version

Summary of RCCGAC (All list)

Organism Arabidopsis thaliana
PLACE Motif RCCGAC
Description Core motif of DRE/CRT (dehydration-responsive element/C-repeat) cis-acting element found in many genes in Arabidopsis and in rice; R=G/A; Os DREB1A bound to GCCGAC more preferentially than to ACCGAC whereas At DREB1A bound to both GCCGAC and ACCGAC efficiently; See S000402 (ACCGAC); Maize ZmDREB1A bound to DRE (Qin et al. 2004); HaDREB2 in Helianthus annuus (sunflower)(Diaz-Martin et al. 2005); HaDREB2 physically interact with HaHSFA9 in vitro (Diaz-Martin et al. 2005);
Total Entry Count 178

Entry Sequences (178 entries)

LocusGene modelSequenceDescription
AT1G01470AT1G01470.1GACCGACTEncodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against dessication.
AT1G02410AT1G02410.1AACCGACTcytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink).
AT1G05340AT1G05340.1ATAAACCGACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 122 Blast hits to 122 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 16; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G07360AT1G07360.1AACCGACTzinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT2G29580.1); Has 15841 Blast hits to 11209 proteins in 616 species: Archae - 12; Bacteria - 933; Metazoa - 6494; Fungi - 2796; Plants - 2983; Viruses - 266; Other Eukaryotes - 2357 (source: NCBI BLink).
AT1G07370AT1G07370.1AGTCGGTTEncodes putative proliferating cell nuclear antigen involved in cell cycle regulation.
AT1G07940AT1G07940.1GACCGACTelongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).
AT1G07940.2GACCGACTelongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).
AT1G08490AT1G08490.1AGTCGGTTGAACCGGTChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation.
AT1G08510AT1G08510.1AACCGACTEncodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer.
AT1G08570AT1G08570.1GACCGACTEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08570.2GACCGACTEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08570.3GACCGACTEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08570.4GACCGACTEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT1G08720AT1G08720.1AGTCGGTTCGGenhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum
AT1G08840AT1G08840.1GACCGACTTAembryo defective 2411 (emb2411); FUNCTIONS IN: ATP-dependent DNA helicase activity, DNA binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, DNA replication; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA replication factor Dna2 (InterPro:IPR014808); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G03270.1); Has 4081 Blast hits to 3639 proteins in 571 species: Archae - 158; Bacteria - 979; Metazoa - 1088; Fungi - 747; Plants - 269; Viruses - 30; Other Eukaryotes - 810 (source: NCBI BLink).
AT1G08845AT1G08845.1TAAGTCGGTCstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: endomembrane system, ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G22450.1).
AT1G09070AT1G09070.1TTAAACCGACTSRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting.
AT1G09760AT1G09760.1TTATGGGCCTAACCGACTGGGCCAATU2 small nuclear ribonucleoprotein A (U2A'); FUNCTIONS IN: protein binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae - 0; Bacteria - 1581; Metazoa - 2979; Fungi - 220; Plants - 106; Viruses - 2; Other Eukaryotes - 591 (source: NCBI BLink).
AT1G09770AT1G09770.1ATTGGCCCAGTCGGTTAGGCCCATAAMember of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1.
AT1G09870AT1G09870.1AACCGACThistidine acid phosphatase family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Histidine acid phosphatase, eukaryotic (InterPro:IPR016274); Has 574 Blast hits to 569 proteins in 162 species: Archae - 0; Bacteria - 75; Metazoa - 167; Fungi - 277; Plants - 29; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G11820AT1G11820.1AGTCGGTTcatalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein / beta-1,3-glucanase, putative (TAIR:AT2G01630.2); Has 1386 Blast hits to 1376 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1383; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G13120AT1G13120.1TTAAACCGACTembryo defective 1745 (emb1745); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nuclear pore; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GLE1-like (InterPro:IPR012476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G05523.1); Has 32122 Blast hits to 20275 proteins in 1392 species: Archae - 166; Bacteria - 5743; Metazoa - 12337; Fungi - 2633; Plants - 1041; Viruses - 221; Other Eukaryotes - 9981 (source: NCBI BLink).
AT1G13250AT1G13250.1AGTCGGTTEncodes a protein with putative galacturonosyltransferase activity.
AT1G14000AT1G14000.1AGTCGGTCEncodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling.
