR:AT5G11100.1); Has 9319 Blast hits to 5090 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 6456; Fungi - 877; Plants - 1262; Viruses - 0; Other Eukaryotes - 724 (source: NCBI BLink).
AT1G05570AT1G05570.1GATGACGTGGCAGEncodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48.
AT1G05630AT1G05630.1ACGTGACAEncodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light–stimulated increase in cytosolic calcium ion.
AT1G05630.2ACGTGACAEncodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light–stimulated increase in cytosolic calcium ion.
AT1G05670AT1G05670.1AGCCACGTUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05680.1); Has 33439 Blast hits to 11406 proteins in 464 species: Archae - 3; Bacteria - 229; Metazoa - 3199; Fungi - 827; Plants - 27610; Viruses - 120; Other Eukaryotes - 1451 (source: NCBI BLink).
AT1G05670.2AGCCACGTUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05680.1); Has 33439 Blast hits to 11406 proteins in 464 species: Archae - 3; Bacteria - 229; Metazoa - 3199; Fungi - 827; Plants - 27610; Viruses - 120; Other Eukaryotes - 1451 (source: NCBI BLink).
AT1G05785AT1G05785.1CACGTGGCTGot1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Got1-like protein (InterPro:IPR007305); BEST Arabidopsis thaliana protein match is: Got1-like family protein (TAIR:AT5G01430.1); Has 318 Blast hits to 318 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 137; Fungi - 75; Plants - 52; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT1G05785.2CACGTGGCTGot1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Got1-like protein (InterPro:IPR007305); BEST Arabidopsis thaliana protein match is: Got1-like family protein (TAIR:AT5G01430.1); Has 318 Blast hits to 318 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 137; Fungi - 75; Plants - 52; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT1G05835AT1G05835.1CGCACGTGTAunknown protein; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32583.1); Has 50 Blast hits to 50 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05890AT1G05890.1CACGTGGGzinc finger protein-related; FUNCTIONS IN: protein binding, zinc ion binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: IBR domain-containing protein / ARIADNE-like protein ARI7 (ARI7) (TAIR:AT2G31510.1); Has 2323 Blast hits to 2304 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 1138; Fungi - 377; Plants - 363; Viruses - 5; Other Eukaryotes - 440 (source: NCBI BLink).
AT1G06000AT1G06000.1CCACGTAGencodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols
AT1G06070AT1G06070.1ACCACGTGbZIP transcription factor, putative (bZIP69); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP transcription factor (POSF21) (TAIR:AT2G31370.5); Has 38161 Blast hits to 16134 proteins in 672 species: Archae - 6; Bacteria - 1085; Metazoa - 14914; Fungi - 4009; Plants - 2167; Viruses - 428; Other Eukaryotes - 15552 (source: NCBI BLink).
AT1G06110AT1G06110.1GTGCCACGTGTASKP1/ASK-interacting protein 16 (SKIP16); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: SCF ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ApaG (InterPro:IPR007474); Has 1427 Blast hits to 1427 proteins in 496 species: Archae - 0; Bacteria - 836; Metazoa - 173; Fungi - 41; Plants - 47; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink).
AT1G06200AT1G06200.1AACACGTGserine-type peptidase; FUNCTIONS IN: serine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927), Peptidase S26A, signal peptidase I (InterPro:IPR000223), Peptidase S26A (InterPro:IPR014037); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31140.1); Has 156 Blast hits to 156 proteins in 51 species: Archae - 0; Bacteria - 4; Metazoa - 57; Fungi - 17; Plants - 68; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G06210AT1G06210.1CACGTGTTVHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT5G16880.2); Has 1056 Blast hits to 1054 proteins in 134 species: Archae - 0; Bacteria - 6; Metazoa - 652; Fungi - 172; Plants - 139; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).
AT1G06210.2CACGTGTTVHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT5G16880.2); Has 1056 Blast hits to 1054 proteins in 134 species: Archae - 0; Bacteria - 6; Metazoa - 652; Fungi - 172; Plants - 139; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink).
AT1G06360AT1G06360.1GGACACGTCfatty acid desaturase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1, core (InterPro:IPR015876), Fatty acid desaturase, type 1 (InterPro:IPR005804); BEST Arabidopsis thaliana protein match is: fatty acid desaturase family protein (TAIR:AT1G06350.1); Has 2722 Blast hits to 2722 proteins in 596 species: Archae - 0; Bacteria - 1082; Metazoa - 698; Fungi - 152; Plants - 71; Viruses - 3; Other Eukaryotes - 716 (source: NCBI BLink).
AT1G06430AT1G06430.1AAGCCACGTAencodes a FtsH protease that is localized to the chloroplast
AT1G06530AT1G06530.1GTACACGTGmyosin heavy chain-related; LOCATED IN: mitochondrion, plasma membrane, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58840.2); Has 115779 Blast hits to 52346 proteins in 2082 species: Archae - 1688; Bacteria - 13782; Metazoa - 57957; Fungi - 9395; Plants - 4647; Viruses - 508; Other Eukaryotes - 27802 (source: NCBI BLink).
AT1G06620AT1G06620.1CCCACGTGGGencodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase
AT1G06680AT1G06680.1CTGACGTGGAAEncodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.
AT1G06680.1CTGCCACGTGGCACEncodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.
AT1G06680.2CTGACGTGGAAEncodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.
AT1G06680.2CTGCCACGTGGCACEncodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution.
AT1G06690AT1G06690.1TACGTGTCCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink).
AT1G06890AT1G06890.1ACGTGGATtransporter-related; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30460.2); Has 1730 Blast hits to 1725 proteins in 204 species: Archae - 2; Bacteria - 41; Metazoa - 571; Fungi - 289; Plants - 633; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).
AT1G06890.2ACGTGGATtransporter-related; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30460.2); Has 1730 Blast hits to 1725 proteins in 204 species: Archae - 2; Bacteria - 41; Metazoa - 571; Fungi - 289; Plants - 633; Viruses - 0; Other Eukaryotes - 194 (source: NCBI BLink).
AT1G07030AT1G07030.1GCTGACGTGTCAmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G30160.1); Has 19774 Blast hits to 10070 proteins in 353 species: Archae - 0; Bacteria - 0; Metazoa - 9836; Fungi - 5154; Plants - 2928; Viruses - 0; Other Eukaryotes - 1856 (source: NCBI BLink).
AT1G07040AT1G07040.1TCGCCACGTCunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27030.1); Has 403 Blast hits to 403 proteins in 131 species: Archae - 0; Bacteria - 232; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).
AT1G07080AT1G07080.1AGACACGTGGCTTgamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: OSH1 (OAS HIGH ACCUMULATION 1); catalytic (TAIR:AT5G01580.1); Has 339 Blast hits to 336 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 260; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G07080.1TACACGTGTCTgamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: OSH1 (OAS HIGH ACCUMULATION 1); catalytic (TAIR:AT5G01580.1); Has 339 Blast hits to 336 proteins in 72 species: Archae - 0; Bacteria - 0; Metazoa - 260; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G07150AT1G07150.1ATCCACGTGGGmember of MEKK subfamily
AT1G07420AT1G07420.1CACGTGGGArabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA
AT1G07430AT1G07430.1ACACGTCACGprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G29380.1); Has 4401 Blast hits to 4389 proteins in 274 species: Archae - 0; Bacteria - 82; Metazoa - 1419; Fungi - 539; Plants - 1372; Viruses - 7; Other Eukaryotes - 982 (source: NCBI BLink).
AT1G07430.1CATTGGGCCACGTAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G29380.1); Has 4401 Blast hits to 4389 proteins in 274 species: Archae - 0; Bacteria - 82; Metazoa - 1419; Fungi - 539; Plants - 1372; Viruses - 7; Other Eukaryotes - 982 (source: NCBI BLink).
AT1G07470AT1G07470.1CACGTGTCAtranscription factor IIA large subunit, putative / TFIIA large subunit, putative; FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor IIA, alpha/beta subunit (InterPro:IPR004855), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription factor IIA, alpha subunit, N-terminal (InterPro:IPR013028), Transcription factor IIA, helical (InterPro:IPR009083); BEST Arabidopsis thaliana protein match is: transcription factor IIA large subunit / TFIIA large subunit (TFIIA-L) (TAIR:AT1G07480.2); Has 561 Blast hits to 467 proteins in 136 species: Archae - 0; Bacteria - 14; Metazoa - 345; Fungi - 107; Plants - 45; Viruses - 6; Other Eukaryotes - 44 (source: NCBI BLink).
AT1G07480AT1G07480.1CACGTGTCCtranscription factor IIA large subunit / TFIIA large subunit (TFIIA-L); FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription; LOCATED IN: transcription factor TFIIA complex; CONTAINS InterPro DOMAIN/s: Transcription factor IIA, alpha/beta subunit (InterPro:IPR004855), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription factor IIA, alpha subunit, N-terminal (InterPro:IPR013028), Transcription factor IIA, helical (InterPro:IPR009083); BEST Arabidopsis thaliana protein match is: transcription factor IIA large subunit, putative / TFIIA large subunit, putative (TAIR:AT1G07470.1); Has 582 Blast hits to 492 proteins in 138 species: Archae - 0; Bacteria - 27; Metazoa - 349; Fungi - 106; Plants - 45; Viruses - 9; Other Eukaryotes - 46 (source: NCBI BLink).
AT1G07480.2CACGTGTCCtranscription factor IIA large subunit / TFIIA large subunit (TFIIA-L); FUNCTIONS IN: RNA polymerase II transcription factor activity, transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription; LOCATED IN: transcription factor TFIIA complex; CONTAINS InterPro DOMAIN/s: Transcription factor IIA, alpha/beta subunit (InterPro:IPR004855), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription factor IIA, alpha subunit, N-terminal (InterPro:IPR013028), Transcription factor IIA, helical (InterPro:IPR009083); BEST Arabidopsis thaliana protein match is: transcription factor IIA large subunit, putative / TFIIA large subunit, putative (TAIR:AT1G07470.1); Has 582 Blast hits to 492 proteins in 138 species: Archae - 0; Bacteria - 27; Metazoa - 349; Fungi - 106; Plants - 45; Viruses - 9; Other Eukaryotes - 46 (source: NCBI BLink).
AT1G07510AT1G07510.1CTGCCACGTGencodes an FtsH protease that is localized to the mitochondrion
AT1G07510.1TACACGTGGAencodes an FtsH protease that is localized to the mitochondrion
AT1G07590AT1G07590.1ATGCCACGTGTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 6623 Blast hits to 3122 proteins in 84 species: Archae - 0; Bacteria - 4; Metazoa - 30; Fungi - 22; Plants - 6377; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).
AT1G07600AT1G07600.1ATGCCACGTGTAmetallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage.
AT1G07645AT1G07645.1ACCACGTGTTDESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G07645.1CACGTGGCAGDESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G07820AT1G07820.1ATCCACGTCATChistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07820.2ATCCACGTCATChistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07830AT1G07830.1GATGACGTGGATribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).
AT1G07870AT1G07870.1GACGTGGCTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G28590.1); Has 82095 Blast hits to 81092 proteins in 2973 species: Archae - 50; Bacteria - 7578; Metazoa - 35765; Fungi - 6178; Plants - 18436; Viruses - 378; Other Eukaryotes - 13710 (source: NCBI BLink).
AT1G07870.1TACGTGGCGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G28590.1); Has 82095 Blast hits to 81092 proteins in 2973 species: Archae - 50; Bacteria - 7578; Metazoa - 35765; Fungi - 6178; Plants - 18436; Viruses - 378; Other Eukaryotes - 13710 (source: NCBI BLink).
AT1G07910AT1G07910.1AAGCCACGTGTTEncodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.
AT1G07910.2AAGCCACGTGTTEncodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.
AT1G07985AT1G07985.1AACACGTGTGAExpressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 33 Blast hits to 33 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G07985.1ACCACGTGTTExpressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 33 Blast hits to 33 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G08040AT1G08040.1AAGCCACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G08040.2AAGCCACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G08190AT1G08190.1CACACGTGGCACvacuolar assembly protein, putative (VPS41); FUNCTIONS IN: protein binding, binding, nucleotide binding, zinc ion binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), WD40 repeat (InterPro:IPR001680), Vacuolar protein sorting-associated protein 41 (InterPro:IPR016902), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); Has 18653 Blast hits to 4150 proteins in 294 species: Archae - 4; Bacteria - 280; Metazoa - 13631; Fungi - 995; Plants - 521; Viruses - 352; Other Eukaryotes - 2870 (source: NCBI BLink).
AT1G08200AT1G08200.1ATGACACGTAEncodes a putative UDP-D-apiose/UPD-D-xylose synthetase.
AT1G08200.1CACGTGGTEncodes a putative UDP-D-apiose/UPD-D-xylose synthetase.
AT1G08210AT1G08210.1GGACACGTCATaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: anchored to membrane, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT5G22850.1); Has 3530 Blast hits to 3512 proteins in 308 species: Archae - 0; Bacteria - 0; Metazoa - 1402; Fungi - 712; Plants - 1209; Viruses - 0; Other Eukaryotes - 207 (source: NCBI BLink).
AT1G08320AT1G08320.2TTCCACGTGbZIP family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT5G06839.1); Has 758 Blast hits to 757 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 28; Plants - 577; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT1G08340AT1G08340.1CCACGTCGrac GTPase activating protein, putative; FUNCTIONS IN: Rac GTPase activator activity; INVOLVED IN: signal transduction; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAK-box/P21-Rho-binding (InterPro:IPR000095), Rho GTPase activation protein (InterPro:IPR008936), RhoGAP (InterPro:IPR000198); BEST Arabidopsis thaliana protein match is: rac GTPase activating protein, putative (TAIR:AT5G22400.1); Has 28415 Blast hits to 13704 proteins in 473 species: Archae - 23; Bacteria - 456; Metazoa - 16450; Fungi - 2676; Plants - 1068; Viruses - 527; Other Eukaryotes - 7215 (source: NCBI BLink).
AT1G08460AT1G08460.1AACACGTGTGHDA08; FUNCTIONS IN: histone deacetylase activity; INVOLVED IN: histone deacetylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylase superfamily (InterPro:IPR000286); BEST Arabidopsis thaliana protein match is: HDA15; histone deacetylase (TAIR:AT3G18520.2); Has 6845 Blast hits to 6725 proteins in 846 species: Archae - 124; Bacteria - 2006; Metazoa - 1106; Fungi - 418; Plants - 273; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink).
AT1G08570AT1G08570.3AGACACGTCGTCEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08570.4AGACACGTCGTCEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08660AT1G08660.1GTCACGTGGGglycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 29 (InterPro:IPR001675); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 29 protein / sialyltransferase family protein (TAIR:AT3G48820.1); Has 1458 Blast hits to 1454 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 1325; Fungi - 0; Plants - 90; Viruses - 11; Other Eukaryotes - 32 (source: NCBI BLink).
AT1G08660.2GTCACGTGGGglycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 29 (InterPro:IPR001675); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 29 protein / sialyltransferase family protein (TAIR:AT3G48820.1); Has 1458 Blast hits to 1454 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 1325; Fungi - 0; Plants - 90; Viruses - 11; Other Eukaryotes - 32 (source: NCBI BLink).
AT1G08720AT1G08720.1GACGTGTCACenhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum
AT1G08830AT1G08830.1CTGACGTGGCTTTTTEncodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress.
AT1G08830.2CTGACGTGGCTTTTTEncodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress.
AT1G08880AT1G08880.1CTGCCACGTEncodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10–20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin.
AT1G08920AT1G08920.1ACGTGACAsugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Phosphopantetheine attachment site (InterPro:IPR006162), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ERD6 (EARLY RESPONSE TO DEHYDRATION 6); carbohydrate transmembrane transporter/ sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G08930.2); Has 14684 Blast hits to 14344 proteins in 1042 species: Archae - 183; Bacteria - 4689; Metazoa - 3670; Fungi - 3962; Plants - 1292; Viruses - 0; Other Eukaryotes - 888 (source: NCBI BLink).
AT1G08920.2ACGTGACAsugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Phosphopantetheine attachment site (InterPro:IPR006162), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ERD6 (EARLY RESPONSE TO DEHYDRATION 6); carbohydrate transmembrane transporter/ sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G08930.2); Has 14684 Blast hits to 14344 proteins in 1042 species: Archae - 183; Bacteria - 4689; Metazoa - 3670; Fungi - 3962; Plants - 1292; Viruses - 0; Other Eukaryotes - 888 (source: NCBI BLink).
AT1G08920.3ACGTGACAsugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Phosphopantetheine attachment site (InterPro:IPR006162), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ERD6 (EARLY RESPONSE TO DEHYDRATION 6); carbohydrate transmembrane transporter/ sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G08930.2); Has 14684 Blast hits to 14344 proteins in 1042 species: Archae - 183; Bacteria - 4689; Metazoa - 3670; Fungi - 3962; Plants - 1292; Viruses - 0; Other Eukaryotes - 888 (source: NCBI BLink).
AT1G08930AT1G08930.1ATGACGTGTencodes a putative sucrose transporter whose gene expression is induced by dehydration and cold.
AT1G08930.2ATGACGTGTencodes a putative sucrose transporter whose gene expression is induced by dehydration and cold.
AT1G09210AT1G09210.1CTGACGTGTCGcalreticulin 2 (CRT2); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: response to oxidative stress, response to salt stress; LOCATED IN: mitochondrion, endoplasmic reticulum, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Calreticulin (InterPro:IPR009169), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding (TAIR:AT1G56340.2); Has 6897 Blast hits to 3331 proteins in 371 species: Archae - 6; Bacteria - 265; Metazoa - 3811; Fungi - 490; Plants - 317; Viruses - 187; Other Eukaryotes - 1821 (source: NCBI BLink).
AT1G09210.1TACACGTGTCAcalreticulin 2 (CRT2); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: response to oxidative stress, response to salt stress; LOCATED IN: mitochondrion, endoplasmic reticulum, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Calreticulin (InterPro:IPR009169), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding (TAIR:AT1G56340.2); Has 6897 Blast hits to 3331 proteins in 371 species: Archae - 6; Bacteria - 265; Metazoa - 3811; Fungi - 490; Plants - 317; Viruses - 187; Other Eukaryotes - 1821 (source: NCBI BLink).
AT1G09210.1TACGTGGCTcalreticulin 2 (CRT2); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: response to oxidative stress, response to salt stress; LOCATED IN: mitochondrion, endoplasmic reticulum, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Calreticulin (InterPro:IPR009169), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding (TAIR:AT1G56340.2); Has 6897 Blast hits to 3331 proteins in 371 species: Archae - 6; Bacteria - 265; Metazoa - 3811; Fungi - 490; Plants - 317; Viruses - 187; Other Eukaryotes - 1821 (source: NCBI BLink).
AT1G09350AT1G09350.1TTTAGGCCACGTGGCATArabidopsis thaliana galactinol synthase 3 (AtGolS3); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 871 Blast hits to 870 proteins in 198 species: Archae - 0; Bacteria - 55; Metazoa - 224; Fungi - 186; Plants - 285; Viruses - 70; Other Eukaryotes - 51 (source: NCBI BLink).
AT1G09490AT1G09490.1AACACGTGGGGTGsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565
AT1G09490.2AACACGTGGGGTGsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565
AT1G09500AT1G09500.1TCACACGTGACsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase
AT1G09500.2TCACACGTGACsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase
AT1G09500.3TCACACGTGACsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase
AT1G09520AT1G09520.1GTGCCACGTCAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G09540AT1G09540.1CGACGTGGACEncodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size.
AT1G09795AT1G09795.1ATCCACGTGTACATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis
AT1G09850AT1G09850.1CACACGTGGTArabidopsis thaliana papain-like cysteine peptidase
AT1G09870AT1G09870.1AACACGTGGCGThistidine acid phosphatase family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Histidine acid phosphatase, eukaryotic (InterPro:IPR016274); Has 574 Blast hits to 569 proteins in 162 species: Archae - 0; Bacteria - 75; Metazoa - 167; Fungi - 277; Plants - 29; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G09870.1ACGTGTGAhistidine acid phosphatase family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Histidine acid phosphatase, eukaryotic (InterPro:IPR016274); Has 574 Blast hits to 569 proteins in 162 species: Archae - 0; Bacteria - 75; Metazoa - 167; Fungi - 277; Plants - 29; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G09932AT1G09932.1TGACGTGTGAphosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G09932.2TGACGTGTGAphosphoglycerate/bisphosphoglycerate mutase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078); BEST Arabidopsis thaliana protein match is: phosphoglycerate/bisphosphoglycerate mutase family protein (TAIR:AT2G17280.2); Has 318 Blast hits to 318 proteins in 67 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 176; Plants - 65; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G09980AT1G09980.1GTACACGTINVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: ZW18 (TAIR:AT1G58350.2); Has 342 Blast hits to 275 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 214; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).
AT1G09980.2GTACACGTINVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF676, hydrolase-like (InterPro:IPR007751); BEST Arabidopsis thaliana protein match is: ZW18 (TAIR:AT1G58350.2); Has 342 Blast hits to 275 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 214; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).
AT1G10070AT1G10070.1AGACACGTCEncodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT1G10070.2AGACACGTCEncodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT1G10070.3AGACACGTCEncodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant.
AT1G10090AT1G10090.1ATGCCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G10090.1TTCCACGTGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G10220AT1G10220.2TACGTGGCAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: ZCF37 (TAIR:AT1G59590.1); Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G10280AT1G10280.1CCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21310.1); Has 332 Blast hits to 332 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G10280.1CGACGTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21310.1); Has 332 Blast hits to 332 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G10350AT1G10350.1ATGCCACGTGGCTCCATTAAGDNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT1G59725.1); Has 19690 Blast hits to 19405 proteins in 2073 species: Archae - 113; Bacteria - 5759; Metazoa - 3795; Fungi - 1695; Plants - 1434; Viruses - 18; Other Eukaryotes - 6876 (source: NCBI BLink).
AT1G10360AT1G10360.1ACCACGTGTCGEncodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G10370AT1G10370.1TACACGTGTCAEARLY-RESPONSIVE TO DEHYDRATION 9 (ERD9); FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: response to water deprivation, toxin catabolic process; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATGSTU18 (GLUTATHIONE S-TRANSFERASE TAU 18); glutathione transferase (TAIR:AT1G10360.1); Has 3306 Blast hits to 3303 proteins in 662 species: Archae - 0; Bacteria - 1571; Metazoa - 184; Fungi - 70; Plants - 1070; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink).
AT1G10560AT1G10560.1ACCACGTGGATEncodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT1G10560.1CACGTGGCACEncodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT1G10585AT1G10585.1ACGTGGAAtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription regulator (TAIR:AT1G10586.1); Has 43 Blast hits to 43 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10590AT1G10590.1ATGACACGTGTTDNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G10590.2ATGACACGTGTTDNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G10590.3ATGACACGTGTTDNA-binding protein-related; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G23750.1); Has 139 Blast hits to 139 proteins in 35 species: Archae - 30; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G10600AT1G10600.1AACACGTGTCATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT1G10600.2AACACGTGTCATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT1G10600.3AACACGTGTCATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G16144.1); Has 753 Blast hits to 752 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 199; Plants - 115; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT1G10700AT1G10700.1ACGTGTCTribose-phosphate pyrophosphokinase 3 / phosphoribosyl diphosphate synthetase 3 (PRS3); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 4 / phosphoribosyl diphosphate synthetase 4 (PRS4) (TAIR:AT2G42910.1); Has 6424 Blast hits to 6423 proteins in 1522 species: Archae - 142; Bacteria - 3196; Metazoa - 415; Fungi - 221; Plants - 120; Viruses - 5; Other Eukaryotes - 2325 (source: NCBI BLink).
AT1G10760AT1G10760.1GTGCCACGTGGTEncodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position.
AT1G10960AT1G10960.1ACGCCACGTGGCAGFERREDOXIN 1 (ATFD1); FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: FED A; 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G60950.1); Has 5347 Blast hits to 5345 proteins in 903 species: Archae - 63; Bacteria - 3637; Metazoa - 8; Fungi - 9; Plants - 447; Viruses - 2; Other Eukaryotes - 1181 (source: NCBI BLink).
AT1G10980AT1G10980.1ACGTGTACINVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61670.1); Has 482 Blast hits to 481 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 255; Fungi - 99; Plants - 97; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G11020AT1G11020.1AACACGTGTACzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 933 Blast hits to 932 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 489; Fungi - 88; Plants - 163; Viruses - 11; Other Eukaryotes - 182 (source: NCBI BLink).
AT1G11080AT1G11080.1ATGACGTGGserine carboxypeptidase-like 31 (scpl31); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL32 (SERINE CARBOXYPEPTIDASE-LIKE 32); serine-type carboxypeptidase (TAIR:AT1G61130.1); Has 2478 Blast hits to 2433 proteins in 263 species: Archae - 0; Bacteria - 97; Metazoa - 570; Fungi - 568; Plants - 896; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink).
AT1G11180AT1G11180.1TACACGTGTCGTsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).
AT1G11180.1TTCCACGTsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).
AT1G11210AT1G11210.1GGACACGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF761, plant (InterPro:IPR008480); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11220.1); Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G11210.1TACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF761, plant (InterPro:IPR008480); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11220.1); Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G11400AT1G11400.1ACGTGTGAThe PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus.
AT1G11400.2ACGTGTGAThe PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus.
AT1G11400.3ACGTGTGAThe PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus.
AT1G11480AT1G11480.1ATCCACGTGTGeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G11480.1CTGCCACGTAeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G11480.2ATCCACGTGTGeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G11480.2CTGCCACGTAeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G11840AT1G11840.1CCGCCACGTGTCATEncodes a glyoxalase I homolog ATGLX1.
AT1G11840.2CCGCCACGTGTCATEncodes a glyoxalase I homolog ATGLX1.
AT1G11840.3CCGCCACGTGTCATEncodes a glyoxalase I homolog ATGLX1.
AT1G11840.4CCGCCACGTGTCATEncodes a glyoxalase I homolog ATGLX1.
AT1G11840.5CCGCCACGTGTCATEncodes a glyoxalase I homolog ATGLX1.
AT1G11870AT1G11870.1AACACGTGGCAASeryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.
AT1G11870.2AACACGTGGCAASeryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.
AT1G11870.3AACACGTGGCAASeryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.
AT1G11890AT1G11890.1AGCCACGTCATCmember of SEC22 Gene Family
AT1G11930AT1G11930.1ACGTGGCGAalanine racemase family protein; FUNCTIONS IN: pyridoxal phosphate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Predicted pyridoxal phosphate-dependent enzyme, YBL036C type (InterPro:IPR011078), Alanine racemase, N-terminal (InterPro:IPR001608); BEST Arabidopsis thaliana protein match is: pyridoxal phosphate binding (TAIR:AT4G26860.1); Has 4934 Blast hits to 4934 proteins in 1278 species: Archae - 14; Bacteria - 2203; Metazoa - 109; Fungi - 88; Plants - 34; Viruses - 0; Other Eukaryotes - 2486 (source: NCBI BLink).
AT1G11930.2ACGTGGCGAalanine racemase family protein; FUNCTIONS IN: pyridoxal phosphate binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Predicted pyridoxal phosphate-dependent enzyme, YBL036C type (InterPro:IPR011078), Alanine racemase, N-terminal (InterPro:IPR001608); BEST Arabidopsis thaliana protein match is: pyridoxal phosphate binding (TAIR:AT4G26860.1); Has 4934 Blast hits to 4934 proteins in 1278 species: Archae - 14; Bacteria - 2203; Metazoa - 109; Fungi - 88; Plants - 34; Viruses - 0; Other Eukaryotes - 2486 (source: NCBI BLink).
AT1G11940AT1G11940.1ACGTGTACGTGGCTTACGACGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 329 Blast hits to 329 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT1G12200AT1G12200.1GTGACACGTCATCflavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62580.1); Has 9107 Blast hits to 8683 proteins in 970 species: Archae - 28; Bacteria - 4021; Metazoa - 1067; Fungi - 1001; Plants - 456; Viruses - 0; Other Eukaryotes - 2534 (source: NCBI BLink).
AT1G12250AT1G12250.1TCACACGTGthylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink).
AT1G12250.2TCACACGTGthylakoid lumenal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 15 kDa protein, chloroplast (TAIR:AT2G44920.2); Has 6004 Blast hits to 3393 proteins in 359 species: Archae - 127; Bacteria - 4195; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 4; Other Eukaryotes - 1572 (source: NCBI BLink).
AT1G12370AT1G12370.1ATCCACGTAGencodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele
AT1G12370.1TGACACGTGTTencodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele
AT1G12370.2ATCCACGTAGencodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele
AT1G12370.2TGACACGTGTTencodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele
AT1G12380AT1G12380.1CGACGTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62870.1); Has 97 Blast hits to 97 proteins in 28 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 8; Plants - 48; Viruses - 6; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G12560AT1G12560.1GTACACGTMember of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Containing a conserved root hair-specific cis-element RHE. Expressed specifically in root hair cell.
