Organism | Arabidopsis thaliana |
PLACE Motif | CCACGTCA |
Description | "Motif I" in the conserved UPR (unfolded protein response) cis-acting element in Arabidopsis genes coding for SAR1B, HSP-90, SBR-like, Ca-ATPase 4, CNX1, PDI, etc.; See S000429 (CCACGTCATC); See also S000426, S000428, S000429; |
Total Entry Count | 423 |
Locus | Gene model | Sequence | Description |
AT1G01630 | AT1G01630.1 | CTGACGTGGGCTCA | SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink). |
AT1G01720 | AT1G01720.1 | TCGCCACGTCAGC | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. |
AT1G02020 | AT1G02020.1 | GTGACGTGG | nitroreductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, nitrogenous group as acceptor, oxidoreductase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitroreductase (InterPro:IPR000415); Has 465 Blast hits to 402 proteins in 182 species: Archae - 87; Bacteria - 350; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
AT1G02020.2 | GTGACGTGG | nitroreductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, nitrogenous group as acceptor, oxidoreductase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nitroreductase (InterPro:IPR000415); Has 465 Blast hits to 402 proteins in 182 species: Archae - 87; Bacteria - 350; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). | |
AT1G02700 | AT1G02700.1 | CCGCCACGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02140.1); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
AT1G03090 | AT1G03090.1 | ATGCCACGTCAC | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
AT1G03090.2 | ATGCCACGTCAC | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. | |
AT1G03905 | AT1G03905.1 | ATGACGTGGAT | ABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink). |
AT1G03905.1 | CTGACGTGGCGA | ABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink). | |
AT1G03905.1 | CTGACGTGGCGA | ABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink). | |
AT1G04410 | AT1G04410.1 | GATGACGTGGCGG | malate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink). |
AT1G04420 | AT1G04420.1 | CCGCCACGTCATC | aldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink). |
AT1G05570 | AT1G05570.1 | GATGACGTGGCAG | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
AT1G06680 | AT1G06680.1 | CTGACGTGGAA | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. |
AT1G06680.2 | CTGACGTGGAA | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. | |
AT1G07820 | AT1G07820.1 | ATCCACGTCATC | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). |
AT1G07820.2 | ATCCACGTCATC | histone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). | |
AT1G07830 | AT1G07830.1 | GATGACGTGGAT | ribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). |
AT1G08830 | AT1G08830.1 | CTGACGTGGCTTTTT | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. |
AT1G08830.2 | CTGACGTGGCTTTTT | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. | |
AT1G09520 | AT1G09520.1 | GTGCCACGTCA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
AT1G10090 | AT1G10090.1 | ATGCCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). |
AT1G10280 | AT1G10280.1 | CCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21310.1); Has 332 Blast hits to 332 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). |
AT1G11080 | AT1G11080.1 | ATGACGTGG | serine carboxypeptidase-like 31 (scpl31); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL32 (SERINE CARBOXYPEPTIDASE-LIKE 32); serine-type carboxypeptidase (TAIR:AT1G61130.1); Has 2478 Blast hits to 2433 proteins in 263 species: Archae - 0; Bacteria - 97; Metazoa - 570; Fungi - 568; Plants - 896; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink). |
AT1G11890 | AT1G11890.1 | AGCCACGTCATC | member of SEC22 Gene Family |
AT1G13640 | AT1G13640.1 | GTGACGTGGCAC | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 401 Blast hits to 395 proteins in 120 species: Archae - 0; Bacteria - 2; Metazoa - 139; Fungi - 53; Plants - 136; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). |
AT1G14900 | AT1G14900.1 | GTCCACGTCAG | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. |
AT1G16150 | AT1G16150.1 | AGCCACGTCAT | Encodes a cell-wall associated kinase like protein of the receptor-like kinase (RLK) superfamily. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. |
AT1G18330 | AT1G18330.1 | CTGACGTGGCAC | EARLY-PHYTOCHROME-RESPONSIVE1 |
AT1G18330.2 | CTGACGTGGCAC | EARLY-PHYTOCHROME-RESPONSIVE1 | |
AT1G19890 | AT1G19890.1 | CCACGTCAGC | histone 3.3, male-gamete-specific expression |
AT1G19890.1 | CCACGTCATC | histone 3.3, male-gamete-specific expression | |
AT1G20030 | AT1G20030.1 | CCACGTCATC | pathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1058 Blast hits to 1048 proteins in 144 species: Archae - 0; Bacteria - 24; Metazoa - 48; Fungi - 45; Plants - 930; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink). |
AT1G20030.2 | CCACGTCATC | pathogenesis-related thaumatin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, conserved site (InterPro:IPR017949), Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: pathogenesis-related thaumatin family protein (TAIR:AT1G75800.1); Has 1058 Blast hits to 1048 proteins in 144 species: Archae - 0; Bacteria - 24; Metazoa - 48; Fungi - 45; Plants - 930; Viruses - 2; Other Eukaryotes - 9 (source: NCBI BLink). | |
AT1G20225 | AT1G20225.1 | TTCCACGTCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76020.1); Has 156 Blast hits to 152 proteins in 51 species: Archae - 0; Bacteria - 81; Metazoa - 14; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). |
AT1G20340 | AT1G20340.1 | AAAACGCCACGTCAT | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. |
AT1G20350 | AT1G20350.1 | ATGACGTGGCGTTTT | mitochondrial inner membrane translocase |
AT1G20510 | AT1G20510.1 | CCACGTCATTT | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink). |
AT1G20510.2 | CCACGTCATTT | OPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink). | |
AT1G20696 | AT1G20696.1 | GATGACGTGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
AT1G20696.2 | GATGACGTGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. | |
AT1G20696.3 | GATGACGTGGC | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. | |
AT1G20930 | AT1G20930.1 | TTCCACGTCAC | Cyclin-dependent kinase, expressed in flowers and suspension cell culture, expression peaks during M phase in synchronized cultures. Required for proper organization of the shoot apical meristem and for hormone signaling. Expressed in the shoot apical meristem. Involved in regulation of the G2/M transition of the mitotic cell cycle. |
AT1G21670 | AT1G21670.1 | ATCCACGTCATC | INVOLVED IN: proteolysis; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Peptidase S9B, dipeptidylpeptidase IV N-terminal (InterPro:IPR002469), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21680.1); Has 6126 Blast hits to 3685 proteins in 788 species: Archae - 47; Bacteria - 3362; Metazoa - 27; Fungi - 47; Plants - 58; Viruses - 0; Other Eukaryotes - 2585 (source: NCBI BLink). |
AT1G21750 | AT1G21750.1 | AAGCCACGTCAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
AT1G21750.2 | AAGCCACGTCAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. | |
AT1G23200 | AT1G23200.1 | TGACGTGGCT | pectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT2G45220.1); Has 1490 Blast hits to 1459 proteins in 273 species: Archae - 6; Bacteria - 408; Metazoa - 1; Fungi - 133; Plants - 940; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
AT1G23830 | AT1G23830.1 | GTGACGTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23840.1); Has 33 Blast hits to 30 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT1G25400 | AT1G25400.1 | CCACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68440.1); Has 14 Blast hits to 14 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT1G26270 | AT1G26270.1 | AAGCCACGTCA | phosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 429 Blast hits to 418 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 149; Fungi - 63; Plants - 133; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). |
AT1G26665 | AT1G26665.1 | TTCCACGTCAGC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: RNA polymerase II mediator complex protein-related (TAIR:AT5G41910.1); Has 223 Blast hits to 223 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 83; Plants - 24; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). |
AT1G26665.2 | TTCCACGTCAGC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: RNA polymerase II mediator complex protein-related (TAIR:AT5G41910.1); Has 223 Blast hits to 223 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 83; Plants - 24; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). | |
AT1G28140 | AT1G28140.1 | CCACGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 111 Blast hits to 111 proteins in 58 species: Archae - 0; Bacteria - 74; Metazoa - 7; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
AT1G29330 | AT1G29330.1 | ATTGCCACGTCATC | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
AT1G29390 | AT1G29390.1 | GCTGACGTGGAA | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane. |
AT1G29390.2 | GCTGACGTGGAA | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane. | |
AT1G29395 | AT1G29395.1 | GCTGACGTGG | encodes a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. Possibly targeted to thylakoid membrane. |
AT1G30520 | AT1G30520.1 | CTGCCACGTCATC | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
AT1G32130 | AT1G32130.1 | GATGACGTGGCGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TFIIS N-terminal (InterPro:IPR017923), IWS1, C-terminal (InterPro:IPR008654); BEST Arabidopsis thaliana protein match is: IWS1 C-terminus family protein (TAIR:AT4G19000.1); Has 907 Blast hits to 871 proteins in 182 species: Archae - 4; Bacteria - 14; Metazoa - 417; Fungi - 195; Plants - 42; Viruses - 8; Other Eukaryotes - 227 (source: NCBI BLink). |