AT1G16010AT1G16010.1AGTCGGTCmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G16010.2AGTCGGTCmagnesium transporter CorA-like family protein (MRS2-1); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MGT1) (MRS2) (TAIR:AT1G80900.1); Has 465 Blast hits to 459 proteins in 113 species: Archae - 2; Bacteria - 12; Metazoa - 57; Fungi - 136; Plants - 199; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G17070AT1G17070.1ATAAAGCCCAAGTCGGTTD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G17080AT1G17080.1AGTCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53560.1); Has 71 Blast hits to 71 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17490AT1G17490.1AGTCGGTTCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72690.1); Has 29 Blast hits to 23 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20140AT1G20140.1ATAAACCGACTARABIDOPSIS SKP1-LIKE 4 (ASK4); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: SCF ubiquitin ligase complex, nucleolus, nucleus, cytoplasm; EXPRESSED IN: inflorescence meristem, male gametophyte, valve, septum, seed; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK3 (ARABIDOPSIS SKP1-LIKE 3); protein binding / ubiquitin-protein ligase (TAIR:AT2G25700.1); Has 1096 Blast hits to 1094 proteins in 198 species: Archae - 0; Bacteria - 0; Metazoa - 499; Fungi - 112; Plants - 354; Viruses - 11; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G20960AT1G20960.1AGTCGGTTembryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink).
AT1G22985AT1G22985.1AACCGACTencodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
AT1G22985.1TAAGTCGGTTencodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
AT1G28200AT1G28200.1GACCGACTVirF-interacting protein FIP1
AT1G31870AT1G31870.1GACCGACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2050, pre-mRNA-splicing factor (InterPro:IPR018609); Has 11793 Blast hits to 8312 proteins in 386 species: Archae - 8; Bacteria - 320; Metazoa - 6710; Fungi - 1763; Plants - 711; Viruses - 126; Other Eukaryotes - 2155 (source: NCBI BLink).
AT1G31870.2GACCGACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2050, pre-mRNA-splicing factor (InterPro:IPR018609); Has 11793 Blast hits to 8312 proteins in 386 species: Archae - 8; Bacteria - 320; Metazoa - 6710; Fungi - 1763; Plants - 711; Viruses - 126; Other Eukaryotes - 2155 (source: NCBI BLink).
AT1G32130AT1G32130.1AGTCGGTTCAAACGACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TFIIS N-terminal (InterPro:IPR017923), IWS1, C-terminal (InterPro:IPR008654); BEST Arabidopsis thaliana protein match is: IWS1 C-terminus family protein (TAIR:AT4G19000.1); Has 907 Blast hits to 871 proteins in 182 species: Archae - 4; Bacteria - 14; Metazoa - 417; Fungi - 195; Plants - 42; Viruses - 8; Other Eukaryotes - 227 (source: NCBI BLink).
AT1G32860AT1G32860.1AACCGACTglycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: ATBG_PAP; glucan endo-1,3-beta-D-glucosidase/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT5G42100.2); Has 1388 Blast hits to 1375 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1382; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G53460AT1G53460.1AGTCGGTTunknown protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 448 Blast hits to 373 proteins in 72 species: Archae - 10; Bacteria - 15; Metazoa - 142; Fungi - 20; Plants - 53; Viruses - 2; Other Eukaryotes - 206 (source: NCBI BLink).
AT1G57700AT1G57700.1AACCGACTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G09600.1); Has 86309 Blast hits to 85244 proteins in 2596 species: Archae - 42; Bacteria - 7073; Metazoa - 37056; Fungi - 7956; Plants - 17619; Viruses - 388; Other Eukaryotes - 16175 (source: NCBI BLink).
AT1G57750AT1G57750.1AACCGACTEncodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis.
AT1G57750.2AACCGACTEncodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis.
AT1G61450AT1G61450.1AGTCGGTTCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61415.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G62730AT1G62730.1AACCGACTtransferase; FUNCTIONS IN: transferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Terpenoid synthase (InterPro:IPR008949), Squalene/phytoene synthase (InterPro:IPR002060); Has 671 Blast hits to 669 proteins in 308 species: Archae - 0; Bacteria - 381; Metazoa - 94; Fungi - 65; Plants - 24; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).
AT1G62740AT1G62740.1AGTCGGTTstress-inducible protein, putative; FUNCTIONS IN: binding; INVOLVED IN: response to stress; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G12270.1); Has 34012 Blast hits to 14045 proteins in 887 species: Archae - 1292; Bacteria - 9292; Metazoa - 8243; Fungi - 1967; Plants - 2227; Viruses - 4; Other Eukaryotes - 10987 (source: NCBI BLink).