AT1G12570AT1G12570.1GTGACACGTGTCCglucose-methanol-choline (GMC) oxidoreductase family protein; FUNCTIONS IN: aldehyde-lyase activity, oxidoreductase activity, acting on CH-OH group of donors, FAD binding; INVOLVED IN: cellular alcohol metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Glucose-methanol-choline oxidoreductase, N-terminal (InterPro:IPR000172), Glucose-methanol-choline oxidoreductase (InterPro:IPR012132), Glucose-methanol-choline oxidoreductase, C-terminal (InterPro:IPR007867); BEST Arabidopsis thaliana protein match is: glucose-methanol-choline (GMC) oxidoreductase family protein (TAIR:AT5G51950.1); Has 8149 Blast hits to 8036 proteins in 676 species: Archae - 2; Bacteria - 2324; Metazoa - 714; Fungi - 1044; Plants - 126; Viruses - 12; Other Eukaryotes - 3927 (source: NCBI BLink).
AT1G12800AT1G12800.1ACCACGTGTCTS1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink).
AT1G12810AT1G12810.1GTGACACGTGAproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.
AT1G12810.2GTGACACGTGAproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.
AT1G12920AT1G12920.1TTGCCACGTGEncodes a eukaryotic release factor one homolog.
AT1G12990AT1G12990.1ACCACGTGTCACglycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G67880.1); Has 972 Blast hits to 971 proteins in 58 species: Archae - 0; Bacteria - 24; Metazoa - 46; Fungi - 23; Plants - 68; Viruses - 4; Other Eukaryotes - 807 (source: NCBI BLink).
AT1G13000AT1G13000.1ACCACGTGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G13000.2ACCACGTGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G13020AT1G13020.1ACGTGTACeukaryotic translation initiation factor, putative (EIF4B5); FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant specific eukaryotic initiation factor 4B (InterPro:IPR010433); BEST Arabidopsis thaliana protein match is: EIF4B1; translation initiation factor (TAIR:AT3G26400.1); Has 37479 Blast hits to 17094 proteins in 1048 species: Archae - 48; Bacteria - 11060; Metazoa - 12404; Fungi - 2655; Plants - 4577; Viruses - 418; Other Eukaryotes - 6317 (source: NCBI BLink).
AT1G13080AT1G13080.1AACACGTGGATcytochrome P450 monooxygenase
AT1G13080.2AACACGTGGATcytochrome P450 monooxygenase
AT1G13245AT1G13245.1ACCACGTGGCGTROTUNDIFOLIA LIKE 17 (RTFL17); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: shoot development; EXPRESSED IN: stem, flower, root, leaf; CONTAINS InterPro DOMAIN/s: DVL (InterPro:IPR012552); BEST Arabidopsis thaliana protein match is: RTFL15 (ROTUNDIFOLIA LIKE 15) (TAIR:AT1G68825.2); Has 68 Blast hits to 68 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13250AT1G13250.1AACACGTGGAAEncodes a protein with putative galacturonosyltransferase activity.
AT1G13380AT1G13380.1ACGTGACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27435.1); Has 150 Blast hits to 150 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13560AT1G13560.1CACACGTGTGEncodes aminoalcoholphosphotransferase AAPT1.
AT1G13560.2CACACGTGTGEncodes aminoalcoholphosphotransferase AAPT1.
AT1G13640AT1G13640.1GTGACGTGGCACphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 401 Blast hits to 395 proteins in 120 species: Archae - 0; Bacteria - 2; Metazoa - 139; Fungi - 53; Plants - 136; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT1G13670AT1G13670.1ACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: petal, inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13740AT1G13740.1ACGACACGTEncodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent.
AT1G13740.1AGACACGTGTCGTEncodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent.
AT1G13740.1GCCACGTGTCGTTEncodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent.
AT1G13860AT1G13860.1ACGACACGTdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G03480.1); Has 643 Blast hits to 634 proteins in 97 species: Archae - 2; Bacteria - 137; Metazoa - 0; Fungi - 2; Plants - 455; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G13860.3ACGACACGTdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G03480.1); Has 643 Blast hits to 634 proteins in 97 species: Archae - 2; Bacteria - 137; Metazoa - 0; Fungi - 2; Plants - 455; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G13860.4ACGACACGTdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G03480.1); Has 643 Blast hits to 634 proteins in 97 species: Archae - 2; Bacteria - 137; Metazoa - 0; Fungi - 2; Plants - 455; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G14010AT1G14010.1AACACGTGGCAATemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).
AT1G14010.1CACGTGTTGACTTTemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).
AT1G14010.1TCCACGTGTTemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).
AT1G14120AT1G14120.1CACGTGGAA2-oxoglutarate-dependent dioxygenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate-dependent dioxygenase, putative (TAIR:AT1G14130.1); Has 4142 Blast hits to 4099 proteins in 511 species: Archae - 0; Bacteria - 408; Metazoa - 75; Fungi - 270; Plants - 2846; Viruses - 0; Other Eukaryotes - 543 (source: NCBI BLink).
AT1G14140AT1G14140.1TTGCCACGTCGmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).
AT1G14290AT1G14290.1TTAAAGCCACGTGGAAEncodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth.
AT1G14345AT1G14345.1CTTAGGCCACGTGGCACoxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); Has 255 Blast hits to 255 proteins in 67 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G14360AT1G14360.1ATCCACGTUDP-GALACTOSE TRANSPORTER 3 (UTR3); FUNCTIONS IN: pyrimidine nucleotide sugar transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: UTR1 (UDP-GALACTOSE TRANSPORTER 1); UDP-galactose transmembrane transporter/ UDP-glucose transmembrane transporter/ pyrimidine nucleotide sugar transmembrane transporter (TAIR:AT2G02810.1); Has 750 Blast hits to 744 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 423; Fungi - 103; Plants - 108; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).
AT1G14360.1TACACGTGGAAUDP-GALACTOSE TRANSPORTER 3 (UTR3); FUNCTIONS IN: pyrimidine nucleotide sugar transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: UTR1 (UDP-GALACTOSE TRANSPORTER 1); UDP-galactose transmembrane transporter/ UDP-glucose transmembrane transporter/ pyrimidine nucleotide sugar transmembrane transporter (TAIR:AT2G02810.1); Has 750 Blast hits to 744 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 423; Fungi - 103; Plants - 108; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).
AT1G14660AT1G14660.1CACGTCATmember of putative Na+/H+ antiporter (AtNHX) family. Functions as a plasma membrane Li+/H+ antiporter. Involved in Li+ efflux and detoxification.
AT1G14730AT1G14730.1ACGTGTGALOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome b561, eukaryote (InterPro:IPR004877), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: ACYB-1; carbon-monoxide oxygenase (TAIR:AT5G38630.1); Has 447 Blast hits to 446 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 321; Fungi - 5; Plants - 110; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G14830AT1G14830.1CGACGTGGEncodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts.
AT1G14900AT1G14900.1GTCCACGTCAGEncodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA.
AT1G15140AT1G15140.1ATCCACGTGGCAAoxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).
AT1G15140.2ATCCACGTGGCAAoxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).
AT1G15140.3ATCCACGTGGCAAoxidoreductase NAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; LOCATED IN: thylakoid, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Oxidoreductase FAD/NAD(P)-binding (InterPro:IPR001433), Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Riboflavin synthase-like beta-barrel (InterPro:IPR017938), Phenol hydroxylase reductase (InterPro:IPR001221); BEST Arabidopsis thaliana protein match is: FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding (TAIR:AT1G20020.3); Has 4066 Blast hits to 4066 proteins in 971 species: Archae - 52; Bacteria - 3026; Metazoa - 11; Fungi - 136; Plants - 246; Viruses - 0; Other Eukaryotes - 595 (source: NCBI BLink).
AT1G15180AT1G15180.1GTGACACGTGGACMATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink).
AT1G15180.2GTGACACGTGGACMATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G15170.1); Has 4248 Blast hits to 4206 proteins in 991 species: Archae - 55; Bacteria - 2461; Metazoa - 126; Fungi - 208; Plants - 689; Viruses - 0; Other Eukaryotes - 709 (source: NCBI BLink).
AT1G15200AT1G15200.1CACACGTGAprotein-protein interaction regulator family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pinin/SDK/memA protein (InterPro:IPR006786); Has 5080 Blast hits to 3694 proteins in 299 species: Archae - 6; Bacteria - 218; Metazoa - 2325; Fungi - 443; Plants - 161; Viruses - 52; Other Eukaryotes - 1875 (source: NCBI BLink).
AT1G15290AT1G15290.1TTGCCACGTGGGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G28080.1); Has 8993 Blast hits to 2614 proteins in 265 species: Archae - 85; Bacteria - 2044; Metazoa - 4793; Fungi - 935; Plants - 100; Viruses - 4; Other Eukaryotes - 1032 (source: NCBI BLink).
AT1G15330AT1G15330.1ATGCCACGTGTTCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G15330.1ATTGCCACGTGCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G15340AT1G15340.1TACGTGTCGTTProtein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT1G15380AT1G15380.1ACGTGGAClactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).
AT1G15380.1GACGTGTCAClactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).
AT1G15380.2ACGTGGAClactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).
AT1G15380.2GACGTGTCAClactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).
AT1G15430AT1G15430.1GGACACGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15430.2GGACACGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15740AT1G15740.1TACACGTGTCATleucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT4G23840.1); Has 25965 Blast hits to 13594 proteins in 578 species: Archae - 6; Bacteria - 5108; Metazoa - 10615; Fungi - 448; Plants - 7228; Viruses - 79; Other Eukaryotes - 2481 (source: NCBI BLink).
AT1G15820AT1G15820.1TTCCACGTGTCATLhcb6 protein (Lhcb6), light harvesting complex of photosystem II.
AT1G15880AT1G15880.1ATCCACGTGolgi SNARE 11 protein (GOS11)
AT1G15890AT1G15890.1ACGTGGATdisease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: N-terminal protein myristoylation, defense response, apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G43730.1); Has 12716 Blast hits to 11782 proteins in 513 species: Archae - 12; Bacteria - 543; Metazoa - 2689; Fungi - 133; Plants - 9121; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink).
AT1G15930AT1G15930.1ATCCACGT40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).
AT1G15930.2ATCCACGT40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).
AT1G16150AT1G16150.1AGCCACGTCATEncodes a cell-wall associated kinase like protein of the receptor-like kinase (RLK) superfamily. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+.
AT1G16190AT1G16190.1CACGTGGADNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink).
AT1G16190.1TGTCACGTGCGDNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink).
AT1G16540AT1G16540.1ACGTGGAAEncodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. <i>sir</i> loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.
AT1G16540.1TGACACGTGACACGEncodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. <i>sir</i> loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.
AT1G16540.1TGACACGTGGCACEncodes molybdenum cofactor sulfurase. Involved in Moco biosynthesis. Involved in the conversion of ABA-aldehyde to ABA, the last step of abscisic acid (ABA) biosynthesis. <i>sir</i> loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling.N terminal domain is similar to bacterial NifS suggesting a common mechanism for sulphur mobilization and transfer.
AT1G16560AT1G16560.1AGACACGTGGTPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G16560.2AGACACGTGGTPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G16560.3AGACACGTGGTPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G16560.4AGACACGTGGTPer1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like protein-related (TAIR:AT5G62130.1); Has 248 Blast hits to 238 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 103; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G16570AT1G16570.1AGACACGTGACglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).
AT1G16570.2AGACACGTGACglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).
AT1G16590AT1G16590.1GTCACGTGTCTputative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).
AT1G16610AT1G16610.1CTGCCACGTASR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP.
AT1G16610.2CTGCCACGTASR spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP.
AT1G16630AT1G16630.1ATCCACGTunknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16270.1); Has 11932 Blast hits to 5221 proteins in 448 species: Archae - 45; Bacteria - 656; Metazoa - 5756; Fungi - 729; Plants - 423; Viruses - 460; Other Eukaryotes - 3863 (source: NCBI BLink).
AT1G16670AT1G16670.1GTGACGTGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G09010.1); Has 86261 Blast hits to 85145 proteins in 3101 species: Archae - 56; Bacteria - 7465; Metazoa - 37883; Fungi - 6798; Plants - 18959; Viruses - 382; Other Eukaryotes - 14718 (source: NCBI BLink).
AT1G16700AT1G16700.1GTCCACGTNADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial, putative; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity, metal ion binding; LOCATED IN: mitochondrion, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: 4Fe-4S ferredoxin, iron-sulphur binding, subgroup (InterPro:IPR001450), NADH-quinone oxidoreductase, chain I (InterPro:IPR010226), 4Fe-4S ferredoxin, iron-sulphur binding, conserved site (InterPro:IPR017900), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Alpha-helical ferredoxin (InterPro:IPR009051); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 23 kDa subunit, mitochondrial (TYKY) (TAIR:AT1G79010.1); Has 7775 Blast hits to 7384 proteins in 1556 species: Archae - 918; Bacteria - 3928; Metazoa - 127; Fungi - 70; Plants - 695; Viruses - 0; Other Eukaryotes - 2037 (source: NCBI BLink).
AT1G16710AT1G16710.1TCACACGTGCGACATCGEncodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides.
AT1G16720AT1G16720.1TACGTGGCTEncodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex.
AT1G16740AT1G16740.1AACACGTGTCCribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).
AT1G16740.1GTGACACGTGGTribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).
AT1G16790AT1G16790.1TGACACGTCATCribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G16850AT1G16850.1ACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G16850.1AGACACGTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17100AT1G17100.1TCACACGTSOUL heme-binding family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SOUL haem-binding protein (InterPro:IPR006917); BEST Arabidopsis thaliana protein match is: SOUL heme-binding family protein (TAIR:AT1G78450.1); Has 1175 Blast hits to 1144 proteins in 91 species: Archae - 10; Bacteria - 83; Metazoa - 242; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 725 (source: NCBI BLink).
AT1G17110AT1G17110.1TAATTACGTGTGAEncodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant.
AT1G17190AT1G17190.1CGACGTGGEncodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G17210AT1G17210.1CACACGTGGCTzinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).
AT1G17220AT1G17220.1AGCCACGTGTGEncodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal.
AT1G17430AT1G17430.1TTGCCACGThydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G72620.1); Has 3179 Blast hits to 3177 proteins in 659 species: Archae - 36; Bacteria - 2008; Metazoa - 134; Fungi - 8; Plants - 175; Viruses - 0; Other Eukaryotes - 818 (source: NCBI BLink).
AT1G17440AT1G17440.1CTGACGTGTACEncodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression.
AT1G17440.2CTGACGTGTACEncodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression.
AT1G17680AT1G17680.1CTGACGTGtranscription factor-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 5115 Blast hits to 2913 proteins in 387 species: Archae - 48; Bacteria - 954; Metazoa - 1578; Fungi - 711; Plants - 242; Viruses - 52; Other Eukaryotes - 1530 (source: NCBI BLink).
AT1G17680.2CTGACGTGtranscription factor-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 5115 Blast hits to 2913 proteins in 387 species: Archae - 48; Bacteria - 954; Metazoa - 1578; Fungi - 711; Plants - 242; Viruses - 52; Other Eukaryotes - 1530 (source: NCBI BLink).
AT1G17690AT1G17690.1ATAAACCGACGTGTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink).
AT1G17760AT1G17760.1ATCCACGTGGACEncodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit.
AT1G17810AT1G17810.1ATCCACGTGTTbeta-tonoplast intrinsic protein (beta-TIP) mRNA, complete
AT1G17860AT1G17860.1ACACGTCAtrypsin and protease inhibitor family protein / Kunitz family protein; FUNCTIONS IN: endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I3, Kunitz legume (InterPro:IPR002160), Kunitz inhibitor ST1-like (InterPro:IPR011065); BEST Arabidopsis thaliana protein match is: trypsin and protease inhibitor family protein / Kunitz family protein (TAIR:AT1G73260.1); Has 508 Blast hits to 508 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 507; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G18040AT1G18040.1AACACGTGGATCYCLIN-DEPENDENT KINASE D1;3 (CDKD1;3); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CDKD1;1 (CYCLIN-DEPENDENT KINASE D1;1); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G73690.1); Has 86988 Blast hits to 85857 proteins in 2791 species: Archae - 31; Bacteria - 7397; Metazoa - 37676; Fungi - 8140; Plants - 16874; Viruses - 362; Other Eukaryotes - 16508 (source: NCBI BLink).
AT1G18070AT1G18070.1TGACACGTGAEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).
AT1G18070.2TGACACGTGAEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).
AT1G18100AT1G18100.1ACGTGGAAE12A11 protein (E12A11)
AT1G18260AT1G18260.1ACGTGGCAATsuppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G73570.1); Has 15581 Blast hits to 5419 proteins in 820 species: Archae - 0; Bacteria - 9844; Metazoa - 747; Fungi - 658; Plants - 84; Viruses - 27; Other Eukaryotes - 4221 (source: NCBI BLink).
AT1G18260.1TACGTGGCsuppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G73570.1); Has 15581 Blast hits to 5419 proteins in 820 species: Archae - 0; Bacteria - 9844; Metazoa - 747; Fungi - 658; Plants - 84; Viruses - 27; Other Eukaryotes - 4221 (source: NCBI BLink).
AT1G18270AT1G18270.1TTCCACGTketose-bisphosphate aldolase class-II family protein; FUNCTIONS IN: in 8 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, glycolysis, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Ketose-bisphosphate aldolase, class-II (InterPro:IPR000771), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71170.1); Has 23566 Blast hits to 15271 proteins in 1513 species: Archae - 155; Bacteria - 12191; Metazoa - 519; Fungi - 517; Plants - 221; Viruses - 0; Other Eukaryotes - 9963 (source: NCBI BLink).
AT1G18270.2TTCCACGTketose-bisphosphate aldolase class-II family protein; FUNCTIONS IN: in 8 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, glycolysis, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Ketose-bisphosphate aldolase, class-II (InterPro:IPR000771), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71170.1); Has 23566 Blast hits to 15271 proteins in 1513 species: Archae - 155; Bacteria - 12191; Metazoa - 519; Fungi - 517; Plants - 221; Viruses - 0; Other Eukaryotes - 9963 (source: NCBI BLink).
AT1G18360AT1G18360.1ACGTGGCAThydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G73480.1); Has 3797 Blast hits to 3785 proteins in 942 species: Archae - 19; Bacteria - 2420; Metazoa - 132; Fungi - 101; Plants - 246; Viruses - 60; Other Eukaryotes - 819 (source: NCBI BLink).
AT1G18400AT1G18400.1CCCACGTGGCTBR Enhanced Expression 1 (BEE1); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BEE3 (BR ENHANCED EXPRESSION 3); DNA binding / transcription factor (TAIR:AT1G73830.1); Has 1122 Blast hits to 1122 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 19; Plants - 1095; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G18460AT1G18460.1CCCACGTGTCAlipase family protein; FUNCTIONS IN: lipase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AB-hydrolase associated lipase region (InterPro:IPR006693); BEST Arabidopsis thaliana protein match is: lipase family protein (TAIR:AT1G73920.1); Has 1378 Blast hits to 1358 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 1048; Fungi - 175; Plants - 88; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G18460.1TACGTGTCATlipase family protein; FUNCTIONS IN: lipase activity; INVOLVED IN: glycerol biosynthetic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AB-hydrolase associated lipase region (InterPro:IPR006693); BEST Arabidopsis thaliana protein match is: lipase family protein (TAIR:AT1G73920.1); Has 1378 Blast hits to 1358 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 1048; Fungi - 175; Plants - 88; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G18500AT1G18500.1TTCCACGTGGGTCAAAEncodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040).
AT1G18740AT1G18740.1GACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF793 (InterPro:IPR008511); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G74450.1); Has 97 Blast hits to 97 proteins in 13 species: Archae - 3; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G19000AT1G19000.1AACACGTGTCATmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT1G19000.1ATGCCACGTGGCTTmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT1G19000.2AACACGTGTCATmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT1G19000.2ATGCCACGTGGCTTmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G74840.1); Has 577 Blast hits to 576 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 521; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT1G19110AT1G19110.1GTCACGTGinter-alpha-trypsin inhibitor heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G72500.1); Has 1260 Blast hits to 1251 proteins in 217 species: Archae - 8; Bacteria - 393; Metazoa - 471; Fungi - 34; Plants - 117; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).
AT1G19110.1TTGCCACGTGACinter-alpha-trypsin inhibitor heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G72500.1); Has 1260 Blast hits to 1251 proteins in 217 species: Archae - 8; Bacteria - 393; Metazoa - 471; Fungi - 34; Plants - 117; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).
AT1G19140AT1G19140.1ACGTGACACGTGTACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19140.2ACGTGACACGTGTACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19150AT1G19150.1GTACACGTGTCACGTPSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,
AT1G19180AT1G19180.1AACACGTGTTJAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
AT1G19180.2AACACGTGTTJAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
AT1G19190AT1G19190.1CACGTCAGChydrolase; FUNCTIONS IN: hydrolase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Lipase, GDXG, active site (InterPro:IPR002168), Alpha/beta hydrolase fold-3 (InterPro:IPR013094); BEST Arabidopsis thaliana protein match is: hydrolase (TAIR:AT2G03550.1); Has 5587 Blast hits to 5577 proteins in 861 species: Archae - 47; Bacteria - 2876; Metazoa - 576; Fungi - 522; Plants - 655; Viruses - 3; Other Eukaryotes - 908 (source: NCBI BLink).
AT1G19310AT1G19310.1AGACACGTCAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G23780.1); Has 3650 Blast hits to 3643 proteins in 226 species: Archae - 0; Bacteria - 2; Metazoa - 2420; Fungi - 377; Plants - 427; Viruses - 21; Other Eukaryotes - 403 (source: NCBI BLink).
AT1G19310.1CCCACGTGGAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G23780.1); Has 3650 Blast hits to 3643 proteins in 226 species: Archae - 0; Bacteria - 2; Metazoa - 2420; Fungi - 377; Plants - 427; Viruses - 21; Other Eukaryotes - 403 (source: NCBI BLink).
AT1G19310.1GTCACGTGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G23780.1); Has 3650 Blast hits to 3643 proteins in 226 species: Archae - 0; Bacteria - 2; Metazoa - 2420; Fungi - 377; Plants - 427; Viruses - 21; Other Eukaryotes - 403 (source: NCBI BLink).
AT1G19350AT1G19350.1CGACACGTGGCTEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.4CGACACGTGGCTEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.5CGACACGTGGCTEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.6CGACACGTGGCTEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19440AT1G19440.1ACGTGGACEncodes KCS4, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT1G19570AT1G19570.1AACACGTGAEncodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.
AT1G19570.2AACACGTGAEncodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.
AT1G19650AT1G19650.1ACGTGTGASEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).
AT1G19650.1CCGCCACGTGTCTSEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).
AT1G19650.2ACGTGTGASEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).
AT1G19650.2CCGCCACGTGTCTSEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: phosphatidylinositol transporter activity, transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphatidylinositol transfer-like protein, putative (TAIR:AT1G75370.1); Has 1786 Blast hits to 1782 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 645; Fungi - 360; Plants - 459; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).
AT1G19660AT1G19660.1CACGTCATCwound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink).
AT1G19660.1GTACACGTGGCGTwound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink).
AT1G19660.2CACGTCATCwound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink).
AT1G19660.2GTACACGTGGCGTwound-responsive family protein; INVOLVED IN: response to wounding; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF151 (InterPro:IPR003729); BEST Arabidopsis thaliana protein match is: wound-responsive protein-related (TAIR:AT1G75380.3); Has 559 Blast hits to 559 proteins in 164 species: Archae - 30; Bacteria - 276; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 186 (source: NCBI BLink).
AT1G19700AT1G19700.1TCACGTGTTEncodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light.
AT1G19700.2TCACGTGTTEncodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light.
AT1G19720AT1G19720.1TTCCACGTGTTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast, cytoplasm; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 22413 Blast hits to 5958 proteins in 201 species: Archae - 3; Bacteria - 14; Metazoa - 387; Fungi - 330; Plants - 20974; Viruses - 0; Other Eukaryotes - 705 (source: NCBI BLink).
AT1G19860AT1G19860.1AGACACGTGTAzinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT3G51180.1); Has 137 Blast hits to 123 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 6; Plants - 102; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G19890AT1G19890.1CCACGTCAGChistone 3.3, male-gamete-specific expression
AT1G19890.1CCACGTCATChistone 3.3, male-gamete-specific expression
AT1G20030AT1G20030.1CCACGTCATCpathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1058 Blast hits to 1048 proteins in 144 species: Archae - 0; Bacteria - 24; Metazoa - 48; Fungi - 45; Plants - 930; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G20030.2CCACGTCATCpathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1058 Blast hits to 1048 proteins in 144 species: Archae - 0; Bacteria - 24; Metazoa - 48; Fungi - 45; Plants - 930; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G20110AT1G20110.1CCGCCACGTGTAzinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT3G14270.1); Has 25361 Blast hits to 16508 proteins in 676 species: Archae - 11; Bacteria - 1450; Metazoa - 10130; Fungi - 5149; Plants - 3412; Viruses - 575; Other Eukaryotes - 4634 (source: NCBI BLink).
AT1G20130AT1G20130.1ACGTGTGAhydrolase, acting on ester bonds / lipase/ structural constituent of cell wall; FUNCTIONS IN: structural constituent of cell wall, lipase activity, hydrolase activity, acting on ester bonds; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Pistil-specific extensin-like protein (InterPro:IPR003882), Lipase, GDSL, active site (InterPro:IPR008265), Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: hydrolase, acting on ester bonds / lipase (TAIR:AT1G20132.1); Has 281578 Blast hits to 80004 proteins in 2359 species: Archae - 1215; Bacteria - 68733; Metazoa - 101691; Fungi - 27522; Plants - 27422; Viruses - 8283; Other Eukaryotes - 46712 (source: NCBI BLink).
AT1G20225AT1G20225.1TTCCACGTCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76020.1); Has 156 Blast hits to 152 proteins in 51 species: Archae - 0; Bacteria - 81; Metazoa - 14; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G20340AT1G20340.1AAAACGCCACGTCATrecombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.
AT1G20340.1ACGTGGACrecombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.
AT1G20350AT1G20350.1ATGACGTGGCGTTTTmitochondrial inner membrane translocase
AT1G20350.1GTCCACGTmitochondrial inner membrane translocase
AT1G20460AT1G20460.1GTACACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20510AT1G20510.1CCACGTCATTTOPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).
AT1G20510.2CCACGTCATTTOPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).
AT1G20630AT1G20630.1AGCCACGTCCatalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2.
AT1G20696AT1G20696.1GATGACGTGGCEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT1G20696.2GATGACGTGGCEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT1G20696.3GATGACGTGGCEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT1G20930AT1G20930.1TTCCACGTCACCyclin-dependent kinase, expressed in flowers and suspension cell culture, expression peaks during M phase in synchronized cultures. Required for proper organization of the shoot apical meristem and for hormone signaling. Expressed in the shoot apical meristem. Involved in regulation of the G2/M transition of the mitotic cell cycle.
AT1G21410AT1G21410.1TACACGTGTCATAtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes.
AT1G21440AT1G21440.1ATGACACGTGGATmutase family protein; FUNCTIONS IN: isocitrate lyase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 6447 Blast hits to 6447 proteins in 860 species: Archae - 75; Bacteria - 2907; Metazoa - 29; Fungi - 322; Plants - 109; Viruses - 0; Other Eukaryotes - 3005 (source: NCBI BLink).
AT1G21540AT1G21540.1CACGTCACAMP-binding protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, C globular stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: AMP-binding protein, putative (TAIR:AT1G21530.2); Has 50553 Blast hits to 47005 proteins in 2235 species: Archae - 550; Bacteria - 27715; Metazoa - 2872; Fungi - 2366; Plants - 1252; Viruses - 1; Other Eukaryotes - 15797 (source: NCBI BLink).
AT1G21670AT1G21670.1ATCCACGTCATCINVOLVED IN: proteolysis; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Peptidase S9B, dipeptidylpeptidase IV N-terminal (InterPro:IPR002469), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21680.1); Has 6126 Blast hits to 3685 proteins in 788 species: Archae - 47; Bacteria - 3362; Metazoa - 27; Fungi - 47; Plants - 58; Viruses - 0; Other Eukaryotes - 2585 (source: NCBI BLink).
AT1G21680AT1G21680.1ATTGCCACGTGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21670.1); Has 6869 Blast hits to 3873 proteins in 790 species: Archae - 41; Bacteria - 3697; Metazoa - 41; Fungi - 39; Plants - 64; Viruses - 0; Other Eukaryotes - 2987 (source: NCBI BLink).
AT1G21690AT1G21690.1TACGTGTCAembryo defective 1968 (emb1968); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: DNA replication factor C complex, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), Replication factor C (InterPro:IPR013748), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: replication factor C 40 kDa, putative (TAIR:AT1G63160.1); Has 12080 Blast hits to 12043 proteins in 1582 species: Archae - 427; Bacteria - 5194; Metazoa - 735; Fungi - 600; Plants - 188; Viruses - 64; Other Eukaryotes - 4872 (source: NCBI BLink).
AT1G21690.2TACGTGTCAembryo defective 1968 (emb1968); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: DNA replication factor C complex, nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), Replication factor C (InterPro:IPR013748), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: replication factor C 40 kDa, putative (TAIR:AT1G63160.1); Has 12080 Blast hits to 12043 proteins in 1582 species: Archae - 427; Bacteria - 5194; Metazoa - 735; Fungi - 600; Plants - 188; Viruses - 64; Other Eukaryotes - 4872 (source: NCBI BLink).
AT1G21750AT1G21750.1AAGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.