AT1G44000 | AT1G44000.1 | GCTGACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11911.1); Has 133 Blast hits to 131 proteins in 47 species: Archae - 0; Bacteria - 53; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
AT1G44750 | AT1G44750.1 | GATGACGTGG | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G47970 | AT1G47970.1 | ACGCCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 85194 Blast hits to 34173 proteins in 1291 species: Archae - 566; Bacteria - 13003; Metazoa - 26927; Fungi - 13823; Plants - 4747; Viruses - 1476; Other Eukaryotes - 24652 (source: NCBI BLink). |
AT1G48410 | AT1G48410.1 | TTCCACGTCATC | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
AT1G48410.2 | TTCCACGTCATC | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. | |
AT1G48620 | AT1G48620.1 | AAAACGCCACGTCATC | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
AT1G52320 | AT1G52320.2 | ATCCACGTCATTACCCCTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25590.1); Has 8111 Blast hits to 6764 proteins in 511 species: Archae - 9; Bacteria - 475; Metazoa - 3444; Fungi - 1217; Plants - 1004; Viruses - 207; Other Eukaryotes - 1755 (source: NCBI BLink). |
AT1G52590 | AT1G52590.1 | ATGACGTGGCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). |
AT1G52590.1 | GATGACGTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). | |
AT1G52590.1 | GTGACGTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). | |
AT1G52600 | AT1G52600.1 | ATGCCACGTCAT | signal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
AT1G52600.1 | CCACGTCAC | signal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). | |
AT1G52600.1 | CCACGTCATC | signal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). | |
AT1G53400 | AT1G53400.1 | GTGACGTGGCAA | unknown protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45740.1); Has 229 Blast hits to 229 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 40; Plants - 47; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
AT1G54050 | AT1G54050.1 | ATGACGTGGAA | 17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink). |
AT1G54740 | AT1G54740.1 | CTGACGTGG | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G22110.1); Has 479 Blast hits to 317 proteins in 60 species: Archae - 0; Bacteria - 25; Metazoa - 81; Fungi - 16; Plants - 88; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink). |
AT1G55810 | AT1G55810.1 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink). |
AT1G55810.2 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink). | |
AT1G55810.3 | CTGACGTGGAT | uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative; FUNCTIONS IN: uracil phosphoribosyltransferase activity, phosphotransferase activity, alcohol group as acceptor, kinase activity, ATP binding; INVOLVED IN: biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Uridine kinase (InterPro:IPR000764); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ phosphotransferase, alcohol group as acceptor / uracil phosphoribosyltransferase (TAIR:AT4G26510.2); Has 7381 Blast hits to 7369 proteins in 1428 species: Archae - 126; Bacteria - 4965; Metazoa - 464; Fungi - 348; Plants - 370; Viruses - 2; Other Eukaryotes - 1106 (source: NCBI BLink). | |
AT1G56220 | AT1G56220.1 | TCGCCACGTCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
AT1G56220.2 | TCGCCACGTCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
AT1G56220.3 | TCGCCACGTCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
AT1G56220.4 | TCGCCACGTCAC | dormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
AT1G56330 | AT1G56330.1 | ACGCCACGTCAC | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
AT1G56340 | AT1G56340.1 | AGCCACGTCAT | Encodes calreticulin CRT1. |
AT1G56340.1 | CCACGTCAGC | Encodes calreticulin CRT1. | |
AT1G56340.2 | AGCCACGTCAT | Encodes calreticulin CRT1. | |
AT1G56340.2 | CCACGTCAGC | Encodes calreticulin CRT1. | |
AT1G61360 | AT1G61360.2 | CCACGTCA | S-locus lectin protein kinase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Protein kinase, ATP binding site (InterPro:IPR017441), PAN-like, type 2 (InterPro:IPR013227), Apple-like (InterPro:IPR003609), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858), EGF (InterPro:IPR006210); BEST Arabidopsis thaliana protein match is: SD1-29 (S-DOMAIN-1 29); carbohydrate binding / kinase/ protein kinase (TAIR:AT1G61380.1); Has 90844 Blast hits to 89410 proteins in 3263 species: Archae - 63; Bacteria - 7784; Metazoa - 39638; Fungi - 7233; Plants - 20141; Viruses - 449; Other Eukaryotes - 15536 (source: NCBI BLink). |
AT1G62180 | AT1G62180.1 | TCGCCACGTCATC | encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. |
AT1G63290 | AT1G63290.1 | GTGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT3G01850.2); Has 6133 Blast hits to 6130 proteins in 1420 species: Archae - 32; Bacteria - 2852; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink). |
AT1G63900 | AT1G63900.1 | GCCACGTCATC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 2665 Blast hits to 2573 proteins in 206 species: Archae - 0; Bacteria - 8; Metazoa - 1654; Fungi - 30; Plants - 409; Viruses - 201; Other Eukaryotes - 363 (source: NCBI BLink). |
AT1G67480 | AT1G67480.1 | TGACGTGG | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G27420.1); Has 9349 Blast hits to 4754 proteins in 382 species: Archae - 21; Bacteria - 551; Metazoa - 7219; Fungi - 97; Plants - 791; Viruses - 153; Other Eukaryotes - 517 (source: NCBI BLink). |
AT1G67480.2 | TGACGTGG | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G27420.1); Has 9349 Blast hits to 4754 proteins in 382 species: Archae - 21; Bacteria - 551; Metazoa - 7219; Fungi - 97; Plants - 791; Viruses - 153; Other Eukaryotes - 517 (source: NCBI BLink). | |
AT1G68010 | AT1G68010.1 | GCCACGTCAGC | Encodes hydroxypyruvate reductase. |
AT1G72320 | AT1G72320.1 | ATCCACGTCA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). |
AT1G72320.2 | ATCCACGTCA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). | |
AT1G72320.3 | ATCCACGTCA | Arabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). | |
AT1G72510 | AT1G72510.1 | CTGACGTGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT1G72510.2 | CTGACGTGGCTTTTA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
AT1G72650 | AT1G72650.1 | CTGACGTGGCAAT | Arabidopsis thaliana myb family transcription factor (At1g72650) |
AT1G72650.2 | CTGACGTGGCAAT | Arabidopsis thaliana myb family transcription factor (At1g72650) | |
AT1G74730 | AT1G74730.1 | CTGACGTGGCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
AT1G76020 | AT1G76020.1 | CTGCCACGTCAC | INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20225.1); Has 118 Blast hits to 116 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 12; Fungi - 4; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). |
AT1G76030 | AT1G76030.1 | GTGACGTGGCAG | Encodes the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. |
AT1G76100 | AT1G76100.1 | ATGCCACGTCAC | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. |
AT1G76730 | AT1G76730.1 | ATGACGTGG | 5-formyltetrahydrofolate cyclo-ligase family protein; FUNCTIONS IN: catalytic activity, ATP binding, 5-formyltetrahydrofolate cyclo-ligase activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 5-formyltetrahydrofolate cyclo-ligase (InterPro:IPR002698); Has 270 Blast hits to 270 proteins in 109 species: Archae - 50; Bacteria - 73; Metazoa - 104; Fungi - 6; Plants - 17; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). |
AT1G76740 | AT1G76740.1 | CCACGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76840.1); Has 3136 Blast hits to 2432 proteins in 274 species: Archae - 9; Bacteria - 251; Metazoa - 1340; Fungi - 208; Plants - 114; Viruses - 8; Other Eukaryotes - 1206 (source: NCBI BLink). |
AT1G77810 | AT1G77810.1 | ATGACGTGGCAT | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
AT1G77810.2 | ATGACGTGGCAT | galactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). | |
AT1G79270 | AT1G79270.1 | ATGACGTGGAC | evolutionarily conserved C-terminal region 8 (ECT8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT6 (evolutionarily conserved C-terminal region 6) (TAIR:AT3G17330.1); Has 700 Blast hits to 699 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 84; Plants - 193; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). |
AT1G79340 | AT1G79340.1 | ATGCCACGTCAG | metacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink). |
AT1G79790 | AT1G79790.1 | CCACGTCATC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). |
AT1G79790.1 | CTGACGTGGAC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). | |
AT1G79790.2 | CCACGTCATC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). | |
AT1G79790.2 | CTGACGTGGAC | haloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink). | |
AT1G80580 | AT1G80580.1 | ATTGCCACGTCAAAACGC | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT2G01300 | AT2G01300.1 | AAATGACGTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15010.1); Has 45 Blast hits to 44 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT2G01590 | AT2G01590.1 | GCTGACGTGGC | Likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located in the membrane fraction of chloroplast. Mutant has impaired NAD(P)H dehydrogenase activity. |
AT2G01900 | AT2G01900.1 | GTCCACGTCAG | endonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, inositol or phosphatidylinositol phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: sepal, hypocotyl, root; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Inositol polyphosphate related phosphatase (InterPro:IPR000300), Endonuclease/exonuclease/phosphatase (InterPro:IPR005135); BEST Arabidopsis thaliana protein match is: endonuclease/exonuclease/phosphatase family protein (TAIR:AT2G37440.1); Has 1513 Blast hits to 1357 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 340; Plants - 368; Viruses - 0; Other Eukaryotes - 208 (source: NCBI BLink). |