AT1G65020AT1G65020.1TTGAACCGACTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NERD (InterPro:IPR011528); Has 53 Blast hits to 53 proteins in 19 species: Archae - 0; Bacteria - 18; Metazoa - 9; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G65030AT1G65030.1AGTCGGTTCAAThis gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT1G67960AT1G67960.1CTAAACCGAACCGAACCGACTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G75510AT1G75510.1AGTCGGTCCACGTtranscription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G75950AT1G75950.1GACCGACTTASKP1 is core component of the SCF family of E3 ubiquitin ligases and serves to tether the rest of the complex to an F-box protein, which provides specificity in binding to ubiquitin ligase substrate proteins. Predominately expressed from leptotene to pachytene. Negatively regulates recombination. Interacts with P0, a silencing suppressor protein encoded by poleroviruses by means of a conserved minimal F-box motif.
AT1G77080AT1G77080.2AACCGACTMADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
AT1G77080.4AACCGACTMADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
AT1G77080.5AACCGACTMADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
AT1G77180AT1G77180.1TTAAACCGACTTAEncodes a protein with a putative role in mRNA splicing.
AT1G77180.2TTAAACCGACTTAEncodes a protein with a putative role in mRNA splicing.
AT1G80410AT1G80410.1TAAGTCGGTTEMBRYO DEFECTIVE 2753 (EMB2753); FUNCTIONS IN: binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 3255 Blast hits to 2440 proteins in 375 species: Archae - 356; Bacteria - 819; Metazoa - 489; Fungi - 174; Plants - 61; Viruses - 3; Other Eukaryotes - 1353 (source: NCBI BLink).
AT2G19080AT2G19080.1AACCCGACCGACTmetaxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein targeting to mitochondrion; LOCATED IN: mitochondrial outer membrane, mitochondrion, mitochondrial inner membrane, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metaxin (InterPro:IPR017410); Has 384 Blast hits to 384 proteins in 77 species: Archae - 0; Bacteria - 46; Metazoa - 295; Fungi - 14; Plants - 20; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT2G21440AT2G21440.1AGTCGGTTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: SCL28; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT5G18810.1); Has 29840 Blast hits to 16953 proteins in 878 species: Archae - 28; Bacteria - 2817; Metazoa - 13587; Fungi - 3327; Plants - 3239; Viruses - 21; Other Eukaryotes - 6821 (source: NCBI BLink).
AT2G21660AT2G21660.1GTAAACCGACTEncodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).
AT2G21660.2GTAAACCGACTEncodes a small glycine-rich RNA binding protein that is part of a negative-feedback loop through which AtGRP7 regulates the circadian oscillations of its own transcript. Gene expression is induced by cold. GRP7 appears to promote stomatal opening and reduce tolerance under salt and dehydration stress conditions, but, promotes stomatal closing and thereby increases stress tolerance under conditions of cold tolerance. Loss of function mutations have increased susceptibility to pathogens suggesting a role in mediating innate immune response. Mutants are also late flowering in a non-photoperiodic manner and are responsive to vernalization suggesting an interaction with the autonomous flowering pathway. There is a reduction of mRNA export from the nucleus in grp7 mutants. GRP7:GFP fusion proteins can be found in the cytosol and nucleus. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).
AT2G22100AT2G22100.1AACCGACTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G19380.1); Has 51803 Blast hits to 27594 proteins in 1051 species: Archae - 78; Bacteria - 2768; Metazoa - 24658; Fungi - 5025; Plants - 3290; Viruses - 216; Other Eukaryotes - 15768 (source: NCBI BLink).
AT2G22120AT2G22120.1AGTCGGTTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G11020.1); Has 1022 Blast hits to 1003 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 474; Fungi - 121; Plants - 181; Viruses - 28; Other Eukaryotes - 218 (source: NCBI BLink).
AT2G22125AT2G22125.1AACCGACTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Armadillo (InterPro:IPR000225), C2 membrane targeting protein (InterPro:IPR018029), Armadillo-type fold (InterPro:IPR016024), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G77460.1); Has 4878 Blast hits to 2097 proteins in 211 species: Archae - 4; Bacteria - 40; Metazoa - 1542; Fungi - 619; Plants - 2223; Viruses - 0; Other Eukaryotes - 450 (source: NCBI BLink).