AT1G21750.2AAGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response.
AT1G21770AT1G21770.1CTGCCACGTGTACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: H3/H4 histone acetyltransferase (TAIR:AT1G77540.1); Has 221 Blast hits to 221 proteins in 107 species: Archae - 4; Bacteria - 182; Metazoa - 4; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G21780AT1G21780.1GTACACGTGGCAGBTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B.
AT1G21780.2GTACACGTGGCAGBTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B.
AT1G21790AT1G21790.1CGACACGTGTCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G21900AT1G21900.1ACGCCACGTAGemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G09580.1); Has 1198 Blast hits to 1196 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 609; Fungi - 316; Plants - 130; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).
AT1G22160AT1G22160.1ATGACGTGTCGTAATTAsenescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT1G78020.1); Has 281 Blast hits to 281 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 281; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22270AT1G22270.1GTCACGTGGCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78190.1); Has 289 Blast hits to 289 proteins in 134 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G22360AT1G22360.1CCCACGTGGGUDP-glucosyl transferase 85A2 (AtUGT85A2); FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups, glucuronosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 4893 Blast hits to 4835 proteins in 290 species: Archae - 0; Bacteria - 46; Metazoa - 1935; Fungi - 10; Plants - 2777; Viruses - 95; Other Eukaryotes - 30 (source: NCBI BLink).
AT1G22360.2CCCACGTGGGUDP-glucosyl transferase 85A2 (AtUGT85A2); FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups, glucuronosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 4893 Blast hits to 4835 proteins in 290 species: Archae - 0; Bacteria - 46; Metazoa - 1935; Fungi - 10; Plants - 2777; Viruses - 95; Other Eukaryotes - 30 (source: NCBI BLink).
AT1G22380AT1G22380.1AGCCACGTGCGUDP-glucosyl transferase 85A3 (AtUGT85A3); FUNCTIONS IN: transferase activity, transferring glycosyl groups, transcription factor activity, glucuronosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT85A1; UDP-glycosyltransferase/ cis-zeatin O-beta-D-glucosyltransferase/ glucuronosyltransferase/ trans-zeatin O-beta-D-glucosyltransferase/ transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G22400.1); Has 4834 Blast hits to 4785 proteins in 286 species: Archae - 0; Bacteria - 31; Metazoa - 1905; Fungi - 10; Plants - 2764; Viruses - 95; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G22400AT1G22400.1TCACACGTGACGTUGT85A1; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: AtUGT85A3 (UDP-glucosyl transferase 85A3); glucuronosyltransferase/ transcription factor/ transferase, transferring glycosyl groups (TAIR:AT1G22380.1); Has 5011 Blast hits to 4962 proteins in 308 species: Archae - 0; Bacteria - 100; Metazoa - 2040; Fungi - 16; Plants - 2764; Viruses - 58; Other Eukaryotes - 33 (source: NCBI BLink).
AT1G22410AT1G22410.1GGACACGT2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative; FUNCTIONS IN: 3-deoxy-7-phosphoheptulonate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DAHP synthetase, class II (InterPro:IPR002480); BEST Arabidopsis thaliana protein match is: DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1); 3-deoxy-7-phosphoheptulonate synthase (TAIR:AT4G39980.1); Has 3140 Blast hits to 3125 proteins in 395 species: Archae - 0; Bacteria - 662; Metazoa - 0; Fungi - 68; Plants - 129; Viruses - 0; Other Eukaryotes - 2281 (source: NCBI BLink).
AT1G22500AT1G22500.1TCACACGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: stem, cotyledon, root, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G72200.1); Has 6507 Blast hits to 6490 proteins in 222 species: Archae - 0; Bacteria - 2; Metazoa - 2224; Fungi - 542; Plants - 2639; Viruses - 59; Other Eukaryotes - 1041 (source: NCBI BLink).
AT1G22510AT1G22510.1ATTGCCACGTGTTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G72175.1); Has 530 Blast hits to 530 proteins in 91 species: Archae - 0; Bacteria - 15; Metazoa - 391; Fungi - 31; Plants - 40; Viruses - 2; Other Eukaryotes - 51 (source: NCBI BLink).
AT1G22710AT1G22710.1AGACACGTGTCACEncodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both &#945;- or &#946;-linkage.
AT1G22770AT1G22770.1ATGACACGTATogether with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression.
AT1G22850AT1G22850.1AGACACGTGGCGINVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03260.1); Has 3098 Blast hits to 3098 proteins in 664 species: Archae - 6; Bacteria - 1614; Metazoa - 182; Fungi - 59; Plants - 145; Viruses - 0; Other Eukaryotes - 1092 (source: NCBI BLink).
AT1G22930AT1G22930.1TACGTGTCGT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink).
AT1G22930.2TACGTGTCGT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink).
AT1G23100AT1G23100.1GAATGGGCCTGGGCCACGTA10 kDa chaperonin, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Chaperonin Cpn10, conserved site (InterPro:IPR018369), Chaperonin Cpn10 (InterPro:IPR001476); BEST Arabidopsis thaliana protein match is: CPN10 (CHAPERONIN 10); chaperone binding (TAIR:AT1G14980.1); Has 5807 Blast hits to 5744 proteins in 1499 species: Archae - 0; Bacteria - 3188; Metazoa - 245; Fungi - 75; Plants - 201; Viruses - 2; Other Eukaryotes - 2096 (source: NCBI BLink).
AT1G23120AT1G23120.1AACACGTGTTmajor latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT1G70870.1); Has 258 Blast hits to 238 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 258; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23190AT1G23190.1TACACGTGTCTphosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative; FUNCTIONS IN: intramolecular transferase activity, phosphotransferases, magnesium ion binding, phosphoglucomutase activity; INVOLVED IN: response to cadmium ion, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, plasma membrane, chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-D-phosphohexomutase, C-terminal (InterPro:IPR005843), Alpha-D-phosphohexomutase, conserved site (InterPro:IPR016066), Alpha-D-phosphohexomutase, alpha/beta/alpha I, II and III (InterPro:IPR016055), Alpha-D-phosphohexomutase, alpha/beta/alpha domain III (InterPro:IPR005846), Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (InterPro:IPR005845), Alpha-D-phosphohexomutase, N-terminal (InterPro:IPR005841), Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (InterPro:IPR005844); BEST Arabidopsis thaliana protein match is: phosphoglucomutase, cytoplasmic, putative / glucose phosphomutase, putative (TAIR:AT1G70730.3); Has 4473 Blast hits to 4462 proteins in 1171 species: Archae - 68; Bacteria - 2876; Metazoa - 457; Fungi - 136; Plants - 117; Viruses - 0; Other Eukaryotes - 819 (source: NCBI BLink).
AT1G23200AT1G23200.1TGACGTGGCTpectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT2G45220.1); Has 1490 Blast hits to 1459 proteins in 273 species: Archae - 6; Bacteria - 408; Metazoa - 1; Fungi - 133; Plants - 940; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G23280AT1G23280.1GCTGACGTGMAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).
AT1G23310AT1G23310.1AAAACGACGGACACGTGGATIdentified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.
AT1G23310.2AAAACGACGGACACGTGGATIdentified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.
AT1G23480AT1G23480.1ACACGTCATencodes a gene similar to cellulose synthase
AT1G23480.2ACACGTCATencodes a gene similar to cellulose synthase
AT1G23480.3ACACGTCATencodes a gene similar to cellulose synthase
AT1G23710AT1G23710.1TGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G23750AT1G23750.1GTACACGTGTTDNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G23830AT1G23830.1GTGACGTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23840.1); Has 33 Blast hits to 30 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23960AT1G23960.1TGTCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23960.2TGTCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G24430AT1G24430.1ATGACACGTtransferase/ transferase, transferring acyl groups other than amino-acyl groups; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups, transferase activity; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: transferase family protein (TAIR:AT3G26040.1); Has 920 Blast hits to 920 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 17; Plants - 903; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G24460AT1G24460.1GTCACGTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31570.1); Has 146166 Blast hits to 64397 proteins in 2264 species: Archae - 2251; Bacteria - 28256; Metazoa - 66049; Fungi - 10658; Plants - 5728; Viruses - 891; Other Eukaryotes - 32333 (source: NCBI BLink).
AT1G25220AT1G25220.1CACGTGGTCatalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2).
AT1G25275AT1G25275.1ATGACACGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G25275.2ATGACACGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G25275.3ATGACACGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G25400AT1G25400.1ACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68440.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G25400.1CCACGTCATCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68440.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G25520AT1G25520.1ATCCACGTGGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68650.1); Has 1239 Blast hits to 1181 proteins in 440 species: Archae - 13; Bacteria - 667; Metazoa - 131; Fungi - 99; Plants - 104; Viruses - 0; Other Eukaryotes - 225 (source: NCBI BLink).
AT1G26150AT1G26150.1TCACACGTPROLINE-RICH EXTENSIN-LIKE RECEPTOR KINASE 10 (PERK10); FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / protein kinase/ protein serine/threonine kinase (TAIR:AT1G68690.1); Has 437812 Blast hits to 190668 proteins in 4392 species: Archae - 931; Bacteria - 74625; Metazoa - 185213; Fungi - 57061; Plants - 50943; Viruses - 9960; Other Eukaryotes - 59079 (source: NCBI BLink).
AT1G26270AT1G26270.1AAGCCACGTCAphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 429 Blast hits to 418 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 149; Fungi - 63; Plants - 133; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink).
AT1G26270.1GTCCACGTphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 429 Blast hits to 418 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 149; Fungi - 63; Plants - 133; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink).
AT1G26300AT1G26300.1ACGTGACATTCGGTTTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26300.2ACGTGACATTCGGTTTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26665AT1G26665.1TTCCACGTCAGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: RNA polymerase II mediator complex protein-related (TAIR:AT5G41910.1); Has 223 Blast hits to 223 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 83; Plants - 24; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G26665.2TTCCACGTCAGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: RNA polymerase II mediator complex protein-related (TAIR:AT5G41910.1); Has 223 Blast hits to 223 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 83; Plants - 24; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G26670AT1G26670.1TGACACGTGTCAmember of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles.
AT1G26761AT1G26761.1AGACACGTGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 197 Blast hits to 129 proteins in 53 species: Archae - 0; Bacteria - 148; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G26799AT1G26799.1CACGTCAGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Plant self-incompatibility S1 (InterPro:IPR010264); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26796.1); Has 67 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G26820AT1G26820.1TCACACGTCACGEncodes ribonuclease RNS3.
AT1G27000AT1G27000.1TTGCCACGTGGCGAbZIP family transcription factor; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1664 (InterPro:IPR012458); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02730.2); Has 122 Blast hits to 113 proteins in 16 species: Archae - 0; Bacteria - 8; Metazoa - 2; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT1G27150AT1G27150.1GGACACGTCATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G27110.1); Has 297 Blast hits to 297 proteins in 82 species: Archae - 4; Bacteria - 114; Metazoa - 76; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).
AT1G27300AT1G27300.1TGTCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 36 Blast hits to 36 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G27350AT1G27350.1ATGACACGTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G27350.1GCCACGTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G27350.1TCACACGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G27461AT1G27461.1TCACACGTGTCCunknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G27470AT1G27470.1CTACGTGGCATtransducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).
AT1G27480AT1G27480.1ATGCCACGTAGlecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).
AT1G27600AT1G27600.1TCGCCACGTGTCCglycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G27600.2TCGCCACGTGTCCglycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G27700AT1G27700.1CGCACGTGTGprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G30240.1); Has 64 Blast hits to 63 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27730AT1G27730.1CACACGTGTACRelated to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress.
AT1G27760AT1G27760.1AGCCACGTGTGAEncodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress.
AT1G27760.2AGCCACGTGTGAEncodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress.
AT1G27760.3AGCCACGTGTGAEncodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress.
AT1G27840AT1G27840.1ATGACGTGTCAATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).
AT1G27840.2ATGACGTGTCAATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).
AT1G27840.3ATGACGTGTCAATCSA-1; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G19750.1); Has 20142 Blast hits to 11900 proteins in 449 species: Archae - 22; Bacteria - 3120; Metazoa - 8347; Fungi - 4311; Plants - 1805; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).
AT1G27930AT1G27930.1ACGTGTCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF579, plant (InterPro:IPR006514); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67330.1); Has 160 Blast hits to 160 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G27930.1GGACACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF579, plant (InterPro:IPR006514); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67330.1); Has 160 Blast hits to 160 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G27990AT1G27990.1ATGACACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27990.1CACGTGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27990.1TGACACGTGTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28140AT1G28140.1CCACGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 111 Blast hits to 111 proteins in 58 species: Archae - 0; Bacteria - 74; Metazoa - 7; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G28360AT1G28360.1CCCACGTGTAencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G28370AT1G28370.1AAGCCACGTAencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G28375AT1G28375.1ACGTGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395AT1G28395.1TGACACGTGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395.2TGACACGTGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395.3TGACACGTGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395.4TGACACGTGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28540AT1G28540.1CACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28540.1CTGCCACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28960AT1G28960.1AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).
AT1G28960.2AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).
AT1G28960.3AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).
AT1G28960.4AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).
AT1G28960.5AACACGTGGACARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 15 (ATNUDX15); FUNCTIONS IN: hydrolase activity, CoA pyrophosphatase activity (sent to SF); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086), Nudix hydrolase, AtNUDT22 (InterPro:IPR017397); BEST Arabidopsis thaliana protein match is: atnudt22 (Arabidopsis thaliana Nudix hydrolase homolog 22); hydrolase (TAIR:AT2G33980.1); Has 2486 Blast hits to 2486 proteins in 782 species: Archae - 27; Bacteria - 1315; Metazoa - 138; Fungi - 119; Plants - 57; Viruses - 0; Other Eukaryotes - 830 (source: NCBI BLink).
AT1G29330AT1G29330.1ATTGCCACGTCATCEncodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves.
AT1G29390AT1G29390.1CTACGTGGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29390.1GCTGACGTGGAAencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29390.1GTCCACGTAGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29390.2CTACGTGGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29390.2GCTGACGTGGAAencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29390.2GTCCACGTAGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29395AT1G29395.1GCTGACGTGGencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. Possibly targeted to thylakoid membrane.
AT1G29395.1GTCCACGTencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. Possibly targeted to thylakoid membrane.
AT1G29395.1TCACGTGTAencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. Possibly targeted to thylakoid membrane.
AT1G29680AT1G29680.1GTGACACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1264 (InterPro:IPR010686); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45690.1); Has 188 Blast hits to 188 proteins in 83 species: Archae - 0; Bacteria - 84; Metazoa - 0; Fungi - 43; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G29920AT1G29920.1ATTGCCACGTAEncodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II.
AT1G29930AT1G29930.1TACGTGTCACGTCATSubunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center.
AT1G30110AT1G30110.1TACACGTGGCAAARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 25 (ATNUDX25); FUNCTIONS IN: bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: diadenosine tetraphosphate catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 4194 Blast hits to 4194 proteins in 805 species: Archae - 14; Bacteria - 2251; Metazoa - 23; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1859 (source: NCBI BLink).
AT1G30120AT1G30120.1AACACGTGTTEncodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit.
AT1G30120.1GTACACGTGEncodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit.
AT1G30260AT1G30260.1CACACGTGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cytokinin stimulus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT4G21060.1); Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G30290AT1G30290.1TGTCACGTGGCTTunknown protein
AT1G30320AT1G30320.1GTGACGTGTCGremorin family protein; FUNCTIONS IN: DNA binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516); BEST Arabidopsis thaliana protein match is: remorin family protein (TAIR:AT2G02170.2); Has 11227 Blast hits to 6329 proteins in 787 species: Archae - 19; Bacteria - 2109; Metazoa - 2795; Fungi - 948; Plants - 557; Viruses - 39; Other Eukaryotes - 4760 (source: NCBI BLink).
AT1G30520AT1G30520.1CTGCCACGTCATCEncodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal.
AT1G30630AT1G30630.1ACGTGACAcoatomer protein epsilon subunit family protein / COPE family protein; FUNCTIONS IN: protein transporter activity, protein binding, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); BEST Arabidopsis thaliana protein match is: coatomer protein epsilon subunit family protein / COPE family protein (TAIR:AT2G34840.1); Has 326 Blast hits to 326 proteins in 131 species: Archae - 2; Bacteria - 5; Metazoa - 149; Fungi - 59; Plants - 65; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).
AT1G30680AT1G30680.1TTCCACGTtoprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).
AT1G30755AT1G30755.1CACGTCACunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF668 (InterPro:IPR007700); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34320.1); Has 262 Blast hits to 228 proteins in 50 species: Archae - 0; Bacteria - 7; Metazoa - 53; Fungi - 15; Plants - 160; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G31230AT1G31230.1TACACGTGGCAAEncodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.
AT1G31320AT1G31320.1TGTCACGTGLOB DOMAIN-CONTAINING PROTEIN 4 (LBD4); INVOLVED IN: biological_process unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: ASL5; DNA binding / protein binding (TAIR:AT2G30130.1); Has 595 Blast hits to 592 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 595; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G31420AT1G31420.1CACGTGCGEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT1G31420.1TGACACGTGTGEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT1G31480AT1G31480.1CTACGTGGCAGencodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole.
AT1G31750AT1G31750.1ACGTGTCATproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 28504 Blast hits to 13839 proteins in 758 species: Archae - 8; Bacteria - 3021; Metazoa - 12889; Fungi - 3156; Plants - 5337; Viruses - 840; Other Eukaryotes - 3253 (source: NCBI BLink).
AT1G31812AT1G31812.1ATCCACGTAcyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases.
AT1G32060AT1G32060.1CCCACGTGTCAPHOSPHORIBULOKINASE (PRK); FUNCTIONS IN: protein binding, phosphoribulokinase activity, ATP binding; INVOLVED IN: response to cold, defense response to bacterium, peptidyl-cysteine S-nitrosylation, biosynthetic process; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Phosphoribulokinase (InterPro:IPR006082); BEST Arabidopsis thaliana protein match is: uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative (TAIR:AT3G27440.1); Has 3778 Blast hits to 3778 proteins in 1337 species: Archae - 19; Bacteria - 2109; Metazoa - 288; Fungi - 89; Plants - 839; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink).
AT1G32130AT1G32130.1GATGACGTGGCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TFIIS N-terminal (InterPro:IPR017923), IWS1, C-terminal (InterPro:IPR008654); BEST Arabidopsis thaliana protein match is: IWS1 C-terminus family protein (TAIR:AT4G19000.1); Has 907 Blast hits to 871 proteins in 182 species: Archae - 4; Bacteria - 14; Metazoa - 417; Fungi - 195; Plants - 42; Viruses - 8; Other Eukaryotes - 227 (source: NCBI BLink).
AT1G32350AT1G32350.1ACGTGTCAalternative oxidase 1D (AOX1D); FUNCTIONS IN: alternative oxidase activity; INVOLVED IN: oxidation reduction, response to cyclopentenone; LOCATED IN: mitochondrial envelope, mitochondrion; EXPRESSED IN: stem, sepal, stamen, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Alternative oxidase (InterPro:IPR002680); BEST Arabidopsis thaliana protein match is: AOX1A (ALTERNATIVE OXIDASE 1A); alternative oxidase (TAIR:AT3G22370.1); Has 1055 Blast hits to 1055 proteins in 175 species: Archae - 0; Bacteria - 81; Metazoa - 6; Fungi - 138; Plants - 257; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink).
AT1G32380AT1G32380.1ATGACACGTAribose-phosphate pyrophosphokinase 2 / phosphoribosyl diphosphate synthetase 2 (PRS2); FUNCTIONS IN: magnesium ion binding, ribose phosphate diphosphokinase activity; INVOLVED IN: cellular biosynthetic process, nucleotide biosynthetic process, nucleoside metabolic process, ribonucleoside monophosphate biosynthetic process; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Phosphoribosyl pyrophosphokinase (InterPro:IPR005946), Phosphoribosyl pyrophosphate synthetase, conserved site (InterPro:IPR000842); BEST Arabidopsis thaliana protein match is: ribose-phosphate pyrophosphokinase 1 / phosphoribosyl diphosphate synthetase 1 (PRSI) (TAIR:AT2G35390.2); Has 8056 Blast hits to 7889 proteins in 1556 species: Archae - 182; Bacteria - 3337; Metazoa - 501; Fungi - 457; Plants - 129; Viruses - 7; Other Eukaryotes - 3443 (source: NCBI BLink).
AT1G32410AT1G32410.1CACACGTGGCvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.2CACACGTGGCvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.3CACACGTGGCvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.4CACACGTGGCvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.5CACACGTGGCvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32460AT1G32460.1ACGTGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 12 Blast hits to 12 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32550AT1G32550.1TCGCCACGTGTCTferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).
AT1G32550.1TTCCACGTGTTferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).
AT1G32550.1TTGCCACGTAGferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).
AT1G32550.2TCGCCACGTGTCTferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).
AT1G32550.2TTCCACGTGTTferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).
AT1G32550.2TTGCCACGTAGferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD1 (FERREDOXIN 1); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G10960.1).
AT1G32560AT1G32560.1AACACGTGGAAlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G32560.1AGACACGTGGCGAlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G32560.1CTACGTGGCAAlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT2G35300.1); Has 190 Blast hits to 190 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 41; Fungi - 0; Plants - 145; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G32640AT1G32640.1ATCCACGTEncodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif. Its transcription is induced by dehydration stress and ABA treatment. Negative regulator of blue light–mediated photomorphogenic growth and blue and far-red-light–regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression.
AT1G32640.1TACACGTGCGEncodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif. Its transcription is induced by dehydration stress and ABA treatment. Negative regulator of blue light–mediated photomorphogenic growth and blue and far-red-light–regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression.
AT1G32640.1TCGCCACGTAEncodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif. Its transcription is induced by dehydration stress and ABA treatment. Negative regulator of blue light–mediated photomorphogenic growth and blue and far-red-light–regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression.
AT1G32870AT1G32870.1TACGTGTCGTArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT1G32870.2TACGTGTCGTArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT1G32900AT1G32900.1ACGCCACGTGTCACstarch synthase, putative; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process, glucan biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycogen/starch synthases, ADP-glucose type (InterPro:IPR011835), Starch synthase catalytic region (InterPro:IPR013534), Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: AtSS2 (starch synthase 2); transferase, transferring glycosyl groups (TAIR:AT3G01180.1); Has 9548 Blast hits to 9532 proteins in 2484 species: Archae - 212; Bacteria - 3723; Metazoa - 12; Fungi - 137; Plants - 4346; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink).
AT1G33170AT1G33170.1ACCACGTGdehydration-responsive family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive family protein (TAIR:AT4G10440.1); Has 559 Blast hits to 552 proteins in 56 species: Archae - 2; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 483; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G33360AT1G33360.1TACACGTGTCCEncodes ClpX3, a subunit of the Clp protease complex.
AT1G34220AT1G34220.1CGACGTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink).
AT1G34220.2CGACGTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink).
AT1G34630AT1G34630.1CGACACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT1G34630.2CGACACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51150.1); Has 221 Blast hits to 214 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT1G35430AT1G35430.1CGCACGTGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 10 Blast hits to 10 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G35516AT1G35516.1ACGTGGAACONTAINS InterPro DOMAIN/s: Myb transcription factor (InterPro:IPR015495); Has 12 Blast hits to 12 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G35580AT1G35580.1TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35580.2TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35580.3TCGTCGTTTAGTCCACGTAGEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9.
AT1G35720AT1G35720.1AACACGTGGCAGEncodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, &#946;-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion.
AT1G35720.1GCCACGTCGEncodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, &#946;-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion.
AT1G37130AT1G37130.1ACGTGTGAIdentified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940.
AT1G42990AT1G42990.1AACACGTGTCATAtbZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. GFP fusions containing the first 260 amino acids (AtbZIP60deltaC) are nuclear-localized. AtbZIP60 is upregulated by the addition of tunicamycin (ER stress response inductor), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress the protein is proteolyzed and the soluble part is translocalized into the nucleus. AtbZIP60deltaC can activate the promoters of the ER chaperones BiP1, BiP2 and BiP3 and CNX1 and CNX2 via binding to the ER stress response element (ERSE) and the plant unfolded protein response element(P-UPRE). It can also activate its own transcription.
AT1G42990.1GTACACGTGTTAtbZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. GFP fusions containing the first 260 amino acids (AtbZIP60deltaC) are nuclear-localized. AtbZIP60 is upregulated by the addition of tunicamycin (ER stress response inductor), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress the protein is proteolyzed and the soluble part is translocalized into the nucleus. AtbZIP60deltaC can activate the promoters of the ER chaperones BiP1, BiP2 and BiP3 and CNX1 and CNX2 via binding to the ER stress response element (ERSE) and the plant unfolded protein response element(P-UPRE). It can also activate its own transcription.
AT1G43130AT1G43130.1GATGACGTGTCGLIKE COV 2 (LCV2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: stem vascular tissue pattern formation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1946 Blast hits to 1946 proteins in 369 species: Archae - 4; Bacteria - 692; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 1166 (source: NCBI BLink).
AT1G43160AT1G43160.1ACGTGTCATencodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily.
AT1G43160.1CCCACGTGTCACencodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily.
AT1G43670AT1G43670.1CTGCCACGTGTCATfructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative; FUNCTIONS IN: fructose 1,6-bisphosphate 1-phosphatase activity, phosphoric ester hydrolase activity; INVOLVED IN: carbohydrate metabolic process, fructose metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Inositol monophosphatase/Fructose-1,6-bisphosphatase (InterPro:IPR017955), Fructose-1,6-bisphosphatase (InterPro:IPR000146); BEST Arabidopsis thaliana protein match is: fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative (TAIR:AT3G54050.1); Has 2339 Blast hits to 2334 proteins in 798 species: Archae - 22; Bacteria - 1225; Metazoa - 341; Fungi - 107; Plants - 205; Viruses - 0; Other Eukaryotes - 439 (source: NCBI BLink).
AT1G44000AT1G44000.1GCTGACGTGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11911.1); Has 133 Blast hits to 131 proteins in 47 species: Archae - 0; Bacteria - 53; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G44350AT1G44350.1CCCACGTGencodes a protein similar to IAA amino acid conjugate hydrolase.
AT1G44446AT1G44446.1CCGCCACGTGTTEncodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.
AT1G44446.1TACACGTGTCATEncodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.
AT1G44446.2CCGCCACGTGTTEncodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.
AT1G44446.2TACACGTGTCATEncodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.
AT1G44446.3CCGCCACGTGTTEncodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.
AT1G44446.3TACACGTGTCATEncodes chlorophyllide <i>a</i> oxygenase which converts chlorophyllide <i>a</i> to chlorophyllide <i>b</i> by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide <i>a</i> . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll <i>b</i> and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22.
AT1G44575AT1G44575.1ACGTGGACEncoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation.
AT1G44575.2ACGTGGACEncoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation.
AT1G44750AT1G44750.1GATGACGTGGMember of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G45201AT1G45201.1CGCACGTGTarget of AtGRP7 regulation.
AT1G45201.2CGCACGTGTarget of AtGRP7 regulation.
AT1G45474AT1G45474.1ACGTGGATEncodes a component of the light harvesting complex of photosystem I.
AT1G45474.2ACGTGGATEncodes a component of the light harvesting complex of photosystem I.
AT1G47550AT1G47550.1TTGCCACGTAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, exocyst; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G47560.1); Has 295 Blast hits to 291 proteins in 116 species: Archae - 3; Bacteria - 6; Metazoa - 134; Fungi - 71; Plants - 54; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G47970AT1G47970.1ACGCCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 85194 Blast hits to 34173 proteins in 1291 species: Archae - 566; Bacteria - 13003; Metazoa - 26927; Fungi - 13823; Plants - 4747; Viruses - 1476; Other Eukaryotes - 24652 (source: NCBI BLink).
AT1G47970.1CGCACGTGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 85194 Blast hits to 34173 proteins in 1291 species: Archae - 566; Bacteria - 13003; Metazoa - 26927; Fungi - 13823; Plants - 4747; Viruses - 1476; Other Eukaryotes - 24652 (source: NCBI BLink).
AT1G48300AT1G48300.1ACGCCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT1G48300.1CTACGTGGCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT1G48300.1TTCCACGTGGCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 68 Blast hits to 62 proteins in 29 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 2; Plants - 37; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT1G48320AT1G48320.1ACGTGTCAthioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT5G48950.1); Has 1639 Blast hits to 1639 proteins in 507 species: Archae - 0; Bacteria - 1172; Metazoa - 3; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink).
AT1G48330AT1G48330.1CACGTGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17580.1); Has 25 Blast hits to 25 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G48410AT1G48410.1TCGCCACGTCGEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.
AT1G48410.1TTCCACGTCATCEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.
AT1G48410.2TCGCCACGTCGEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.
AT1G48410.2TTCCACGTCATCEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus.
AT1G48430AT1G48430.1AACACGTGdihydroxyacetone kinase family protein; FUNCTIONS IN: glycerone kinase activity, ATP binding; INVOLVED IN: glycerol metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dak phosphatase (InterPro:IPR004007), Dihydroxyacetone kinase (InterPro:IPR012734), Dak kinase (InterPro:IPR004006); BEST Arabidopsis thaliana protein match is: dihydroxyacetone kinase family protein (TAIR:AT3G17770.1); Has 2623 Blast hits to 2620 proteins in 533 species: Archae - 8; Bacteria - 1792; Metazoa - 85; Fungi - 145; Plants - 38; Viruses - 0; Other Eukaryotes - 555 (source: NCBI BLink).