AT2G04850 | AT2G04850.1 | ATCCACGTCAT | auxin-responsive protein-related; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT3G25290.2); Has 374 Blast hits to 374 proteins in 74 species: Archae - 0; Bacteria - 2; Metazoa - 72; Fungi - 47; Plants - 246; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
AT2G06025 | AT2G06025.1 | TCGCCACGTCAC | GCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT4G28030.1); Has 565 Blast hits to 565 proteins in 223 species: Archae - 42; Bacteria - 278; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). |
AT2G09990 | AT2G09990.1 | GTGACGTGGAA | 40S ribosomal protein S16 (RPS16A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast, membrane; EXPRESSED IN: guard cell, callus, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16C) (TAIR:AT5G18380.1); Has 4968 Blast hits to 4968 proteins in 1538 species: Archae - 152; Bacteria - 2664; Metazoa - 274; Fungi - 125; Plants - 112; Viruses - 0; Other Eukaryotes - 1641 (source: NCBI BLink). |
AT2G15695 | AT2G15695.1 | ATGACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF829, eukaryotic (InterPro:IPR008547); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44250.1); Has 84 Blast hits to 84 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
AT2G16640 | AT2G16640.1 | GTCCACGTCAGC | MULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink). |
AT2G17870 | AT2G17870.1 | GCTGACGTGGCGA | cold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink). |
AT2G20260 | AT2G20260.1 | TTGCCACGTCATC | Encodes subunit E of photosystem I. |
AT2G20360 | AT2G20360.1 | GTGACGTGG | binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink). |
AT2G21060 | AT2G21060.1 | GTGACGTGGCGG | glycine-rich protein (AtGRP2b) |
AT2G22010 | AT2G22010.1 | ACGTCATCAGCCACGTCATC | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
AT2G22170 | AT2G22170.1 | AAAACGACCACGTCATC | lipid-associated family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976); BEST Arabidopsis thaliana protein match is: lipid-associated family protein (TAIR:AT4G39730.1); Has 113 Blast hits to 108 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
AT2G24020 | AT2G24020.1 | GTGACGTGGCG | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30620.1); Has 1553 Blast hits to 1553 proteins in 610 species: Archae - 0; Bacteria - 1223; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). |
AT2G24550 | AT2G24550.1 | CCACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G31510.1); Has 115 Blast hits to 115 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 2; Plants - 108; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). |
AT2G25090 | AT2G25090.1 | TTCCACGTCA | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16). |
AT2G25430 | AT2G25430.1 | TCGCCACGTCATC | epsin N-terminal homology (ENTH) domain-containing protein; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT4G32285.2); Has 1419 Blast hits to 1078 proteins in 187 species: Archae - 4; Bacteria - 130; Metazoa - 620; Fungi - 114; Plants - 393; Viruses - 2; Other Eukaryotes - 156 (source: NCBI BLink). |
AT2G28940 | AT2G28940.1 | TCGCCACGTCATC | protein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G39110.1); Has 81015 Blast hits to 80048 proteins in 2308 species: Archae - 40; Bacteria - 6913; Metazoa - 35685; Fungi - 6155; Plants - 18356; Viruses - 328; Other Eukaryotes - 13538 (source: NCBI BLink). |
AT2G29530 | AT2G29530.1 | GATGACGTGGCGT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
AT2G29530.2 | GATGACGTGGCGT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. | |
AT2G29530.3 | GATGACGTGGCGT | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. | |
AT2G29540 | AT2G29540.1 | ACGCCACGTCATC | RNA polymerase I(A) and III(C) 14 kDa subunit |
AT2G29540.2 | ACGCCACGTCATC | RNA polymerase I(A) and III(C) 14 kDa subunit | |
AT2G29540.3 | ACGCCACGTCATC | RNA polymerase I(A) and III(C) 14 kDa subunit | |
AT2G33180 | AT2G33180.1 | TTGCCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
AT2G37250 | AT2G37250.1 | ATGCCACGTCAG | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
AT2G38210 | AT2G38210.1 | TTCCACGTCA | PUTATIVE PDX1-LIKE PROTEIN 4 (PDX1L4); INVOLVED IN: response to ethylene stimulus, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Vitamin B6 biosynthesis protein (InterPro:IPR001852); BEST Arabidopsis thaliana protein match is: ATPDX1.1 (pyridoxine biosynthesis 1.1); protein heterodimerization (TAIR:AT2G38230.1); Has 1462 Blast hits to 1461 proteins in 499 species: Archae - 146; Bacteria - 735; Metazoa - 10; Fungi - 97; Plants - 79; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink). |
AT2G38220 | AT2G38220.1 | TTCCACGTCA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G38195.1); Has 1929 Blast hits to 1925 proteins in 192 species: Archae - 0; Bacteria - 0; Metazoa - 1143; Fungi - 39; Plants - 257; Viruses - 180; Other Eukaryotes - 310 (source: NCBI BLink). |
AT2G39170 | AT2G39170.1 | GATGACGTGGAC | unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
AT2G39280 | AT2G39280.1 | GTGACGTGGAC | RAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RabGAP/TBC domain-containing protein (TAIR:AT3G55020.1); Has 4701 Blast hits to 4645 proteins in 231 species: Archae - 15; Bacteria - 84; Metazoa - 2806; Fungi - 708; Plants - 245; Viruses - 9; Other Eukaryotes - 834 (source: NCBI BLink). |
AT2G40490 | AT2G40490.1 | ATCCACGTCAGC | HEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink). |
AT2G40490.1 | ATGACGTGGCAG | HEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink). | |
AT2G41790 | AT2G41790.1 | AAATGACGTGGCT | peptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT3G57470.2); Has 5997 Blast hits to 5925 proteins in 1223 species: Archae - 5; Bacteria - 3363; Metazoa - 558; Fungi - 370; Plants - 146; Viruses - 3; Other Eukaryotes - 1552 (source: NCBI BLink). |
AT2G41900 | AT2G41900.1 | ATGACGTGGAC | zinc finger (CCCH-type) family protein; FUNCTIONS IN: transcription factor activity, nucleic acid binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT5G12850.1); Has 4817 Blast hits to 2898 proteins in 270 species: Archae - 2; Bacteria - 179; Metazoa - 2413; Fungi - 222; Plants - 261; Viruses - 8; Other Eukaryotes - 1732 (source: NCBI BLink). |
AT2G42750 | AT2G42750.1 | TTGCCACGTCAGC | DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink). |
AT2G43400 | AT2G43400.1 | TTGCCACGTCATC | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
AT2G44360 | AT2G44360.1 | CCACGTCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT2G45820 | AT2G45820.1 | GTGACGTGGCAT | DNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / remorin family protein (TAIR:AT3G61260.1); Has 2170 Blast hits to 1469 proteins in 249 species: Archae - 2; Bacteria - 278; Metazoa - 371; Fungi - 179; Plants - 300; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink). |
AT2G46535 | AT2G46535.1 | GTGACGTGG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G61840.1); Has 22 Blast hits to 22 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT2G46790 | AT2G46790.1 | AAGCCACGTCAGC | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. |
AT2G46790.2 | AAGCCACGTCAGC | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. | |
AT2G46820 | AT2G46820.1 | CCGCCACGTCAGC | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. |
AT2G46820.2 | CCGCCACGTCAGC | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. | |
AT2G47200 | AT2G47200.1 | TTCCACGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT2G47470 | AT2G47470.1 | ACGCCACGTCAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
AT2G47470.2 | ACGCCACGTCAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. | |
AT2G47470.3 | ACGCCACGTCAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. | |
AT2G47470.4 | ACGCCACGTCAT | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. | |
AT2G47700 | AT2G47700.1 | CCACGTCATC | zinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: transcription factor, putative / zinc finger (C3HC4 type RING finger) family protein (TAIR:AT3G05545.1); Has 360 Blast hits to 360 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 172; Fungi - 15; Plants - 110; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). |
AT2G47710 | AT2G47710.1 | AGCCACGTCATC | universal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49050.1); Has 1402 Blast hits to 1369 proteins in 323 species: Archae - 50; Bacteria - 850; Metazoa - 46; Fungi - 22; Plants - 381; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). |
AT3G01570 | AT3G01570.1 | GTGCCACGTCAC | glycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT3G01850 | AT3G01850.1 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). |
AT3G01850.1 | CCACGTCA | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). | |
AT3G01850.2 | ATGCCACGTCATC | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). | |
AT3G01850.2 | CCACGTCA | ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). | |
AT3G01990 | AT3G01990.1 | GTGCCACGTCATC | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
AT3G02380 | AT3G02380.1 | ATCCACGTCAGC | homologous to the flowering-time gene CONSTANS (CO) encoding zinc-finger proteins |
AT3G02580 | AT3G02580.1 | GTGACGTGGAT | Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype. |
AT3G04460 | AT3G04460.1 | GATGACGTGGAC | RING finger protein involved in peroxisome biogenesis. |
AT3G04460.1 | GATGACGTGGCT | RING finger protein involved in peroxisome biogenesis. | |