AT2G29670AT2G29670.1AGTCGGTTbinding; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT1G07280.3); Has 351 Blast hits to 210 proteins in 32 species: Archae - 10; Bacteria - 88; Metazoa - 2; Fungi - 0; Plants - 203; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT2G35900AT2G35900.1TAAGTCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G36640AT2G36640.1AACCGACTEncodes putative phosphotyrosine protein belonging to late embryogenesis abundant (LEA) protein in group 3 that might be involved in maturation and desiccation tolerance of seeds. RFLP and CAPS mapping place it on chromosome 4 but the nucleotide sequence maps it to chromosome 2.
AT2G37340AT2G37340.1AGTCGGTTencodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks.
AT2G39780AT2G39780.1GACCGACTS-like ribonuclease
AT2G39780.2GACCGACTS-like ribonuclease
AT2G40240AT2G40240.1AGTCGGTTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56030.1); Has 9083 Blast hits to 2533 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 21; Plants - 8812; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink).
AT2G40810AT2G40810.1AACCGACTAtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).
AT2G40810.2AACCGACTAtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).
AT2G43250AT2G43250.1AACCGACTunknown protein; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46520AT2G46520.1AATAGCCCATTTAACCGACTTAcellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), CAS/CSE, C-terminal (InterPro:IPR005043), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Exportin, Cse1-like (InterPro:IPR013713); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G59020.2); Has 841 Blast hits to 834 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 412; Fungi - 251; Plants - 70; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT2G46970AT2G46970.1AACCGACTencodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family.
AT3G06670AT3G06670.1CGAACCGACTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024), Protein of unknown function DUF625 (InterPro:IPR006887); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49390.1); Has 2798 Blast hits to 2244 proteins in 244 species: Archae - 0; Bacteria - 63; Metazoa - 1367; Fungi - 471; Plants - 155; Viruses - 18; Other Eukaryotes - 724 (source: NCBI BLink).
AT3G08030AT3G08030.1AGTCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41800.1); Has 178 Blast hits to 157 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 176; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G08030.2AGTCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41800.1); Has 178 Blast hits to 157 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 176; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G09440AT3G09440.1GACCGACTheat shock cognate 70 kDa protein 3 (HSC70-3) (HSP70-3); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to heat; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24859 Blast hits to 24560 proteins in 3087 species: Archae - 103; Bacteria - 9593; Metazoa - 3143; Fungi - 1202; Plants - 719; Viruses - 241; Other Eukaryotes - 9858 (source: NCBI BLink).
AT3G09440.1GACCGACTheat shock cognate 70 kDa protein 3 (HSC70-3) (HSP70-3); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to heat; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24859 Blast hits to 24560 proteins in 3087 species: Archae - 103; Bacteria - 9593; Metazoa - 3143; Fungi - 1202; Plants - 719; Viruses - 241; Other Eukaryotes - 9858 (source: NCBI BLink).
AT3G11397AT3G11397.1AGTCGGTTPRENYLATED RAB ACCEPTOR 1.A3 (PRA1.A3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum, membrane; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 234 Blast hits to 234 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G11590AT3G11590.1TTCGGTTTAAGTCGGTTTACunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G22310.1); Has 18950 Blast hits to 12386 proteins in 794 species: Archae - 267; Bacteria - 1381; Metazoa - 9845; Fungi - 1311; Plants - 683; Viruses - 61; Other Eukaryotes - 5402 (source: NCBI BLink).
AT3G12510AT3G12510.1AGTCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, flower, pollen tube, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, E expanded cotyledon stage; Has 36 Blast hits to 36 proteins in 5 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13330AT3G13330.1AGTCGGTTbinding; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); Has 345 Blast hits to 234 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 178; Plants - 15; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).
AT3G14130AT3G14130.1GACCGACT(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14150.2); Has 9793 Blast hits to 9779 proteins in 1166 species: Archae - 155; Bacteria - 3369; Metazoa - 366; Fungi - 469; Plants - 174; Viruses - 0; Other Eukaryotes - 5260 (source: NCBI BLink).
AT3G15360AT3G15360.1AGTCGGTCencodes a prokaryotic thioredoxin
AT3G16190AT3G16190.1AGTCGGTTTAGisochorismatase hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); Has 3706 Blast hits to 3703 proteins in 851 species: Archae - 95; Bacteria - 2998; Metazoa - 0; Fungi - 127; Plants - 43; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink).
AT3G17520AT3G17520.1AGTCGGTTlate embryogenesis abundant domain-containing protein / LEA domain-containing protein; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endomembrane system; EXPRESSED IN: cultured cell, seed, leaf; EXPRESSED DURING: dry seed stage, LP.04 four leaves visible; Has 34185 Blast hits to 18660 proteins in 1584 species: Archae - 165; Bacteria - 7752; Metazoa - 10377; Fungi - 3168; Plants - 2120; Viruses - 260; Other Eukaryotes - 10343 (source: NCBI BLink).