AT1G48440AT1G48440.1CACGTGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17780.1); Has 61 Blast hits to 61 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G48620AT1G48620.1AAAACGCCACGTCATCThis gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation.
AT1G48745AT1G48745.1TTCCACGTunknown protein; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G48830AT1G48830.1AACACGTGA40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G48830.1ACGTGGCTT40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G48830.1TACACGTGTCAT40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G48830.2AACACGTGA40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G48830.2ACGTGGCTT40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G48830.2TACACGTGTCAT40S ribosomal protein S7 (RPS7A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, plasma membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G48920AT1G48920.1TCCACGTGGACEncodes the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants.
AT1G49240AT1G49240.1TGTCACGTMember of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen.
AT1G49330AT1G49330.1ACCACGTGGCAChydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16190.1); Has 840 Blast hits to 686 proteins in 130 species: Archae - 0; Bacteria - 47; Metazoa - 222; Fungi - 69; Plants - 342; Viruses - 66; Other Eukaryotes - 94 (source: NCBI BLink).
AT1G49500AT1G49500.1AAGCCACGTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19030.1); Has 18 Blast hits to 18 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G49660AT1G49660.1CTACGTGGCEncodes a protein with carboxylesterase whose activity was tested using pNA.
AT1G49670AT1G49670.1GACGTGTCACmolecular function has not been defined. Was shown involved in oxidative stress tolerance.
AT1G49720AT1G49720.1TCACACGTIdentified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses.
AT1G49840AT1G49840.1CACGTGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19540.1); Has 110 Blast hits to 108 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G49840.1TCACACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19540.1); Has 110 Blast hits to 108 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G50000AT1G50000.1TACACGTGTAmethyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), Ribosomal RNA small subunit methyltransferase E (InterPro:IPR006700); Has 3924 Blast hits to 3924 proteins in 1156 species: Archae - 0; Bacteria - 2219; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1687 (source: NCBI BLink).
AT1G50000.2TACACGTGTAmethyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), Ribosomal RNA small subunit methyltransferase E (InterPro:IPR006700); Has 3924 Blast hits to 3924 proteins in 1156 species: Archae - 0; Bacteria - 2219; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1687 (source: NCBI BLink).
AT1G50010AT1G50010.1TACACGTGTAEncodes alpha-2,4 tubulin. TUA2 and TUA4 encode identical proteins.
AT1G50380AT1G50380.1GGACACGTAprolyl oligopeptidase family protein; FUNCTIONS IN: serine-type peptidase activity, serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375), Peptidase S9A, oligopeptidase, N-terminal beta-propeller (InterPro:IPR004106), Peptidase S9A, prolyl oligopeptidase (InterPro:IPR002470); BEST Arabidopsis thaliana protein match is: prolyl oligopeptidase family protein (TAIR:AT1G69020.1); Has 6063 Blast hits to 6017 proteins in 719 species: Archae - 41; Bacteria - 1884; Metazoa - 253; Fungi - 18; Plants - 99; Viruses - 0; Other Eukaryotes - 3768 (source: NCBI BLink).
AT1G50430AT1G50430.1CACGTGACACGTGGGMutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype.
AT1G50430.2CACGTGACACGTGGGMutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype.
AT1G50440AT1G50440.1CCCACGTGTCACGTGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).
AT1G50440.2CCCACGTGTCACGTGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).
AT1G50440.3CCCACGTGTCACGTGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G22120.1); Has 722 Blast hits to 707 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 308; Fungi - 79; Plants - 160; Viruses - 16; Other Eukaryotes - 159 (source: NCBI BLink).
AT1G50450AT1G50450.1ACACGTCATCbinding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saccharopine dehydrogenase (InterPro:IPR005097), NAD(P)-binding (InterPro:IPR016040); Has 934 Blast hits to 931 proteins in 259 species: Archae - 13; Bacteria - 434; Metazoa - 33; Fungi - 62; Plants - 25; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink).
AT1G50575AT1G50575.1ATCCACGTGTAlysine decarboxylase family protein; FUNCTIONS IN: carboxy-lyase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP00730 (InterPro:IPR005269); Has 2104 Blast hits to 2104 proteins in 559 species: Archae - 2; Bacteria - 1299; Metazoa - 4; Fungi - 31; Plants - 102; Viruses - 0; Other Eukaryotes - 666 (source: NCBI BLink).
AT1G50730AT1G50730.1GGACACGTCunknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 182 Blast hits to 175 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 2; Plants - 11; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT1G51090AT1G51090.1ACACGTCATTTheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: metal ion binding (TAIR:AT4G16380.1); Has 2088 Blast hits to 1362 proteins in 268 species: Archae - 0; Bacteria - 571; Metazoa - 270; Fungi - 137; Plants - 643; Viruses - 138; Other Eukaryotes - 329 (source: NCBI BLink).
AT1G51140AT1G51140.1CCCACGTGGCbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42280.1); Has 1045 Blast hits to 1045 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 3; Plants - 1030; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G51140.1TACACGTGTCAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42280.1); Has 1045 Blast hits to 1045 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 3; Plants - 1030; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G51400AT1G51400.1AGACACGTGGCAAphotosystem II 5 kD protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to UV-B, response to wounding, response to ozone; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSBTN (photosystem II subunit T) (TAIR:AT3G21055.1); Has 59 Blast hits to 59 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G52040AT1G52040.1CGTAATTACACGTGTTEncodes myrosinase-binding protein expressed in flowers.
AT1G52100AT1G52100.1TTCCACGTjacalin lectin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: shoot, cotyledon, hypocotyl, leaf; CONTAINS InterPro DOMAIN/s: Mannose-binding lectin (InterPro:IPR001229); BEST Arabidopsis thaliana protein match is: jacalin lectin family protein (TAIR:AT5G35950.1); Has 1199 Blast hits to 527 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1195; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G52220AT1G52220.1ATGCCACGTGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G52220.1CTGCCACGTGGCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G52220.2ATGCCACGTGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G52220.2CTGCCACGTGGCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G52220.3ATGCCACGTGGATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G52220.3CTGCCACGTGGCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: PSI-P (PHOTOSYSTEM I P SUBUNIT); DNA binding (TAIR:AT2G46820.2); Has 203 Blast hits to 203 proteins in 35 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 136; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G52230AT1G52230.1ATCCACGTGGCATPHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G52230.1TCGCCACGTGGCAGPHOTOSYSTEM I SUBUNIT H2 (PSAH2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem I reaction centre subunit VI (InterPro:IPR004928); BEST Arabidopsis thaliana protein match is: PSAH-1 (photosystem I subunit H-1) (TAIR:AT3G16140.1); Has 72 Blast hits to 72 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G52320AT1G52320.2ATCCACGTCATTACCCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25590.1); Has 8111 Blast hits to 6764 proteins in 511 species: Archae - 9; Bacteria - 475; Metazoa - 3444; Fungi - 1217; Plants - 1004; Viruses - 207; Other Eukaryotes - 1755 (source: NCBI BLink).
AT1G52410AT1G52410.1ATCCACGTContains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers.
AT1G52410.2ATCCACGTContains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers.
AT1G52510AT1G52510.2ACGCCACGTCGhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink).
AT1G52550AT1G52550.1CACGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15780.1); Has 45 Blast hits to 43 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 3; Fungi - 0; Plants - 18; Viruses - 8; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G52590AT1G52590.1ATGACGTGGCATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).
AT1G52590.1GATGACGTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).
AT1G52590.1GTGACGTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).
AT1G52600AT1G52600.1ATGCCACGTCATsignal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT1G52600.1CCACGTCACsignal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT1G52600.1CCACGTCATCsignal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT1G52690AT1G52690.1ACCACGTGTCTlate embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink).
AT1G52690.1ATGACGTGTCAClate embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink).
AT1G52690.2ACCACGTGTCTlate embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink).
AT1G52690.2ATGACGTGTCAClate embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G15670.1); Has 2025 Blast hits to 947 proteins in 265 species: Archae - 6; Bacteria - 474; Metazoa - 312; Fungi - 113; Plants - 812; Viruses - 15; Other Eukaryotes - 293 (source: NCBI BLink).
AT1G52710AT1G52710.1TCACACGTGcytochrome c oxidase-related; FUNCTIONS IN: cytochrome-c oxidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial envelope; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit Vb (InterPro:IPR002124); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase family protein (TAIR:AT3G15640.2); Has 219 Blast hits to 219 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 17; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT1G52870AT1G52870.1CTACGTGGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT1G52870.2CTACGTGGperoxisomal membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein-related (TAIR:AT4G03410.2); Has 941 Blast hits to 941 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 495; Fungi - 210; Plants - 171; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT1G53140AT1G53140.1GTCCACGTEncodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis.
AT1G53170AT1G53170.1AACACGTGGCAAencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G53210AT1G53210.1GTACACGTsodium/calcium exchanger family protein / calcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: vacuolar membrane, plasma membrane, vacuole, membrane, plant-type vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Sodium/calcium exchanger membrane region (InterPro:IPR004837), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT2G34030.1); Has 365 Blast hits to 356 proteins in 99 species: Archae - 8; Bacteria - 43; Metazoa - 10; Fungi - 120; Plants - 154; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).
AT1G53320AT1G53320.1GACGTGTCCMember of TLP family
AT1G53400AT1G53400.1GTGACGTGGCAAunknown protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45740.1); Has 229 Blast hits to 229 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 40; Plants - 47; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G53542AT1G53542.1CGCACGTGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G53670AT1G53670.1CGACGTGGCAGmethionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).
AT1G53670.2CGACGTGGCAGmethionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink).
AT1G53750AT1G53750.1AAAAAGCCCATTTTACACGTGGG26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA,
AT1G53750.1CACGTCAC26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA,
AT1G53750.1CACGTGGG26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA,
AT1G53750.1CACGTGTG26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA,
AT1G53770AT1G53770.1CGCACGTGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G50420.1); Has 40 Blast hits to 40 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G54050AT1G54050.1ATGACGTGGAA17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink).
AT1G54100AT1G54100.1GGACACGTGACAAldehyde dehydrogenase
AT1G54100.2GGACACGTGACAAldehyde dehydrogenase
AT1G54200AT1G54200.1AACACGTGGCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G13980.1); Has 1298 Blast hits to 515 proteins in 102 species: Archae - 0; Bacteria - 43; Metazoa - 442; Fungi - 73; Plants - 54; Viruses - 0; Other Eukaryotes - 686 (source: NCBI BLink).
AT1G54500AT1G54500.1AAAAGGCCACGTGGTrubredoxin family protein; FUNCTIONS IN: electron carrier activity, metal ion binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubredoxin, iron-binding site (InterPro:IPR018527), Rubredoxin-type Fe(Cys)4 protein (InterPro:IPR004039), Rubredoxin (InterPro:IPR001052); Has 2007 Blast hits to 1988 proteins in 612 species: Archae - 138; Bacteria - 1563; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink).
AT1G54740AT1G54740.1CTGACGTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G22110.1); Has 479 Blast hits to 317 proteins in 60 species: Archae - 0; Bacteria - 25; Metazoa - 81; Fungi - 16; Plants - 88; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink).
AT1G54780AT1G54780.1TAAAACGCCACGTCGthylakoid lumen 18.3 kDa protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF477 (InterPro:IPR007621); Has 159 Blast hits to 159 proteins in 71 species: Archae - 0; Bacteria - 103; Metazoa - 2; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT1G55265AT1G55265.1TACACGTGGCAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19860.1); Has 266 Blast hits to 266 proteins in 15 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 259; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G55480AT1G55480.1ATGACACGTGGCGAbinding / protein binding; FUNCTIONS IN: protein binding, binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), PDZ/DHR/GLGF (InterPro:IPR001478), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: LPA1 (LOW PSII ACCUMULATION1); binding (TAIR:AT1G02910.1); Has 203 Blast hits to 203 proteins in 54 species: Archae - 0; Bacteria - 65; Metazoa - 7; Fungi - 2; Plants - 97; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT1G55520AT1G55520.1AACACGTGGCAGTATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex.
AT1G55520.1ACGTGTCTTATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex.
AT1G55520.2AACACGTGGCAGTATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex.
AT1G55520.2ACGTGTCTTATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex.
AT1G55530AT1G55530.1GTACACGTGTTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7739 Blast hits to 7642 proteins in 225 species: Archae - 0; Bacteria - 8; Metazoa - 2938; Fungi - 729; Plants - 2721; Viruses - 30; Other Eukaryotes - 1313 (source: NCBI BLink).
AT1G55810AT1G55810.1CTGACGTGGATuracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink).
AT1G55810.2CTGACGTGGATuracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink).
AT1G55810.3CTGACGTGGATuracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink).
AT1G55820AT1G55820.1GTCCACGTGTCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: GIP1 (GBF-INTERACTING PROTEIN 1); unfolded protein binding (TAIR:AT3G13222.1); Has 1009 Blast hits to 462 proteins in 111 species: Archae - 0; Bacteria - 42; Metazoa - 245; Fungi - 90; Plants - 135; Viruses - 12; Other Eukaryotes - 485 (source: NCBI BLink).
AT1G55820.1GTGACGTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1296 (InterPro:IPR009719); BEST Arabidopsis thaliana protein match is: GIP1 (GBF-INTERACTING PROTEIN 1); unfolded protein binding (TAIR:AT3G13222.1); Has 1009 Blast hits to 462 proteins in 111 species: Archae - 0; Bacteria - 42; Metazoa - 245; Fungi - 90; Plants - 135; Viruses - 12; Other Eukaryotes - 485 (source: NCBI BLink).
AT1G56090AT1G56090.1ACGTGTCACtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ROF1 (ROTAMASE FKBP 1); FK506 binding / calmodulin binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G25230.2); Has 4281 Blast hits to 3841 proteins in 306 species: Archae - 16; Bacteria - 269; Metazoa - 2216; Fungi - 437; Plants - 507; Viruses - 6; Other Eukaryotes - 830 (source: NCBI BLink).
AT1G56100AT1G56100.1ACGTGGATpectinesterase inhibitor domain-containing protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G00872.1); Has 669 Blast hits to 508 proteins in 102 species: Archae - 2; Bacteria - 18; Metazoa - 226; Fungi - 61; Plants - 51; Viruses - 2; Other Eukaryotes - 309 (source: NCBI BLink).
AT1G56100.2ACGTGGATpectinesterase inhibitor domain-containing protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G00872.1); Has 669 Blast hits to 508 proteins in 102 species: Archae - 2; Bacteria - 18; Metazoa - 226; Fungi - 61; Plants - 51; Viruses - 2; Other Eukaryotes - 309 (source: NCBI BLink).
AT1G56100.3ACGTGGATpectinesterase inhibitor domain-containing protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: embryo, sepal; EXPRESSED DURING: 4 anthesis, C globular stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G00872.1); Has 669 Blast hits to 508 proteins in 102 species: Archae - 2; Bacteria - 18; Metazoa - 226; Fungi - 61; Plants - 51; Viruses - 2; Other Eukaryotes - 309 (source: NCBI BLink).
AT1G56200AT1G56200.1CCCACGTGCCGTTTembryo defective 1303 (emb1303); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G30475.3); Has 46 Blast hits to 46 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G56200.2CCCACGTGCCGTTTembryo defective 1303 (emb1303); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G30475.3); Has 46 Blast hits to 46 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G56220AT1G56220.1ATCCACGTGGCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.1TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.2ATCCACGTGGCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.2TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.3ATCCACGTGGCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.3TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.4ATCCACGTGGCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.4TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56330AT1G56330.1ACGCCACGTCACEncodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol.
AT1G56330.1GCCACGTGTGEncodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol.
AT1G56340AT1G56340.1ACGTGGATEncodes calreticulin CRT1.
AT1G56340.1AGCCACGTCATEncodes calreticulin CRT1.
AT1G56340.1CCACGTCAGCEncodes calreticulin CRT1.
AT1G56340.1TCACGTGTAEncodes calreticulin CRT1.
AT1G56340.2ACGTGGATEncodes calreticulin CRT1.
AT1G56340.2AGCCACGTCATEncodes calreticulin CRT1.
AT1G56340.2CCACGTCAGCEncodes calreticulin CRT1.
AT1G56340.2TCACGTGTAEncodes calreticulin CRT1.
AT1G56440AT1G56440.1TCACACGTserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).
AT1G56450AT1G56450.1ACGTGTGA20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds
AT1G56460AT1G56460.1GTACACGTPAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT2G47350.1); Has 6344 Blast hits to 4558 proteins in 417 species: Archae - 6; Bacteria - 427; Metazoa - 2467; Fungi - 794; Plants - 231; Viruses - 26; Other Eukaryotes - 2393 (source: NCBI BLink).
AT1G57540AT1G57540.1AGACACGTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57540.1AGCCACGTGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57540.2AGACACGTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57540.2AGCCACGTGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57540.3AGACACGTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57540.3AGCCACGTGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57680AT1G57680.1AGCCACGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031277 (InterPro:IPR016971); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G57680.2AGCCACGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031277 (InterPro:IPR016971); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G57770AT1G57770.1ACGTGGCTamine oxidase family; FUNCTIONS IN: oxidoreductase activity; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD dependent oxidoreductase (InterPro:IPR006076); BEST Arabidopsis thaliana protein match is: CRTISO (CAROTENOID ISOMERASE); carotenoid isomerase (TAIR:AT1G06820.1); Has 4784 Blast hits to 4705 proteins in 573 species: Archae - 90; Bacteria - 1781; Metazoa - 346; Fungi - 53; Plants - 173; Viruses - 0; Other Eukaryotes - 2341 (source: NCBI BLink).
AT1G57850AT1G57850.1CTGACGTGTCAToll-Interleukin-Resistance (TIR) domain-containing protein; FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: signal transduction, defense response, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: leaf lamina base, leaf whorl, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.10 ten leaves visible, LP.02 two leaves visible, LP.12 twelve leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: Toll-Interleukin-Resistance (TIR) domain-containing protein (TAIR:AT2G03300.1); Has 846 Blast hits to 806 proteins in 40 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 841; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G58200AT1G58200.1CACGTGGAAA member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.
AT1G58200.2CACGTGGAAA member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity.
AT1G58270AT1G58270.1AGACACGTAZW9 mRNA, complete cds
AT1G58270.1TACGTGTCACZW9 mRNA, complete cds
AT1G59900AT1G59900.1TGTCACGTGACencodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC)
AT1G59950AT1G59950.1TACACGTGGCATaldo/keto reductase, putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase, putative (TAIR:AT1G59960.1); Has 11553 Blast hits to 11538 proteins in 1272 species: Archae - 159; Bacteria - 6414; Metazoa - 1616; Fungi - 1065; Plants - 853; Viruses - 0; Other Eukaryotes - 1446 (source: NCBI BLink).
AT1G60600AT1G60600.1AGACACGTGAEncodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.
AT1G60600.2AGACACGTGAEncodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.
AT1G60950AT1G60950.1ACGCCACGTGGTencodes a major leaf ferredoxin
AT1G61360AT1G61360.2CCACGTCAS-locus lectin protein kinase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Protein kinase, ATP binding site (InterPro:IPR017441), PAN-like, type 2 (InterPro:IPR013227), Apple-like (InterPro:IPR003609), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858), EGF (InterPro:IPR006210); BEST Arabidopsis thaliana protein match is: SD1-29 (S-DOMAIN-1 29); carbohydrate binding / kinase/ protein kinase (TAIR:AT1G61380.1); Has 90844 Blast hits to 89410 proteins in 3263 species: Archae - 63; Bacteria - 7784; Metazoa - 39638; Fungi - 7233; Plants - 20141; Viruses - 449; Other Eukaryotes - 15536 (source: NCBI BLink).
AT1G61520AT1G61520.1ATTGCCACGTGGACPSI type III chlorophyll a/b-binding protein (Lhca3*1)
AT1G61520.2ATTGCCACGTGGACPSI type III chlorophyll a/b-binding protein (Lhca3*1)
AT1G61780AT1G61780.1ACCACGTGGAApostsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G61780.1ACCACGTGGATpostsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G61790AT1G61790.1ATCCACGTGGTOST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G61790.1TTCCACGTGGTOST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G62180AT1G62180.1TCGCCACGTCATCencodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis.
AT1G62290AT1G62290.1ACACGTCAaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).
AT1G62290.2ACACGTCAaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).
AT1G62305AT1G62305.1TACACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT1G62305.2TACACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11940.1); Has 342 Blast hits to 342 proteins in 16 species: Archae - 0; Bacteria - 9; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT1G62570AT1G62570.1TACGTGTCAbelongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates
AT1G62750AT1G62750.1GTGACGTGTCTNuclear encoded protein consists of the five domains conserved in EF-G proteins, with two GTP-binding sites in the first domain, and an additional transit peptide at the N-terminus. Localized in chloroplasts. Point mutation results in a delay in the onset of germination. At early developmental stage embryos still contain undifferentiated proplastids. The greening of cotyledons is severely impaired in light-grown mutant sco1 seedlings, whereas the following true leaves develop normally as in wild-type plants.
AT1G63290AT1G63290.1GTGCCACGTCATCribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT3G01850.2); Has 6133 Blast hits to 6130 proteins in 1420 species: Archae - 32; Bacteria - 2852; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink).
AT1G63600AT1G63600.1ACGTGTCCprotein kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF26 (InterPro:IPR002902); BEST Arabidopsis thaliana protein match is: receptor-like protein kinase-related (TAIR:AT1G63570.1); Has 952 Blast hits to 922 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 2; Plants - 933; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G63900AT1G63900.1GCCACGTCATCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 2665 Blast hits to 2573 proteins in 206 species: Archae - 0; Bacteria - 8; Metazoa - 1654; Fungi - 30; Plants - 409; Viruses - 201; Other Eukaryotes - 363 (source: NCBI BLink).
AT1G63970AT1G63970.1TACACGTGGTEncodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF
AT1G63970.2TACACGTGGTEncodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF
AT1G63980AT1G63980.1ACCACGTGTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink).
AT1G63980.2ACCACGTGTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink).
AT1G64040AT1G64040.1CGCACGTGTGEncodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers.
AT1G64142AT1G64142.1CACGTGTGUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF23 represents a conserved upstream opening reading frame relative to major ORF AT1G64140.1
AT1G64200AT1G64200.1AACACGTGTGAVACUOLAR H+-ATPASE SUBUNIT E ISOFORM 3 (VHA-E3); FUNCTIONS IN: proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole, mitochondrial proton-transporting ATP synthase complex; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V1/A1 complex, subunit E (InterPro:IPR002842); BEST Arabidopsis thaliana protein match is: TUF (VACUOLAR ATP SYNTHASE SUBUNIT E1); proton-transporting ATPase, rotational mechanism (TAIR:AT4G11150.1); Has 579 Blast hits to 579 proteins in 214 species: Archae - 54; Bacteria - 8; Metazoa - 200; Fungi - 95; Plants - 83; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).
AT1G64440AT1G64440.1AAAAAGCCACGTGGCTTEncodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis.
AT1G64500AT1G64500.1CCACGTAGglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: N-terminal protein myristoylation, cell redox homeostasis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT4G10630.1); Has 415 Blast hits to 414 proteins in 89 species: Archae - 0; Bacteria - 34; Metazoa - 120; Fungi - 26; Plants - 208; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G64660AT1G64660.1GTACACGTGAEncodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis.
AT1G65040AT1G65040.2TACACGTGTCGTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).
AT1G65040.2TACACGTGTCTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).
AT1G65040.3TACACGTGTCGTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).
AT1G65040.3TACACGTGTCTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).
AT1G65445AT1G65445.1GTACACGTtransferase-related; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: HCT (HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE HYDROXYCINNAMOYL TRANSFERASE); quinate O-hydroxycinnamoyltransferase/ shikimate O-hydroxycinnamoyltransferase/ transferase (TAIR:AT5G48930.1); Has 438 Blast hits to 437 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 435; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G65500AT1G65500.1TCACACGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65486.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G65730AT1G65730.1GTCCACGTGArabidopsis thaliana metal-nicotianamine transporter YSL4
AT1G65820AT1G65820.1TACACGTGAmicrosomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).
AT1G65820.2TACACGTGAmicrosomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).
AT1G65820.3TACACGTGAmicrosomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129).
AT1G66200AT1G66200.1CACGTCACencodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium
AT1G66200.2CACGTCACencodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium
AT1G66500AT1G66500.1ACTGGGCCTATAAACCGTGGCCCAAAACACGTGACAzinc finger (C2H2-type) family protein; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: S-locus protein-related (TAIR:AT5G43620.1); Has 275 Blast hits to 273 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 91; Fungi - 85; Plants - 35; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT1G66730AT1G66730.1TACACGTGTCAATP dependent DNA ligase family protein; FUNCTIONS IN: DNA binding, DNA ligase (ATP) activity, ATP binding; INVOLVED IN: DNA repair, DNA replication, DNA recombination; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), DNA ligase, N-terminal (InterPro:IPR012308), ATP dependent DNA ligase, central (InterPro:IPR012310), ATP-dependent DNA ligase, conserved site (InterPro:IPR016059), DNA repair metallo-beta-lactamase (InterPro:IPR011084), ATP dependent DNA ligase, C-terminal (InterPro:IPR012309), ATP-dependent DNA ligase (InterPro:IPR000977); BEST Arabidopsis thaliana protein match is: ATLIG1 (ARABIDOPSIS THALIANA DNA LIGASE 1); ATP binding / DNA binding / DNA ligase (ATP) (TAIR:AT1G08130.1); Has 3133 Blast hits to 3071 proteins in 628 species: Archae - 227; Bacteria - 996; Metazoa - 564; Fungi - 431; Plants - 130; Viruses - 148; Other Eukaryotes - 637 (source: NCBI BLink).
AT1G66890AT1G66890.1AAGCCACGTGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: 50S ribosomal protein-related (TAIR:AT5G16200.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G66940AT1G66940.1CTACGTGGprotein kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G67000.1); Has 144 Blast hits to 122 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 140; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G66940.2CTACGTGGprotein kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G67000.1); Has 144 Blast hits to 122 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 140; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G66940.3CTACGTGGprotein kinase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G67000.1); Has 144 Blast hits to 122 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 140; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67090AT1G67090.1TTCCACGTGGCATRIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).
AT1G67090.2TTCCACGTGGCATRIBULOSE BISPHOSPHATE CARBOXYLASE SMALL CHAIN 1A (RBCS1A); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity, copper ion binding; INVOLVED IN: response to blue light, response to cold, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: in 10 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, seedling growth; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 1B / RuBisCO small subunit 1B (RBCS-1B) (ATS1B) (TAIR:AT5G38430.1); Has 1759 Blast hits to 1738 proteins in 405 species: Archae - 0; Bacteria - 340; Metazoa - 0; Fungi - 0; Plants - 872; Viruses - 0; Other Eukaryotes - 547 (source: NCBI BLink).
AT1G67300AT1G67300.1GTGACACGTGCGhexose transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SGB1 (SUPPRESSOR OF G PROTEIN BETA1); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G79820.2); Has 25681 Blast hits to 25295 proteins in 1402 species: Archae - 357; Bacteria - 13235; Metazoa - 4312; Fungi - 4716; Plants - 1519; Viruses - 2; Other Eukaryotes - 1540 (source: NCBI BLink).
AT1G67300.2GTGACACGTGCGhexose transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SGB1 (SUPPRESSOR OF G PROTEIN BETA1); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G79820.2); Has 25681 Blast hits to 25295 proteins in 1402 species: Archae - 357; Bacteria - 13235; Metazoa - 4312; Fungi - 4716; Plants - 1519; Viruses - 2; Other Eukaryotes - 1540 (source: NCBI BLink).
AT1G67360AT1G67360.1ACGTGGACrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67360.1TACACGTGTTrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67360.2ACGTGGACrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67360.2TACACGTGTTrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67480AT1G67480.1TGACGTGGkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G27420.1); Has 9349 Blast hits to 4754 proteins in 382 species: Archae - 21; Bacteria - 551; Metazoa - 7219; Fungi - 97; Plants - 791; Viruses - 153; Other Eukaryotes - 517 (source: NCBI BLink).
AT1G67480.2TGACGTGGkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G27420.1); Has 9349 Blast hits to 4754 proteins in 382 species: Archae - 21; Bacteria - 551; Metazoa - 7219; Fungi - 97; Plants - 791; Viruses - 153; Other Eukaryotes - 517 (source: NCBI BLink).
AT1G67560AT1G67560.1ACACGCGTACGTGACAlipoxygenase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen, lipoxygenase activity, iron ion binding, metal ion binding; INVOLVED IN: growth; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Lipoxygenase, C-terminal (InterPro:IPR013819), Lipoxygenase (InterPro:IPR000907), Lipoxygenase, plant (InterPro:IPR001246); BEST Arabidopsis thaliana protein match is: lipoxygenase, putative (TAIR:AT1G72520.1); Has 1115 Blast hits to 1100 proteins in 148 species: Archae - 0; Bacteria - 67; Metazoa - 487; Fungi - 37; Plants - 508; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT1G67700AT1G67700.1AACACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G67700.2AACACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G67760AT1G67760.1CAAAGGCCCACGTAGATP binding / protein binding / unfolded protein binding; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), T-complex protein 1, epsilon subunit (InterPro:IPR012718); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 767 Blast hits to 665 proteins in 236 species: Archae - 251; Bacteria - 0; Metazoa - 166; Fungi - 119; Plants - 66; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink).