AT3G07195 | AT3G07195.1 | CCACGTCACG | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: defense protein-related (TAIR:AT5G48657.2); Has 4353 Blast hits to 3535 proteins in 378 species: Archae - 6; Bacteria - 1484; Metazoa - 1568; Fungi - 266; Plants - 491; Viruses - 21; Other Eukaryotes - 517 (source: NCBI BLink). |
AT3G07360 | AT3G07360.1 | ATGACGTGGCAA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G07360.2 | ATGACGTGGCAA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. | |
AT3G07360.3 | ATGACGTGGCAA | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. | |
AT3G07510 | AT3G07510.1 | GTGACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01580.1); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT3G07510.2 | GTGACGTGGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01580.1); Has 69 Blast hits to 69 proteins in 10 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
AT3G07680 | AT3G07680.1 | ATGACGTGGCAAT | emp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 protein-related (TAIR:AT3G22845.1); Has 672 Blast hits to 672 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). |
AT3G07730 | AT3G07730.1 | ATGACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 1172 Blast hits to 1023 proteins in 165 species: Archae - 3; Bacteria - 80; Metazoa - 419; Fungi - 100; Plants - 69; Viruses - 2; Other Eukaryotes - 499 (source: NCBI BLink). |
AT3G08020 | AT3G08020.1 | GTGACGTGGAA | protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G52100.1); Has 2063 Blast hits to 1961 proteins in 124 species: Archae - 0; Bacteria - 10; Metazoa - 1699; Fungi - 54; Plants - 101; Viruses - 0; Other Eukaryotes - 199 (source: NCBI BLink). |
AT3G08590 | AT3G08590.1 | CCACGTCATC | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). |
AT3G08590.2 | CCACGTCATC | 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink). | |
AT3G08890 | AT3G08890.1 | GTCCACGTCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT3G08890.2 | GTCCACGTCAG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37070.1); Has 268 Blast hits to 266 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 268; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
AT3G09150 | AT3G09150.1 | CCACGTCA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
AT3G09150.2 | CCACGTCA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. | |
AT3G09150.3 | CCACGTCA | Required for biosynthesis of the tetrapyrrole phytochrome chromophore phytochromobilin. Encodes phytochromobilin synthase, a ferredoxin-dependent biliverdin reductase. It is necessary for coupling the expression of some nuclear genes to the functional state of the chloroplast. | |
AT3G09690 | AT3G09690.1 | CCGCCACGTCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). |
AT3G09690.2 | CCGCCACGTCAG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). | |
AT3G11050 | AT3G11050.1 | CCACGTCAT | ferritin 2 (ATFER2); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: response to oxidative stress, cellular iron ion homeostasis, response to abscisic acid stimulus, iron ion transport; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal (InterPro:IPR001519), Ferritin-related (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040), Ferritin, conserved site (InterPro:IPR014034), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Ferritin and Dps (InterPro:IPR008331); BEST Arabidopsis thaliana protein match is: ATFER4 (ferritin 4); binding / ferric iron binding / oxidoreductase/ transition metal ion binding (TAIR:AT2G40300.1); Has 2388 Blast hits to 2383 proteins in 603 species: Archae - 119; Bacteria - 761; Metazoa - 1101; Fungi - 6; Plants - 217; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). |
AT3G11397 | AT3G11397.1 | CTGCCACGTCATC | PRENYLATED RAB ACCEPTOR 1.A3 (PRA1.A3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum, membrane; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 234 Blast hits to 234 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
AT3G11900 | AT3G11900.1 | GTGCCACGTCAC | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
AT3G13445 | AT3G13445.1 | GCTGACGTGGC | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
AT3G13445.2 | GCTGACGTGGC | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex | |
AT3G13450 | AT3G13450.1 | CTGACGTGGCT | branched chain alpha-keto acid dehydrogenase E1 beta |
AT3G13550 | AT3G13550.1 | CCACGTCAGC | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
AT3G13550.2 | CCACGTCAGC | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. | |
AT3G13670 | AT3G13670.1 | CTGACGTGGCAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G25760.1); Has 12090 Blast hits to 12038 proteins in 826 species: Archae - 10; Bacteria - 3127; Metazoa - 4213; Fungi - 955; Plants - 1425; Viruses - 207; Other Eukaryotes - 2153 (source: NCBI BLink). |
AT3G14180 | AT3G14180.1 | ATCCACGTCAC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
AT3G14180.1 | CACGTCATTCCACGTCATC | transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). | |
AT3G14990 | AT3G14990.1 | ATGACGTGGAA | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). |
AT3G14990.2 | ATGACGTGGAA | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). | |
AT3G14990.3 | ATGACGTGGAA | 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative; FUNCTIONS IN: catalytic activity; INVOLVED IN: response to cadmium ion, thiamin biosynthetic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DJ-1 (InterPro:IPR006287), ThiJ/PfpI (InterPro:IPR002818); BEST Arabidopsis thaliana protein match is: DJ-1 family protein (TAIR:AT1G53280.1); Has 6214 Blast hits to 3737 proteins in 1037 species: Archae - 210; Bacteria - 4967; Metazoa - 446; Fungi - 43; Plants - 170; Viruses - 0; Other Eukaryotes - 378 (source: NCBI BLink). | |
AT3G15360 | AT3G15360.1 | ATGACGTGGCGA | encodes a prokaryotic thioredoxin |
AT3G15580 | AT3G15580.1 | ATGACGTGGGACCCA | Encodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. |
AT3G16700 | AT3G16700.1 | ATCCACGTCAT | fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). |
AT3G16700.2 | ATCCACGTCAT | fumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). | |
AT3G17000 | AT3G17000.1 | GTGACGTGGAA | ubiquitin-conjugating enzyme 32 (UBC32); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC34 (ubiquitin-conjugating enzyme 34); ubiquitin-protein ligase (TAIR:AT1G17280.2); Has 5810 Blast hits to 5810 proteins in 294 species: Archae - 0; Bacteria - 0; Metazoa - 2855; Fungi - 1053; Plants - 896; Viruses - 16; Other Eukaryotes - 990 (source: NCBI BLink). |
AT3G20640 | AT3G20640.1 | ATGACGTGG | ethylene-responsive protein -related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G61660.1); Has 2718 Blast hits to 1146 proteins in 107 species: Archae - 0; Bacteria - 21; Metazoa - 331; Fungi - 82; Plants - 843; Viruses - 0; Other Eukaryotes - 1441 (source: NCBI BLink). |
AT3G21150 | AT3G21150.1 | CCACGTCAC | zinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G15248.1); Has 570 Blast hits to 534 proteins in 37 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 570; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT3G22440 | AT3G22440.1 | CCACGTCATC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
AT3G22440.1 | GTCCACGTCAC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | |
AT3G22880 | AT3G22880.1 | ATGACGTGGCAT | Expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene. |
AT3G23080 | AT3G23080.1 | AAGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14500.1); Has 247 Blast hits to 246 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 162; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
AT3G23080.2 | AAGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14500.1); Has 247 Blast hits to 246 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 162; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). | |
AT3G23700 | AT3G23700.1 | ATGCCACGTCAC | S1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: response to cold; LOCATED IN: chloroplast stroma, nucleus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RPS1 (RIBOSOMAL PROTEIN S1); RNA binding / structural constituent of ribosome (TAIR:AT5G30510.1); Has 19049 Blast hits to 12627 proteins in 1560 species: Archae - 136; Bacteria - 11493; Metazoa - 155; Fungi - 150; Plants - 198; Viruses - 0; Other Eukaryotes - 6917 (source: NCBI BLink). |
AT3G24520 | AT3G24520.1 | AAGCCACGTCA | member of Heat Stress Transcription Factor (Hsf) family |
AT3G46020 | AT3G46020.1 | TTCCACGTCATC | RNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink). |
AT3G46030 | AT3G46030.1 | TTCCACGTCATC | HTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink). |
AT3G46780 | AT3G46780.1 | ATGACGTGGCAT | PLASTID TRANSCRIPTIONALLY ACTIVE 16 (PTAC16); FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT3G18890.1); Has 939 Blast hits to 790 proteins in 244 species: Archae - 1; Bacteria - 344; Metazoa - 68; Fungi - 66; Plants - 99; Viruses - 22; Other Eukaryotes - 339 (source: NCBI BLink). |
AT3G47470 | AT3G47470.1 | CCACGTCATC | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
AT3G50690 | AT3G50690.1 | ACGCCACGTCATC | leucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink). |
AT3G51200 | AT3G51200.1 | TGACGTGG | auxin-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT5G66260.1); Has 595 Blast hits to 585 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 594; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
AT3G51250 | AT3G51250.1 | ACGCCACGTCATC | senescence/dehydration-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Senescence-associated (InterPro:IPR009686); BEST Arabidopsis thaliana protein match is: ERD7 (EARLY-RESPONSIVE TO DEHYDRATION 7) (TAIR:AT2G17840.1); Has 204 Blast hits to 204 proteins in 60 species: Archae - 0; Bacteria - 2; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). |