AT3G17860AT3G17860.1TTTAACCGACTJAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine.
AT3G18510AT3G18510.1AACCGACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 6 Blast hits to 6 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G19580AT3G19580.1GACCGACTTAEncodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. The protein is localized to the nucleus and acts as a transcriptional repressor.
AT3G19580.2GACCGACTTAEncodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild dessication. The protein is localized to the nucleus and acts as a transcriptional repressor.
AT3G20630AT3G20630.1AGTCGGTTEncodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage.
AT3G22490AT3G22490.1AGTCGGTClate embryogenesis abundant protein, putative / LEA protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Seed maturation protein (InterPro:IPR007011); BEST Arabidopsis thaliana protein match is: ATECP31 (TAIR:AT3G22500.1); Has 125 Blast hits to 114 proteins in 29 species: Archae - 2; Bacteria - 32; Metazoa - 7; Fungi - 0; Plants - 80; Viruses - 3; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G49080AT3G49080.1CAAACCGGAATAAACCGACTribosomal protein S9 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: RPS9 (RIBOSOMAL PROTEIN S9); structural constituent of ribosome (TAIR:AT1G74970.1); Has 5624 Blast hits to 5609 proteins in 1600 species: Archae - 138; Bacteria - 2917; Metazoa - 148; Fungi - 89; Plants - 121; Viruses - 18; Other Eukaryotes - 2193 (source: NCBI BLink).
AT3G51500AT3G51500.1AGTCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G51510AT3G51510.1AGTCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G52090AT3G52090.1AGTCGGTTNon-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB11 and the E. oli RNA polymerase alpha subunit.
AT3G53110AT3G53110.1AGTCGGTTTAATCACGTGTAEncodes a putative DEAD-Box RNA Helicase and has RNA-dependent ATPase activity. Mutant is Sensitive to chilling stress and heat stress. Germination of the mutant is inhibited by ABA. LOS4 may be involved in temperature sensing. Is enriched in the nuclear envelope and also located in the cytoplasm. LOS4 is involved in export of poly A RNA.
AT3G54820AT3G54820.1AGTCGGTTPLASMA MEMBRANE INTRINSIC PROTEIN 2;5 (PIP2;5); FUNCTIONS IN: water channel activity; INVOLVED IN: transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aquaporin (InterPro:IPR012269), Major intrinsic protein (InterPro:IPR000425); BEST Arabidopsis thaliana protein match is: PIP2B (PLASMA MEMBRANE INTRINSIC PROTEIN 2); water channel (TAIR:AT2G37170.1); Has 6824 Blast hits to 6815 proteins in 1262 species: Archae - 57; Bacteria - 2642; Metazoa - 1283; Fungi - 291; Plants - 1508; Viruses - 2; Other Eukaryotes - 1041 (source: NCBI BLink).
AT3G62260AT3G62260.1AACCGACTprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).
AT3G62260.2AACCGACTprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: catalytic/ protein serine/threonine phosphatase (TAIR:AT1G48040.1); Has 4773 Blast hits to 4750 proteins in 462 species: Archae - 3; Bacteria - 529; Metazoa - 1381; Fungi - 534; Plants - 1284; Viruses - 9; Other Eukaryotes - 1033 (source: NCBI BLink).
AT3G63390AT3G63390.1AGTCGGTTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G01900AT4G01900.1CTAAACCGACTencodes a PII protein that may function as part of a signal transduction network involved in perceiving the status of carbon and organic nitrogen. Forms a protein complex with N-acetylglutamate kinase and regulates the kinase activity by relieving the feedback inhibition of the kinase by arginine.
AT4G02890AT4G02890.1GACCGACTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.2GACCGACTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.3GACCGACTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.4GACCGACTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G03430AT4G03430.1AACCGACTEncodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes.
AT4G10040AT4G10040.1AACCGACTEncodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers.
AT4G13220AT4G13220.1AGTCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G14890AT4G14890.1TTCGGTTTAAGTCGGTTTTCGGTTTferredoxin family protein; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: ATFD3 (ferredoxin 3); 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT2G27510.1); Has 3979 Blast hits to 3977 proteins in 721 species: Archae - 45; Bacteria - 2406; Metazoa - 8; Fungi - 2; Plants - 434; Viruses - 2; Other Eukaryotes - 1082 (source: NCBI BLink).