AT1G67785AT1G67785.1CGACACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, respiratory chain complex I; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67865AT1G67865.1ACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67880AT1G67880.1AAGCCACGTGGTglycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G12990.1); Has 882 Blast hits to 881 proteins in 59 species: Archae - 0; Bacteria - 22; Metazoa - 50; Fungi - 23; Plants - 70; Viruses - 4; Other Eukaryotes - 713 (source: NCBI BLink).
AT1G67920AT1G67920.1CGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24600.1); Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67960AT1G67960.1AACACGTGGCAGEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G68010AT1G68010.1GCCACGTCAGCEncodes hydroxypyruvate reductase.
AT1G68110AT1G68110.1CACACGTGTGepsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G68110.1TCACACGTGepsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: clathrin coat; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT1G25240.1); Has 192 Blast hits to 186 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 9; Fungi - 4; Plants - 177; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G68310AT1G68310.1GATGACGTGTCGEncodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized.
AT1G68310.2GATGACGTGTCGEncodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized.
AT1G68400AT1G68400.1AACACGTGAleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G26730.1); Has 109181 Blast hits to 85983 proteins in 3222 species: Archae - 64; Bacteria - 9468; Metazoa - 37963; Fungi - 6180; Plants - 40805; Viruses - 358; Other Eukaryotes - 14343 (source: NCBI BLink).
AT1G68570AT1G68570.1GTCCACGTproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: PTR1 (PEPTIDE TRANSPORTER 1); dipeptide transporter/ transporter/ tripeptide transporter (TAIR:AT3G54140.1); Has 3536 Blast hits to 3259 proteins in 593 species: Archae - 0; Bacteria - 1199; Metazoa - 646; Fungi - 246; Plants - 1123; Viruses - 0; Other Eukaryotes - 322 (source: NCBI BLink).
AT1G68830AT1G68830.1GACGTGTCCSTN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation
AT1G69010AT1G69010.1ACCACGTGBES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G69010.1CACGTGACBES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G69010.1CCCACGTGTCATBES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G69010.1GTACACGTBES1-interacting Myc-like protein 2 (BIM2); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: dTDP-rhamnose biosynthetic process, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM1; DNA binding / protein binding / transcription factor (TAIR:AT5G08130.3); Has 1614 Blast hits to 1609 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 38; Plants - 1371; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G69410AT1G69410.1AAAACGCCGCACGTGTAEUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A-3); FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation protein SH3-like, subgroup (InterPro:IPR014722), Eukaryotic initiation factor 5A hypusine (eIF-5A) (InterPro:IPR001884); BEST Arabidopsis thaliana protein match is: ELF5A-1 (EUKARYOTIC ELONGATION FACTOR 5A-1); translation initiation factor (TAIR:AT1G13950.1); Has 986 Blast hits to 984 proteins in 296 species: Archae - 160; Bacteria - 0; Metazoa - 294; Fungi - 163; Plants - 195; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink).
AT1G69410.1CGACACGTCAEUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A-3); FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation protein SH3-like, subgroup (InterPro:IPR014722), Eukaryotic initiation factor 5A hypusine (eIF-5A) (InterPro:IPR001884); BEST Arabidopsis thaliana protein match is: ELF5A-1 (EUKARYOTIC ELONGATION FACTOR 5A-1); translation initiation factor (TAIR:AT1G13950.1); Has 986 Blast hits to 984 proteins in 296 species: Archae - 160; Bacteria - 0; Metazoa - 294; Fungi - 163; Plants - 195; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink).
AT1G69450AT1G69450.1AACACGTGTTLOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: HYP1 (HYPOTHETICAL PROTEIN 1) (TAIR:AT3G01100.1); Has 911 Blast hits to 825 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 442; Plants - 243; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT1G69460AT1G69460.1TACACGTGTCAemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1075 Blast hits to 1073 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 530; Fungi - 308; Plants - 128; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).
AT1G69640AT1G69640.1CCGCCACGTAGEncodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth.
AT1G69870AT1G69870.1ACGTGGAAproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: response to salt stress, oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: NRT1.6 (NITRATE TRANSPORTER 1.6); low affinity nitrate transmembrane transporter/ transporter (TAIR:AT1G27080.1); Has 2739 Blast hits to 2630 proteins in 509 species: Archae - 0; Bacteria - 693; Metazoa - 468; Fungi - 272; Plants - 1130; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).
AT1G69870.1CACGTGGAproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: response to salt stress, oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: NRT1.6 (NITRATE TRANSPORTER 1.6); low affinity nitrate transmembrane transporter/ transporter (TAIR:AT1G27080.1); Has 2739 Blast hits to 2630 proteins in 509 species: Archae - 0; Bacteria - 693; Metazoa - 468; Fungi - 272; Plants - 1130; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).
AT1G70160AT1G70160.1CTACGTGGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27020.1); Has 70 Blast hits to 70 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G70480AT1G70480.1AAAACGACACGTGGCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G70480.2AAAACGACACGTGGCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G70490AT1G70490.1TCACGTGTTA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.
AT1G70490.2TCACGTGTTA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.
AT1G70490.3TCACGTGTTA member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.
AT1G70580AT1G70580.1CTACGTGGSimilar to glutamate-glyoxylate transaminase enzyme encoded by AOAT1
AT1G70580.2CTACGTGGSimilar to glutamate-glyoxylate transaminase enzyme encoded by AOAT1
AT1G70580.3CTACGTGGSimilar to glutamate-glyoxylate transaminase enzyme encoded by AOAT1
AT1G70580.4CTACGTGGSimilar to glutamate-glyoxylate transaminase enzyme encoded by AOAT1
AT1G70700AT1G70700.1AACACGTGTGAJAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
AT1G70700.2AACACGTGTGAJAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2.
AT1G70710AT1G70710.1TCCACGTGGTendo-1,4-beta-glucanase. Involved in cell elongation.
AT1G70760AT1G70760.1ATGACACGTGGAAa subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity.
AT1G70780AT1G70780.1AGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23150.1); Has 70 Blast hits to 70 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G70782AT1G70782.1AGACACGTAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF28 represents a conserved upstream opening reading frame relative to major ORF AT1G70780.1
AT1G70830AT1G70830.1GTGACGTGMLP-LIKE PROTEIN 28 (MLP28); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP34 (MLP-LIKE PROTEIN 34) (TAIR:AT1G70850.3); Has 480 Blast hits to 259 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 478; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G70830.2GTGACGTGMLP-LIKE PROTEIN 28 (MLP28); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP34 (MLP-LIKE PROTEIN 34) (TAIR:AT1G70850.3); Has 480 Blast hits to 259 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 478; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G70830.3GTGACGTGMLP-LIKE PROTEIN 28 (MLP28); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP34 (MLP-LIKE PROTEIN 34) (TAIR:AT1G70850.3); Has 480 Blast hits to 259 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 478; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G70830.4GTGACGTGMLP-LIKE PROTEIN 28 (MLP28); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP34 (MLP-LIKE PROTEIN 34) (TAIR:AT1G70850.3); Has 480 Blast hits to 259 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 478; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G70830.5GTGACGTGMLP-LIKE PROTEIN 28 (MLP28); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: MLP34 (MLP-LIKE PROTEIN 34) (TAIR:AT1G70850.3); Has 480 Blast hits to 259 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 478; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G70985AT1G70985.1AGACACGThydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; EXPRESSED IN: cotyledon, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, LP.08 eight leaves visible; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT1G23050.1); Has 1360 Blast hits to 767 proteins in 140 species: Archae - 2; Bacteria - 103; Metazoa - 226; Fungi - 91; Plants - 854; Viruses - 15; Other Eukaryotes - 69 (source: NCBI BLink).
AT1G71090AT1G71090.1CCCACGTGCGauxin efflux carrier family protein; FUNCTIONS IN: auxin:hydrogen symporter activity; INVOLVED IN: auxin polar transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin efflux carrier (InterPro:IPR004776); BEST Arabidopsis thaliana protein match is: auxin efflux carrier family protein (TAIR:AT5G01990.1); Has 433 Blast hits to 370 proteins in 101 species: Archae - 9; Bacteria - 33; Metazoa - 0; Fungi - 220; Plants - 97; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT1G71170AT1G71170.1TACGTGTCT6-phosphogluconate dehydrogenase NAD-binding domain-containing protein; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, binding, phosphogluconate dehydrogenase (decarboxylating) activity, catalytic activity; INVOLVED IN: pentose-phosphate shunt, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71180.1); Has 10923 Blast hits to 10908 proteins in 1167 species: Archae - 86; Bacteria - 5485; Metazoa - 273; Fungi - 222; Plants - 147; Viruses - 0; Other Eukaryotes - 4710 (source: NCBI BLink).
AT1G71840AT1G71840.1GTGACACGTCACtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink).
AT1G72020AT1G72020.1CTACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G72020.1TACACGTGGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G72040AT1G72040.1CGCACGTGTCATdeoxynucleoside kinase family; FUNCTIONS IN: phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Deoxynucleoside kinase (InterPro:IPR002624); Has 1720 Blast hits to 1716 proteins in 345 species: Archae - 0; Bacteria - 621; Metazoa - 410; Fungi - 0; Plants - 41; Viruses - 60; Other Eukaryotes - 588 (source: NCBI BLink).
AT1G72110AT1G72110.1ATCCACGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1298 (InterPro:IPR009721), Uncharacterised protein family UPF0089 (InterPro:IPR004255); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38995.1); Has 589 Blast hits to 582 proteins in 94 species: Archae - 2; Bacteria - 456; Metazoa - 7; Fungi - 2; Plants - 109; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G72280AT1G72280.1CACGTCACGendoplasmic reticulum oxidoreductin
AT1G72320AT1G72320.1ATCCACGTCAArabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
AT1G72320.2ATCCACGTCAArabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
AT1G72320.3ATCCACGTCAArabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
AT1G72500AT1G72500.1TTCCACGTGTACinter-alpha-trypsin inhibitor heavy chain-related; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: von Willebrand factor, type A (InterPro:IPR002035); BEST Arabidopsis thaliana protein match is: inter-alpha-trypsin inhibitor heavy chain-related (TAIR:AT1G19110.1); Has 1082 Blast hits to 1082 proteins in 207 species: Archae - 2; Bacteria - 371; Metazoa - 410; Fungi - 36; Plants - 60; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink).
AT1G72510AT1G72510.1CTGACGTGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G72510.1GACGACGTGACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G72510.2CTGACGTGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G72510.2GACGACGTGACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G72530AT1G72530.1CTACGTGGAAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1).
AT1G72530.2CTACGTGGAAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1).
AT1G72650AT1G72650.1CACACGTGACArabidopsis thaliana myb family transcription factor (At1g72650)
AT1G72650.1CTGACGTGGCAATArabidopsis thaliana myb family transcription factor (At1g72650)
AT1G72650.2CACACGTGACArabidopsis thaliana myb family transcription factor (At1g72650)
AT1G72650.2CTGACGTGGCAATArabidopsis thaliana myb family transcription factor (At1g72650)
AT1G72770AT1G72770.1TACGTGTCCmutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C
AT1G72770.2TACGTGTCCmutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C
AT1G73060AT1G73060.1AGCCACGTGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48790.1); Has 45 Blast hits to 45 proteins in 18 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G73080AT1G73080.1ACCACGTGTGEncodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks.
AT1G73120AT1G73120.1ACGTGGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G73120.1ATGCCACGTGGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G73150AT1G73150.1GTACACGTBromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1.
AT1G73170AT1G73170.1GCTGACGTGTCTATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).
AT1G73170.1GTCCACGTGGTATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).
AT1G73170.2GCTGACGTGTCTATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).
AT1G73170.2GTCCACGTGGTATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase; FUNCTIONS IN: nucleoside-triphosphatase activity, ATP-dependent peptidase activity, nucleotide binding, serine-type endopeptidase activity, ATP binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), Peptidase S16, Lon protease, C-terminal region (InterPro:IPR001984); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 703 Blast hits to 692 proteins in 278 species: Archae - 15; Bacteria - 439; Metazoa - 45; Fungi - 2; Plants - 64; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink).
AT1G73570AT1G73570.1ACGTGGCAATsuppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G18260.1); Has 10975 Blast hits to 4576 proteins in 759 species: Archae - 0; Bacteria - 7044; Metazoa - 503; Fungi - 430; Plants - 71; Viruses - 21; Other Eukaryotes - 2906 (source: NCBI BLink).
AT1G73570.1TACGTGGCGGsuppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G18260.1); Has 10975 Blast hits to 4576 proteins in 759 species: Archae - 0; Bacteria - 7044; Metazoa - 503; Fungi - 430; Plants - 71; Viruses - 21; Other Eukaryotes - 2906 (source: NCBI BLink).
AT1G73580AT1G73580.1ACGTGGCTTC2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT3G17980.1); Has 3675 Blast hits to 3037 proteins in 189 species: Archae - 0; Bacteria - 0; Metazoa - 2349; Fungi - 402; Plants - 643; Viruses - 0; Other Eukaryotes - 281 (source: NCBI BLink).
AT1G73840AT1G73840.1ACGTGTACResembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors.
AT1G73870AT1G73870.1GTACACGTzinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT1G25440.1); Has 2021 Blast hits to 1311 proteins in 82 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1960; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G73980AT1G73980.1ACGTGGACphosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: adenylate cyclase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, cAMP biosynthetic process, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764), Adenylate cyclase (InterPro:IPR008172); BEST Arabidopsis thaliana protein match is: phosphoribulokinase/uridine kinase family protein (TAIR:AT1G26190.1); Has 2533 Blast hits to 2522 proteins in 907 species: Archae - 19; Bacteria - 1635; Metazoa - 298; Fungi - 83; Plants - 169; Viruses - 2; Other Eukaryotes - 327 (source: NCBI BLink).
AT1G73980.1GTGACGTGTGAphosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: adenylate cyclase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, cAMP biosynthetic process, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764), Adenylate cyclase (InterPro:IPR008172); BEST Arabidopsis thaliana protein match is: phosphoribulokinase/uridine kinase family protein (TAIR:AT1G26190.1); Has 2533 Blast hits to 2522 proteins in 907 species: Archae - 19; Bacteria - 1635; Metazoa - 298; Fungi - 83; Plants - 169; Viruses - 2; Other Eukaryotes - 327 (source: NCBI BLink).
AT1G73990AT1G73990.1GACGACGTGGAAEncodes a putative protease SppA (SppA).
AT1G73990.1GTCCACGTEncodes a putative protease SppA (SppA).
AT1G73990.1TCACACGTCACEncodes a putative protease SppA (SppA).
AT1G74020AT1G74020.1ACGTGGATEncodes AtSS-2 strictosidine synthase.
AT1G74090AT1G74090.1AACACGTGGGencodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with preference with methionine-derived desulfoglucosinolates.
AT1G74450AT1G74450.1TTCCACGTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF793 (InterPro:IPR008511); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G18740.1); Has 121 Blast hits to 121 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 121; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G74470AT1G74470.1CTACGTGGEncodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate.
AT1G74510AT1G74510.1AACACGTGkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink).
AT1G74510.2AACACGTGkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink).
AT1G74650AT1G74650.1AGCCACGTAGMember of the R2R3 factor gene family.
AT1G74730AT1G74730.1CTGACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G74780AT1G74780.1TCCACGTGTCATnodulin family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT1G18940.1); Has 1801 Blast hits to 1756 proteins in 510 species: Archae - 9; Bacteria - 869; Metazoa - 40; Fungi - 217; Plants - 319; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink).
AT1G74840AT1G74840.1AACACGTGTCATmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 9 processes; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G19000.2); Has 742 Blast hits to 741 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 677; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G74840.1ACCACGTGGCmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 9 processes; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT1G19000.2); Has 742 Blast hits to 741 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 677; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G74880AT1G74880.1GTACACGTEncodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly.
AT1G74880.1TACGTGGCATEncodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly.
AT1G74930AT1G74930.1CACGTGGAAencodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
AT1G74930.1CCGCCACGTGTCCencodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
AT1G74950AT1G74950.1AACACGTGTTTIFY10B; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to jasmonic acid stimulus, response to wounding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ1 (JASMONATE-ZIM-DOMAIN PROTEIN 1); protein binding (TAIR:AT1G19180.1); Has 249 Blast hits to 244 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 249; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G75080AT1G75080.1TACACGTGGACEncodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities.
AT1G75080.2TACACGTGGACEncodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities.
AT1G75440AT1G75440.1GTACACGTGGCATubiquitin-conjugating enzyme 16 (UBC16); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC18 (ubiquitin-conjugating enzyme 18); small conjugating protein ligase/ ubiquitin-protein ligase (TAIR:AT5G42990.1); Has 6497 Blast hits to 6496 proteins in 295 species: Archae - 0; Bacteria - 2; Metazoa - 3150; Fungi - 1284; Plants - 976; Viruses - 16; Other Eukaryotes - 1069 (source: NCBI BLink).
AT1G75460AT1G75460.1CACGTGGCATATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); BEST Arabidopsis thaliana protein match is: ATP-dependent protease La (LON) domain-containing protein (TAIR:AT1G19740.1); Has 2926 Blast hits to 2926 proteins in 561 species: Archae - 0; Bacteria - 1066; Metazoa - 150; Fungi - 29; Plants - 57; Viruses - 0; Other Eukaryotes - 1624 (source: NCBI BLink).
AT1G75510AT1G75510.1AGTCGGTCCACGTtranscription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G75560AT1G75560.1TTCCACGTGzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).
AT1G75560.2TTCCACGTGzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).
AT1G75690AT1G75690.1AAGCCACGTGchaperone protein dnaJ-related; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 326 Blast hits to 308 proteins in 90 species: Archae - 4; Bacteria - 115; Metazoa - 13; Fungi - 12; Plants - 104; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).
AT1G75760AT1G75760.1ATCCACGTGTCACER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT1G19970.1); Has 627 Blast hits to 627 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 115; Plants - 120; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G75800AT1G75800.1GTCCACGTpathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G20030.2); Has 1077 Blast hits to 1068 proteins in 152 species: Archae - 2; Bacteria - 22; Metazoa - 59; Fungi - 47; Plants - 930; Viruses - 4; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G76020AT1G76020.1CTGCCACGTCACINVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20225.1); Has 118 Blast hits to 116 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 12; Fungi - 4; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G76030AT1G76030.1GTGACGTGGCAGEncodes the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus.
AT1G76070AT1G76070.1GTCACGTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20310.1); Has 36 Blast hits to 36 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G76100AT1G76100.1ATGCCACGTCACOne of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions.
AT1G76440AT1G76440.1TGACACGTGTCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20870.1); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G76440.2TGACACGTGTCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20870.1); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G76440.3TGACACGTGTCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20870.1); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G76480AT1G76480.1TGTCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20890.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G76540AT1G76540.1TACGTGGCAAEncodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling.
AT1G76570AT1G76570.1TACACGTGGCchlorophyll A-B binding family protein; FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to blue light, response to far red light, photosynthesis; LOCATED IN: light-harvesting complex, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B binding protein (InterPro:IPR001344); BEST Arabidopsis thaliana protein match is: LHCB2.3; chlorophyll binding (TAIR:AT3G27690.1); Has 1746 Blast hits to 1686 proteins in 190 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 1525; Viruses - 0; Other Eukaryotes - 219 (source: NCBI BLink).
AT1G76690AT1G76690.1CCACGTCGTTEncodes one of two closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer.
AT1G76730AT1G76730.1ATGACGTGG5-formyltetrahydrofolate cyclo-ligase family protein; FUNCTIONS IN: catalytic activity, ATP binding, 5-formyltetrahydrofolate cyclo-ligase activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 5-formyltetrahydrofolate cyclo-ligase (InterPro:IPR002698); Has 270 Blast hits to 270 proteins in 109 species: Archae - 50; Bacteria - 73; Metazoa - 104; Fungi - 6; Plants - 17; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT1G76740AT1G76740.1CCACGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76840.1); Has 3136 Blast hits to 2432 proteins in 274 species: Archae - 9; Bacteria - 251; Metazoa - 1340; Fungi - 208; Plants - 114; Viruses - 8; Other Eukaryotes - 1206 (source: NCBI BLink).
AT1G76850AT1G76850.1TTCCACGTEXOCYST COMPLEX COMPONENT SEC5 (SEC5A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen germination, pollen tube growth; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: SEC5B (TAIR:AT1G21170.1); Has 394 Blast hits to 372 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 200; Fungi - 94; Plants - 52; Viruses - 4; Other Eukaryotes - 42 (source: NCBI BLink).
AT1G76910AT1G76910.1CACGTGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT1G76940AT1G76940.1ATCCACGTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G77090AT1G77090.1TGACACGTGTGAthylakoid lumenal 29.8 kDa protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast stroma, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: thylakoid lumenal 20 kDa protein (TAIR:AT3G56650.1); Has 139 Blast hits to 139 proteins in 25 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G77120AT1G77120.1ATGCCACGTGGACCatalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.
AT1G77370AT1G77370.1TGTCACGTGTTglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink).
AT1G77370.1TTGCCACGTGTCATglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink).
AT1G77450AT1G77450.1ACGTGTCGArabidopsis NAC domain containing protein 32 (anac032); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ATAF1; transcription activator/ transcription factor (TAIR:AT1G01720.1); Has 1620 Blast hits to 1617 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1620; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G77450.1CTGCCACGTGTCCArabidopsis NAC domain containing protein 32 (anac032); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: ATAF1; transcription activator/ transcription factor (TAIR:AT1G01720.1); Has 1620 Blast hits to 1617 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1620; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G77510AT1G77510.1TCCACGTGTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response.
AT1G77750AT1G77750.1ACGTGGCGG30S ribosomal protein S13, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: mitochondrion, small ribosomal subunit, chloroplast, mitochondrial small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast (CS13) (TAIR:AT5G14320.1); Has 5725 Blast hits to 5725 proteins in 1762 species: Archae - 116; Bacteria - 2963; Metazoa - 147; Fungi - 105; Plants - 348; Viruses - 0; Other Eukaryotes - 2046 (source: NCBI BLink).
AT1G77750.1CAAAGCCCAACACGTCA30S ribosomal protein S13, chloroplast, putative; FUNCTIONS IN: structural constituent of ribosome, RNA binding, nucleic acid binding; INVOLVED IN: translation; LOCATED IN: mitochondrion, small ribosomal subunit, chloroplast, mitochondrial small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13, conserved site (InterPro:IPR018269), Ribosomal protein S13-like, H2TH (InterPro:IPR010979), Ribosomal protein S13 (InterPro:IPR001892); BEST Arabidopsis thaliana protein match is: 30S ribosomal protein S13, chloroplast (CS13) (TAIR:AT5G14320.1); Has 5725 Blast hits to 5725 proteins in 1762 species: Archae - 116; Bacteria - 2963; Metazoa - 147; Fungi - 105; Plants - 348; Viruses - 0; Other Eukaryotes - 2046 (source: NCBI BLink).
AT1G77810AT1G77810.1ATGACGTGGCATgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G77810.2ATGACGTGGCATgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G78040AT1G78040.1ATGCCACGTpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78040.2ATGCCACGTpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78140AT1G78140.1CTGCCACGTGTGAmethyltransferase-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase-related (TAIR:AT2G41040.1); Has 3459 Blast hits to 3458 proteins in 853 species: Archae - 143; Bacteria - 2524; Metazoa - 44; Fungi - 102; Plants - 117; Viruses - 0; Other Eukaryotes - 529 (source: NCBI BLink).
AT1G78150AT1G78150.1TCACACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78150.2TCACACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G35780.1); Has 77 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78510AT1G78510.1ATGACACGTGGTEncodes a protein with solanesyl diphosphate synthase activity.
AT1G78510.2ATGACACGTGGTEncodes a protein with solanesyl diphosphate synthase activity.
AT1G78600AT1G78600.1TCACGTGTCTLIGHT-REGULATED ZINC FINGER PROTEIN 1 (LZF1); FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: chlorophyll biosynthetic process, chloroplast organization, anthocyanin biosynthetic process, regulation of photomorphogenesis, regulation of transcription; LOCATED IN: nuclear speck; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: STO (SALT TOLERANCE); DNA binding / protein binding / transcription factor/ zinc ion binding (TAIR:AT1G06040.2); Has 1252 Blast hits to 916 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 1143; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink).
AT1G78660AT1G78660.1ATCCACGTThe Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.
AT1G78660.2ATCCACGTThe Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.
AT1G78660.3ATCCACGTThe Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.
AT1G78680AT1G78680.1ACCACGTGTACThe Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.
AT1G78700AT1G78700.1CACGTGGTbrassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink).
AT1G78700.1CCCACGTGbrassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink).
AT1G78900AT1G78900.1TGTCACGTGGCTEncodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.
AT1G78900.2TGTCACGTGGCTEncodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.
AT1G79040AT1G79040.1AGCCACGTGTCATEncodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.
AT1G79040.1CTACGTGGCATEncodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.
AT1G79040.1CTACGTGGCATEncodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ.
AT1G79060AT1G79060.1CACGTGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56020.1); Has 3270 Blast hits to 887 proteins in 158 species: Archae - 0; Bacteria - 617; Metazoa - 634; Fungi - 189; Plants - 72; Viruses - 8; Other Eukaryotes - 1750 (source: NCBI BLink).
AT1G79230AT1G79230.1GACGTGTCTencodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification.
AT1G79230.2GACGTGTCTencodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification.
AT1G79230.3GACGTGTCTencodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification.
AT1G79270AT1G79270.1ATGACGTGGACevolutionarily conserved C-terminal region 8 (ECT8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT6 (evolutionarily conserved C-terminal region 6) (TAIR:AT3G17330.1); Has 700 Blast hits to 699 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 84; Plants - 193; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).
AT1G79280AT1G79280.1GCCACGTGGTTAAAAGCCACGCGCTEncodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development.
AT1G79340AT1G79340.1ACGTGACAmetacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).
AT1G79340.1ATGCCACGTCAGmetacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).
AT1G79350AT1G79350.1GTCACGTGATGACACGTGAembryo defective 1135 (EMB1135); FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: embryonic development ending in seed dormancy, regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, LSD1-type (InterPro:IPR005735), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: ATXR6; DNA binding / protein binding (TAIR:AT5G24330.1); Has 3516 Blast hits to 3129 proteins in 248 species: Archae - 2; Bacteria - 434; Metazoa - 2253; Fungi - 273; Plants - 285; Viruses - 34; Other Eukaryotes - 235 (source: NCBI BLink).
AT1G79440AT1G79440.1ACACGTCATEncodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004).
AT1G79440.1CGGTTAAACTGCCACGTGGATEncodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004).
AT1G79650AT1G79650.1TGTCACGTGGATputative DNA repair protein RAD23
AT1G79650.2TGTCACGTGGATputative DNA repair protein RAD23
AT1G79650.3TGTCACGTGGATputative DNA repair protein RAD23
AT1G79750AT1G79750.1AGACACGTCAThe malic enzyme (EC encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed.
AT1G79790AT1G79790.1CCACGTCATChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G79790.1CTGACGTGGAChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G79790.2CCACGTCATChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G79790.2CTGACGTGGAChaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G80030AT1G80030.1ATCCACGTGDNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink).
AT1G80030.2ATCCACGTGDNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink).
AT1G80030.3ATCCACGTGDNAJ heat shock protein, putative; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305), Chaperone DnaJ (InterPro:IPR012724), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT3G17830.1); Has 20943 Blast hits to 20164 proteins in 2101 species: Archae - 124; Bacteria - 6520; Metazoa - 3750; Fungi - 1621; Plants - 1440; Viruses - 18; Other Eukaryotes - 7470 (source: NCBI BLink).
AT1G80060AT1G80060.1CTGACGTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32270.1); Has 97 Blast hits to 97 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G80110AT1G80110.1AGACACGTGTGARABIDOPSIS THALIANA PHLOEM PROTEIN 2-B11 (ATPP2-B11); FUNCTIONS IN: carbohydrate binding; LOCATED IN: nucleus; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-B12 (Phloem protein 2-B12); carbohydrate binding (TAIR:AT5G24560.1); Has 276 Blast hits to 269 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 276; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G80110.1TTCCACGTARABIDOPSIS THALIANA PHLOEM PROTEIN 2-B11 (ATPP2-B11); FUNCTIONS IN: carbohydrate binding; LOCATED IN: nucleus; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-B12 (Phloem protein 2-B12); carbohydrate binding (TAIR:AT5G24560.1); Has 276 Blast hits to 269 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 276; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G80460AT1G80460.1AGCCACGTGGGEncodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1.
AT1G80460.2AGCCACGTGGGEncodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1.
AT1G80480AT1G80480.1ATGCCACGTGPLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink).