AT3G51730 | AT3G51730.1 | GATGACGTGG | saposin B domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139), Saposin-like (InterPro:IPR011001), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138); BEST Arabidopsis thaliana protein match is: saposin B domain-containing protein (TAIR:AT5G01800.1); Has 852 Blast hits to 399 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 693; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). |
AT3G51800 | AT3G51800.1 | TGACGTGGGCTTATATGGGCCCGGTTAAGGGTA | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
AT3G51800.2 | TGACGTGGGCTTATATGGGCCCGGTTAAGGGTA | putative nuclear DNA-binding protein G2p (AtG2) mRNA, | |
AT3G52400 | AT3G52400.1 | TGACGTGG | syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway |
AT3G54180 | AT3G54180.1 | GTGACGTGGAA | Arabidopsis homolog of yeast cdc2, a protein kinase (cyclin-dependent kinase) that plays a central role in control of the mitotic cell cycle. |
AT3G54500 | AT3G54500.1 | CTGACGTGGCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). |
AT3G54500.2 | CTGACGTGGCAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). | |
AT3G55660 | AT3G55660.1 | CTGACGTGGCAG | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G56140 | AT3G56140.1 | AAATGACGTGGCT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF399 (InterPro:IPR007314); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40400.2); Has 354 Blast hits to 354 proteins in 86 species: Archae - 0; Bacteria - 111; Metazoa - 36; Fungi - 6; Plants - 172; Viruses - 6; Other Eukaryotes - 23 (source: NCBI BLink). |
AT3G61260 | AT3G61260.1 | CCACGTCACG | DNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink). |
AT4G00990 | AT4G00990.1 | GCCACGTCAC | transcription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: protein binding, transcription factor activity, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G62310.1); Has 700 Blast hits to 466 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 459; Fungi - 31; Plants - 147; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). |
AT4G01050 | AT4G01050.1 | GTCCACGTCAGC | hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain. |
AT4G01800 | AT4G01800.1 | ATGACGTGGCAA | preprotein translocase secA subunit, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: intracellular protein transport, protein targeting, protein import; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecA Wing and Scaffold (InterPro:IPR011116), SecA preprotein cross-linking region (InterPro:IPR011130), SecA DEAD-like (InterPro:IPR011115), SecA motor DEAD (InterPro:IPR014018), SecA protein (InterPro:IPR000185); BEST Arabidopsis thaliana protein match is: ATP binding / protein binding (TAIR:AT1G21650.1); Has 15109 Blast hits to 10309 proteins in 1586 species: Archae - 2; Bacteria - 6696; Metazoa - 44; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 8307 (source: NCBI BLink). |
AT4G01810 | AT4G01810.1 | CCACGTCAT | protein transport protein-related; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular protein transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895); BEST Arabidopsis thaliana protein match is: transport protein, putative (TAIR:AT2G21630.1); Has 7526 Blast hits to 4938 proteins in 507 species: Archae - 16; Bacteria - 861; Metazoa - 2084; Fungi - 961; Plants - 2123; Viruses - 449; Other Eukaryotes - 1032 (source: NCBI BLink). |
AT4G02940 | AT4G02940.1 | AGCCACGTCAGC | oxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G48080.1); Has 143 Blast hits to 141 proteins in 42 species: Archae - 0; Bacteria - 8; Metazoa - 22; Fungi - 12; Plants - 70; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). |
AT4G03100 | AT4G03100.1 | ACGCCACGTCA | rac GTPase activating protein, putative; FUNCTIONS IN: Rac GTPase activator activity; INVOLVED IN: signal transduction; LOCATED IN: intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: PAK-box/P21-Rho-binding (InterPro:IPR000095), Rho GTPase activation protein (InterPro:IPR008936), RhoGAP (InterPro:IPR000198); BEST Arabidopsis thaliana protein match is: rac GTPase activating protein, putative (TAIR:AT2G46710.1); Has 3126 Blast hits to 3120 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 2422; Fungi - 299; Plants - 105; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink). |
AT4G03150 | AT4G03150.1 | AGCCACGTCACG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 30 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT4G03510 | AT4G03510.1 | TCGCCACGTCAT | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. |
AT4G03510.2 | TCGCCACGTCAT | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. | |
AT4G04640 | AT4G04640.1 | ACGCCACGTCA | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
AT4G05180 | AT4G05180.1 | TTCCACGTCAT | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
AT4G08180 | AT4G08180.1 | TCGCCACGTCAGC | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink). |
AT4G08180.2 | TCGCCACGTCAGC | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink). | |
AT4G08180.3 | TCGCCACGTCAGC | OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink). | |
AT4G08330 | AT4G08330.1 | ATCCACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G17705.1); Has 48 Blast hits to 48 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT4G08390 | AT4G08390.3 | TGACGTGGCT | Encodes a chloroplastic stromal ascorbate peroxidase sAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT4G08685 | AT4G08685.1 | ATCCACGTCATCAAATACCCC | Encodes a protein, expressed in leaves, with similarity to pollen allergens. |
AT4G09420 | AT4G09420.1 | GTCCACGTCA | disease resistance protein (TIR-NBS class), putative; FUNCTIONS IN: transmembrane receptor activity, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: shoot apex, leaf whorl, cotyledon, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS class), putative (TAIR:AT1G72850.1); Has 5786 Blast hits to 5719 proteins in 204 species: Archae - 0; Bacteria - 43; Metazoa - 6; Fungi - 0; Plants - 5734; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
AT4G09630 | AT4G09630.1 | ACGCCACGTCAT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 2910 Blast hits to 2214 proteins in 235 species: Archae - 17; Bacteria - 119; Metazoa - 666; Fungi - 192; Plants - 194; Viruses - 70; Other Eukaryotes - 1652 (source: NCBI BLink). |
AT4G09750 | AT4G09750.1 | AAAAAGCCACGTCATC | short-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G24050.1); Has 49720 Blast hits to 49652 proteins in 1938 species: Archae - 292; Bacteria - 27546; Metazoa - 4870; Fungi - 3259; Plants - 1240; Viruses - 0; Other Eukaryotes - 12513 (source: NCBI BLink). |
AT4G11960 | AT4G11960.1 | ATGACGTGGAA | Encodes PGRL1B, a transmembrane protein present in thylakoids. PGRL1B has a highly homologous isoform PGRL1A encoded by At4g22890. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
AT4G13010 | AT4G13010.1 | GTGACGTGGCAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink). |
AT4G13010.1 | GTGACGTGGCAA | oxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink). | |
AT4G14500 | AT4G14500.1 | CGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). |
AT4G14500.2 | CGCCACGTCATC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). | |
AT4G14620 | AT4G14620.1 | AAATGACGTGGCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 217 Blast hits to 217 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). |
AT4G14622 | AT4G14622.1 | AAATGACGTGGCAT | Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF60 represents a conserved upstream opening reading frame relative to major ORF AT4G14620.1 |
AT4G14900 | AT4G14900.1 | ATCCACGTCATC | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT3G22440.1); Has 1960 Blast hits to 1334 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 248; Fungi - 80; Plants - 1600; Viruses - 2; Other Eukaryotes - 22 (source: NCBI BLink). |
AT4G15560 | AT4G15560.1 | TGACGTGGCCCAAC | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
AT4G16330 | AT4G16330.1 | GTGCCACGTCAGC | oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G38240.1); Has 5424 Blast hits to 5410 proteins in 662 species: Archae - 0; Bacteria - 677; Metazoa - 111; Fungi - 490; Plants - 3015; Viruses - 0; Other Eukaryotes - 1131 (source: NCBI BLink). |
AT4G16660 | AT4G16660.1 | TTCCACGTCAG | heat shock protein 70, putative / HSP70, putative; FUNCTIONS IN: ATP binding; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: heat shock protein, putative (TAIR:AT1G11660.1); Has 18930 Blast hits to 18189 proteins in 2776 species: Archae - 119; Bacteria - 6307; Metazoa - 3629; Fungi - 1186; Plants - 638; Viruses - 97; Other Eukaryotes - 6954 (source: NCBI BLink). |
AT4G18640 | AT4G18640.1 | GTGACGTGGCTT | Required for root hair elongation during tip growth. |
AT4G19490 | AT4G19490.1 | GATGACGTGGAT | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. |
AT4G19490.2 | GATGACGTGGAT | Putative homolog of yeast Vps54. Thought to associate with POK and ATVPS53 in a plant GARP-like complex involved in the membrane trafficking system. | |
AT4G20070 | AT4G20070.1 | CCACGTCATC | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. |
AT4G21320 | AT4G21320.1 | ATGACGTGGCAT | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. |
AT4G21320.1 | ATGACGTGGCT | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. | |
AT4G22756 | AT4G22756.1 | ATGCCACGTCAC | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase. |
AT4G22890 | AT4G22890.1 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). |
AT4G22890.2 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). | |
AT4G22890.3 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). | |