AT4G17620AT4G17620.1TTAAACCGACTglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).
AT4G17620.2TTAAACCGACTglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).
AT4G19510AT4G19510.2AACCGACTdisease resistance protein (TIR-NBS-LRR class), putative; FUNCTIONS IN: transmembrane receptor activity, protein binding, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat 3 (InterPro:IPR011713), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT4G12010.1); Has 12646 Blast hits to 9374 proteins in 372 species: Archae - 8; Bacteria - 481; Metazoa - 568; Fungi - 15; Plants - 11055; Viruses - 0; Other Eukaryotes - 519 (source: NCBI BLink).
AT4G20960AT4G20960.1CTTAACCGACTencodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis
AT4G21020AT4G21020.1AGTCGGTTlate embryogenesis abundant domain-containing protein / LEA domain-containing protein; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: late embryogenesis abundant domain-containing protein / LEA domain-containing protein (TAIR:AT5G44310.2); Has 20047 Blast hits to 9539 proteins in 1087 species: Archae - 69; Bacteria - 4524; Metazoa - 4955; Fungi - 1474; Plants - 1716; Viruses - 139; Other Eukaryotes - 7170 (source: NCBI BLink).
AT4G21660AT4G21660.1AACCGACTproline-rich spliceosome-associated (PSP) family protein; INVOLVED IN: mRNA processing; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Protein of unknown function DUF382 (InterPro:IPR007180); BEST Arabidopsis thaliana protein match is: pliceosome associated protein-related (TAIR:AT1G11520.1); Has 12288 Blast hits to 5916 proteins in 388 species: Archae - 20; Bacteria - 224; Metazoa - 7139; Fungi - 832; Plants - 388; Viruses - 239; Other Eukaryotes - 3446 (source: NCBI BLink).
AT4G22220AT4G22220.1CCAAACCGACTEncodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein.
AT4G24090AT4G24090.1AGTCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 95 Blast hits to 93 proteins in 48 species: Archae - 3; Bacteria - 45; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT4G25850AT4G25850.1AACCGACTOSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B (ORP4B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4A (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4A); oxysterol binding (TAIR:AT4G25860.1); Has 1645 Blast hits to 1644 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 908; Fungi - 430; Plants - 143; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink).
AT4G25850.1CTAAACCGACTOSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4B (ORP4B); FUNCTIONS IN: oxysterol binding; INVOLVED IN: steroid metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Oxysterol-binding protein (InterPro:IPR000648); BEST Arabidopsis thaliana protein match is: ORP4A (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 4A); oxysterol binding (TAIR:AT4G25860.1); Has 1645 Blast hits to 1644 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 908; Fungi - 430; Plants - 143; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink).
AT4G29840AT4G29840.1TTAAACCGACTthreonine synthase
AT4G30935AT4G30935.1AGTCGGTCmember of WRKY Transcription Factor; Group I
AT4G31150AT4G31150.1AACCGACTendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31150.2AACCGACTendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G32020AT4G32020.1AGTCGGTTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25250.1); Has 34 Blast hits to 34 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 5; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G33140AT4G33140.1GACCGACTunknown protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 138 Blast hits to 138 proteins in 40 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 8; Plants - 25; Viruses - 2; Other Eukaryotes - 56 (source: NCBI BLink).
AT4G33930AT4G33930.1ATAATGGGAACCGACTEncodes a protein with 14.6% glycine residues, similar to hyphally regulated protein from Candida albicans, PIR2:S58135
AT4G39675AT4G39675.1AACCGACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, leaf apex, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; Has 7 Blast hits to 7 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G01100AT5G01100.1AACCGACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37980.1); Has 427 Blast hits to 424 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 426; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G03240AT5G03240.1AGTCGGTCencodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments.
AT5G03240.2AGTCGGTCencodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments.
AT5G03240.3AGTCGGTCencodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments.
AT5G03300AT5G03300.1AGTCGGTCEncodes adenosine kinase 2 (ADK2), a typical, constitutively expressed housekeeping enzyme. Shows a high sequence identity with ADK1. Involved in salvage synthesis of adenylates and methyl recycling. Enzyme activity is substantially inhibited in roots, siliques and dry seeds by an unknown compound. May contribute to cytokinin interconversion.