AT1G80530AT1G80530.1TCACGTGTTnodulin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nodulin-like (InterPro:IPR010658), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nodulin family protein (TAIR:AT2G16660.1); Has 1371 Blast hits to 1343 proteins in 395 species: Archae - 7; Bacteria - 668; Metazoa - 19; Fungi - 115; Plants - 316; Viruses - 0; Other Eukaryotes - 246 (source: NCBI BLink).
AT1G80570AT1G80570.1ATGACGTGTCAF-box family protein (FBL14); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 3926 Blast hits to 1921 proteins in 161 species: Archae - 0; Bacteria - 279; Metazoa - 1944; Fungi - 309; Plants - 1047; Viruses - 3; Other Eukaryotes - 344 (source: NCBI BLink).
AT1G80570.2ATGACGTGTCAF-box family protein (FBL14); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 3926 Blast hits to 1921 proteins in 161 species: Archae - 0; Bacteria - 279; Metazoa - 1944; Fungi - 309; Plants - 1047; Viruses - 3; Other Eukaryotes - 344 (source: NCBI BLink).
AT1G80570.3ATGACGTGTCAF-box family protein (FBL14); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 3926 Blast hits to 1921 proteins in 161 species: Archae - 0; Bacteria - 279; Metazoa - 1944; Fungi - 309; Plants - 1047; Viruses - 3; Other Eukaryotes - 344 (source: NCBI BLink).
AT1G80580AT1G80580.1ATTGCCACGTCAAAACGCencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G80610AT1G80610.1ATGCCACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15800.1); Has 41 Blast hits to 39 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 27; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G80850AT1G80850.1GATGACGTGTCAmethyladenine glycosylase family protein; FUNCTIONS IN: DNA-3-methyladenine glycosylase I activity, catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Methyladenine glycosylase (InterPro:IPR005019); BEST Arabidopsis thaliana protein match is: methyladenine glycosylase family protein (TAIR:AT1G15970.1); Has 1956 Blast hits to 1956 proteins in 800 species: Archae - 7; Bacteria - 1545; Metazoa - 4; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink).
AT2G01150AT2G01150.1ATAATGGGTCCCACAACACGTGGCEncodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils.
AT2G01300AT2G01300.1AAATGACGTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15010.1); Has 45 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G01320AT2G01320.1CACACGTGTCTABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01320.2CACACGTGTCTABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01320.3CACACGTGTCTABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01320.4CACACGTGTCTABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ABC transporter family protein (TAIR:AT3G21090.1); Has 227389 Blast hits to 208575 proteins in 2622 species: Archae - 4247; Bacteria - 158384; Metazoa - 7388; Fungi - 4469; Plants - 2613; Viruses - 18; Other Eukaryotes - 50270 (source: NCBI BLink).
AT2G01340AT2G01340.1TTCCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71015.1); Has 55 Blast hits to 55 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G01420AT2G01420.1GTCCACGTEncodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).
AT2G01420.1TTGCCACGTGTCCEncodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).
AT2G01420.2GTCCACGTEncodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).
AT2G01420.2TTGCCACGTGTCCEncodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452).
AT2G01490AT2G01490.1ATCCACGTGGAAphytanoyl-CoA dioxygenase (PhyH) family protein; FUNCTIONS IN: phytanoyl-CoA dioxygenase activity; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phytanoyl-CoA dioxygenase (InterPro:IPR008775); Has 2632 Blast hits to 2624 proteins in 223 species: Archae - 0; Bacteria - 300; Metazoa - 320; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 1913 (source: NCBI BLink).
AT2G01590AT2G01590.1GCTGACGTGGCLikely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located in the membrane fraction of chloroplast. Mutant has impaired NAD(P)H dehydrogenase activity.
AT2G01720AT2G01720.1TACACGTGTCTribophorin I family protein; FUNCTIONS IN: oligosaccharyl transferase activity, dolichyl-diphosphooligosaccharide-protein glycotransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribophorin I (InterPro:IPR007676); BEST Arabidopsis thaliana protein match is: ribophorin I family protein (TAIR:AT1G76400.1); Has 285 Blast hits to 285 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 87; Plants - 31; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT2G01860AT2G01860.1TTGCCACGTAEMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT2G01900AT2G01900.1GTCCACGTCAGendonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, hypocotyl, root; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Inositol polyphosphate related phosphatase (InterPro:IPR000300), Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT2G37440.1); Has 1513 Blast hits to 1357 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 340; Plants - 368; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink).
AT2G01980AT2G01980.1TACACGTGTGEncodes a plasma membrane-localized Na+/H+ antiporter SOS1. Functions in the extrusion of toxic Na+ from cells and is essential for plant salt tolerance. Has 12 predicted transmembrane domains in the N-terminal region and a long cytoplasmic tail of approx. 700 aa at the C-terminal side. SOS1 interacts through its predicted cytoplasmic tail with RCD1, a regulator of oxidative-stress responses, suggesting that SOS1 might function in oxidative-stress tolerance.
AT2G02160AT2G02160.1CCCACGTGTCAzinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); Has 10894 Blast hits to 6834 proteins in 394 species: Archae - 15; Bacteria - 298; Metazoa - 5860; Fungi - 845; Plants - 435; Viruses - 183; Other Eukaryotes - 3258 (source: NCBI BLink).
AT2G02180AT2G02180.1GTGCCACGTGGANecessary for the efficient multiplication of tobamoviruses.
AT2G02810AT2G02810.1TTCCACGTGGAAEncodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER.
AT2G02960AT2G02960.1TCACACGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink).
AT2G02960.2TCACACGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink).
AT2G02960.3TCACACGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink).
AT2G02960.4TCACACGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink).
AT2G02960.5TCACACGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14260.2); Has 1256 Blast hits to 1256 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 621; Fungi - 87; Plants - 308; Viruses - 29; Other Eukaryotes - 211 (source: NCBI BLink).
AT2G03120AT2G03120.1AGACACGTGAhomologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant.
AT2G03120.1TGTCACGTAATTAhomologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant.
AT2G03470AT2G03470.1TACACGTGmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink).
AT2G03470.2TACACGTGmyb family transcription factor / ELM2 domain-containing protein; FUNCTIONS IN: DNA binding; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), ELM2 (InterPro:IPR000949), Myb, DNA-binding (InterPro:IPR014778); BEST Arabidopsis thaliana protein match is: ELM2 domain-containing protein (TAIR:AT1G13880.1); Has 3793 Blast hits to 2659 proteins in 214 species: Archae - 5; Bacteria - 202; Metazoa - 1087; Fungi - 393; Plants - 192; Viruses - 107; Other Eukaryotes - 1807 (source: NCBI BLink).
AT2G03640AT2G03640.1ACGTGACAnuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT1G13730.1); Has 2445 Blast hits to 2409 proteins in 239 species: Archae - 0; Bacteria - 81; Metazoa - 1485; Fungi - 337; Plants - 309; Viruses - 2; Other Eukaryotes - 231 (source: NCBI BLink).
AT2G03640.2ACGTGACAnuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT1G13730.1); Has 2445 Blast hits to 2409 proteins in 239 species: Archae - 0; Bacteria - 81; Metazoa - 1485; Fungi - 337; Plants - 309; Viruses - 2; Other Eukaryotes - 231 (source: NCBI BLink).
AT2G03740AT2G03740.1GTACACGTGGCGAlate embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT2G03850.1); Has 750 Blast hits to 378 proteins in 112 species: Archae - 2; Bacteria - 180; Metazoa - 50; Fungi - 21; Plants - 454; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT2G03820AT2G03820.1ATGACACGTGGATnonsense-mediated mRNA decay NMD3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: nuclear-transcribed mRNA catabolic process, nonsense-mediated decay; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NMD3 (InterPro:IPR007064); Has 355 Blast hits to 345 proteins in 156 species: Archae - 8; Bacteria - 0; Metazoa - 129; Fungi - 90; Plants - 42; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT2G03850AT2G03850.1CACGTCAGClate embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT2G03740.1); Has 393 Blast hits to 214 proteins in 69 species: Archae - 1; Bacteria - 67; Metazoa - 15; Fungi - 12; Plants - 269; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT2G03890AT2G03890.1GATGACGTGTCATphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT2G03890.2GATGACGTGTCATphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G13640.1); Has 415 Blast hits to 408 proteins in 124 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 52; Plants - 137; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT2G04032AT2G04032.1ACGTGGCACZINC TRANSPORTER 7 PRECURSOR (ZIP7); FUNCTIONS IN: cation transmembrane transporter activity, zinc ion transmembrane transporter activity, metal ion transmembrane transporter activity; INVOLVED IN: cation transport, zinc ion transport, metal ion transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease, fungal and plant (InterPro:IPR004698), Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: IRT1 (iron-regulated transporter 1); cadmium ion transmembrane transporter/ copper uptake transmembrane transporter/ iron ion transmembrane transporter/ manganese ion transmembrane transporter/ zinc ion transmembrane transporter (TAIR:AT4G19690.2); Has 1314 Blast hits to 1247 proteins in 219 species: Archae - 0; Bacteria - 98; Metazoa - 346; Fungi - 382; Plants - 314; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink).
AT2G04100AT2G04100.1AACACGTGTCAMATE efflux family protein; FUNCTIONS IN: drug transporter activity, antiporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: MATE family transporter related protein (InterPro:IPR015521), Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G04090.1); Has 5827 Blast hits to 5747 proteins in 1091 species: Archae - 83; Bacteria - 3728; Metazoa - 122; Fungi - 212; Plants - 684; Viruses - 0; Other Eukaryotes - 998 (source: NCBI BLink).
AT2G04350AT2G04350.1ACGTGGCAAlong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.1ATCCACGTGTCClong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.1CCCACGTGTCClong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.2ACGTGGCAAlong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.2ATCCACGTGTCClong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.2CCCACGTGTCClong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04400AT2G04400.1CCCACGTGTTindole-3-glycerol phosphate synthase (IGPS); FUNCTIONS IN: indole-3-glycerol-phosphate synthase activity; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate binding barrel (InterPro:IPR011060), Indole-3-glycerol phosphate synthase, central region (InterPro:IPR001468), Indole-3-glycerol phosphate synthase (InterPro:IPR013798); BEST Arabidopsis thaliana protein match is: indole-3-glycerol phosphate synthase, putative (TAIR:AT5G48220.1); Has 5692 Blast hits to 5692 proteins in 1242 species: Archae - 135; Bacteria - 3149; Metazoa - 0; Fungi - 114; Plants - 42; Viruses - 0; Other Eukaryotes - 2252 (source: NCBI BLink).
AT2G04550AT2G04550.1TCCACGTGGCACEncodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid.
AT2G04550.3TCCACGTGGCACEncodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid.
AT2G04850AT2G04850.1ATCCACGTCATauxin-responsive protein-related; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT3G25290.2); Has 374 Blast hits to 374 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 72; Fungi - 47; Plants - 246; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT2G05070AT2G05070.1CTGACGTGTACEncodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus.
AT2G05260AT2G05260.1ACGTGTCAlipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G05260.2ACGTGTCAlipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G05580AT2G05580.1TACGTGGCGAunknown protein; LOCATED IN: endomembrane system.
AT2G05920AT2G05920.1CTAACGGTCACACGTsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink).
AT2G05920.1TACGTGTCCsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink).
AT2G06025AT2G06025.1TCGCCACGTCACGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT4G28030.1); Has 565 Blast hits to 565 proteins in 223 species: Archae - 42; Bacteria - 278; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT2G06040AT2G06040.1TGACACGTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G21900.1); Has 3642 Blast hits to 1885 proteins in 175 species: Archae - 0; Bacteria - 109; Metazoa - 2066; Fungi - 492; Plants - 697; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).
AT2G06520AT2G06520.1CTGCCACGTAEncodes a protein with sequence similarity to the spinach photosystem II subunit PsbX.
AT2G07050AT2G07050.1CACGTGACAInvolved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol.
AT2G09990AT2G09990.1GTGACGTGGAA40S ribosomal protein S16 (RPS16A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast, membrane; EXPRESSED IN: guard cell, callus, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16C) (TAIR:AT5G18380.1); Has 4968 Blast hits to 4968 proteins in 1538 species: Archae - 152; Bacteria - 2664; Metazoa - 274; Fungi - 125; Plants - 112; Viruses - 0; Other Eukaryotes - 1641 (source: NCBI BLink).
AT2G14170AT2G14170.2CCCACGTGGCGAArabidopsis thaliana methylmalonate-semialdehyde dehydrogenase
AT2G14260AT2G14260.1ACGTGTCAencodes proline iminopeptidase
AT2G14260.2ACGTGTCAencodes proline iminopeptidase
AT2G14890AT2G14890.1ACGTGTCAputative proline-rich protein (At2g14890) mRNA, complete
AT2G14890.2ACGTGTCAputative proline-rich protein (At2g14890) mRNA, complete
AT2G14910AT2G14910.1TGTCACGTunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink).
AT2G14910.2TGTCACGTunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14970.1); Has 495 Blast hits to 336 proteins in 81 species: Archae - 0; Bacteria - 243; Metazoa - 19; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 182 (source: NCBI BLink).
AT2G15695AT2G15695.1ATGACGTGGCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF829, eukaryotic (InterPro:IPR008547); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44250.1); Has 84 Blast hits to 84 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT2G15970AT2G15970.1CTGCCACGTGGCGTencodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment.
AT2G16365AT2G16365.1ACACGTCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT2G16365.2ACACGTCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT2G16365.3ACACGTCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT2G16365.4ACACGTCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT2G16600AT2G16600.1TCCACGTGTCAEncodes cytosolic cyclophilin ROC3.
AT2G16600.2TCCACGTGTCAEncodes cytosolic cyclophilin ROC3.
AT2G16640AT2G16640.1GTCCACGTCAGCMULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink).
AT2G16890AT2G16890.1GTACACGTUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213), Tudor subgroup (InterPro:IPR018351); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT5G14860.1); Has 4649 Blast hits to 4605 proteins in 328 species: Archae - 0; Bacteria - 167; Metazoa - 1679; Fungi - 16; Plants - 2672; Viruses - 91; Other Eukaryotes - 24 (source: NCBI BLink).
AT2G16890.2GTACACGTUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213), Tudor subgroup (InterPro:IPR018351); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT5G14860.1); Has 4649 Blast hits to 4605 proteins in 328 species: Archae - 0; Bacteria - 167; Metazoa - 1679; Fungi - 16; Plants - 2672; Viruses - 91; Other Eukaryotes - 24 (source: NCBI BLink).
AT2G16980AT2G16980.1CGCACGTGtetracycline transporter; FUNCTIONS IN: tetracycline transporter activity; INVOLVED IN: response to antibiotic, tetracycline transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: inflorescence meristem, male gametophyte, hypocotyl, flower, root; EXPRESSED DURING: L mature pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: Tetracycline resistance protein, TetA (InterPro:IPR001958), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: MEE15 (maternal effect embryo arrest 15); tetracycline transporter (TAIR:AT2G16970.1); Has 1587 Blast hits to 1585 proteins in 635 species: Archae - 8; Bacteria - 1006; Metazoa - 211; Fungi - 5; Plants - 45; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink).
AT2G16980.2CGCACGTGtetracycline transporter; FUNCTIONS IN: tetracycline transporter activity; INVOLVED IN: response to antibiotic, tetracycline transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: inflorescence meristem, male gametophyte, hypocotyl, flower, root; EXPRESSED DURING: L mature pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: Tetracycline resistance protein, TetA (InterPro:IPR001958), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: MEE15 (maternal effect embryo arrest 15); tetracycline transporter (TAIR:AT2G16970.1); Has 1587 Blast hits to 1585 proteins in 635 species: Archae - 8; Bacteria - 1006; Metazoa - 211; Fungi - 5; Plants - 45; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink).
AT2G17350AT2G17350.1CACACGTGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 93 Blast hits to 67 proteins in 31 species: Archae - 0; Bacteria - 1; Metazoa - 16; Fungi - 13; Plants - 21; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT2G17360AT2G17360.1TCACACGTGTG40S ribosomal protein S4 (RPS4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink).
AT2G17560AT2G17560.1GTACACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT2G17560.1TACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT2G17560.2GTACACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT2G17560.2TACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT2G17560.3GTACACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT2G17560.3TACGTGTCAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha.
AT2G17790AT2G17790.1GTACACGTGTGAVPS35 HOMOLOG A (VPS35A); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport, retrograde transport, endosome to Golgi; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting-associated protein 35 (InterPro:IPR005378); BEST Arabidopsis thaliana protein match is: VPS35B (VPS35 HOMOLOG B) (TAIR:AT1G75850.1); Has 463 Blast hits to 387 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 144; Plants - 38; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT2G17840AT2G17840.1ATCCACGTIdentified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis.
AT2G17850AT2G17850.1ACGCCACGTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: aging; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G66170.2); Has 1960 Blast hits to 1954 proteins in 396 species: Archae - 22; Bacteria - 1018; Metazoa - 11; Fungi - 7; Plants - 116; Viruses - 0; Other Eukaryotes - 786 (source: NCBI BLink).
AT2G17870AT2G17870.1CACACGTGGTcold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink).
AT2G17870.1GCTGACGTGGCGAcold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink).
AT2G18050AT2G18050.1TAAACGACACGTGTACencodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA.
AT2G18050.2TAAACGACACGTGTACencodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA.
AT2G18193AT2G18193.1CTGACGTGTACAAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT2G18190.1); Has 15970 Blast hits to 14789 proteins in 1627 species: Archae - 790; Bacteria - 4301; Metazoa - 3207; Fungi - 2071; Plants - 1436; Viruses - 30; Other Eukaryotes - 4135 (source: NCBI BLink).
AT2G18193.1GTCACGTGTCACAAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT2G18190.1); Has 15970 Blast hits to 14789 proteins in 1627 species: Archae - 790; Bacteria - 4301; Metazoa - 3207; Fungi - 2071; Plants - 1436; Viruses - 30; Other Eukaryotes - 4135 (source: NCBI BLink).
AT2G18370AT2G18370.1ACACGTCATCPredicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT2G18680AT2G18680.1ACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18690.1); Has 116 Blast hits to 114 proteins in 17 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G18730AT2G18730.1TCACACGTdiacylglycerol kinase, putative; FUNCTIONS IN: diacylglycerol kinase activity; INVOLVED IN: activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Diacylglycerol kinase, catalytic region (InterPro:IPR001206), Diacylglycerol kinase accessory region (InterPro:IPR000756), Diacylglycerol kinase, plant (InterPro:IPR016961); BEST Arabidopsis thaliana protein match is: ATDGK7 (Diacylglycerol kinase 7); diacylglycerol kinase (TAIR:AT4G30340.1); Has 1222 Blast hits to 1067 proteins in 153 species: Archae - 0; Bacteria - 98; Metazoa - 849; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).
AT2G18860AT2G18860.1AGCCACGTsyntaxin family protein; FUNCTIONS IN: protein binding; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G30240.1); Has 58 Blast hits to 58 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G18860.2AGCCACGTsyntaxin family protein; FUNCTIONS IN: protein binding; INVOLVED IN: Golgi vesicle transport, vesicle-mediated transport; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: t-SNARE (InterPro:IPR010989), Syntaxin 6, N-terminal (InterPro:IPR015260); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G30240.1); Has 58 Blast hits to 58 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G19380AT2G19380.1ACACGTCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2, LYAR-type (InterPro:IPR014898), RNA recognition motif, RNP-1 (InterPro:IPR000504), Zinc finger, U1-type (InterPro:IPR003604), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G22100.1); Has 12850 Blast hits to 10717 proteins in 556 species: Archae - 0; Bacteria - 638; Metazoa - 7561; Fungi - 1405; Plants - 1811; Viruses - 2; Other Eukaryotes - 1433 (source: NCBI BLink).
AT2G19700AT2G19700.1TGACGTGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G20260AT2G20260.1TCACACGTGTCATEncodes subunit E of photosystem I.
AT2G20260.1TTGCCACGTCATCEncodes subunit E of photosystem I.
AT2G20360AT2G20360.1GTGACGTGGbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink).
AT2G20400AT2G20400.1TTCCACGTAGmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 913 Blast hits to 906 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 900; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G20480AT2G20480.1GTCACGTGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G20490AT2G20490.1TCACACGTGACNOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT2G20490.2TCACACGTGACNOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT2G20550AT2G20550.1TACGTGTCTDNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink).
AT2G20550.2TACGTGTCTDNAJ chaperone C-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ peptide-binding (InterPro:IPR008971), Chaperone DnaJ, C-terminal (InterPro:IPR002939); BEST Arabidopsis thaliana protein match is: DNAJ heat shock family protein (TAIR:AT2G20560.1); Has 7698 Blast hits to 7627 proteins in 1649 species: Archae - 68; Bacteria - 3560; Metazoa - 890; Fungi - 429; Plants - 401; Viruses - 2; Other Eukaryotes - 2348 (source: NCBI BLink).
AT2G20770AT2G20770.1ATGCCACGTEncodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase.
AT2G20890AT2G20890.1ACGTGGACChloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane–delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex.
AT2G20890.1GGACACGTGTCACChloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane–delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex.
AT2G21060AT2G21060.1GTGACGTGGCGGglycine-rich protein (AtGRP2b)
AT2G21130AT2G21130.1AACACGTGTCGpeptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: ROC1 (ROTAMASE CYP 1); peptidyl-prolyl cis-trans isomerase (TAIR:AT4G38740.1); Has 11585 Blast hits to 11564 proteins in 1521 species: Archae - 82; Bacteria - 3695; Metazoa - 2395; Fungi - 955; Plants - 731; Viruses - 4; Other Eukaryotes - 3723 (source: NCBI BLink).
AT2G21130.1CGACACGTGTCTpeptidyl-prolyl cis-trans isomerase / cyclophilin (CYP2) / rotamase; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: ROC1 (ROTAMASE CYP 1); peptidyl-prolyl cis-trans isomerase (TAIR:AT4G38740.1); Has 11585 Blast hits to 11564 proteins in 1521 species: Archae - 82; Bacteria - 3695; Metazoa - 2395; Fungi - 955; Plants - 731; Viruses - 4; Other Eukaryotes - 3723 (source: NCBI BLink).
AT2G21170AT2G21170.1ACGTGACAEncodes triosephosphate isomerase.
AT2G21170.2ACGTGACAEncodes triosephosphate isomerase.
AT2G21270AT2G21270.1ACACGTCAubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).
AT2G21270.2ACACGTCAubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).
AT2G21270.3ACACGTCAubiquitin fusion degradation UFD1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT4G38930.2); Has 506 Blast hits to 506 proteins in 158 species: Archae - 8; Bacteria - 2; Metazoa - 131; Fungi - 142; Plants - 71; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).
AT2G21330AT2G21330.1ATCCACGTGGCAAfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).
AT2G21330.2ATCCACGTGGCAAfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).
AT2G21330.3ATCCACGTGGCAAfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, pentose-phosphate shunt; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G38970.1); Has 4194 Blast hits to 4191 proteins in 673 species: Archae - 0; Bacteria - 436; Metazoa - 1009; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2408 (source: NCBI BLink).
AT2G21410AT2G21410.1TACGTGGCAGVacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast.
AT2G21430AT2G21430.1ACCACGTGcysteine proteinase A494, putative / thiol protease, putative; FUNCTIONS IN: cysteine-type endopeptidase activity, cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C1A, papain (InterPro:IPR013128), Proteinase inhibitor I29, cathepsin propeptide (InterPro:IPR013201), Peptidase C1A, papain C-terminal (InterPro:IPR000668), Peptidase, cysteine peptidase active site (InterPro:IPR000169); BEST Arabidopsis thaliana protein match is: RD19 (RESPONSIVE TO DEHYDRATION 19); cysteine-type endopeptidase/ cysteine-type peptidase (TAIR:AT4G39090.1); Has 6074 Blast hits to 6031 proteins in 584 species: Archae - 31; Bacteria - 96; Metazoa - 2794; Fungi - 4; Plants - 1193; Viruses - 124; Other Eukaryotes - 1832 (source: NCBI BLink).
AT2G21490AT2G21490.1ACGCCACGTADEHYDRIN LEA (LEA); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to water, response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Dehydrin (InterPro:IPR000167); BEST Arabidopsis thaliana protein match is: dehydrin family protein (TAIR:AT4G39130.1); Has 1199 Blast hits to 1011 proteins in 136 species: Archae - 0; Bacteria - 3; Metazoa - 16; Fungi - 16; Plants - 1152; Viruses - 2; Other Eukaryotes - 10 (source: NCBI BLink).
AT2G21500AT2G21500.1ATGACGTGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT2G21500.2ATGACGTGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT2G21590AT2G21590.1ACGTGTCCEncodes the large subunit of ADP-glucose pyrophosphorylase, the enzyme which catalyzes the first and limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described.
AT2G21590.2ACGTGTCCEncodes the large subunit of ADP-glucose pyrophosphorylase, the enzyme which catalyzes the first and limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described.
AT2G21640AT2G21640.1CGCACGTGEncodes a protein of unknown function that is a marker for oxidative stress response.
AT2G21660AT2G21660.1TGTCACGTGEncodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).
AT2G21660.2TGTCACGTGEncodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).
AT2G21970AT2G21970.1AAAACGACACGTAstress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein
AT2G21970.1AGCCACGTCGstress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein
AT2G21970.1TAAACGACACGACGTGTACstress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein
AT2G22010AT2G22010.1ACGCCACGTGTCAEncodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein.
AT2G22010.1ACGTCATCAGCCACGTCATCEncodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein.
AT2G22010.1CGACACGTGTCGEncodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein.
AT2G22170AT2G22170.1AAAACGACCACGTCATClipid-associated family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976); BEST Arabidopsis thaliana protein match is: lipid-associated family protein (TAIR:AT4G39730.1); Has 113 Blast hits to 108 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G22190AT2G22190.1ACCACGTGGCGcatalytic/ trehalose-phosphatase; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT4G39770.1); Has 1471 Blast hits to 1467 proteins in 515 species: Archae - 29; Bacteria - 759; Metazoa - 195; Fungi - 105; Plants - 269; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).
AT2G22240AT2G22240.1ACGCCACGTGTCT** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT2G22240.1ACGTGTCT** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT2G22240.1CCGCCACGTGTCC** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT2G22240.2ACGCCACGTGTCT** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT2G22240.2ACGTGTCT** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT2G22240.2CCGCCACGTGTCC** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT2G22300AT2G22300.1AACACGTGAEncodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.
AT2G22300.2AACACGTGAEncodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.
AT2G22470AT2G22470.1AACACGTGGCAGEncodes arabinogalactan-protein (AGP2).
AT2G22470.1ACACGTCAEncodes arabinogalactan-protein (AGP2).
AT2G22470.1ACGTGTCAEncodes arabinogalactan-protein (AGP2).
AT2G23120AT2G23120.1AACCGCGTAATTAACGTGTCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G23120.1AAGCCACGTCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G23170AT2G23170.1ACGTGGCGencodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro.
AT2G23170.1CGACGTGGAAencodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro.
AT2G23320AT2G23320.1AACACGTGAEncodes WRKY DNA-binding protein 15 (WRKY15).
AT2G23320.2AACACGTGAEncodes WRKY DNA-binding protein 15 (WRKY15).
AT2G23440AT2G23440.1CACGTGTCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: root; Has 8 Blast hits to 8 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G23630AT2G23630.1GTGACGTGSKU5 Similar 16 (sks16); FUNCTIONS IN: pectinesterase activity, copper ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, hypocotyl, root; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: sks15 (SKU5 Similar 15); copper ion binding / oxidoreductase (TAIR:AT4G37160.1); Has 3666 Blast hits to 3642 proteins in 654 species: Archae - 2; Bacteria - 1007; Metazoa - 248; Fungi - 1479; Plants - 775; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).
AT2G23670AT2G23670.1GATGACGTGTCACGTArabidopsis homolog of Synechocystis YCF37 (YCF37); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G24020AT2G24020.1GTGACGTGGCGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30620.1); Has 1553 Blast hits to 1553 proteins in 610 species: Archae - 0; Bacteria - 1223; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink).
AT2G24210AT2G24210.1GTACACGTterpene synthase 10 (TPS10); FUNCTIONS IN: myrcene synthase activity, (E)-beta-ocimene synthase activity; INVOLVED IN: response to jasmonic acid stimulus, monoterpenoid biosynthetic process, response to wounding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Terpene synthase, metal-binding domain (InterPro:IPR005630), Terpenoid synthase (InterPro:IPR008949), Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (InterPro:IPR008930), Terpene synthase-like (InterPro:IPR001906); BEST Arabidopsis thaliana protein match is: ATTPS-CIN (terpene synthase-like sequence-1,8-cineole); (E)-beta-ocimene synthase/ myrcene synthase (TAIR:AT3G25830.1); Has 1100 Blast hits to 1084 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1097; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G24360AT2G24360.1AAGCCACGTGTCTserine/threonine/tyrosine kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G31170.3); Has 96787 Blast hits to 95023 proteins in 3525 species: Archae - 68; Bacteria - 8423; Metazoa - 42926; Fungi - 8081; Plants - 19355; Viruses - 602; Other Eukaryotes - 17332 (source: NCBI BLink).
AT2G24360.1ACGTGTGAserine/threonine/tyrosine kinase, putative; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G31170.3); Has 96787 Blast hits to 95023 proteins in 3525 species: Archae - 68; Bacteria - 8423; Metazoa - 42926; Fungi - 8081; Plants - 19355; Viruses - 602; Other Eukaryotes - 17332 (source: NCBI BLink).