AT4G22890.4 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). | |
AT4G22890.5 | GCTGACGTGGAT | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). | |
AT4G24100 | AT4G24100.1 | CCACGTCAGC | protein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G10730.1); Has 91504 Blast hits to 90179 proteins in 3094 species: Archae - 51; Bacteria - 7936; Metazoa - 40188; Fungi - 8002; Plants - 18055; Viruses - 587; Other Eukaryotes - 16685 (source: NCBI BLink). |
AT4G24110 | AT4G24110.1 | GTCCACGTCAGC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 49 Blast hits to 49 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT4G24190 | AT4G24190.1 | CCACGTCA | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
AT4G24190.2 | CCACGTCA | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. | |
AT4G25620 | AT4G25620.1 | GATGACGTGGCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink). |
AT4G26450 | AT4G26450.1 | GCTGACGTGGCGTTTT | unknown protein; Has 2630 Blast hits to 1931 proteins in 274 species: Archae - 42; Bacteria - 240; Metazoa - 1048; Fungi - 174; Plants - 110; Viruses - 15; Other Eukaryotes - 1001 (source: NCBI BLink). |
AT4G26630 | AT4G26630.1 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). |
AT4G26630.2 | CTGACGTGGCAT | EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). | |
AT4G26970 | AT4G26970.1 | CTGACGTGGCCTTGGGCCAT | aconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); BEST Arabidopsis thaliana protein match is: aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative (TAIR:AT2G05710.1); Has 15496 Blast hits to 15351 proteins in 1535 species: Archae - 312; Bacteria - 6112; Metazoa - 484; Fungi - 449; Plants - 132; Viruses - 0; Other Eukaryotes - 8007 (source: NCBI BLink). |
AT4G28750 | AT4G28750.1 | CCACGTCAC | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
AT4G28860 | AT4G28860.1 | GTCCACGTCAC | Casein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink). |
AT4G28860.2 | GTCCACGTCAC | Casein Kinase I-like 4 (ckl4); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl3 (Casein Kinase I-like 3); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28880.1); Has 49581 Blast hits to 49221 proteins in 1441 species: Archae - 25; Bacteria - 6110; Metazoa - 21777; Fungi - 5145; Plants - 5994; Viruses - 336; Other Eukaryotes - 10194 (source: NCBI BLink). | |
AT4G29020 | AT4G29020.1 | TGACGTGG | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 83971 Blast hits to 21200 proteins in 1263 species: Archae - 175; Bacteria - 30874; Metazoa - 25594; Fungi - 4634; Plants - 7115; Viruses - 1037; Other Eukaryotes - 14542 (source: NCBI BLink). |
AT4G29020.2 | TGACGTGG | glycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 83971 Blast hits to 21200 proteins in 1263 species: Archae - 175; Bacteria - 30874; Metazoa - 25594; Fungi - 4634; Plants - 7115; Viruses - 1037; Other Eukaryotes - 14542 (source: NCBI BLink). | |
AT4G29390 | AT4G29390.1 | GCTGACGTGGCT | 40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). |
AT4G29400 | AT4G29400.1 | AGCCACGTCAGC | unknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). |
AT4G29905 | AT4G29905.1 | TTGCCACGTCATC | unknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 41 Blast hits to 41 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT4G31330 | AT4G31330.1 | ATGCCACGTCATC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10580.1); Has 252 Blast hits to 252 proteins in 85 species: Archae - 0; Bacteria - 139; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
AT4G31340 | AT4G31340.1 | ACGCCACGTCAT | myosin heavy chain-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: DNA repair ATPase-related (TAIR:AT2G24420.2); Has 34880 Blast hits to 19753 proteins in 1289 species: Archae - 456; Bacteria - 3905; Metazoa - 16892; Fungi - 2497; Plants - 1119; Viruses - 175; Other Eukaryotes - 9836 (source: NCBI BLink). |
AT4G31340.2 | ACGCCACGTCAT | myosin heavy chain-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: DNA repair ATPase-related (TAIR:AT2G24420.2); Has 34880 Blast hits to 19753 proteins in 1289 species: Archae - 456; Bacteria - 3905; Metazoa - 16892; Fungi - 2497; Plants - 1119; Viruses - 175; Other Eukaryotes - 9836 (source: NCBI BLink). | |
AT4G32285 | AT4G32285.1 | CCACGTCAGC | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT2G25430.1); Has 1251 Blast hits to 1096 proteins in 211 species: Archae - 8; Bacteria - 172; Metazoa - 457; Fungi - 134; Plants - 334; Viruses - 22; Other Eukaryotes - 124 (source: NCBI BLink). |
AT4G32285.2 | CCACGTCAGC | epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT2G25430.1); Has 1251 Blast hits to 1096 proteins in 211 species: Archae - 8; Bacteria - 172; Metazoa - 457; Fungi - 134; Plants - 334; Viruses - 22; Other Eukaryotes - 124 (source: NCBI BLink). | |
AT4G32330 | AT4G32330.1 | ATGACGTGGCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink). |
AT4G32330.2 | ATGACGTGGCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink). | |
AT4G32330.3 | ATGACGTGGCAC | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink). | |
AT4G32410 | AT4G32410.1 | TTGCCACGTCAC | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. |
AT4G32440 | AT4G32440.1 | CCACGTCAC | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT2G25590.1); Has 104 Blast hits to 95 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT4G32440.2 | CCACGTCAC | agenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT2G25590.1); Has 104 Blast hits to 95 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | |
AT4G33430 | AT4G33430.1 | GTCCACGTCATC | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. |
AT4G34720 | AT4G34720.1 | AAATGACGTGG | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1) |
AT4G34730 | AT4G34730.1 | TTCCACGTCAC | ribosome-binding factor A family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K homology-like, alpha/beta (InterPro:IPR015946), Ribosome-binding factor A (InterPro:IPR000238); Has 2908 Blast hits to 2907 proteins in 1057 species: Archae - 0; Bacteria - 2230; Metazoa - 5; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 649 (source: NCBI BLink). |
AT4G35780 | AT4G35780.1 | ATGACGTGGAT | protein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, protein kinase activity; INVOLVED IN: protein amino acid phosphorylation, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Amino acid-binding ACT (InterPro:IPR002912), Tyrosine protein kinase (InterPro:IPR001245), ATMRK serine/threonine protein kinase-like (InterPro:IPR015783), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G17700.1); Has 96534 Blast hits to 94806 proteins in 3572 species: Archae - 70; Bacteria - 8063; Metazoa - 43456; Fungi - 7958; Plants - 19255; Viruses - 472; Other Eukaryotes - 17260 (source: NCBI BLink). |
AT4G36530 | AT4G36530.1 | TTCCACGTCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G19850.1); Has 14231 Blast hits to 14229 proteins in 1328 species: Archae - 104; Bacteria - 8998; Metazoa - 576; Fungi - 206; Plants - 508; Viruses - 5; Other Eukaryotes - 3834 (source: NCBI BLink). |
AT4G36530.2 | TTCCACGTCA | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G19850.1); Has 14231 Blast hits to 14229 proteins in 1328 species: Archae - 104; Bacteria - 8998; Metazoa - 576; Fungi - 206; Plants - 508; Viruses - 5; Other Eukaryotes - 3834 (source: NCBI BLink). | |
AT4G37390 | AT4G37390.1 | GCTGACGTGGAA | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
AT4G37470 | AT4G37470.1 | CCACGTCAT | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: catechol catabolic process, ortho-cleavage, protocatechuate catabolic process, ortho-cleavage; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT3G03990.1); Has 5337 Blast hits to 5337 proteins in 931 species: Archae - 35; Bacteria - 3866; Metazoa - 99; Fungi - 70; Plants - 165; Viruses - 18; Other Eukaryotes - 1084 (source: NCBI BLink). |
AT4G38680 | AT4G38680.1 | GTGACGTGGCAG | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
AT4G39050 | AT4G39050.1 | CCACGTCAGC | kinesin-related protein (MKRP2); FUNCTIONS IN: protein binding, microtubule motor activity, zinc ion binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT2G21380.1); Has 37077 Blast hits to 25676 proteins in 1021 species: Archae - 260; Bacteria - 2097; Metazoa - 19200; Fungi - 3004; Plants - 2225; Viruses - 313; Other Eukaryotes - 9978 (source: NCBI BLink). |
AT4G39100 | AT4G39100.1 | GCTGACGTGG | Putative transcription factor containing a PHD finger and BAH motif, required for normal development |
AT4G39730 | AT4G39730.1 | AGCCACGTCA | lipid-associated family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976); BEST Arabidopsis thaliana protein match is: lipid-associated family protein (TAIR:AT2G22170.1); Has 164 Blast hits to 150 proteins in 34 species: Archae - 0; Bacteria - 1; Metazoa - 73; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). |
AT5G02090 | AT5G02090.1 | ACGCCACGTCAC | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G02810 | AT5G02810.1 | ATCCACGTCAC | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. |
AT5G02810.1 | CTGACGTGGAA | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. | |
AT5G03940 | AT5G03940.1 | TACTGGGCCACGTCATC | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
AT5G07090 | AT5G07090.1 | ACGCCACGTCAGC | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). |
AT5G07090.2 | ACGCCACGTCAGC | 40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). | |
AT5G07330 | AT5G07330.1 | TGACGTGGAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G63060.1); Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G09440 | AT5G09440.1 | CCACGTCAC | EXORDIUM LIKE 4 (EXL4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL2 (EXORDIUM LIKE 2) (TAIR:AT5G64260.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G10400 | AT5G10400.1 | ATGACGTGGAT | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10280 Blast hits to 10277 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7396; Fungi - 1309; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink). |