AT5G05980AT5G05980.2AACCGACTA. THALIANA DHFS-FPGS HOMOLOG B (ATDFB); FUNCTIONS IN: tetrahydrofolylpolyglutamate synthase activity; INVOLVED IN: one-carbon compound metabolic process; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Folylpolyglutamate synthetase, conserved site (InterPro:IPR018109), Mur ligase, central (InterPro:IPR013221), Mur ligase, C-terminal (InterPro:IPR004101), Folylpolyglutamate synthetase (InterPro:IPR001645); BEST Arabidopsis thaliana protein match is: ATDFD (A. THALIANA DHFS-FPGS HOMOLOG D); tetrahydrofolylpolyglutamate synthase (TAIR:AT3G55630.3); Has 5065 Blast hits to 5063 proteins in 1340 species: Archae - 23; Bacteria - 2465; Metazoa - 145; Fungi - 231; Plants - 66; Viruses - 0; Other Eukaryotes - 2135 (source: NCBI BLink).
AT5G05987AT5G05987.1AGTCGGTTPRENYLATED RAB ACCEPTOR 1.A2 (PRA1.A2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A3 (PRENYLATED RAB ACCEPTOR 1.A3) (TAIR:AT3G11397.1); Has 209 Blast hits to 209 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 134; Fungi - 6; Plants - 67; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G08050AT5G08050.1AGTCGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500), Uncharacterised conserved protein UCP022207 (InterPro:IPR016801); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G08790AT5G08790.1AGTCGGTCinduced by wounding, belongs to a large family of putative transcriptional activators with NAC domain.
AT5G10790AT5G10790.1TAAGTCGGTCEncodes a ubiquitin-specific protease.
AT5G10980AT5G10980.1AACCGACThistone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3.2 (TAIR:AT4G40040.2); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink).
AT5G15170AT5G15170.1AACCGACTtyrosyl-DNA phosphodiesterase-related; FUNCTIONS IN: phosphoric diester hydrolase activity; INVOLVED IN: DNA repair; LOCATED IN: nucleus; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tyrosyl-DNA phosphodiesterase (InterPro:IPR010347), SMAD/FHA domain (InterPro:IPR008984); Has 311 Blast hits to 309 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).
AT5G16780AT5G16780.1AACCGACTEncodes a protein belonging to SART-1 family. The gene is expressed in the basal region of the developing embryo during heart stage. Phenotypic analyses of dot2 mutants suggest that this protein plays a role in root, shoot, and flower development. dot2 mutants are dwarved plants that display an aberrant spurred leaf venation pattern and fail to flower. In the roots DOT2 appears to be require for normal meristem organization and maintenance and the proper expression of PIN and PLT genes.
AT5G17900AT5G17900.1AGTCGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: extracellular region; CONTAINS InterPro DOMAIN/s: Micro-fibrillar-associated 1, C-terminal (InterPro:IPR009730); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08580.1); Has 36643 Blast hits to 21191 proteins in 1090 species: Archae - 183; Bacteria - 2726; Metazoa - 17629; Fungi - 3036; Plants - 994; Viruses - 215; Other Eukaryotes - 11860 (source: NCBI BLink).
AT5G19900AT5G19900.1AACCGACTPRLI-interacting factor, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 1528 Blast hits to 1237 proteins in 215 species: Archae - 5; Bacteria - 69; Metazoa - 541; Fungi - 137; Plants - 125; Viruses - 37; Other Eukaryotes - 614 (source: NCBI BLink).
AT5G27270AT5G27270.1AACCGACTTAEMBRYO DEFECTIVE 976 (EMB976); INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 29581 Blast hits to 5939 proteins in 208 species: Archae - 4; Bacteria - 59; Metazoa - 599; Fungi - 472; Plants - 27208; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink).
AT5G27520AT5G27520.1GACCGACTencodes a peroxisomal adenine nucleotide transporter, involved in fatty acid beta-oxidation during early stage of postgerminative growth.
AT5G42020AT5G42020.1AGTCGGTTluminal binding protein (BiP)
AT5G42020.2AGTCGGTTluminal binding protein (BiP)
AT5G47230AT5G47230.1AGTCGGTCencodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
AT5G47880AT5G47880.1AGTCGGTTEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.
AT5G47880.2AGTCGGTTEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones.
AT5G48540AT5G48540.1GCGTTTTGACCGACT33 kDa secretory protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF26 (InterPro:IPR002902); BEST Arabidopsis thaliana protein match is: receptor protein kinase-related (TAIR:AT3G22060.1); Has 1085 Blast hits to 938 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1085; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G50430AT5G50430.1AACCGACTubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).
AT5G50430.2AACCGACTubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).
AT5G50430.3AACCGACTubiquitin-conjugating enzyme 33 (UBC33); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5716 Blast hits to 5712 proteins in 289 species: Archae - 0; Bacteria - 0; Metazoa - 2721; Fungi - 1107; Plants - 897; Viruses - 19; Other Eukaryotes - 972 (source: NCBI BLink).
AT5G51110AT5G51110.1AGTCGGTCCCAC4-alpha-hydroxytetrahydrobiopterin dehydratase; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: dehydratase family (TAIR:AT1G29810.1); Has 1563 Blast hits to 1563 proteins in 256 species: Archae - 17; Bacteria - 489; Metazoa - 0; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1013 (source: NCBI BLink).
AT5G51120AT5G51120.1GTGGGACCGACTEncodes a homolog of the protein PABN1, a polyadenylation factor subunit.
AT5G51430AT5G51430.1AGTCGGTTTAGEncodes a protein that is homologous to Cog7, a subunit of the conserved oligomeric Golgi (COG) complex, which is required for the normal morphology and function of the Golgi apparatus. It is likely to be involved in transport or retention of Golgi-localized proteins and in maintenance of Golgi morphology.
AT5G52300AT5G52300.1ACGTGGACCGACTencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi.
AT5G52300.2ACGTGGACCGACTencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi.
AT5G53600AT5G53600.1AGTCGGTTglycosyl hydrolase family protein 17; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family protein 17 (TAIR:AT5G53610.1); Has 733 Blast hits to 697 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 733; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G54720AT5G54720.1GACCGACTankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT5G54710.1); Has 165 Blast hits to 155 proteins in 46 species: Archae - 0; Bacteria - 19; Metazoa - 47; Fungi - 10; Plants - 52; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).
AT5G55450AT5G55450.1GACCGACTprotease inhibitor/seed storage/lipid transfer protein (LTP) family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: response to other organism, lipid transport; LOCATED IN: endomembrane system; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612); BEST Arabidopsis thaliana protein match is: protease inhibitor/seed storage/lipid transfer protein (LTP) family protein (TAIR:AT5G55410.2); Has 77 Blast hits to 77 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G56050AT5G56050.1GACCGACTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G26490.1); Has 322 Blast hits to 322 proteins in 28 species: Archae - 0; Bacteria - 8; Metazoa - 10; Fungi - 1; Plants - 299; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G58020AT5G58020.1TAAGTCGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF602 (InterPro:IPR006735); Has 270 Blast hits to 270 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 71; Plants - 21; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink).
AT5G58570AT5G58570.1AGTCGGTTunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 4 Blast hits to 4 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G59140AT5G59140.1AGTCGGTCSKP1 family protein; FUNCTIONS IN: protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); Has 313 Blast hits to 313 proteins in 108 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 77; Plants - 28; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT5G59280AT5G59280.1AGTCGGTTTACArabidopsis Pumilio 16 (APUM16); FUNCTIONS IN: RNA binding, binding; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: APUM17 (Arabidopsis Pumilio 17); RNA binding / binding (TAIR:AT1G35850.1); Has 1554 Blast hits to 894 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 442; Fungi - 382; Plants - 344; Viruses - 0; Other Eukaryotes - 386 (source: NCBI BLink).
AT5G64100AT5G64100.1GACCGACTperoxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: cell wall; EXPRESSED IN: hypocotyl, root, callus; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT5G64110.1); Has 2534 Blast hits to 2521 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 20; Plants - 2497; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT5G64270AT5G64270.1AACCGACTsplicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink).
AT5G64310AT5G64310.1TAAGTCGGTCEncodes arabinogalactan-protein (AGP1).
AT5G64500AT5G64500.1GACCGACTTAmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: transporter-related (TAIR:AT2G22730.1); Has 8955 Blast hits to 8930 proteins in 1105 species: Archae - 134; Bacteria - 6267; Metazoa - 491; Fungi - 956; Plants - 74; Viruses - 0; Other Eukaryotes - 1033 (source: NCBI BLink).
AT5G65050AT5G65050.1AACCGACTOriginally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function.
AT5G65050.2AACCGACTOriginally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function.
AT5G65050.3AACCGACTOriginally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function.
AT5G66500AT5G66500.1GACCGACTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, cauline leaf, flower, seed; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G13600.1); Has 10819 Blast hits to 4139 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 15; Plants - 10655; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).
AT5G67500AT5G67500.1AGTCGGTTEncodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.