AT2G24420AT2G24420.1CGACACGTGTCADNA repair ATPase-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT4G31340.1); Has 40459 Blast hits to 22195 proteins in 1227 species: Archae - 603; Bacteria - 4138; Metazoa - 19968; Fungi - 2677; Plants - 1225; Viruses - 186; Other Eukaryotes - 11662 (source: NCBI BLink).
AT2G24420.2CGACACGTGTCADNA repair ATPase-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT4G31340.1); Has 40459 Blast hits to 22195 proteins in 1227 species: Archae - 603; Bacteria - 4138; Metazoa - 19968; Fungi - 2677; Plants - 1225; Viruses - 186; Other Eukaryotes - 11662 (source: NCBI BLink).
AT2G24550AT2G24550.1CCACGTCAGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31510.1); Has 115 Blast hits to 115 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G24790AT2G24790.1ACGTGTCATPositive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching.
AT2G24790.2ACGTGTCATPositive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching.
AT2G25090AT2G25090.1TTCCACGTCAEncodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16).
AT2G25110AT2G25110.1ATGACACGTGTTSTROMAL CELL-DERIVED FACTOR 2-LIKE PROTEIN PRECURSOR (SDF2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MIR (InterPro:IPR003608), MIR motif (InterPro:IPR016093); Has 774 Blast hits to 744 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 337; Fungi - 338; Plants - 41; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).
AT2G25250AT2G25250.1AGACACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32020.1); Has 14 Blast hits to 14 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G25430AT2G25430.1TCGCCACGTCATCepsin N-terminal homology (ENTH) domain-containing protein; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT4G32285.2); Has 1419 Blast hits to 1078 proteins in 187 species: Archae - 4; Bacteria - 130; Metazoa - 620; Fungi - 114; Plants - 393; Viruses - 2; Other Eukaryotes - 156 (source: NCBI BLink).
AT2G25520AT2G25520.1TCGCCACGTAGphosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT4G32390.1); Has 1588 Blast hits to 1588 proteins in 185 species: Archae - 0; Bacteria - 8; Metazoa - 446; Fungi - 283; Plants - 685; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).
AT2G25890AT2G25890.1ACCACGTGTCAglycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; EXPRESSED IN: leaf whorl, petal, flower, carpel; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO1 (OLEOSIN 1) (TAIR:AT4G25140.1); Has 402 Blast hits to 402 proteins in 48 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 398; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G25900AT2G25900.1TACACGTGTCATputative Cys3His zinc finger protein (ATCTH) mRNA, complete
AT2G25970AT2G25970.1CCACGTAGKH domain-containing protein; FUNCTIONS IN: RNA binding, nucleic acid binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, type 1, subgroup (InterPro:IPR018111), K Homology (InterPro:IPR004087), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G10070.1); Has 58601 Blast hits to 28880 proteins in 1175 species: Archae - 49; Bacteria - 9002; Metazoa - 29116; Fungi - 7911; Plants - 5123; Viruses - 311; Other Eukaryotes - 7089 (source: NCBI BLink).
AT2G26080AT2G26080.1ACGTGGAAArabidopsis thaliana glycine decarboxylase P-protein 2 (AtGLDP2); FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity, ATP binding; INVOLVED IN: glycine decarboxylation via glycine cleavage system, glycine metabolic process; LOCATED IN: mitochondrion, glycine cleavage complex, chloroplast, chloroplast envelope; EXPRESSED IN: 33 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Glycine cleavage system P-protein (InterPro:IPR003437), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: AtGLDP1 (Arabidopsis thaliana glycine decarboxylase P-protein 1); catalytic/ glycine dehydrogenase (decarboxylating)/ pyridoxal phosphate binding (TAIR:AT4G33010.1); Has 9803 Blast hits to 8963 proteins in 1111 species: Archae - 132; Bacteria - 2858; Metazoa - 123; Fungi - 158; Plants - 73; Viruses - 0; Other Eukaryotes - 6459 (source: NCBI BLink).
AT2G26350AT2G26350.1ACGTGTCAZinc-binding peroxisomal integral membrane protein (PEX10). Inserted directly from the cytosol into peroxisomes and is involved in importing proteins into the peroxisome. Required for embryogenesis.
AT2G26570AT2G26570.1ACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G33390.1); Has 116898 Blast hits to 58103 proteins in 2191 species: Archae - 1417; Bacteria - 21958; Metazoa - 54071; Fungi - 9153; Plants - 5267; Viruses - 512; Other Eukaryotes - 24520 (source: NCBI BLink).
AT2G27040AT2G27040.1TACGTGTCAAGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation and increased susceptibility to bacterial pathogens.
AT2G27590AT2G27590.1GGGCCTACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 78 Blast hits to 78 proteins in 13 species: Archae - 0; Bacteria - 16; Metazoa - 0; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT2G27600AT2G27600.1CTACGTGGATEncodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function.
AT2G27860AT2G27860.1CACGTGGAAEncodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate.
AT2G27950AT2G27950.1TACGTGTCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT5G04460.1); Has 502 Blast hits to 402 proteins in 102 species: Archae - 0; Bacteria - 164; Metazoa - 106; Fungi - 26; Plants - 62; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink).
AT2G28890AT2G28890.1CACGTGTCGTEncodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves.
AT2G28900AT2G28900.1ACGTGTGAEncodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment.
AT2G28940AT2G28940.1TCGCCACGTCATCprotein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G39110.1); Has 81015 Blast hits to 80048 proteins in 2308 species: Archae - 40; Bacteria - 6913; Metazoa - 35685; Fungi - 6155; Plants - 18356; Viruses - 328; Other Eukaryotes - 13538 (source: NCBI BLink).
AT2G29020AT2G29020.1TGTCACGTGCGTGGCACRab5-interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rab5-interacting (InterPro:IPR010742); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59410.1); Has 144 Blast hits to 144 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 108; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT2G29070AT2G29070.1CCCACGTGTAubiquitin fusion degradation UFD1 family protein; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 499 Blast hits to 499 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 134; Plants - 71; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT2G29070.1TTCCACGTAGubiquitin fusion degradation UFD1 family protein; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 499 Blast hits to 499 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 134; Plants - 71; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT2G29070.2CCCACGTGTAubiquitin fusion degradation UFD1 family protein; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 499 Blast hits to 499 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 134; Plants - 71; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT2G29070.2TTCCACGTAGubiquitin fusion degradation UFD1 family protein; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin fusion degradation protein UFD1 (InterPro:IPR004854); BEST Arabidopsis thaliana protein match is: ubiquitin fusion degradation UFD1 family protein (TAIR:AT2G21270.3); Has 499 Blast hits to 499 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 134; Plants - 71; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT2G29300AT2G29300.1ATGCCACGTAtropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29320.1); Has 77732 Blast hits to 77581 proteins in 2156 species: Archae - 464; Bacteria - 43191; Metazoa - 4073; Fungi - 3687; Plants - 1470; Viruses - 5; Other Eukaryotes - 24842 (source: NCBI BLink).
AT2G29400AT2G29400.1ACGTGTACType 1 protein phosphatase, expressed in roots, rosettes and flowers
AT2G29530AT2G29530.1GATGACGTGGCGTEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.
AT2G29530.2GATGACGTGGCGTEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.
AT2G29530.3GATGACGTGGCGTEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.
AT2G29540AT2G29540.1ACGCCACGTCATCRNA polymerase I(A) and III(C) 14 kDa subunit
AT2G29540.2ACGCCACGTCATCRNA polymerase I(A) and III(C) 14 kDa subunit
AT2G29540.3ACGCCACGTCATCRNA polymerase I(A) and III(C) 14 kDa subunit
AT2G29550AT2G29550.1CACGTGCGEncodes a beta-tubulin that is expressed in leaves, roots and flowers.
AT2G29550.1TACGTGGCATEncodes a beta-tubulin that is expressed in leaves, roots and flowers.
AT2G29560AT2G29560.1CGCACGTGenolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: glycolysis; LOCATED IN: phosphopyruvate hydratase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9375 Blast hits to 9353 proteins in 2216 species: Archae - 179; Bacteria - 3114; Metazoa - 1311; Fungi - 220; Plants - 152; Viruses - 0; Other Eukaryotes - 4399 (source: NCBI BLink).
AT2G29560.1CGCACGTGenolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: glycolysis; LOCATED IN: phosphopyruvate hydratase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9375 Blast hits to 9353 proteins in 2216 species: Archae - 179; Bacteria - 3114; Metazoa - 1311; Fungi - 220; Plants - 152; Viruses - 0; Other Eukaryotes - 4399 (source: NCBI BLink).
AT2G29630AT2G29630.1GGACACGTCAGCEncodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene.
AT2G29630.2GGACACGTCAGCEncodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene.
AT2G30040AT2G30040.1GTCCACGTCGmember of MEKK subfamily
AT2G30200AT2G30200.1GGACACGTGTCC[acyl-carrier-protein] S-malonyltransferase/ binding / catalytic/ transferase; FUNCTIONS IN: binding, transferase activity, [acyl-carrier-protein] S-malonyltransferase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Malonyl CoA-acyl carrier protein transacylase (InterPro:IPR004410), Acyl transferase region (InterPro:IPR001227), Acyl transferase (InterPro:IPR014043), Malonyl-CoA ACP transacylase, ACP-binding (InterPro:IPR016036); Has 10358 Blast hits to 9483 proteins in 1551 species: Archae - 0; Bacteria - 6429; Metazoa - 193; Fungi - 844; Plants - 33; Viruses - 0; Other Eukaryotes - 2859 (source: NCBI BLink).
AT2G30200.2GGACACGTGTCC[acyl-carrier-protein] S-malonyltransferase/ binding / catalytic/ transferase; FUNCTIONS IN: binding, transferase activity, [acyl-carrier-protein] S-malonyltransferase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acyl transferase/acyl hydrolase/lysophospholipase (InterPro:IPR016035), Malonyl CoA-acyl carrier protein transacylase (InterPro:IPR004410), Acyl transferase region (InterPro:IPR001227), Acyl transferase (InterPro:IPR014043), Malonyl-CoA ACP transacylase, ACP-binding (InterPro:IPR016036); Has 10358 Blast hits to 9483 proteins in 1551 species: Archae - 0; Bacteria - 6429; Metazoa - 193; Fungi - 844; Plants - 33; Viruses - 0; Other Eukaryotes - 2859 (source: NCBI BLink).
AT2G30290AT2G30290.1ATCCACGTvacuolar sorting receptor, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: protein targeting to vacuole; LOCATED IN: integral to plasma membrane, Golgi transport complex; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), EGF-type aspartate/asparagine hydroxylation conserved site (InterPro:IPR000152), EGF-like calcium-binding, conserved site (InterPro:IPR018097), EGF-like, type 3 (InterPro:IPR000742), Growth factor, receptor (InterPro:IPR009030), EGF-like region, conserved site (InterPro:IPR013032); BEST Arabidopsis thaliana protein match is: VSR1 (VACUOLAR SORTING RECEPTOR HOMOLOG 1); amino-terminal vacuolar sorting propeptide binding (TAIR:AT3G52850.1); Has 8236 Blast hits to 4061 proteins in 169 species: Archae - 2; Bacteria - 64; Metazoa - 7534; Fungi - 0; Plants - 232; Viruses - 0; Other Eukaryotes - 404 (source: NCBI BLink).
AT2G30390AT2G30390.1GGACACGTGTGEncodes one of two ferrochelatase genes in Arabidopsis. Ferrochelatase is the terminal enzyme of heme biosynthesis. FC-II is speculated to operate in photosynthetic cytochromes
AT2G30570AT2G30570.1ATGACACGTGGAEncodes a protein similar to photosystem II reaction center subunit W.
AT2G30860AT2G30860.1ACGCCACGTEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT2G30860.2ACGCCACGTEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT2G30870AT2G30870.1ATGACGTGearly dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002)
AT2G30870.1CGACACGTAearly dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002)
AT2G30950AT2G30950.1GGACACGTAMetalloprotease that functions in thylakoid membrane biogenesis. Involved in the repair of PSII following damaged incurred during photoinhibition. Forms a complex with VAR1. Mutants show a variegated phenotype, which decreases during development. Transcript and protein levels increase with light intensity.
AT2G31060AT2G31060.1ACGTGGCTelongation factor family protein; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding protein TypA (InterPro:IPR006298), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor family protein (TAIR:AT5G13650.2); Has 57588 Blast hits to 53803 proteins in 9459 species: Archae - 666; Bacteria - 25964; Metazoa - 8718; Fungi - 3160; Plants - 1202; Viruses - 0; Other Eukaryotes - 17878 (source: NCBI BLink).
AT2G31580AT2G31580.1TACGTGGCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: tRNAHis guanylyltransferase (InterPro:IPR007537); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32320.1); Has 640 Blast hits to 336 proteins in 155 species: Archae - 65; Bacteria - 47; Metazoa - 212; Fungi - 176; Plants - 43; Viruses - 2; Other Eukaryotes - 95 (source: NCBI BLink).
AT2G31670AT2G31670.1ATCCACGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome, chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Stress responsive alpha-beta barrel (InterPro:IPR013097), Dimeric alpha-beta barrel (InterPro:IPR011008); BEST Arabidopsis thaliana protein match is: DABB1 (DIMERIC A/B BARREL DOMAINS-PROTEIN 1) (TAIR:AT1G51360.1); Has 138 Blast hits to 135 proteins in 38 species: Archae - 0; Bacteria - 51; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT2G31810AT2G31810.1GCTGACGTGTacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink).
AT2G31810.2GCTGACGTGTacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink).
AT2G31810.3GCTGACGTGTacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT5G16290.2); Has 8371 Blast hits to 4290 proteins in 1102 species: Archae - 146; Bacteria - 3993; Metazoa - 0; Fungi - 172; Plants - 54; Viruses - 0; Other Eukaryotes - 4006 (source: NCBI BLink).
AT2G31945AT2G31945.1TTCCACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05575.1); Has 34 Blast hits to 34 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G32080AT2G32080.1TACGTGGCATsimilar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication
AT2G32080.2TACGTGGCATsimilar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication
AT2G32415AT2G32415.1AACACGTGTCA3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink).
AT2G32415.1AGACACGTGTT3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink).
AT2G32510AT2G32510.1ATCCACGTGTGmember of MEKK subfamily
AT2G32850AT2G32850.1GTCCACGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATPK3; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT5G08160.1); Has 67658 Blast hits to 66473 proteins in 1675 species: Archae - 30; Bacteria - 5982; Metazoa - 29177; Fungi - 6997; Plants - 11346; Viruses - 187; Other Eukaryotes - 13939 (source: NCBI BLink).
AT2G32850.2GTCCACGTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ATPK3; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT5G08160.1); Has 67658 Blast hits to 66473 proteins in 1675 species: Archae - 30; Bacteria - 5982; Metazoa - 29177; Fungi - 6997; Plants - 11346; Viruses - 187; Other Eukaryotes - 13939 (source: NCBI BLink).
AT2G32990AT2G32990.1CACGTCATCArabidopsis thaliana glycosyl hydrolase 9B8 (AtGH9B8); FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Six-hairpin glycosidase (InterPro:IPR012341), Glycoside hydrolase, family 9, active site (InterPro:IPR018221), Six-hairpin glycosidase-like (InterPro:IPR008928), Glycoside hydrolase, family 9 (InterPro:IPR001701); BEST Arabidopsis thaliana protein match is: AtGH9C2 (Arabidopsis thaliana glycosyl hydrolase 9C2); carbohydrate binding / catalytic/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G64390.1); Has 1108 Blast hits to 1103 proteins in 191 species: Archae - 0; Bacteria - 304; Metazoa - 140; Fungi - 14; Plants - 622; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT2G33180AT2G33180.1TTGCCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G33250AT2G33250.1ACGTGGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G33250.1ATCCACGTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G33380AT2G33380.1ACCACGTGGATEncodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.
AT2G33380.1TGACACGTGTCCEncodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.
AT2G33380.2ACCACGTGGATEncodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.
AT2G33380.2TGACACGTGTCCEncodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to dessication. mRNA expression under drought conditions is apparent particularly in leaves and flowers.
AT2G33540AT2G33540.1GCTGACGTGTACC-TERMINAL DOMAIN PHOSPHATASE-LIKE 3 (CPL3); FUNCTIONS IN: phosphoprotein phosphatase activity, CTD phosphatase activity; INVOLVED IN: response to salt stress; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FCP1-like phosphatase, phosphatase domain (InterPro:IPR011947), NLI interacting factor (InterPro:IPR004274), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: CPL4 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 4); phosphoprotein phosphatase (TAIR:AT5G58003.1); Has 1270 Blast hits to 886 proteins in 180 species: Archae - 0; Bacteria - 80; Metazoa - 438; Fungi - 191; Plants - 138; Viruses - 2; Other Eukaryotes - 421 (source: NCBI BLink).
AT2G33540.1TCACACGTC-TERMINAL DOMAIN PHOSPHATASE-LIKE 3 (CPL3); FUNCTIONS IN: phosphoprotein phosphatase activity, CTD phosphatase activity; INVOLVED IN: response to salt stress; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FCP1-like phosphatase, phosphatase domain (InterPro:IPR011947), NLI interacting factor (InterPro:IPR004274), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: CPL4 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 4); phosphoprotein phosphatase (TAIR:AT5G58003.1); Has 1270 Blast hits to 886 proteins in 180 species: Archae - 0; Bacteria - 80; Metazoa - 438; Fungi - 191; Plants - 138; Viruses - 2; Other Eukaryotes - 421 (source: NCBI BLink).
AT2G33700AT2G33700.1TGACACGTGTCGprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51470.1); Has 4375 Blast hits to 4330 proteins in 315 species: Archae - 3; Bacteria - 175; Metazoa - 1377; Fungi - 480; Plants - 1317; Viruses - 7; Other Eukaryotes - 1016 (source: NCBI BLink).
AT2G34250AT2G34250.1GACGTGGCAGprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink).
AT2G34250.2GACGTGGCAGprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink).
AT2G34260AT2G34260.1ACGTGGATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 55 (InterPro:IPR017422); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 16318 Blast hits to 9709 proteins in 465 species: Archae - 44; Bacteria - 3325; Metazoa - 6190; Fungi - 3093; Plants - 1110; Viruses - 0; Other Eukaryotes - 2556 (source: NCBI BLink).
AT2G34260.2ACGTGGATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), WD repeat protein 55 (InterPro:IPR017422); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 16318 Blast hits to 9709 proteins in 465 species: Archae - 44; Bacteria - 3325; Metazoa - 6190; Fungi - 3093; Plants - 1110; Viruses - 0; Other Eukaryotes - 2556 (source: NCBI BLink).
AT2G34430AT2G34430.1ACACGTCAGPhotosystem II type I chlorophyll a/b-binding protein
AT2G34460AT2G34460.1TTGCCACGTGGCGTflavin reductase-related; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT3G18890.1); Has 2946 Blast hits to 2906 proteins in 716 species: Archae - 28; Bacteria - 1803; Metazoa - 133; Fungi - 58; Plants - 295; Viruses - 0; Other Eukaryotes - 629 (source: NCBI BLink).
AT2G34600AT2G34600.1TACACGTGCGJASMONATE-ZIM-DOMAIN PROTEIN 7 (JAZ7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to jasmonic acid stimulus, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399); BEST Arabidopsis thaliana protein match is: JAZ8 (JASMONATE-ZIM-DOMAIN PROTEIN 8) (TAIR:AT1G30135.1); Has 16 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G34620AT2G34620.1GTGCCACGTGGAAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G03050.1); Has 469 Blast hits to 329 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).
AT2G34620.1GTGCCACGTGTTmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT2G03050.1); Has 469 Blast hits to 329 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 0; Plants - 400; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).
AT2G34650AT2G34650.1CACGTGACAEncodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID.
AT2G34650.1TCACACGTGTCATEncodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID.
AT2G34740AT2G34740.1GCTGACGTGTCGcatalytic/ protein serine/threonine phosphatase; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 5333 Blast hits to 5320 proteins in 675 species: Archae - 7; Bacteria - 1029; Metazoa - 1363; Fungi - 524; Plants - 1327; Viruses - 11; Other Eukaryotes - 1072 (source: NCBI BLink).
AT2G35260AT2G35260.1TCCACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17840.1); Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G35290AT2G35290.1TTGCCACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; Has 25 Blast hits to 25 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G35300AT2G35300.1CCACGTAGlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: cellular_component unknown; EXPRESSED IN: flower, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT1G32560.1); Has 110 Blast hits to 110 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G35300.1GTGACACGTAlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: cellular_component unknown; EXPRESSED IN: flower, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT1G32560.1); Has 110 Blast hits to 110 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G35300.1TACACGTGGTlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube development; LOCATED IN: cellular_component unknown; EXPRESSED IN: flower, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein (TAIR:AT1G32560.1); Has 110 Blast hits to 110 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G35620AT2G35620.1CACGTGTGEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT2G35620.1CGACACGTGTAEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT2G35680AT2G35680.1AACACGTGTCAdual specificity protein phosphatase family protein; FUNCTIONS IN: phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity; INVOLVED IN: protein amino acid dephosphorylation, dephosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein-tyrosine phosphatase, active site (InterPro:IPR016130), Protein-tyrosine phosphatase (InterPro:IPR000387), Protein-tyrosine phosphatase, dual specificity (InterPro:IPR000340); BEST Arabidopsis thaliana protein match is: dual specificity protein phosphatase family protein (TAIR:AT5G56610.1); Has 1622 Blast hits to 1620 proteins in 220 species: Archae - 34; Bacteria - 127; Metazoa - 962; Fungi - 94; Plants - 121; Viruses - 22; Other Eukaryotes - 262 (source: NCBI BLink).
AT2G35840AT2G35840.1TACACGTGsucrose-phosphatase 1 (SPP1); FUNCTIONS IN: phosphatase activity, magnesium ion binding, sucrose-phosphatase activity, catalytic activity; INVOLVED IN: response to cadmium ion, sucrose biosynthetic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sucrose-6F-phosphate phosphohydrolase, plant and cyanobacteria (InterPro:IPR006380), Sucrose-6-phosphate phosphohydrolase C-terminal (InterPro:IPR013679), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Sucrose phosphatase, plant and cyanobacteria (InterPro:IPR012847), Sucrose-phosphate phosphatase (InterPro:IPR006378); BEST Arabidopsis thaliana protein match is: SPP1 (SUCROSE-PHOSPHATASE 1); catalytic/ magnesium ion binding / phosphatase/ sucrose-phosphatase (TAIR:AT1G51420.1); Has 758 Blast hits to 754 proteins in 266 species: Archae - 0; Bacteria - 574; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT2G35840.2TACACGTGsucrose-phosphatase 1 (SPP1); FUNCTIONS IN: phosphatase activity, magnesium ion binding, sucrose-phosphatase activity, catalytic activity; INVOLVED IN: response to cadmium ion, sucrose biosynthetic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sucrose-6F-phosphate phosphohydrolase, plant and cyanobacteria (InterPro:IPR006380), Sucrose-6-phosphate phosphohydrolase C-terminal (InterPro:IPR013679), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Sucrose phosphatase, plant and cyanobacteria (InterPro:IPR012847), Sucrose-phosphate phosphatase (InterPro:IPR006378); BEST Arabidopsis thaliana protein match is: SPP1 (SUCROSE-PHOSPHATASE 1); catalytic/ magnesium ion binding / phosphatase/ sucrose-phosphatase (TAIR:AT1G51420.1); Has 758 Blast hits to 754 proteins in 266 species: Archae - 0; Bacteria - 574; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT2G35940AT2G35940.1AACACGTGEncodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm.
AT2G35940.2AACACGTGEncodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm.
AT2G35940.3AACACGTGEncodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm.
AT2G36120AT2G36120.1TGTGGGCCTCAACGTGTGAEncodes a glycine rich protein that is involved in leaf vascular patterning. dot1 mutants have an aberrant open-class venation pattern in leaves and cotyledons, as well as several other leaf development defects.
AT2G36145AT2G36145.1ACACGTCATCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast stroma, chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; Has 27 Blast hits to 27 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G36160AT2G36160.1ACGTGGAA40S ribosomal protein S14 (RPS14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane, chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971), Ribosomal S11, conserved site (InterPro:IPR018102); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S14 (RPS14B) (TAIR:AT3G11510.1); Has 6247 Blast hits to 6247 proteins in 1750 species: Archae - 169; Bacteria - 2829; Metazoa - 487; Fungi - 108; Plants - 517; Viruses - 0; Other Eukaryotes - 2137 (source: NCBI BLink).
AT2G36260AT2G36260.1TGACACGTiron-sulfur cluster assembly complex protein, putative; FUNCTIONS IN: iron-sulfur cluster binding, structural molecule activity; INVOLVED IN: iron-sulfur cluster assembly; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: FeS cluster biogenesis (InterPro:IPR000361), FeS cluster insertion (InterPro:IPR016092); BEST Arabidopsis thaliana protein match is: hesB-like domain-containing protein (TAIR:AT2G16710.1); Has 7479 Blast hits to 7478 proteins in 1103 species: Archae - 25; Bacteria - 3491; Metazoa - 208; Fungi - 122; Plants - 90; Viruses - 0; Other Eukaryotes - 3543 (source: NCBI BLink).
AT2G36290AT2G36290.1TACGTGGCTThydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G74300.1); Has 557 Blast hits to 555 proteins in 128 species: Archae - 11; Bacteria - 242; Metazoa - 0; Fungi - 39; Plants - 185; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT2G36305AT2G36305.1ACGTGGCACEncodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast.
AT2G36390AT2G36390.1TACACGTGGCAGEncodes a starch branching enzyme (EC. similar to SBE2 from maize and rice. Expressed throughout plant tissues.
AT2G36420AT2G36420.1TGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03670.1); Has 11237 Blast hits to 6364 proteins in 349 species: Archae - 8; Bacteria - 288; Metazoa - 5131; Fungi - 1107; Plants - 404; Viruses - 219; Other Eukaryotes - 4080 (source: NCBI BLink).
AT2G36490AT2G36490.1ACGTGGATA repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts.
AT2G36500AT2G36500.1AGACACGTCBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein (TAIR:AT3G52950.1); Has 4354 Blast hits to 3459 proteins in 798 species: Archae - 506; Bacteria - 2822; Metazoa - 4; Fungi - 86; Plants - 161; Viruses - 0; Other Eukaryotes - 775 (source: NCBI BLink).
AT2G36830AT2G36830.1CCGCCACGTAGencodes a tonoplast intrinsic protein, which functions as water channel. highly expressed in root, stem, cauline leaves and flowers. Complete knock out mutants have no detectable phenotype from the wild type.
AT2G36880AT2G36880.1AACACGTGAmethionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).
AT2G36880.2AACACGTGAmethionine adenosyltransferase 3 (MAT3); FUNCTIONS IN: copper ion binding, methionine adenosyltransferase activity; INVOLVED IN: one-carbon compound metabolic process, S-adenosylmethionine biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine synthetase (InterPro:IPR002133); BEST Arabidopsis thaliana protein match is: MTO3 (METHIONINE OVER-ACCUMULATOR 3); methionine adenosyltransferase (TAIR:AT3G17390.1); Has 8009 Blast hits to 8008 proteins in 1637 species: Archae - 6; Bacteria - 2990; Metazoa - 309; Fungi - 109; Plants - 502; Viruses - 0; Other Eukaryotes - 4093 (source: NCBI BLink).
AT2G36885AT2G36885.1GTCACGTGGGunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT2G36885.2GTCACGTGGGunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT2G36895AT2G36895.1CACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G36895.2CACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G37060AT2G37060.1TACACGTGGCGTNUCLEAR FACTOR Y, SUBUNIT B8 (NF-YB8); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB10 (NUCLEAR FACTOR Y, SUBUNIT B10); transcription factor (TAIR:AT3G53340.1); Has 989 Blast hits to 989 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 385; Fungi - 228; Plants - 296; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT2G37060.2TACACGTGGCGTNUCLEAR FACTOR Y, SUBUNIT B8 (NF-YB8); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB10 (NUCLEAR FACTOR Y, SUBUNIT B10); transcription factor (TAIR:AT3G53340.1); Has 989 Blast hits to 989 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 385; Fungi - 228; Plants - 296; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT2G37060.3TACACGTGGCGTNUCLEAR FACTOR Y, SUBUNIT B8 (NF-YB8); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus, intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Transcription factor, CBFA/NFYB, DNA topoisomerase (InterPro:IPR003957), Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072), Transcription factor, NFYB/HAP3, conserved site (InterPro:IPR003956); BEST Arabidopsis thaliana protein match is: NF-YB10 (NUCLEAR FACTOR Y, SUBUNIT B10); transcription factor (TAIR:AT3G53340.1); Has 989 Blast hits to 989 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 385; Fungi - 228; Plants - 296; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT2G37100AT2G37100.1ACGTGTGAprotamine P1 family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: chromosome organization; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03110.1); Has 239 Blast hits to 225 proteins in 58 species: Archae - 0; Bacteria - 5; Metazoa - 125; Fungi - 23; Plants - 48; Viruses - 12; Other Eukaryotes - 26 (source: NCBI BLink).