AT5G10840 | AT5G10840.1 | GTGACGTGG | endomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G25100.1); Has 1057 Blast hits to 1040 proteins in 178 species: Archae - 0; Bacteria - 38; Metazoa - 446; Fungi - 142; Plants - 235; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink). |
AT5G10980 | AT5G10980.1 | AGCCACGTCATC | histone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3.2 (TAIR:AT4G40040.2); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink). |
AT5G11700 | AT5G11700.1 | ATGACGTGGCGT | glycine-rich protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G32920.1). |
AT5G11700.2 | ATGACGTGGCGT | glycine-rich protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G32920.1). | |
AT5G14800 | AT5G14800.1 | ATCCACGTCATC | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. |
AT5G14800.2 | ATCCACGTCATC | Delta 1-pyrroline-5-carboxylate reductase, catalyzes the final step in proline biosynthesis from glutamate and ornithine.In situ hybridization indicated that under normal growth conditions, the highest concentration of P5CR transcripts occurs in the cortical parenchyma, phloem, vascular cambium and pith parenchyma in the vicinity of the protoxylem. Single gene in Arabidopsis. | |
AT5G15500 | AT5G15500.1 | CTGCCACGTCAC | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). |
AT5G15500.2 | CTGCCACGTCAC | ankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). | |
AT5G16630 | AT5G16630.1 | GTGACGTGGCGA | RAD4; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: nucleotide-excision repair; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transglutaminase-like (InterPro:IPR002931), DNA repair protein Rad4, DNA-binding domain 1 (InterPro:IPR018326), DNA repair protein Rad4, DNA-binding domain 3 (InterPro:IPR018328), DNA repair protein Rad4, DNA-binding domain 2 (InterPro:IPR018327), DNA repair protein Rad4, transglutaminase-like domain (InterPro:IPR018325), DNA repair protein Rad4 (InterPro:IPR004583); Has 484 Blast hits to 413 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 196; Fungi - 169; Plants - 44; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). |
AT5G16630.2 | GTGACGTGGCGA | RAD4; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: nucleotide-excision repair; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transglutaminase-like (InterPro:IPR002931), DNA repair protein Rad4, DNA-binding domain 1 (InterPro:IPR018326), DNA repair protein Rad4, DNA-binding domain 3 (InterPro:IPR018328), DNA repair protein Rad4, DNA-binding domain 2 (InterPro:IPR018327), DNA repair protein Rad4, transglutaminase-like domain (InterPro:IPR018325), DNA repair protein Rad4 (InterPro:IPR004583); Has 484 Blast hits to 413 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 196; Fungi - 169; Plants - 44; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). | |
AT5G18380 | AT5G18380.1 | GTGACGTGGAA | 40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). |
AT5G18380.2 | GTGACGTGGAA | 40S ribosomal protein S16 (RPS16C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, chloroplast; EXPRESSED IN: fruit, guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16A) (TAIR:AT2G09990.1); Has 4941 Blast hits to 4941 proteins in 1533 species: Archae - 152; Bacteria - 2655; Metazoa - 264; Fungi - 126; Plants - 110; Viruses - 0; Other Eukaryotes - 1634 (source: NCBI BLink). | |
AT5G18390 | AT5G18390.1 | TTCCACGTCAC | pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 14680 Blast hits to 4971 proteins in 159 species: Archae - 2; Bacteria - 2; Metazoa - 244; Fungi - 162; Plants - 13880; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink). |
AT5G18850 | AT5G18850.1 | GATGACGTGGCG | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G19390 | AT5G19390.1 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein. |
AT5G19390.2 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein. | |
AT5G19390.3 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein. | |
AT5G19390.4 | GCTGACGTGGAA | Encodes a protein with similarity to REN1, a Rho GTPase activating protein. | |
AT5G19580 | AT5G19580.1 | CCACGTCAT | glyoxal oxidase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Galactose oxidase, beta-propeller (InterPro:IPR015916), Immunoglobulin-like fold (InterPro:IPR013783), Immunoglobulin E-set (InterPro:IPR014756), Glyoxal oxidase, N-terminal (InterPro:IPR009880), Region of unknown function DUF1929 (InterPro:IPR015202); BEST Arabidopsis thaliana protein match is: glyoxal oxidase-related (TAIR:AT1G67290.1); Has 581 Blast hits to 577 proteins in 114 species: Archae - 0; Bacteria - 238; Metazoa - 0; Fungi - 172; Plants - 154; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). |
AT5G19850 | AT5G19850.1 | ATGACGTGG | hydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G38520.1); Has 7686 Blast hits to 7686 proteins in 1013 species: Archae - 67; Bacteria - 4924; Metazoa - 449; Fungi - 69; Plants - 394; Viruses - 0; Other Eukaryotes - 1783 (source: NCBI BLink). |
AT5G19930 | AT5G19930.1 | GTGCCACGTCAT | integral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink). |
AT5G19940 | AT5G19940.1 | ATGACGTGGCAC | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). |
AT5G19940.2 | ATGACGTGGCAC | plastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | |
AT5G22290 | AT5G22290.1 | GTGACGTGGCAT | Arabidopsis NAC domain containing protein 89 (anac089); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac060 (Arabidopsis NAC domain containing protein 60); transcription factor (TAIR:AT3G44290.1); Has 1506 Blast hits to 1504 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1506; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G22880 | AT5G22880.1 | CCACGTCACG | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases. |
AT5G22880.1 | CCACGTCAGC | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases. | |
AT5G23280 | AT5G23280.1 | ATGACGTGGCAA | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G08330.1); Has 679 Blast hits to 678 proteins in 154 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 0; Plants - 639; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). |
AT5G23330 | AT5G23330.1 | TGACGTGGAT | riboflavin biosynthesis protein-related; FUNCTIONS IN: FMN adenylyltransferase activity; INVOLVED IN: riboflavin biosynthetic process; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), FAD synthetase (InterPro:IPR015864); BEST Arabidopsis thaliana protein match is: riboflavin biosynthesis protein-related (TAIR:AT5G08340.1); Has 2811 Blast hits to 2811 proteins in 943 species: Archae - 0; Bacteria - 2024; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 761 (source: NCBI BLink). |
AT5G23420 | AT5G23420.1 | ACGCCACGTCA | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
AT5G23890 | AT5G23890.1 | GCTGACGTGGCAT | LOCATED IN: mitochondrion, chloroplast thylakoid membrane, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: S-layer homology region (InterPro:IPR001119); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52410.2); Has 47782 Blast hits to 27307 proteins in 1672 species: Archae - 444; Bacteria - 6951; Metazoa - 22630; Fungi - 3561; Plants - 1682; Viruses - 252; Other Eukaryotes - 12262 (source: NCBI BLink). |
AT5G24810 | AT5G24810.1 | GATGACGTGGCCCATTG | ABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink). |
AT5G24850 | AT5G24850.1 | CCACGTCACG | Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome. |
AT5G25090 | AT5G25090.1 | CCACGTCA | plastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT2G25060.1); Has 775 Blast hits to 766 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 775; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G27740 | AT5G27740.1 | CTGACGTGG | EMBRYO DEFECTIVE 2775 (EMB2775); FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding; INVOLVED IN: DNA replication; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA polymerase III clamp loader subunit, C-terminal (InterPro:IPR008921); BEST Arabidopsis thaliana protein match is: emb1968 (embryo defective 1968); ATP binding / ATPase/ DNA binding / DNA clamp loader/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT1G21690.1); Has 8053 Blast hits to 8003 proteins in 1440 species: Archae - 377; Bacteria - 2705; Metazoa - 463; Fungi - 373; Plants - 162; Viruses - 67; Other Eukaryotes - 3906 (source: NCBI BLink). |
AT5G28540 | AT5G28540.1 | GTCCACGTCATC | Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. |
AT5G35180 | AT5G35180.1 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). |
AT5G35180.2 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). | |
AT5G35180.3 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). | |
AT5G35180.4 | TGACGTGGAT | phosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769), Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: EDR2; lipid binding (TAIR:AT4G19040.1). | |
AT5G36120 | AT5G36120.1 | TTCCACGTCAGC | COFACTOR ASSEMBLY, COMPLEX C (B6F), (CCB3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cytochrome b6f complex assembly; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function YGGT (InterPro:IPR003425); Has 552 Blast hits to 552 proteins in 118 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 238 (source: NCBI BLink). |
AT5G41080 | AT5G41080.1 | GCTGACGTGGAA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink). |