AT2G37210AT2G37210.1TCACGTGTGAEncodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950.
AT2G37250AT2G37250.1ATGCCACGTCAGencodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth
AT2G37250.1TACACGTGTCAencodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth
AT2G37550AT2G37550.1CACGTGACAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT2G37550.2CACGTGACAA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT2G37750AT2G37750.1ACGCCACGTGACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G37750.1ATGACGTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G37790AT2G37790.1GACGTGTCTaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37770.2); Has 14317 Blast hits to 14296 proteins in 1374 species: Archae - 187; Bacteria - 8146; Metazoa - 1861; Fungi - 1118; Plants - 723; Viruses - 0; Other Eukaryotes - 2282 (source: NCBI BLink).
AT2G37880AT2G37880.1TTCCACGTGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21050.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G37880.1TTCCACGTGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21050.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G38000AT2G38000.1TCACACGTGGCAATchaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT2G38040AT2G38040.1GTCACGTGGGCACGTGCGencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis
AT2G38040.1TCACACGTencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis
AT2G38040.2GTCACGTGGGCACGTGCGencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis
AT2G38040.2TCACACGTencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis
AT2G38130AT2G38130.1TGTCACGTGTGEncodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.
AT2G38130.2TGTCACGTGTGEncodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes.
AT2G38140AT2G38140.1CACACGTGACAplastid-specific ribosomal protein 4 (PSRP4) mRNA, complete
AT2G38210AT2G38210.1TTCCACGTCAPUTATIVE PDX1-LIKE PROTEIN 4 (PDX1L4); INVOLVED IN: response to ethylene stimulus, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Vitamin B6 biosynthesis protein (InterPro:IPR001852); BEST Arabidopsis thaliana protein match is: ATPDX1.1 (pyridoxine biosynthesis 1.1); protein heterodimerization (TAIR:AT2G38230.1); Has 1462 Blast hits to 1461 proteins in 499 species: Archae - 146; Bacteria - 735; Metazoa - 10; Fungi - 97; Plants - 79; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink).
AT2G38220AT2G38220.1TTCCACGTCAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G38195.1); Has 1929 Blast hits to 1925 proteins in 192 species: Archae - 0; Bacteria - 0; Metazoa - 1143; Fungi - 39; Plants - 257; Viruses - 180; Other Eukaryotes - 310 (source: NCBI BLink).
AT2G38560AT2G38560.1AGCCACGTGEncodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy.
AT2G38580AT2G38580.1CTACGTGGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65010.1); Has 59428 Blast hits to 34448 proteins in 1513 species: Archae - 407; Bacteria - 6232; Metazoa - 29606; Fungi - 3999; Plants - 1722; Viruses - 205; Other Eukaryotes - 17257 (source: NCBI BLink).
AT2G38620AT2G38620.1ACGTGTGAEncodes a member of a plant specific family of cyclin dependent kinases.
AT2G38620.2ACGTGTGAEncodes a member of a plant specific family of cyclin dependent kinases.
AT2G38650AT2G38650.1AGACACGTGTTGALACTURONOSYLTRANSFERASE 7 (GAUT7); FUNCTIONS IN: polygalacturonate 4-alpha-galacturonosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: GAUT4 (Galacturonosyltransferase 4); polygalacturonate 4-alpha-galacturonosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT5G47780.1); Has 882 Blast hits to 876 proteins in 179 species: Archae - 0; Bacteria - 255; Metazoa - 131; Fungi - 43; Plants - 430; Viruses - 2; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G38650.1CACACGTGTGAGALACTURONOSYLTRANSFERASE 7 (GAUT7); FUNCTIONS IN: polygalacturonate 4-alpha-galacturonosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: GAUT4 (Galacturonosyltransferase 4); polygalacturonate 4-alpha-galacturonosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT5G47780.1); Has 882 Blast hits to 876 proteins in 179 species: Archae - 0; Bacteria - 255; Metazoa - 131; Fungi - 43; Plants - 430; Viruses - 2; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G38740AT2G38740.1GTGACACGTGGCGAhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), Haloacid dehydrogenase/epoxide hydrolase (InterPro:IPR005833), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT1G56500.1); Has 10291 Blast hits to 10291 proteins in 1397 species: Archae - 137; Bacteria - 7267; Metazoa - 142; Fungi - 274; Plants - 203; Viruses - 3; Other Eukaryotes - 2265 (source: NCBI BLink).
AT2G38810AT2G38810.1CACGTGTCGTEncodes HTA8, a histone H2A protein.
AT2G38810.1GTACACGTGTGEncodes HTA8, a histone H2A protein.
AT2G38810.1TACGTGTCTEncodes HTA8, a histone H2A protein.
AT2G38810.2CACGTGTCGTEncodes HTA8, a histone H2A protein.
AT2G38810.2GTACACGTGTGEncodes HTA8, a histone H2A protein.
AT2G38810.2TACGTGTCTEncodes HTA8, a histone H2A protein.
AT2G38810.3CACGTGTCGTEncodes HTA8, a histone H2A protein.
AT2G38810.3GTACACGTGTGEncodes HTA8, a histone H2A protein.
AT2G38810.3TACGTGTCTEncodes HTA8, a histone H2A protein.
AT2G38820AT2G38820.1ACGACACGTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G38820.1AGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G38820.1CACACGTGTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G38820.2ACGACACGTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G38820.2AGACACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G38820.2CACACGTGTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 216 Blast hits to 216 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 214; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G39000AT2G39000.1ACGTGTGAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 213 Blast hits to 213 proteins in 77 species: Archae - 10; Bacteria - 116; Metazoa - 3; Fungi - 4; Plants - 54; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT2G39000.2ACGTGTGAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 213 Blast hits to 213 proteins in 77 species: Archae - 10; Bacteria - 116; Metazoa - 3; Fungi - 4; Plants - 54; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT2G39000.3ACGTGTGAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 213 Blast hits to 213 proteins in 77 species: Archae - 10; Bacteria - 116; Metazoa - 3; Fungi - 4; Plants - 54; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT2G39170AT2G39170.1ACGTGGACunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G39170.1AGACACGTGCGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G39170.1GATGACGTGGACunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G39270AT2G39270.1ATGACACGTGTTadenylate kinase family protein; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; CONTAINS InterPro DOMAIN/s: Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: ADK (ADENOSINE KINASE); adenylate kinase/ nucleotide kinase (TAIR:AT2G37250.1); Has 8604 Blast hits to 8484 proteins in 1852 species: Archae - 61; Bacteria - 4479; Metazoa - 995; Fungi - 287; Plants - 246; Viruses - 0; Other Eukaryotes - 2536 (source: NCBI BLink).
AT2G39280AT2G39280.1GTGACGTGGACRAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RabGAP/TBC domain-containing protein (TAIR:AT3G55020.1); Has 4701 Blast hits to 4645 proteins in 231 species: Archae - 15; Bacteria - 84; Metazoa - 2806; Fungi - 708; Plants - 245; Viruses - 9; Other Eukaryotes - 834 (source: NCBI BLink).
AT2G39430AT2G39430.1GTCCACGTdisease resistance-responsive protein-related / dirigent protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lignan biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: leaf apex, hypocotyl, root, petiole, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Plant disease resistance response protein (InterPro:IPR004265); BEST Arabidopsis thaliana protein match is: disease resistance-responsive family protein (TAIR:AT3G55230.1); Has 394 Blast hits to 394 proteins in 31 species: Archae - 2; Bacteria - 2; Metazoa - 0; Fungi - 2; Plants - 387; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G39450AT2G39450.1GTACACGTGTGEncodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn<sup>2+</sup> and Cu<sup>2+</sup> tolerance.
AT2G39570AT2G39570.1AGACACGTAGGTCCCACACT domain-containing protein; FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: ACT domain-containing protein (TAIR:AT2G36840.1); Has 256 Blast hits to 222 proteins in 28 species: Archae - 0; Bacteria - 28; Metazoa - 0; Fungi - 0; Plants - 199; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT2G39730AT2G39730.1TTCCACGTGGACRubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco.
AT2G39730.2TTCCACGTGGACRubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco.
AT2G39730.3TTCCACGTGGACRubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco.
AT2G39805AT2G39805.1TCACGTGTCCintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G39805.2TCACGTGTCCintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G39930AT2G39930.1AGCCACGTGEncodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex.
AT2G40120AT2G40120.1GTACACGTGTCAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G17750.1); Has 65627 Blast hits to 64489 proteins in 2041 species: Archae - 50; Bacteria - 5400; Metazoa - 28985; Fungi - 7798; Plants - 8456; Viruses - 355; Other Eukaryotes - 14583 (source: NCBI BLink).
AT2G40300AT2G40300.1GTACACGTGTCTEncodes FERRITIN 4, AtFER4. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool.
AT2G40420AT2G40420.1ATGCCACGTAEncodes a putative amino acid transporter.
AT2G40490AT2G40490.1ATCCACGTCAGCHEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink).
AT2G40490.1ATGACGTGGCAGHEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink).
AT2G40540AT2G40540.1TCACGTGTTputative potassium transporter AtKT2p (AtKT2) mRNA,
AT2G40540.2TCACGTGTTputative potassium transporter AtKT2p (AtKT2) mRNA,
AT2G40770AT2G40770.1AAGCCACGTCGATP binding / DNA binding / helicase/ nucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), SNF2-related (InterPro:IPR000330), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: RAD5; ATP binding / ATP-dependent helicase/ DNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / protein binding / zinc ion binding (TAIR:AT5G22750.1); Has 13590 Blast hits to 8685 proteins in 812 species: Archae - 59; Bacteria - 2742; Metazoa - 4195; Fungi - 3438; Plants - 951; Viruses - 102; Other Eukaryotes - 2103 (source: NCBI BLink).
AT2G40810AT2G40810.1AGACACGTGAAtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).
AT2G40810.2AGACACGTGAAtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).
AT2G40880AT2G40880.1AGACACGTGTCATEncodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmitic, cold stress).
AT2G40940AT2G40940.1AGGCCTATAACACGTGAEthylene receptor, subfamily 1. Has histidine kinase activity.
AT2G41040AT2G41040.1TGTCACGTmethyltransferase-related; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase-related (TAIR:AT1G78140.1); Has 4579 Blast hits to 4578 proteins in 1027 species: Archae - 190; Bacteria - 3325; Metazoa - 76; Fungi - 170; Plants - 189; Viruses - 0; Other Eukaryotes - 629 (source: NCBI BLink).
AT2G41110AT2G41110.1AACCGCGTGAACGTGTGAEncodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6.
AT2G41280AT2G41280.1GGACACGTGTAEncodes a hydrophilic protein similar to Late Embryogenesis Activated (LEA) proteins expressed during embryogenesis, which are thought to be involved in the acquisition of dessication tolerance.
AT2G41430AT2G41430.1TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.
AT2G41430.2TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.
AT2G41430.3TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.
AT2G41430.4TACACGTGGACEncodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2.
AT2G41620AT2G41620.1CTACGTGGnucleoporin interacting component family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoporin interacting component Nup93/Nic96 (InterPro:IPR007231); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57350.1); Has 274 Blast hits to 270 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 97; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT2G41790AT2G41790.1AAATGACGTGGCTpeptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT3G57470.2); Has 5997 Blast hits to 5925 proteins in 1223 species: Archae - 5; Bacteria - 3363; Metazoa - 558; Fungi - 370; Plants - 146; Viruses - 3; Other Eukaryotes - 1552 (source: NCBI BLink).
AT2G41840AT2G41840.1ACGTGTGA40S ribosomal protein S2 (RPS2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 9044 Blast hits to 7622 proteins in 1716 species: Archae - 183; Bacteria - 3055; Metazoa - 2026; Fungi - 746; Plants - 385; Viruses - 17; Other Eukaryotes - 2632 (source: NCBI BLink).
AT2G41900AT2G41900.1ATGACGTGGACzinc finger (CCCH-type) family protein; FUNCTIONS IN: transcription factor activity, nucleic acid binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT5G12850.1); Has 4817 Blast hits to 2898 proteins in 270 species: Archae - 2; Bacteria - 179; Metazoa - 2413; Fungi - 222; Plants - 261; Viruses - 8; Other Eukaryotes - 1732 (source: NCBI BLink).
AT2G42220AT2G42220.1TACGTGGCAATrhodanese-like domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rhodanese-like (InterPro:IPR001763); BEST Arabidopsis thaliana protein match is: rhodanese-like domain-containing protein (TAIR:AT3G08920.1); Has 686 Blast hits to 686 proteins in 102 species: Archae - 12; Bacteria - 169; Metazoa - 1; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).
AT2G42270AT2G42270.1CGCACGTGTCAU5 small nuclear ribonucleoprotein helicase, putative; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: emb1507 (embryo defective 1507); ATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G20960.1); Has 13381 Blast hits to 8246 proteins in 1082 species: Archae - 1064; Bacteria - 4051; Metazoa - 2407; Fungi - 1500; Plants - 518; Viruses - 50; Other Eukaryotes - 3791 (source: NCBI BLink).
AT2G42490AT2G42490.1ATCCACGTCGTTcopper amine oxidase, putative; FUNCTIONS IN: quinone binding, amine oxidase activity, copper ion binding; INVOLVED IN: cellular amine metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Copper amine oxidase, N-terminal region (InterPro:IPR016182), Copper amine oxidase, N2-terminal (InterPro:IPR015800), Copper amine oxidase, N2/N3-terminal (InterPro:IPR015801), Copper amine oxidase, N3-terminal (InterPro:IPR015802), Copper amine oxidase (InterPro:IPR000269), Copper amine oxidase, C-terminal (InterPro:IPR015798); BEST Arabidopsis thaliana protein match is: copper amine oxidase, putative (TAIR:AT3G43670.1); Has 1087 Blast hits to 1084 proteins in 164 species: Archae - 4; Bacteria - 240; Metazoa - 211; Fungi - 291; Plants - 130; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink).
AT2G42540AT2G42540.1TACACGTGGCA cold-regulated gene whose product is targeted to the chloroplast and constitutive expression increases freezing tolerance in protoplasts in vitro and chloroplasts in vivo. NMR and x-ray diffraction studies suggest that COR15a alters the intrinsic curvature of the inner membrane of chloroplast envelope.
AT2G42540.2TACACGTGGCA cold-regulated gene whose product is targeted to the chloroplast and constitutive expression increases freezing tolerance in protoplasts in vitro and chloroplasts in vivo. NMR and x-ray diffraction studies suggest that COR15a alters the intrinsic curvature of the inner membrane of chloroplast envelope.
AT2G42560AT2G42560.1TCCACGTGlate embryogenesis abundant domain-containing protein / LEA domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein (InterPro:IPR004238); BEST Arabidopsis thaliana protein match is: ATECP63 (EMBRYONIC CELL PROTEIN 63) (TAIR:AT2G36640.1); Has 12374 Blast hits to 7501 proteins in 1066 species: Archae - 63; Bacteria - 4676; Metazoa - 2087; Fungi - 744; Plants - 1442; Viruses - 129; Other Eukaryotes - 3233 (source: NCBI BLink).
AT2G42750AT2G42750.1TGACACGTGCCACGDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink).
AT2G42750.1TTGCCACGTCAGCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink).
AT2G42790AT2G42790.1TACACGTGGATEncodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.
AT2G43120AT2G43120.1GTGACGTGpirin, putative; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: stem, flower; CONTAINS InterPro DOMAIN/s: Pirin, C-terminal (InterPro:IPR008778), Pirin (InterPro:IPR012093), Cupin, RmlC-type (InterPro:IPR011051), Pirin, N-terminal (InterPro:IPR003829); BEST Arabidopsis thaliana protein match is: PRN (PIRIN); calmodulin binding (TAIR:AT3G59220.1); Has 5405 Blast hits to 5403 proteins in 856 species: Archae - 43; Bacteria - 2852; Metazoa - 62; Fungi - 147; Plants - 68; Viruses - 0; Other Eukaryotes - 2233 (source: NCBI BLink).
AT2G43140AT2G43140.1ACCACGTGDNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G05805.1); Has 937 Blast hits to 923 proteins in 54 species: Archae - 0; Bacteria - 2; Metazoa - 50; Fungi - 2; Plants - 870; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G43140.1CACGTGCGDNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G05805.1); Has 937 Blast hits to 923 proteins in 54 species: Archae - 0; Bacteria - 2; Metazoa - 50; Fungi - 2; Plants - 870; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G43180AT2G43180.1CACGTGACAcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).
AT2G43180.2CACGTGACAcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).
AT2G43180.3CACGTGACAcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).
AT2G43180.4CACGTGACAcatalytic; FUNCTIONS IN: catalytic activity; LOCATED IN: chloroplast; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 4169 Blast hits to 4169 proteins in 637 species: Archae - 48; Bacteria - 1660; Metazoa - 19; Fungi - 112; Plants - 58; Viruses - 0; Other Eukaryotes - 2272 (source: NCBI BLink).
AT2G43240AT2G43240.1ACCACGTGTCAnucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT2G43240.1ATGACACGTCAGCnucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT2G43240.2ACCACGTGTCAnucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT2G43240.2ATGACACGTCAGCnucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: integral to membrane, Golgi membrane; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271); BEST Arabidopsis thaliana protein match is: UTR6 (UDP-GALACTOSE TRANSPORTER 6); nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G59360.2); Has 741 Blast hits to 731 proteins in 121 species: Archae - 0; Bacteria - 8; Metazoa - 477; Fungi - 76; Plants - 94; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT2G43320AT2G43320.1ACGTGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14000.1); Has 199 Blast hits to 194 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 98; Fungi - 25; Plants - 44; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).
AT2G43320.2ACGTGTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14000.1); Has 199 Blast hits to 194 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 98; Fungi - 25; Plants - 44; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).
AT2G43330AT2G43330.1TACACGTGTAEncodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium.
AT2G43330.1TCGCCACGTGTAEncodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium.
AT2G43400AT2G43400.1TTGCCACGTCATCEncodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods.
AT2G43550AT2G43550.1GTGACGTGTGAEncodes a defensin-like (DEFL) family protein.
AT2G43600AT2G43600.1TGTCACGTGglycoside hydrolase family 19 protein; FUNCTIONS IN: chitin binding, chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, sperm cell, root; CONTAINS InterPro DOMAIN/s: Chitin-binding, type 1, conserved site (InterPro:IPR018371), Glycoside hydrolase, family 19 (InterPro:IPR016283), Chitin-binding, type 1 (InterPro:IPR001002), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 19 protein (TAIR:AT1G56680.1); Has 1226 Blast hits to 1219 proteins in 250 species: Archae - 0; Bacteria - 187; Metazoa - 13; Fungi - 13; Plants - 976; Viruses - 1; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G43945AT2G43945.1TCACACGTGTGAunknown protein; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59870.1); Has 245 Blast hits to 245 proteins in 63 species: Archae - 0; Bacteria - 102; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).
AT2G44110AT2G44110.1AGACACGTA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT2G44110.2AGACACGTA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT2G44140AT2G44140.1TTCCACGTautophagy 4a (APG4a); FUNCTIONS IN: peptidase activity; INVOLVED IN: autophagy; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Peptidase C54 (InterPro:IPR005078); BEST Arabidopsis thaliana protein match is: autophagy 4b (APG4b) (TAIR:AT3G59950.1); Has 685 Blast hits to 659 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 373; Fungi - 125; Plants - 57; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).
AT2G44140.2TTCCACGTautophagy 4a (APG4a); FUNCTIONS IN: peptidase activity; INVOLVED IN: autophagy; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Peptidase C54 (InterPro:IPR005078); BEST Arabidopsis thaliana protein match is: autophagy 4b (APG4b) (TAIR:AT3G59950.1); Has 685 Blast hits to 659 proteins in 158 species: Archae - 0; Bacteria - 0; Metazoa - 373; Fungi - 125; Plants - 57; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).
AT2G44360AT2G44360.1CCACGTCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G44440AT2G44440.1AACACGTGGCTemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G13020.1); Has 355 Blast hits to 341 proteins in 54 species: Archae - 0; Bacteria - 6; Metazoa - 159; Fungi - 14; Plants - 166; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT2G44525AT2G44525.1TGACGTGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF498 (InterPro:IPR007523); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G60150.1); Has 656 Blast hits to 656 proteins in 282 species: Archae - 0; Bacteria - 346; Metazoa - 107; Fungi - 59; Plants - 38; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink).
AT2G44578AT2G44578.1CCCACGTGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G44581.1); Has 6429 Blast hits to 6413 proteins in 213 species: Archae - 0; Bacteria - 6; Metazoa - 2026; Fungi - 558; Plants - 2747; Viruses - 34; Other Eukaryotes - 1058 (source: NCBI BLink).
AT2G44600AT2G44600.1ACGTGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G60200.1); Has 34 Blast hits to 34 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G44610AT2G44610.1ATGACACGTGEncodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant.
AT2G44970AT2G44970.1TACACGTGTTlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G44970.1TTCCACGTlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G44970.2TACACGTGTTlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G44970.2TTCCACGTlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G45000AT2G45000.1ACGTGGACEMBRYO DEFECTIVE 2766 (EMB2766); FUNCTIONS IN: structural constituent of nuclear pore; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, nuclear pore; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nsp1-like, C-terminal (InterPro:IPR007758); Has 196388 Blast hits to 74057 proteins in 2349 species: Archae - 657; Bacteria - 41194; Metazoa - 62656; Fungi - 37422; Plants - 6443; Viruses - 2462; Other Eukaryotes - 45554 (source: NCBI BLink).
AT2G45000.1GTACACGTCATCEMBRYO DEFECTIVE 2766 (EMB2766); FUNCTIONS IN: structural constituent of nuclear pore; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, nuclear pore; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nsp1-like, C-terminal (InterPro:IPR007758); Has 196388 Blast hits to 74057 proteins in 2349 species: Archae - 657; Bacteria - 41194; Metazoa - 62656; Fungi - 37422; Plants - 6443; Viruses - 2462; Other Eukaryotes - 45554 (source: NCBI BLink).
AT2G45010AT2G45010.1AAAACGACGACGTGGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51400.1); Has 322 Blast hits to 321 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 15; Plants - 299; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G45010.2AAAACGACGACGTGGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51400.1); Has 322 Blast hits to 321 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 15; Plants - 299; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G45170AT2G45170.1ACACGTCAGCInvolved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.
AT2G45170.1GCTGACGTGTCTInvolved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.
AT2G45170.2ACACGTCAGCInvolved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.
AT2G45170.2GCTGACGTGTCTInvolved in autophagy. Under nutrient starvation the protein localizes to autophagosomes.
AT2G45220AT2G45220.1ACACGTCApectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: membrane, plant-type cell wall; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Carbohydrate-binding and sugar hydrolysis (InterPro:IPR006633), Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT5G51490.1); Has 1304 Blast hits to 1273 proteins in 193 species: Archae - 0; Bacteria - 259; Metazoa - 1; Fungi - 134; Plants - 899; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT2G45300AT2G45300.1AACACGTGTCATencodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis
AT2G45630AT2G45630.1ACGTGTCGToxidoreductase family protein; FUNCTIONS IN: NAD or NADH binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, binding, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19514 Blast hits to 19508 proteins in 1512 species: Archae - 283; Bacteria - 9436; Metazoa - 661; Fungi - 754; Plants - 319; Viruses - 5; Other Eukaryotes - 8056 (source: NCBI BLink).
AT2G45630.2ACGTGTCGToxidoreductase family protein; FUNCTIONS IN: NAD or NADH binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, binding, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19514 Blast hits to 19508 proteins in 1512 species: Archae - 283; Bacteria - 9436; Metazoa - 661; Fungi - 754; Plants - 319; Viruses - 5; Other Eukaryotes - 8056 (source: NCBI BLink).
AT2G45680AT2G45680.1CACGTGGTTCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G51910.2); Has 1037 Blast hits to 398 proteins in 90 species: Archae - 0; Bacteria - 18; Metazoa - 101; Fungi - 57; Plants - 215; Viruses - 0; Other Eukaryotes - 646 (source: NCBI BLink).
AT2G45730AT2G45730.1ACCACGTGGCACeukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).
AT2G45730.1TTCCACGTGGATeukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).
AT2G45740AT2G45740.1ATCCACGTGGAAmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT2G45740.1GTGCCACGTGGTmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT2G45740.2ATCCACGTGGAAmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT2G45740.2GTGCCACGTGGTmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT2G45740.3ATCCACGTGGAAmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT2G45740.3GTGCCACGTGGTmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT2G45820AT2G45820.1GTGACGTGGCATDNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / remorin family protein (TAIR:AT3G61260.1); Has 2170 Blast hits to 1469 proteins in 249 species: Archae - 2; Bacteria - 278; Metazoa - 371; Fungi - 179; Plants - 300; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink).
AT2G45820.1TCACGTGTADNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / remorin family protein (TAIR:AT3G61260.1); Has 2170 Blast hits to 1469 proteins in 249 species: Archae - 2; Bacteria - 278; Metazoa - 371; Fungi - 179; Plants - 300; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink).
AT2G45980AT2G45980.1AAGCCACGTGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00355.3); Has 57 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46020AT2G46020.1TCACACGTGTCTEncodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.
AT2G46020.2TCACACGTGTCTEncodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.
AT2G46110AT2G46110.1CACGTCATCTCACACGTGTGEncodes a ketopentoate hydroxymethyltransferase that appears to localize to the mitochondria. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis.
AT2G46170AT2G46170.1GGACACGTGTCGTreticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT2G46170.2GGACACGTGTCGTreticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT2G46230AT2G46230.1AACACGTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).
AT2G46230.2AACACGTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink).
AT2G46500AT2G46500.1AGACACGTGTCCphosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink).
AT2G46500.2AGACACGTGTCCphosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein / ubiquitin family protein (TAIR:AT5G24240.1); Has 9099 Blast hits to 3359 proteins in 560 species: Archae - 0; Bacteria - 10; Metazoa - 3779; Fungi - 1061; Plants - 2175; Viruses - 263; Other Eukaryotes - 1811 (source: NCBI BLink).
AT2G46535AT2G46535.1GTGACGTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61840.1); Has 22 Blast hits to 22 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46550AT2G46550.1TCGCCACGTGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01240.3); Has 47 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46600AT2G46600.1ACGTGACAcalcium-binding protein, putative; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: PBP1 (PINOID-BINDING PROTEIN 1); calcium ion binding / protein binding (TAIR:AT5G54490.1); Has 2155 Blast hits to 2154 proteins in 355 species: Archae - 0; Bacteria - 4; Metazoa - 957; Fungi - 168; Plants - 633; Viruses - 0; Other Eukaryotes - 393 (source: NCBI BLink).
AT2G46790AT2G46790.1AAGCCACGTCAGCPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.
AT2G46790.1ATGACACGTGTTPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.
AT2G46790.1CCCACGTGTCATPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.
AT2G46790.2AAGCCACGTCAGCPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.
AT2G46790.2ATGACACGTGTTPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.
AT2G46790.2CCCACGTGTCATPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay.
AT2G46800AT2G46800.1AAAACGGCCACGTGTTEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis.
AT2G46800.2AAAACGGCCACGTGTTEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis.
AT2G46820AT2G46820.1CCGCCACGTCAGCEncodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits.
AT2G46820.2CCGCCACGTCAGCEncodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits.
AT2G46850AT2G46850.1CGACACGTCAGATP binding / protein kinase/ protein tyrosine kinase; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G23450.2); Has 14254 Blast hits to 14061 proteins in 404 species: Archae - 0; Bacteria - 73; Metazoa - 2017; Fungi - 136; Plants - 11571; Viruses - 17; Other Eukaryotes - 440 (source: NCBI BLink).
AT2G46910AT2G46910.1CTGCCACGTAplastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 169 Blast hits to 169 proteins in 57 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 120; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G47180AT2G47180.1TACACGTGTACArabidopsis thaliana galactinol synthase 1 (AtGolS1); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, carbohydrate biosynthetic process, response to heat; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 818 Blast hits to 817 proteins in 194 species: Archae - 0; Bacteria - 56; Metazoa - 224; Fungi - 185; Plants - 235; Viruses - 68; Other Eukaryotes - 50 (source: NCBI BLink).
AT2G47200AT2G47200.1TTCCACGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G47350AT2G47350.1CACACGTGTCTPAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT1G56460.1); Has 2885 Blast hits to 2186 proteins in 266 species: Archae - 7; Bacteria - 140; Metazoa - 1186; Fungi - 340; Plants - 134; Viruses - 23; Other Eukaryotes - 1055 (source: NCBI BLink).
AT2G47350.2CACACGTGTCTPAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT1G56460.1); Has 2885 Blast hits to 2186 proteins in 266 species: Archae - 7; Bacteria - 140; Metazoa - 1186; Fungi - 340; Plants - 134; Viruses - 23; Other Eukaryotes - 1055 (source: NCBI BLink).
AT2G47380AT2G47380.1TGACACGTcytochrome c oxidase subunit Vc family protein / COX5C family protein; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase subunit Vc (InterPro:IPR008432); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit Vc, putative / COX5C, putative (TAIR:AT5G61310.4); Has 60 Blast hits to 60 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G47400AT2G47400.1GTACACGTGGCAACP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The annotation of this gene is based on article 32494.
AT2G47460AT2G47460.1ACGTGGCG"MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. " The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots.
AT2G47460.1CACACGTGTCAT"MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain mi