AT5G41080.2 | GCTGACGTGGAA | glycerophosphoryl diester phosphodiesterase family protein; FUNCTIONS IN: phosphoric diester hydrolase activity, glycerophosphodiester phosphodiesterase activity; INVOLVED IN: glycerol metabolic process, lipid metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), Glycerophosphoryl diester phosphodiesterase (InterPro:IPR004129); BEST Arabidopsis thaliana protein match is: SRG3 (senescence-related gene 3); glycerophosphodiester phosphodiesterase/ phosphoric diester hydrolase (TAIR:AT3G02040.1); Has 1314 Blast hits to 1286 proteins in 350 species: Archae - 22; Bacteria - 625; Metazoa - 237; Fungi - 103; Plants - 54; Viruses - 2; Other Eukaryotes - 271 (source: NCBI BLink). | |
AT5G42020 | AT5G42020.1 | GTCCACGTCATC | luminal binding protein (BiP) |
AT5G42020.2 | GTCCACGTCATC | luminal binding protein (BiP) | |
AT5G44110 | AT5G44110.1 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters. |
AT5G44110.2 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters. | |
AT5G44110.3 | GTGACGTGGCAG | Encodes a member of the NAP subfamily of ABC transporters. | |
AT5G45800 | AT5G45800.1 | ATCCACGTCATC | maternal effect embryo arrest 62 (MEE62); FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G24230.1); Has 55296 Blast hits to 36416 proteins in 1147 species: Archae - 36; Bacteria - 3164; Metazoa - 17246; Fungi - 1111; Plants - 30254; Viruses - 106; Other Eukaryotes - 3379 (source: NCBI BLink). |
AT5G47180 | AT5G47180.1 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). |
AT5G47180.2 | CTGCCACGTCATC | vesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). | |
AT5G47200 | AT5G47200.1 | GCCACGTCAGC | ATRAB1A; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1C; GTP binding (TAIR:AT4G17530.1); Has 23714 Blast hits to 23664 proteins in 649 species: Archae - 17; Bacteria - 107; Metazoa - 13262; Fungi - 2840; Plants - 2236; Viruses - 19; Other Eukaryotes - 5233 (source: NCBI BLink). |
AT5G47590 | AT5G47590.1 | GTGCCACGTCAC | heat shock protein-related; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Small heat shock protein, predicted, plant (InterPro:IPR016952), Peptidase A1 (InterPro:IPR001461), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT4G16550.1); Has 51 Blast hits to 42 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G49650 | AT5G49650.1 | ATGACGTGGAT | xylulose kinase, putative; FUNCTIONS IN: xylulokinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process, xylulose catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485); Has 2320 Blast hits to 2320 proteins in 693 species: Archae - 2; Bacteria - 1651; Metazoa - 139; Fungi - 96; Plants - 28; Viruses - 0; Other Eukaryotes - 404 (source: NCBI BLink). |
AT5G49650.2 | ATGACGTGGAT | xylulose kinase, putative; FUNCTIONS IN: xylulokinase activity, phosphotransferase activity, alcohol group as acceptor; INVOLVED IN: carbohydrate metabolic process, xylulose catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate kinase, FGGY (InterPro:IPR000577), Carbohydrate kinase, FGGY, N-terminal (InterPro:IPR018484), Carbohydrate kinase, FGGY, C-terminal (InterPro:IPR018485); Has 2320 Blast hits to 2320 proteins in 693 species: Archae - 2; Bacteria - 1651; Metazoa - 139; Fungi - 96; Plants - 28; Viruses - 0; Other Eukaryotes - 404 (source: NCBI BLink). | |
AT5G50375 | AT5G50375.1 | CTGCCACGTCAGC | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
AT5G52430 | AT5G52430.1 | GATGACGTGGCAA | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G25620.1); Has 849 Blast hits to 464 proteins in 107 species: Archae - 2; Bacteria - 43; Metazoa - 236; Fungi - 114; Plants - 84; Viruses - 9; Other Eukaryotes - 361 (source: NCBI BLink). |
AT5G52960 | AT5G52960.1 | ATTGCCACGTCAT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). |
AT5G52960.1 | GTGACGTGGCAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). | |
AT5G53490 | AT5G53490.1 | ATGCCACGTCAT | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
AT5G53490.2 | ATGCCACGTCAT | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. | |
AT5G53590 | AT5G53590.1 | CCACGTCA | auxin-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: pollen tube; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT2G46690.1); Has 708 Blast hits to 691 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 32; Fungi - 11; Plants - 642; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). |
AT5G54080 | AT5G54080.1 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase |
AT5G54080.2 | ATGCCACGTCATC | homogentisate 1,2-dioxygenase | |
AT5G54770 | AT5G54770.1 | CTGACGTGGC | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. |
AT5G55000 | AT5G55000.1 | ATGACGTGGCT | FH protein interacting protein FIP2 |
AT5G55000.2 | ATGACGTGGCT | FH protein interacting protein FIP2 | |
AT5G58710 | AT5G58710.1 | TGACGTGGCTT | Encodes cyclophilin ROC7. |
AT5G58720 | AT5G58720.1 | TGACGTGGCGA | PRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). |
AT5G58720.2 | TGACGTGGCGA | PRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | |
AT5G58720.3 | TGACGTGGCGA | PRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). | |
AT5G58800 | AT5G58800.1 | ATTGCCACGTCAT | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). |
AT5G58800.2 | ATTGCCACGTCAT | quinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). | |
AT5G59570 | AT5G59570.1 | ATGACGTGGCT | myb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PCL1 (PHYTOCLOCK 1); DNA binding / transcription factor (TAIR:AT3G46640.2); Has 892 Blast hits to 892 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 875; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). |
AT5G59750 | AT5G59750.1 | TATAGGCCACGTCAGC | riboflavin biosynthesis protein, putative; FUNCTIONS IN: 3,4-dihydroxy-2-butanone-4-phosphate synthase activity, GTP cyclohydrolase II activity; INVOLVED IN: riboflavin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP cyclohydrolase II (InterPro:IPR000926), DHBP synthase RibB (InterPro:IPR000422), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945); BEST Arabidopsis thaliana protein match is: ATGCH; 3,4-dihydroxy-2-butanone-4-phosphate synthase/ GTP cyclohydrolase II (TAIR:AT5G64300.1); Has 8351 Blast hits to 8350 proteins in 1311 species: Archae - 133; Bacteria - 4029; Metazoa - 0; Fungi - 273; Plants - 55; Viruses - 0; Other Eukaryotes - 3861 (source: NCBI BLink). |
AT5G61380 | AT5G61380.1 | GATGACGTGGCCTTTT | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. |
AT5G61380.1 | GTCCACGTCATC | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. | |
AT5G61790 | AT5G61790.1 | ATGACGTGGC | calnexin 1 (CNX1); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin, putative (TAIR:AT5G07340.1); Has 1344 Blast hits to 1252 proteins in 297 species: Archae - 2; Bacteria - 61; Metazoa - 623; Fungi - 137; Plants - 191; Viruses - 36; Other Eukaryotes - 294 (source: NCBI BLink). |
AT5G61840 | AT5G61840.1 | GCTGACGTGGAA | GUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). |
AT5G64040 | AT5G64040.1 | GTCCACGTCATC | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. |
AT5G64040.2 | GTCCACGTCATC | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. | |
AT5G64260 | AT5G64260.1 | CCACGTCAC | EXORDIUM LIKE 2 (EXL2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphate-induced protein 1 conserved region (InterPro:IPR006766); BEST Arabidopsis thaliana protein match is: EXL4 (EXORDIUM LIKE 4) (TAIR:AT5G09440.1); Has 233 Blast hits to 233 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 231; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). |
AT5G65110 | AT5G65110.1 | AACGACGTGTCCACGTCATC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
AT5G65110.2 | AACGACGTGTCCACGTCATC | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. | |
AT5G65700 | AT5G65700.1 | CTGACGTGGCAC | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. |
AT5G65730 | AT5G65730.1 | GTCCACGTCAGC | xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative; FUNCTIONS IN: hydrolase activity, acting on glycosyl bonds, hydrolase activity, hydrolyzing O-glycosyl compounds, xyloglucan:xyloglucosyl transferase activity; INVOLVED IN: response to water deprivation; LOCATED IN: endomembrane system, cell wall, apoplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Xyloglucan endotransglucosylase/hydrolase (InterPro:IPR016455), Xyloglucan endo-transglycosylase, C-terminal (InterPro:IPR010713), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Glycoside hydrolase, family 16 (InterPro:IPR000757), Glycoside hydrolase, family 16, active site (InterPro:IPR008263); BEST Arabidopsis thaliana protein match is: xyloglucan:xyloglucosyl transferase, putative / xyloglucan endotransglycosylase, putative / endo-xyloglucan transferase, putative (TAIR:AT4G37800.1); Has 1348 Blast hits to 1342 proteins in 196 species: Archae - 0; Bacteria - 152; Metazoa - 0; Fungi - 301; Plants - 805; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). |
AT5G66510 | AT5G66510.1 | GTGACGTGGCGA | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
AT5G66510.2 | GTGACGTGGCGA | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. | |
AT5G66520 | AT5G66520.1 | TCGCCACGTCAC | pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G06540.1); Has 14737 Blast hits to 5344 proteins in 184 species: Archae - 1; Bacteria - 4; Metazoa - 109; Fungi - 73; Plants - 14158; Viruses - 0; Other Eukaryotes - 392 (source: NCBI BLink). |
AT5G67330 | AT5G67330.1 | CTGACGTGGCGT | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
AT5G67490 | AT5G67490.1 | TCAGCCCACGTCA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1674 (InterPro:IPR012875); Has 340 Blast hits to 340 proteins in 113 species: Archae - 0; Bacteria - 97; Metazoa - 109; Fungi - 4; Plants - 24; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). |
AT5G67500 | AT5G67500.1 | TGACGTGGGCTGA | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |