version

Summary of ACGTSSSC (All list)

Organism Oryza sativa
PLACE Motif ACGTSSSC
Description "ABA responsive element (ABRE)" of wheat Em and rice (O.s.) rab21 genes; Proposed consensus sequence for the repeated motif (Em1a and Em1b) of wheat Em gene; S=C/G;
Total Entry Count 1944

Entry Sequences (1944 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein.
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein.
Os01g0171200AK107515ACGTGGGCCTTGNONE
AK109475ACGTGGGCCTTGConserved hypothetical protein.
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE
015-007-B11CGTGTGGGGCCCACGTGNONE
015-062-F05CGTGTGGGGCCCACGTGNONE
015-078-C11CGTGTGGGGCCCACGTGNONE
016-068-F07CGTGTGGGGCCCACGTGNONE
016-074-F08CGTGTGGGGCCCACGTGNONE
AK065131CGTGTGGGGCCCACGTGTransferase family protein.
AK098922CGTGTGGGGCCCACGTGNONE
J013000G12CGTGTGGGGCCCACGTGNONE
J013001P14CGTGTGGGGCCCACGTGNONE
J013002O23CGTGTGGGGCCCACGTGNONE
J013096L23CGTGTGGGGCCCACGTGNONE
J013097F24CGTGTGGGGCCCACGTGNONE
J013120N24CGTGTGGGGCCCACGTGNONE
J023007C15CGTGTGGGGCCCACGTGNONE
J023119O12CGTGTGGGGCCCACGTGNONE
J033039O11CGTGTGGGGCCCACGTGNONE
J033043L11CGTGTGGGGCCCACGTGNONE
J033061A07CGTGTGGGGCCCACGTGNONE
J033076M13CGTGTGGGGCCCACGTGNONE
J033082B04CGTGTGGGGCCCACGTGNONE
J033143H15CGTGTGGGGCCCACGTGNONE
J043013A02CGTGTGGGGCCCACGTGNONE
J043036N21CGTGTGGGGCCCACGTGNONE
J065013M09CGTGTGGGGCCCACGTGNONE
J065082E22CGTGTGGGGCCCACGTGNONE
J065093G01CGTGTGGGGCCCACGTGNONE
J065120L06CGTGTGGGGCCCACGTGNONE
J065135D03CGTGTGGGGCCCACGTGNONE
J065197C10CGTGTGGGGCCCACGTGNONE
J100024J10CGTGTGGGGCCCACGTGNONE
J100042M22CGTGTGGGGCCCACGTGNONE
J100077E12CGTGTGGGGCCCACGTGNONE
J100084P03CGTGTGGGGCCCACGTGNONE
Os01g0222700012-011-E01GAGGCCCACGTNONE
AK068883GAGGCCCACGTNONE
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein.
J033075C16GAGGCCCACGTNONE
J043013D08GAGGCCCACGTNONE
J065089G19GAGGCCCACGTNONE
J065197K19GAGGCCCACGTNONE
J075161L21GAGGCCCACGTNONE
Os01g0223900AK101712ACGTGGGCCurculin-like (mannose-binding) lectin domain containing protein.
J033060M08ACGTGGGCNONE
Os01g0226400AK102301AGCCCACGTAAA ATPase domain containing protein.
Os01g0229100006-113-G08ACGTGGGCCGAAANONE
006-113-G08ACGTGGGCCTCNONE
011-075-E08ACGTGGGCCGAAANONE
011-075-E08ACGTGGGCCTCNONE
AK061285ACGTGGGCCGAAANONE
AK061285ACGTGGGCCTCNONE
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein.
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein.
J013059F08ACGTGGGCCGAAANONE
J013059F08ACGTGGGCCTCNONE
J013059G08ACGTGGGCCGAAANONE
J013059G08ACGTGGGCCTCNONE
J013059G09ACGTGGGCCGAAANONE
J013059G09ACGTGGGCCTCNONE
J013069M12ACGTGGGCCGAAANONE
J013069M12ACGTGGGCCTCNONE
J013105A19ACGTGGGCCGAAANONE
J013105A19ACGTGGGCCTCNONE
J013149F07ACGTGGGCCGAAANONE
J013149F07ACGTGGGCCTCNONE
J023073J07ACGTGGGCCGAAANONE
J023073J07ACGTGGGCCTCNONE
J023130F24ACGTGGGCCGAAANONE
J023130F24ACGTGGGCCTCNONE
J023147J08ACGTGGGCCGAAANONE
J023147J08ACGTGGGCCTCNONE
J033028F13ACGTGGGCCGAAANONE
J033028F13ACGTGGGCCTCNONE
J033115A16ACGTGGGCCGAAANONE
J033115A16ACGTGGGCCTCNONE
J033135F02ACGTGGGCCGAAANONE
J033135F02ACGTGGGCCTCNONE
J065031G16ACGTGGGCCGAAANONE
J065031G16ACGTGGGCCTCNONE
J065058A09ACGTGGGCCGAAANONE
J065058A09ACGTGGGCCTCNONE
J065089N15ACGTGGGCCGAAANONE
J065089N15ACGTGGGCCTCNONE
J065130I09ACGTGGGCCGAAANONE
J065130I09ACGTGGGCCTCNONE
J065191P09ACGTGGGCCGAAANONE
J065191P09ACGTGGGCCTCNONE
J065197P14ACGTGGGCCGAAANONE
J065197P14ACGTGGGCCTCNONE
J080306D15ACGTGGGCCGAAANONE
J080306D15ACGTGGGCCTCNONE
J080308M06ACGTGGGCCGAAANONE
J080308M06ACGTGGGCCTCNONE
J080315A03ACGTGGGCCGAAANONE
J080315A03ACGTGGGCCTCNONE
J080315N11ACGTGGGCCGAAANONE
J080315N11ACGTGGGCCTCNONE
J090046E14ACGTGGGCCGAAANONE
J090046E14ACGTGGGCCTCNONE
J090058G09ACGTGGGCCGAAANONE
J090058G09ACGTGGGCCTCNONE
J090077H05ACGTGGGCCGAAANONE
J090077H05ACGTGGGCCTCNONE
J090087O20ACGTGGGCCGAAANONE
J090087O20ACGTGGGCCTCNONE
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein.
AK066024TTTCGGCCCACGTVHS domain containing protein.
Os01g0271700J065184P16AGGGCCCACGTNONE
J075182E21AGGGCCCACGTNONE
J075191M19AGGGCCCACGTNONE
J090021E22AGGGCCCACGTNONE
Os01g0276500006-030-E04ACGTGGGCCGTANONE
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)].
AK099335ACGTGGGCCGTANONE
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE
009-084-B05ACAGCCCACGTGGCNONE
009-100-E07ACAGCCCACGTGGCNONE
009-133-B03ACAGCCCACGTGGCNONE
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment).
AK066266ACAGCCCACGTGGCNONE
AK102013ACAGCCCACGTGGCNONE
J065001I21ACAGCCCACGTGGCNONE
J065025D22ACAGCCCACGTGGCNONE
J065098M18ACAGCCCACGTGGCNONE
J065105O22ACAGCCCACGTGGCNONE
J065121F07ACAGCCCACGTGGCNONE
J065181F03ACAGCCCACGTGGCNONE
J075020M03ACAGCCCACGTGGCNONE
J075028O06ACAGCCCACGTGGCNONE
J075032F15ACAGCCCACGTGGCNONE
J075033H07ACAGCCCACGTGGCNONE
J075062F22ACAGCCCACGTGGCNONE
J075083P19ACAGCCCACGTGGCNONE
J075097J16ACAGCCCACGTGGCNONE
J075099A15ACAGCCCACGTGGCNONE
J075104P03ACAGCCCACGTGGCNONE
J075118K12ACAGCCCACGTGGCNONE
J075125H01ACAGCCCACGTGGCNONE
J075127K12ACAGCCCACGTGGCNONE
J075128F24ACAGCCCACGTGGCNONE
J075151P06ACAGCCCACGTGGCNONE
J075169K22ACAGCCCACGTGGCNONE
J075170K24ACAGCCCACGTGGCNONE
J075182A01ACAGCCCACGTGGCNONE
J075199H16ACAGCCCACGTGGCNONE
J080010O12ACAGCCCACGTGGCNONE
J080013A02ACAGCCCACGTGGCNONE
J080013F09ACAGCCCACGTGGCNONE
J080017C19ACAGCCCACGTGGCNONE
J080017G05ACAGCCCACGTGGCNONE
J080022L04ACAGCCCACGTGGCNONE
J080025B17ACAGCCCACGTGGCNONE
J080029A08ACAGCCCACGTGGCNONE
J080037C12ACAGCCCACGTGGCNONE
J080037L14ACAGCCCACGTGGCNONE
J080037M24ACAGCCCACGTGGCNONE
J080038M21ACAGCCCACGTGGCNONE
J080039E06ACAGCCCACGTGGCNONE
J080039I10ACAGCCCACGTGGCNONE
J080042H01ACAGCCCACGTGGCNONE
J080042L18ACAGCCCACGTGGCNONE
J080042N21ACAGCCCACGTGGCNONE
J080043E01ACAGCCCACGTGGCNONE
J080044H05ACAGCCCACGTGGCNONE
J080047H10ACAGCCCACGTGGCNONE
J080050H03ACAGCCCACGTGGCNONE
J080060N21ACAGCCCACGTGGCNONE
J080061M09ACAGCCCACGTGGCNONE
J080062D15ACAGCCCACGTGGCNONE
J080062I18ACAGCCCACGTGGCNONE
J080063G05ACAGCCCACGTGGCNONE
J080063H16ACAGCCCACGTGGCNONE
J080067G16ACAGCCCACGTGGCNONE
J080067M07ACAGCCCACGTGGCNONE
J080068M13ACAGCCCACGTGGCNONE
J080069A19ACAGCCCACGTGGCNONE
J080069G14ACAGCCCACGTGGCNONE
J080070F04ACAGCCCACGTGGCNONE
J080070K15ACAGCCCACGTGGCNONE
J080072O20ACAGCCCACGTGGCNONE
J080075L02ACAGCCCACGTGGCNONE
J080077I10ACAGCCCACGTGGCNONE
J080077P03ACAGCCCACGTGGCNONE
J080078F14ACAGCCCACGTGGCNONE
J080092H15ACAGCCCACGTGGCNONE
J080097J15ACAGCCCACGTGGCNONE
J080305C10ACAGCCCACGTGGCNONE
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE
AK064784GTGTGGGGCCCACGTGGGTCCCANONE
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein.
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE
Os01g0337600AK099595ACGTGGGCATPase, F1 complex, gamma subunit family protein.
AK119468ACGTGGGCNONE
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein.
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE
Os01g0533400AK119447GCCCACGTGTGlycoside hydrolase, family 35 protein.
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein.
Os01g0643900AK108288ACGTGGGCOleosin family protein.
Os01g0673500AK065017GCCCACGTGSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
AK069899GCCCACGTGNONE
Os01g0678100AK099717ACGTGGGCConserved hypothetical protein.
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein.
Os01g0701900AK066793GCCCACGTGGCSimilar to Phosphatidylinositol transfer-like protein III.
Os01g0703300AK069643ACGTGGGCZinc finger, RING-type domain containing protein.
J023027O19ACGTGGGCNONE
Os01g0720700J033124M22ACGTGGGCCAGGCCCNONE
J065006G21ACGTGGGCCAGGCCCNONE
J065025M24ACGTGGGCCAGGCCCNONE
J065041J02ACGTGGGCCAGGCCCNONE
J065044B14ACGTGGGCCAGGCCCNONE
J065061J06ACGTGGGCCAGGCCCNONE
J065116L21ACGTGGGCCAGGCCCNONE
J075030F18ACGTGGGCCAGGCCCNONE
J075034K17ACGTGGGCCAGGCCCNONE
J075063I02ACGTGGGCCAGGCCCNONE
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase.
J075188L15ACGTGGGCCAGGCCCNONE
J075197B17ACGTGGGCCAGGCCCNONE
Os01g0749400AK064990ACGTGGGCCCCNONE
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein.
AK103775ACGTGGGCCCCNONE
J023001B06ACGTGGGCCCCNONE
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein.
J100042H18ACGTGGGCCTANONE
J100044L13ACGTGGGCCTANONE
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein.
Os01g0767700AK122168CACGTGGGCACGTGGCSimilar to DEIH-box RNA/DNA helicase.
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein.
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein.
Os01g0836400AK073540ACGTGGGCCCCASAC3/GANP family protein.
J023019D11ACGTGGGCCCCANONE
J023139O22ACGTGGGCCCCANONE
J033042J20ACGTGGGCCCCANONE
J033046M18ACGTGGGCCCCANONE
J033124J09ACGTGGGCCCCANONE
J090015E05ACGTGGGCCCCANONE
J090076J09ACGTGGGCCCCANONE
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein.
Os01g0868300AB004461GCCCACGTSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7).
Os01g0872100AK099405GCCCACGTTGF-beta receptor, type I/II extracellular region family protein.
J013001K17GCCCACGTNONE
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE
012-048-H01ACGTGGGCCCCACCNONE
012-094-B02ACGTGGGCCCCACCNONE
AK073077ACGTGGGCCCCACCNONE
AK105447ACGTGGGCCCCACCNONE
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein.
J100026G07ACGTGGGCCCCACCNONE
J100030F07ACGTGGGCCCCACCNONE
J100066J18ACGTGGGCCCCACCNONE
J100077G12ACGTGGGCCCCACCNONE
J100081K23ACGTGGGCCCCACCNONE
Os01g0889000AK103621ACGTGGGCTTetratricopeptide-like helical domain containing protein.
Os01g0918200009-034-H02GGGGCCCACGTNONE
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3.
AK103092GGGGCCCACGTNONE
J065093P18GGGGCCCACGTNONE
J065137C15GGGGCCCACGTNONE
J065156G01GGGGCCCACGTNONE
J065206H16GGGGCCCACGTNONE
J065209D03GGGGCCCACGTNONE
J075073K05GGGGCCCACGTNONE
J075099B17GGGGCCCACGTNONE
J075166N04GGGGCCCACGTNONE
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
J013039J22CCCGGGCCCACGTGTCNONE
J013109E03CCCGGGCCCACGTGTCNONE
J023081J12CCCGGGCCCACGTGTCNONE
J023091E24CCCGGGCCCACGTGTCNONE
J033022A01CCCGGGCCCACGTGTCNONE
J033074C13CCCGGGCCCACGTGTCNONE
J065199E03CCCGGGCCCACGTGTCNONE
J075172O04CCCGGGCCCACGTGTCNONE
J090007G18CCCGGGCCCACGTGTCNONE
J090052B17CCCGGGCCCACGTGTCNONE
J090074H01CCCGGGCCCACGTGTCNONE
J100043J09CCCGGGCCCACGTGTCNONE
J100059J05CCCGGGCCCACGTGTCNONE
Os01g0924000004-020-C09ACGTGGGCCGGANONE
004-020-C09AGCCCACGTNONE
005-014-A06ACGTGGGCCGGANONE
005-014-A06AGCCCACGTNONE
009-085-G12ACGTGGGCCGGANONE
009-085-G12AGCCCACGTNONE
009-123-A08ACGTGGGCCGGANONE
009-123-A08AGCCCACGTNONE
009-134-A05ACGTGGGCCGGANONE
009-134-A05AGCCCACGTNONE
009-137-F06ACGTGGGCCGGANONE
009-137-F06AGCCCACGTNONE
016-016-B08ACGTGGGCCGGANONE
016-016-B08AGCCCACGTNONE
AF050674ACGTGGGCCGGANONE
AF050674AGCCCACGTNONE
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK061690AGCCCACGTSimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK120797ACGTGGGCCGGANONE
AK120797AGCCCACGTNONE
J013040A15ACGTGGGCCGGANONE
J013040A15AGCCCACGTNONE
J013104L20ACGTGGGCCGGANONE
J013104L20AGCCCACGTNONE
J013127E12ACGTGGGCCGGANONE
J013127E12AGCCCACGTNONE
J013158O05ACGTGGGCCGGANONE
J013158O05AGCCCACGTNONE
J023012E09ACGTGGGCCGGANONE
J023012E09AGCCCACGTNONE
J023126L23ACGTGGGCCGGANONE
J023126L23AGCCCACGTNONE
J023143B03ACGTGGGCCGGANONE
J023143B03AGCCCACGTNONE
J065005B16ACGTGGGCCGGANONE
J065005B16AGCCCACGTNONE
J065101J15ACGTGGGCCGGANONE
J065101J15AGCCCACGTNONE
J065105K16ACGTGGGCCGGANONE
J065105K16AGCCCACGTNONE
J065155K16ACGTGGGCCGGANONE
J065155K16AGCCCACGTNONE
J065171M17ACGTGGGCCGGANONE
J065171M17AGCCCACGTNONE
J065182F07ACGTGGGCCGGANONE
J065182F07AGCCCACGTNONE
J065187D10ACGTGGGCCGGANONE
J065187D10AGCCCACGTNONE
J065194I24ACGTGGGCCGGANONE
J065194I24AGCCCACGTNONE
J065207E24ACGTGGGCCGGANONE
J065207E24AGCCCACGTNONE
J075001C24ACGTGGGCCGGANONE
J075001C24AGCCCACGTNONE
J075090O10ACGTGGGCCGGANONE
J075090O10AGCCCACGTNONE
J075095H17ACGTGGGCCGGANONE
J075095H17AGCCCACGTNONE
J075109M24ACGTGGGCCGGANONE
J075109M24AGCCCACGTNONE
J075123C18ACGTGGGCCGGANONE
J075123C18AGCCCACGTNONE
J075148G22ACGTGGGCCGGANONE
J075148G22AGCCCACGTNONE
J090009B09ACGTGGGCCGGANONE
J090009B09AGCCCACGTNONE
J090075K17ACGTGGGCCGGANONE
J090075K17AGCCCACGTNONE
J090081H23ACGTGGGCCGGANONE
J090081H23AGCCCACGTNONE
J090097H21ACGTGGGCCGGANONE
J090097H21AGCCCACGTNONE
J100063P14ACGTGGGCCGGANONE
J100063P14AGCCCACGTNONE
Os01g0935700AK069403AAAGCCCACGTSimilar to Cytochrome c1 (Fragment).
AK073125AAAGCCCACGTNONE
J023013M20AAAGCCCACGTNONE
Os01g0964000AK073599ACACGTGGGCSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1).
AK104012ACACGTGGGCNONE
AK104190ACACGTGGGCNONE
Os02g0110200009-041-B07ATGGCCCACGTNONE
AK100012ATGGCCCACGTNONE
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase.
Os02g0119400AK060055TTGGCCCACGTGTCCNONE
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52).
J033107H09TTGGCCCACGTGTCCNONE
J075175F09TTGGCCCACGTGTCCNONE
J090011H05TTGGCCCACGTGTCCNONE
J090091O05TTGGCCCACGTGTCCNONE
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein.
J043024M20GCGGCCCACGTGTCAGTGGNONE
Os02g0208200J023104K09TCCGGCCCACGTNONE
J033080L20TCCGGCCCACGTNONE
J033105D08TCCGGCCCACGTNONE
J090079N16TCCGGCCCACGTNONE
Os02g0208900003-126-D10ACAGCCCACGTNONE
AK066171ACAGCCCACGTNONE
AK070031ACAGCCCACGTNONE
AK121183ACAGCCCACGTSimilar to ZIGA2 protein (Fragment).
J013031N09ACAGCCCACGTNONE
J013045O19ACAGCCCACGTNONE
J023102A14ACAGCCCACGTNONE
J023145E14ACAGCCCACGTNONE
J033033E15ACAGCCCACGTNONE
J033041H19ACAGCCCACGTNONE
J033050E09ACAGCCCACGTNONE
J065191H21ACAGCCCACGTNONE
J065193C21ACAGCCCACGTNONE
J075068F07ACAGCCCACGTNONE
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE
AK060915ATCGGACGGCCCACGTNONE
AK099194ATCGGACGGCCCACGTNONE
AK104206ATCGGACGGCCCACGTNONE
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1).
J023109D07ATCGGACGGCCCACGTNONE
Os02g0265900006-102-B07CGCCACGTGGGCNONE
016-087-A02CGCCACGTGGGCNONE
AK059921CGCCACGTGGGCReticulon family protein.
AK064290CGCCACGTGGGCNONE
AK072628CGCCACGTGGGCNONE
AK104196CGCCACGTGGGCNONE
J023130B01CGCCACGTGGGCNONE
J080010O13CGCCACGTGGGCNONE
J100065C12CGCCACGTGGGCNONE
J100067M20CGCCACGTGGGCNONE
J100070I01CGCCACGTGGGCNONE
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein.
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein.
Os02g0327500AK069802GCCCACGTCTCProtein of unknown function DUF266, plant family protein.
J065186I04GCCCACGTCTCNONE
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE
AK100111GCTGGGCCCACGTGTCNONE
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein.
J013074C19GCTGGGCCCACGTGTCNONE
J013153K16GCTGGGCCCACGTGTCNONE
J023078O21GCTGGGCCCACGTGTCNONE
J033127M18GCTGGGCCCACGTGTCNONE
J043038D17GCTGGGCCCACGTGTCNONE
J065090L08GCTGGGCCCACGTGTCNONE
J065110P16GCTGGGCCCACGTGTCNONE
J065163C03GCTGGGCCCACGTGTCNONE
J065213D23GCTGGGCCCACGTGTCNONE
J090010M14GCTGGGCCCACGTGTCNONE
J090016E02GCTGGGCCCACGTGTCNONE
J090044J20GCTGGGCCCACGTGTCNONE
J090091M16GCTGGGCCCACGTGTCNONE
J090099I23GCTGGGCCCACGTGTCNONE
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein.
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE
AB110167GCCGGCCCACGTCGGCCCATCANONE
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61).
AK104168GCCGGCCCACGTCGGCCCATCANONE
AK109435GCCGGCCCACGTCGGCCCATCANONE
AY224558GCCGGCCCACGTCGGCCCATCANONE
J023013M13GCCGGCCCACGTCGGCCCATCANONE
J023059I08GCCGGCCCACGTCGGCCCATCANONE
J023084C06GCCGGCCCACGTCGGCCCATCANONE
J023114G06GCCGGCCCACGTCGGCCCATCANONE
J023142A09GCCGGCCCACGTCGGCCCATCANONE
J033026E14GCCGGCCCACGTCGGCCCATCANONE
J053042M10GCCGGCCCACGTCGGCCCATCANONE
J053082K21GCCGGCCCACGTCGGCCCATCANONE
J065105J15GCCGGCCCACGTCGGCCCATCANONE
J065150F02GCCGGCCCACGTCGGCCCATCANONE
J075177H05GCCGGCCCACGTCGGCCCATCANONE
J080040B16GCCGGCCCACGTCGGCCCATCANONE
J090077J10GCCGGCCCACGTCGGCCCATCANONE
Os02g0602300AK065609GCCGGCCCACGTGNONE
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
J013092L08GCCGGCCCACGTGNONE
J090040I23GCCGGCCCACGTGNONE
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein.
AK100281TAAGCCCACGTAGGCCCAAACNONE
J023074H03TAAGCCCACGTAGGCCCAAACNONE
J065002J16TAAGCCCACGTAGGCCCAAACNONE
J065032I20TAAGCCCACGTAGGCCCAAACNONE
J065076A07TAAGCCCACGTAGGCCCAAACNONE
J065142O21TAAGCCCACGTAGGCCCAAACNONE
J065203A03TAAGCCCACGTAGGCCCAAACNONE
J075017F24TAAGCCCACGTAGGCCCAAACNONE
J075017G24TAAGCCCACGTAGGCCCAAACNONE
Os02g0661900006-030-G12ACGTGGGCNONE
AK061447ACGTGGGCSimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2.
AK068742ACGTGGGCNONE
J075046K13ACGTGGGCNONE
J075139O08ACGTGGGCNONE
J075149I16ACGTGGGCNONE
Os02g0677300006-102-D12GCGGCCCACGTNONE
AK060550GCGGCCCACGTNONE
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1.
Os02g0744700AF395537GACACGTGGGCCCCACACNONE
AJ308110GACACGTGGGCCCCACACNONE
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21).
Os02g0755600014-024-D06TGTGGGCCCACGTGNONE
015-039-F09TGTGGGCCCACGTGNONE
AK064105TGTGGGCCCACGTGNONE
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase.
Os02g0771200011-006-B07CCCGGCCCACGTNONE
AK066823CCCGGCCCACGTConserved hypothetical protein.
AK071059CCCGGCCCACGTNONE
J013075K03CCCGGCCCACGTNONE
Os02g0776800AB042415ACGTGGGCCGAGNONE
AK072308ACGTGGGCCGAGReplication protein A 70kDa.
AK101212ACGTGGGCCGAGNONE
J033031B02ACGTGGGCCGAGNONE
J090004E18ACGTGGGCCGAGNONE
J090084C24ACGTGGGCCGAGNONE
Os02g0780800J090080O19ACGTGGGCCGTGGNONE
J090091I06ACGTGGGCCGTGGNONE
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein.
Os02g0802400J065054M13GAAGCCCACGTNONE
J065061I04GAAGCCCACGTNONE
J065112M15GAAGCCCACGTEF-Hand type domain containing protein.
J100050L24GAAGCCCACGTNONE
J100059D20GAAGCCCACGTNONE
Os02g0815300AK061607ACGTGGGCTConserved hypothetical protein.
J075088I01ACGTGGGCTNONE
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein.
J013152D10TAGGCCCAGCAAAGCCCACGTNONE
J075167I20TAGGCCCAGCAAAGCCCACGTNONE
J090067O04TAGGCCCAGCAAAGCCCACGTNONE
Os03g0129100003-009-E09GCCCACGTNONE
AF384030GCCCACGTNONE
AK098993GCCCACGTSeven transmembrane protein MLO2.
AK111990GCCCACGTNONE
J013098A12GCCCACGTNONE
J023020M16GCCCACGTNONE
J043001L02GCCCACGTNONE
Os03g0137500006-040-G01ACAGCCCACGTNONE
015-054-G04ACAGCCCACGTNONE
AK060148ACAGCCCACGTNONE
AK073584ACAGCCCACGTNONE
AK100231ACAGCCCACGTSimilar to VDAC3.1.
J013146L24ACAGCCCACGTNONE
J023022O09ACAGCCCACGTNONE
J023049J19ACAGCCCACGTNONE
J023133L05ACAGCCCACGTNONE
J023143P12ACAGCCCACGTNONE
J033040B12ACAGCCCACGTNONE
J033050O14ACAGCCCACGTNONE
J033066G05ACAGCCCACGTNONE
J065007J18ACAGCCCACGTNONE
J100067H13ACAGCCCACGTNONE
Os03g0156500011-075-F02CGGGCCCACGTGNONE
012-077-G10CGGGCCCACGTGNONE
AK103466CGGGCCCACGTGLupus La protein family protein.
J013088H17CGGGCCCACGTGNONE
J013135G21CGGGCCCACGTGNONE
J033050E10CGGGCCCACGTGNONE
J033050J01CGGGCCCACGTGNONE
J033129N23CGGGCCCACGTGNONE
J065085L16CGGGCCCACGTGNONE
J065101B19CGGGCCCACGTGNONE
J065167N03CGGGCCCACGTGNONE
J090009O21CGGGCCCACGTGNONE
J090049D11CGGGCCCACGTGNONE
J100017F23CGGGCCCACGTGNONE
J100040E12CGGGCCCACGTGNONE
J100055O18CGGGCCCACGTGNONE
J100061K08CGGGCCCACGTGNONE
J100072M05CGGGCCCACGTGNONE
J100077B08CGGGCCCACGTGNONE
J100086G03CGGGCCCACGTGNONE
Os03g0159600AK106743GCCCACGTSimilar to Rab28 protein.
J075041K15GCCCACGTNONE
J075051E03GCCCACGTNONE
J075055P19GCCCACGTNONE
J075096D01GCCCACGTNONE
Os03g0189400AK067720TCAGCCCACGTSimilar to Alcohol dehydrogenase ADH.
J043012M09TCAGCCCACGTNONE
J043026L22TCAGCCCACGTNONE
J075115C06TCAGCCCACGTNONE
J100056M03TCAGCCCACGTNONE
J100064I05TCAGCCCACGTNONE
Os03g0193225012-084-B12TCAGGCCCACGTNONE
AK069459TCAGGCCCACGTFrigida-like family protein.
J023019D20TCAGGCCCACGTNONE
Os03g0210400AK065966ACGTGGGCCGCProtein prenyltransferase domain containing protein.
Os03g0243300013-024-B05GGACGGACGTGGGCCGAANONE
AB010740GGACGGACGTGGGCCGAANONE
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein).
AK073601GGACGGACGTGGGCCGAANONE
J023010M13GGACGGACGTGGGCCGAANONE
J023030M11GGACGGACGTGGGCCGAANONE
J023066I02GGACGGACGTGGGCCGAANONE
J023080H21GGACGGACGTGGGCCGAANONE
J023123O15GGACGGACGTGGGCCGAANONE
J033029N24GGACGGACGTGGGCCGAANONE
J033031G18GGACGGACGTGGGCCGAANONE
J033046D23GGACGGACGTGGGCCGAANONE
J033046P11GGACGGACGTGGGCCGAANONE
J033079C14GGACGGACGTGGGCCGAANONE
J033125G12GGACGGACGTGGGCCGAANONE
J033133I21GGACGGACGTGGGCCGAANONE
J033141F22GGACGGACGTGGGCCGAANONE
J065035O21GGACGGACGTGGGCCGAANONE
J090008P15GGACGGACGTGGGCCGAANONE
J090033F15GGACGGACGTGGGCCGAANONE
J090059A16GGACGGACGTGGGCCGAANONE
J090080N01GGACGGACGTGGGCCGAANONE
J100022C16GGACGGACGTGGGCCGAANONE
J100023K05GGACGGACGTGGGCCGAANONE
J100043B19GGACGGACGTGGGCCGAANONE
J100046G11GGACGGACGTGGGCCGAANONE
J100049L11GGACGGACGTGGGCCGAANONE
J100054M01GGACGGACGTGGGCCGAANONE
J100068G15GGACGGACGTGGGCCGAANONE
J100085A18GGACGGACGTGGGCCGAANONE
Os03g0243350J065025D24TTCGGCCCACGTCCGTCCNONE
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein.
J065064E08TTCGGCCCACGTCCGTCCNONE
Os03g0270200012-009-A03TCGGCCCACGTNONE
AK066896TCGGCCCACGTNONE
AK102826TCGGCCCACGTSplicing factor PWI domain containing protein.
J013042L05TCGGCCCACGTNONE
J013091L22TCGGCCCACGTNONE
J013096P13TCGGCCCACGTNONE
J013118M15TCGGCCCACGTNONE
J013151N20TCGGCCCACGTNONE
J033061D07TCGGCCCACGTNONE
J033086L04TCGGCCCACGTNONE
J033099J11TCGGCCCACGTNONE
J033109C10TCGGCCCACGTNONE
J033116F13TCGGCCCACGTNONE
J065019F13TCGGCCCACGTNONE
J065089O14TCGGCCCACGTNONE
J065158D07TCGGCCCACGTNONE
J065160G19TCGGCCCACGTNONE
J065168N10TCGGCCCACGTNONE
J065208E17TCGGCCCACGTNONE
J075001A15TCGGCCCACGTNONE
J075010G15TCGGCCCACGTNONE
J075016L23TCGGCCCACGTNONE
J075019A06TCGGCCCACGTNONE
J075023B13TCGGCCCACGTNONE
J075032P15TCGGCCCACGTNONE
J075045F05TCGGCCCACGTNONE
J075053O13TCGGCCCACGTNONE
J075057P06TCGGCCCACGTNONE
J075061C19TCGGCCCACGTNONE
J075078B10TCGGCCCACGTNONE
J075086A20TCGGCCCACGTNONE
J075127A16TCGGCCCACGTNONE
J075128E07TCGGCCCACGTNONE
J075129C06TCGGCCCACGTNONE
J075130M14TCGGCCCACGTNONE
J075136H13TCGGCCCACGTNONE
J075149M17TCGGCCCACGTNONE
J075156L08TCGGCCCACGTNONE
J075160P12TCGGCCCACGTNONE
J075164J01TCGGCCCACGTNONE
J075173N05TCGGCCCACGTNONE
J075177O03TCGGCCCACGTNONE
J075188K11TCGGCCCACGTNONE
J090009A02TCGGCCCACGTNONE
J090019O12TCGGCCCACGTNONE
J090065H05TCGGCCCACGTNONE
J090067E24TCGGCCCACGTNONE
J090080C03TCGGCCCACGTNONE
J090090A04TCGGCCCACGTNONE
J090098D13TCGGCCCACGTNONE
J100060D03TCGGCCCACGTNONE
J100062D05TCGGCCCACGTNONE
J100074A08TCGGCCCACGTNONE
Os03g0280400009-125-G04GCCCACGTGNONE
AK063845GCCCACGTGConserved hypothetical protein 1589, plant family protein.
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein.
Os03g0292800012-077-B05GCCCACGTNONE
AK069970GCCCACGTSimilar to Ran binding protein 1 homolog.
J065138F22GCCCACGTNONE
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE
AK106050CACGTGGGCCCAACTNONE
Os03g0302700006-099-F12TCCGGCCCACGTNONE
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein.
AK121656TCCGGCCCACGTNONE
J075090A19TCCGGCCCACGTNONE
J075148M06TCCGGCCCACGTNONE
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein.
J023013H05CGACACGTGGGCCCAACANONE
J023043K04CGACACGTGGGCCCAACANONE
J023083I20CGACACGTGGGCCCAACANONE
J033068F22CGACACGTGGGCCCAACANONE
J033125P21CGACACGTGGGCCCAACANONE
J065207A22CGACACGTGGGCCCAACANONE
J100018D20CGACACGTGGGCCCAACANONE
J100026L17CGACACGTGGGCCCAACANONE
J100055D14CGACACGTGGGCCCAACANONE
J100060P03CGACACGTGGGCCCAACANONE
J100078A20CGACACGTGGGCCCAACANONE
Os03g0310800009-126-C10CACGTGGGCCACNONE
009-156-D02CACGTGGGCCACNONE
AK058663CACGTGGGCCACNONE
AK099476CACGTGGGCCACSimilar to Hypersensitive reaction associated Ca2+-binding protein.
J065084G15CACGTGGGCCACNONE
J075046C12CACGTGGGCCACNONE
J075058D24CACGTGGGCCACNONE
J075151M03CACGTGGGCCACNONE
J075151M04CACGTGGGCCACNONE
J075153I20CACGTGGGCCACNONE
J075167J05CACGTGGGCCACNONE
J075179G06CACGTGGGCCACNONE
J100025I19CACGTGGGCCACNONE
J100025L21CACGTGGGCCACNONE
J100029C06CACGTGGGCCACNONE
J100068E24CACGTGGGCCACNONE
J100070F10CACGTGGGCCACNONE
J100083H23CACGTGGGCCACNONE
J100089H10CACGTGGGCCACNONE
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein.
AK109328CCCACGTGGGCCCCANONE
Os03g0337600AF119232ACGTGGGCCGANONE
AK070859ACGTGGGCCGASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment).
J013110I18ACGTGGGCCGANONE
J013147M17ACGTGGGCCGANONE
J065083M01ACGTGGGCCGANONE
J065199H24ACGTGGGCCGANONE
Os03g0340500012-007-F10CACGTGGGCCATNONE
AK099406CACGTGGGCCATNONE
AK102158CACGTGGGCCATSimilar to Sucrose synthase (EC 2.4.1.13).
J013030N13CACGTGGGCCATNONE
J013063E02CACGTGGGCCATNONE
J013063I02CACGTGGGCCATNONE
J013157O07CACGTGGGCCATNONE
J023131N05CACGTGGGCCATNONE
J033033P05CACGTGGGCCATNONE
J033040N16CACGTGGGCCATNONE
J033044M19CACGTGGGCCATNONE
J033086F24CACGTGGGCCATNONE
J033097H01CACGTGGGCCATNONE
J033106C22CACGTGGGCCATNONE
J033128M13CACGTGGGCCATNONE
J033133I15CACGTGGGCCATNONE
J043027A21CACGTGGGCCATNONE
J090028A09CACGTGGGCCATNONE
J090053D06CACGTGGGCCATNONE
J090083O17CACGTGGGCCATNONE
J090099H10CACGTGGGCCATNONE
J100036M05CACGTGGGCCATNONE
Os03g0342900006-032-D01CACGTGGGCCTCNONE
006-033-E10CACGTGGGCCTCNONE
006-051-G06CACGTGGGCCTCNONE
006-053-E05CACGTGGGCCTCNONE
006-056-B05CACGTGGGCCTCNONE
006-058-F04CACGTGGGCCTCNONE
006-059-E05CACGTGGGCCTCNONE
006-060-F10CACGTGGGCCTCNONE
006-104-D12CACGTGGGCCTCNONE
009-129-C12CACGTGGGCCTCNONE
AK060136CACGTGGGCCTCNONE
AK060980CACGTGGGCCTCNONE
AK064815CACGTGGGCCTCDormancyauxin associated family protein.
AK104244CACGTGGGCCTCNONE
AK104391CACGTGGGCCTCNONE
AK104590CACGTGGGCCTCNONE
AK104744CACGTGGGCCTCNONE
AK106100CACGTGGGCCTCNONE
J013000E10CACGTGGGCCTCNONE
J075027O22CACGTGGGCCTCNONE
J075052J03CACGTGGGCCTCNONE
J075066E15CACGTGGGCCTCNONE
J075095C17CACGTGGGCCTCNONE
J075118N05CACGTGGGCCTCNONE
J075187K22CACGTGGGCCTCNONE
J090026L04CACGTGGGCCTCNONE
J090059G16CACGTGGGCCTCNONE
J100055P20CACGTGGGCCTCNONE
J100062A10CACGTGGGCCTCNONE
J100068G20CACGTGGGCCTCNONE
Os03g0344100009-166-F10ACGTGGGCCTTNONE
AK061903ACGTGGGCCTTNONE
AK065547ACGTGGGCCTTSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''.
J023095G24ACGTGGGCCTTNONE
J033087C06ACGTGGGCCTTNONE
J053073I09ACGTGGGCCTTNONE
J065189D11ACGTGGGCCTTNONE
J090032B15ACGTGGGCCTTNONE
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE
AF022735ATCGGACGGCCCACGTGNONE
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
AK101195ATCGGACGGCCCACGTGNONE
J033030J15ATCGGACGGCCCACGTGNONE
J033102N16ATCGGACGGCCCACGTGNONE
J065056E08ATCGGACGGCCCACGTGNONE
J065112M11ATCGGACGGCCCACGTGNONE
J065170H07ATCGGACGGCCCACGTGNONE
J075003P17ATCGGACGGCCCACGTGNONE
J075074D06ATCGGACGGCCCACGTGNONE
J075127F20ATCGGACGGCCCACGTGNONE
J075129I01ATCGGACGGCCCACGTGNONE
J075178A10ATCGGACGGCCCACGTGNONE
J090071P12ATCGGACGGCCCACGTGNONE
J100090D18ATCGGACGGCCCACGTGNONE
Os03g0411000AK072079GCCCACGTApoptosis inhibitory 5 family protein.
AK120207GCCCACGTNONE
J013038J18GCCCACGTNONE
J013063P09GCCCACGTNONE
J013118N09GCCCACGTNONE
J033022P08GCCCACGTNONE
J033043E22GCCCACGTNONE
J033094K23GCCCACGTNONE
J033118J19GCCCACGTNONE
J043010M20GCCCACGTNONE
J065006E09GCCCACGTNONE
J065011M01GCCCACGTNONE
J065044F22GCCCACGTNONE
J065131F15GCCCACGTNONE
J065147G04GCCCACGTNONE
J065154C20GCCCACGTNONE
J065158H17GCCCACGTNONE
J090011G09GCCCACGTNONE
J090030I09GCCCACGTNONE
Os03g0415500AK108435GCCCACGTMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J065182P12GCCCACGTNONE
Os03g0421400J075194I21AAAGCCCACGTNONE
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE
J065183O12GGTCCACGTGGGCCCCACACNONE
Os03g0606200009-030-E09TCTGGCCCACGTGNONE
009-076-H10TCTGGCCCACGTGNONE
009-122-H12TCTGGCCCACGTGNONE
009-153-F09TCTGGCCCACGTGNONE
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit.
AK072384TCTGGCCCACGTGNONE
AK107928TCTGGCCCACGTGNONE
J023078E13TCTGGCCCACGTGNONE
J053031N01TCTGGCCCACGTGNONE
J053046K19TCTGGCCCACGTGNONE
J053062P07TCTGGCCCACGTGNONE
J053091C23TCTGGCCCACGTGNONE
J053099N19TCTGGCCCACGTGNONE
J065005E06TCTGGCCCACGTGNONE
J065030N03TCTGGCCCACGTGNONE
J065138O21TCTGGCCCACGTGNONE
J065159K03TCTGGCCCACGTGNONE
J075030M08TCTGGCCCACGTGNONE
J080006E23TCTGGCCCACGTGNONE
J080010D10TCTGGCCCACGTGNONE
J080016N17TCTGGCCCACGTGNONE
J080024N09TCTGGCCCACGTGNONE
J080028E23TCTGGCCCACGTGNONE
J080035I11TCTGGCCCACGTGNONE
J080038D15TCTGGCCCACGTGNONE
J080040H08TCTGGCCCACGTGNONE
J080043L04TCTGGCCCACGTGNONE
J080047C06TCTGGCCCACGTGNONE
J080061G04TCTGGCCCACGTGNONE
J080066E10TCTGGCCCACGTGNONE
J080067P03TCTGGCCCACGTGNONE
J080082D07TCTGGCCCACGTGNONE
J080089M13TCTGGCCCACGTGNONE
J080094O09TCTGGCCCACGTGNONE
J080095C24TCTGGCCCACGTGNONE
J080309E21TCTGGCCCACGTGNONE
J090016G15TCTGGCCCACGTGNONE
J090031C20TCTGGCCCACGTGNONE
J090033A15TCTGGCCCACGTGNONE
J090037L07TCTGGCCCACGTGNONE
J090038I10TCTGGCCCACGTGNONE
J090072P19TCTGGCCCACGTGNONE
J100040J02TCTGGCCCACGTGNONE
J100047N05TCTGGCCCACGTGNONE
J100048M10TCTGGCCCACGTGNONE
J100076C02TCTGGCCCACGTGNONE
J100077G23TCTGGCCCACGTGNONE
J100080O08TCTGGCCCACGTGNONE
J100085C06TCTGGCCCACGTGNONE
J100085F16TCTGGCCCACGTGNONE
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein.
AK068169ACGTGGGCCCCACANONE
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein.
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE
Os03g0746600AK069559ACGTGGGCCACWD40-like domain containing protein.
J023141K22ACGTGGGCCACNONE
Os03g0758500016-015-D02CACGTGGGCCCCNONE
AK059403CACGTGGGCCCCNONE
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein.
J033079N03CACGTGGGCCCCNONE
J065012M05CACGTGGGCCCCNONE
J065045H19CACGTGGGCCCCNONE
J065050J08CACGTGGGCCCCNONE
J075189D02CACGTGGGCCCCNONE
J090018L03CACGTGGGCCCCNONE
J100043O22CACGTGGGCCCCNONE
J100088G17CACGTGGGCCCCNONE
Os03g0761200011-038-H02GAGGCCCACGTNONE
015-055-D12GAGGCCCACGTNONE
016-032-B01GAGGCCCACGTNONE
AK064205GAGGCCCACGTNONE
AK101534GAGGCCCACGTAnkyrin repeat containing protein.
J075033L23GAGGCCCACGTNONE
J075046K09GAGGCCCACGTNONE
J075134K18GAGGCCCACGTNONE
J075157I10GAGGCCCACGTNONE
Os03g0770100AK108776CACGTGGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein.
J033125G24GTGGGACCCACGTGGGCCCCACANONE
J065132N21GTGGGACCCACGTGGGCCCCACANONE
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein.
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein.
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog.
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment).
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE
Os03g0799100AK058959ACACGTGGGCCCTNONE
AK102772ACACGTGGGCCCTSimilar to WAVE-DAMPENED2.
J023093D03ACACGTGGGCCCTNONE
J033099D22ACACGTGGGCCCTNONE
J090054G18ACACGTGGGCCCTNONE
J100031H24ACACGTGGGCCCTNONE
J100065H09ACACGTGGGCCCTNONE
J100082G10ACACGTGGGCCCTNONE
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein.
J013146A20ACACGTGGGCCTANONE
J023050I08ACACGTGGGCCTANONE
J033058E14ACACGTGGGCCTANONE
J033111G20ACACGTGGGCCTANONE
J033141H24ACACGTGGGCCTANONE
J065021K13ACACGTGGGCCTANONE
J065082M21ACACGTGGGCCTANONE
J075106L22ACACGTGGGCCTANONE
J075150L05ACACGTGGGCCTANONE
J075172H24ACACGTGGGCCTANONE
J075199F06ACACGTGGGCCTANONE
Os04g0115400015-048-B05ACGTGGGCCGAANONE
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein.
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein.
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE
Os04g0208400AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein.
AK069629CCAGCCCACGTGCyclin-like F-box domain containing protein.
Os04g0244800009-066-G06GCCCACGTGTCNONE
011-024-D02GCCCACGTGTCNONE
AK121488GCCCACGTGTCHeavy metal transport/detoxification protein domain containing protein.
J023095P14GCCCACGTGTCNONE
J023150J09GCCCACGTGTCNONE
J053097G24GCCCACGTGTCNONE
J065001K24GCCCACGTGTCNONE
J065009O13GCCCACGTGTCNONE
J065076M12GCCCACGTGTCNONE
J065081I15GCCCACGTGTCNONE
J065105E10GCCCACGTGTCNONE
J065106G04GCCCACGTGTCNONE
J065123I12GCCCACGTGTCNONE
J065137H16GCCCACGTGTCNONE
J065151I11GCCCACGTGTCNONE
J065164H06GCCCACGTGTCNONE
J065173J07GCCCACGTGTCNONE
J065196F02GCCCACGTGTCNONE
J065198I17GCCCACGTGTCNONE
J065206I11GCCCACGTGTCNONE
J065216J02GCCCACGTGTCNONE
J075076D10GCCCACGTGTCNONE
J075098F06GCCCACGTGTCNONE
J075115A20GCCCACGTGTCNONE
J075184H05GCCCACGTGTCNONE
J075193E17GCCCACGTGTCNONE
J090014L09GCCCACGTGTCNONE
J090015H16GCCCACGTGTCNONE
J090024M04GCCCACGTGTCNONE
J090062K08GCCCACGTGTCNONE
J090082I08GCCCACGTGTCNONE
Os04g0436800015-053-A06ACGTGGGCCTGANONE
AK101115ACGTGGGCCTGAProtein prenyltransferase domain containing protein.
J033025G14ACGTGGGCCTGANONE
J033073N23ACGTGGGCCTGANONE
J033097L19ACGTGGGCCTGANONE
Os04g0479300AK106088AGCCCACGTGTConserved hypothetical protein.
Os04g0510900012-083-A10GCCCACGTNONE
014-002-F04GCCCACGTNONE
AK063625GCCCACGTSimilar to Embryo-specific protein 1 (ATS1).
J065136I20GCCCACGTNONE
J065144F23GCCCACGTNONE
J065153D08GCCCACGTNONE
J065178A02GCCCACGTNONE
J065178B01GCCCACGTNONE
J065195M21GCCCACGTNONE
Os04g0558700AK110633GCCCACGTConserved hypothetical protein.
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE
AK105145CCCGGCCCATAAGGCCCACGTNONE
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein.
J013102D16CCCGGCCCATAAGGCCCACGTNONE
J013151P06CCCGGCCCATAAGGCCCACGTNONE
J033082C11CCCGGCCCATAAGGCCCACGTNONE
J065073N13CCCGGCCCATAAGGCCCACGTNONE
J065142E11CCCGGCCCATAAGGCCCACGTNONE
J065187I19CCCGGCCCATAAGGCCCACGTNONE
J065204K02CCCGGCCCATAAGGCCCACGTNONE
J090089P22CCCGGCCCATAAGGCCCACGTNONE
J100060B16CCCGGCCCATAAGGCCCACGTNONE
Os04g0565500006-022-C06CCAGGCCCACGTNONE
AK058888CCAGGCCCACGTAmino acid/polyamine transporter II family protein.
AK071118CCAGGCCCACGTNONE
AK105902CCAGGCCCACGTNONE
J023052I22CCAGGCCCACGTNONE
J023082L01CCAGGCCCACGTNONE
J023112P14CCAGGCCCACGTNONE
J065043O12CCAGGCCCACGTNONE
J065045B08CCAGGCCCACGTNONE
J065059N01CCAGGCCCACGTNONE
J065073A04CCAGGCCCACGTNONE
J065078K06CCAGGCCCACGTNONE
J065124J08CCAGGCCCACGTNONE
J065140G16CCAGGCCCACGTNONE
J065185E13CCAGGCCCACGTNONE
J065197N09CCAGGCCCACGTNONE
J100024A03CCAGGCCCACGTNONE
J100042E11CCAGGCCCACGTNONE
J100069L15CCAGGCCCACGTNONE
J100078K13CCAGGCCCACGTNONE
Os04g0626400006-050-B09GCCCACGTGGGCNONE
006-072-C12GCCCACGTGGGCNONE
006-092-C11GCCCACGTGGGCNONE
AK059851GCCCACGTGGGCCalycin-like family protein.
AK100069GCCCACGTGGGCNONE
AK104062GCCCACGTGGGCNONE
AK104663GCCCACGTGGGCNONE
Os04g0640800AK065522GTGGCCCACGTGProgrammed cell death protein 2, C-terminal domain containing protein.
AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein.
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein.
J033075E19GCCACGTGGGCCCGCACCGCNONE
J033109O19GCCACGTGGGCCCGCACCGCNONE
J065002J12GCCACGTGGGCCCGCACCGCNONE
J065026E22GCCACGTGGGCCCGCACCGCNONE
J065061F05GCCACGTGGGCCCGCACCGCNONE
J065068D22GCCACGTGGGCCCGCACCGCNONE
J065072N14GCCACGTGGGCCCGCACCGCNONE
J065085F02GCCACGTGGGCCCGCACCGCNONE
J075055G19GCCACGTGGGCCCGCACCGCNONE
J075105B14GCCACGTGGGCCCGCACCGCNONE
J075118M17GCCACGTGGGCCCGCACCGCNONE
J075193H02GCCACGTGGGCCCGCACCGCNONE
J100040O05GCCACGTGGGCCCGCACCGCNONE
J100064I04GCCACGTGGGCCCGCACCGCNONE
Os05g0164100AF456329GGCCCACGTNONE
AK065086GGCCCACGTNONE
AK072243GGCCCACGTSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment).
J013001L18GGCCCACGTNONE
J013132O12GGCCCACGTNONE
J023003N09GGCCCACGTNONE
Os05g0169300J023091A07ACGTGGGCNONE
J023113A03ACGTGGGCNONE
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein.
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450.
AK104994TCCGGGCCCACGTNONE
Os05g0346100012-005-C07GCCACGTGGGCGCGCGCGANONE
AK066689GCCACGTGGGCGCGCGCGAPhox-like domain containing protein.
J013073J06GCCACGTGGGCGCGCGCGANONE
Os05g0357200014-046-H09GCCCCACGTGGGCCCCACGCCTCNONE
AK064069GCCCCACGTGGGCCCCACGCCTCNONE
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein.
J065038M01GCCCCACGTGGGCCCCACGCCTCNONE
J065121C16GCCCCACGTGGGCCCCACGCCTCNONE
J075173E09GCCCCACGTGGGCCCCACGCCTCNONE
J080307A20GCCCCACGTGGGCCCCACGCCTCNONE
J090046B19GCCCCACGTGGGCCCCACGCCTCNONE
J100033N12GCCCCACGTGGGCCCCACGCCTCNONE
J100036G01GCCCCACGTGGGCCCCACGCCTCNONE
J100057B19GCCCCACGTGGGCCCCACGCCTCNONE
Os05g0366600015-093-D12ACGTGGGCCAGNONE
AK071469ACGTGGGCCAGSimilar to Hydroxyisourate hydrolase.
Os05g0380900AK067214GCCCACGTGTSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2).
AK099962GCCCACGTGTNONE
J065083M07GCCCACGTGTNONE
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein.
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE
015-093-F04ACGTGGGCCCCACGTGTCNONE
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein.
AK073142ACGTGGGCCCCACGTGTCNONE
Os05g0423500015-048-C11CACGTGGGCCCACCTNONE
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein.
J013049L02CACGTGGGCCCACCTNONE
Os05g0437800015-045-B10GCCCACGTNONE
AK106328GCCCACGTConserved hypothetical protein.
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein.
Os05g0451300AK108341GCCCACGTConserved hypothetical protein.
Os05g0480000AK061052ACGTGGGCProtein kinase domain containing protein.
Os05g0487600AK100817TGTGGGGCCCACGTGNONE
AK103104TGTGGGGCCCACGTGNONE
J043027P10TGTGGGGCCCACGTGNONE
J065183N17TGTGGGGCCCACGTGNONE
Os05g0529300AK102648GCGGGCCCACGTSimilar to ER lumen protein retaining receptor (HDEL receptor).
Os05g0529400009-126-H06ACGTGGGCCCGCNONE
AK063846ACGTGGGCCCGCConserved hypothetical protein.
AK122038ACGTGGGCCCGCNONE
J033113C01ACGTGGGCCCGCNONE
Os05g0540100AB021666CACGTGGGCCGCANONE
AK060623CACGTGGGCCGCANONE
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a).
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein.
Os05g0563600009-152-H06CCAGGCCCACGTNONE
AK058836CCAGGCCCACGTNONE
AK099313CCAGGCCCACGTBeta-Ig-H3/fasciclin domain containing protein.
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit).
Os05g0586600AB096011GCCCACGTGGCGPlastid sigma factor SIG5.
AB096071GCCCACGTGGCGNONE
AK105697GCCCACGTGGCGNONE
Os06g0101600AF093636AAGGCCCACGTNONE
AK070447AAGGCCCACGTPlastocyanin, chloroplast precursor.
J065001A20AAGGCCCACGTNONE
J065019M17AAGGCCCACGTNONE
J065021H18AAGGCCCACGTNONE
J065061A17AAGGCCCACGTNONE
J065073L02AAGGCCCACGTNONE
J065099F17AAGGCCCACGTNONE
J065101C23AAGGCCCACGTNONE
J065121E23AAGGCCCACGTNONE
J065122N04AAGGCCCACGTNONE
J065141N05AAGGCCCACGTNONE
J065143N21AAGGCCCACGTNONE
J065161H09AAGGCCCACGTNONE
J065161J04AAGGCCCACGTNONE
J065162P20AAGGCCCACGTNONE
J065182K10AAGGCCCACGTNONE
J065184M05AAGGCCCACGTNONE
J065186H24AAGGCCCACGTNONE
J065189G21AAGGCCCACGTNONE
J065190N14AAGGCCCACGTNONE
J065191H08AAGGCCCACGTNONE
J065205H17AAGGCCCACGTNONE
J075001E03AAGGCCCACGTNONE
J075001H21AAGGCCCACGTNONE
J075003J23AAGGCCCACGTNONE
J075003K01AAGGCCCACGTNONE
J075005I11AAGGCCCACGTNONE
J075007F16AAGGCCCACGTNONE
J075017I11AAGGCCCACGTNONE
J075018O05AAGGCCCACGTNONE
J075019G24AAGGCCCACGTNONE
J075032D04AAGGCCCACGTNONE
J075032N13AAGGCCCACGTNONE
J075033C09AAGGCCCACGTNONE
J075033D11AAGGCCCACGTNONE
J075039A20AAGGCCCACGTNONE
J075058P12AAGGCCCACGTNONE
J075062E10AAGGCCCACGTNONE
J075062P16AAGGCCCACGTNONE
J075063C17AAGGCCCACGTNONE
J075066E07AAGGCCCACGTNONE
J075066I20AAGGCCCACGTNONE
J075075K21AAGGCCCACGTNONE
J075078F03AAGGCCCACGTNONE
J075082F10AAGGCCCACGTNONE
J075086G16AAGGCCCACGTNONE
J075087E07AAGGCCCACGTNONE
J075087K06AAGGCCCACGTNONE
J075087L04AAGGCCCACGTNONE
J075088B16AAGGCCCACGTNONE
J075088D02AAGGCCCACGTNONE
J075094H21AAGGCCCACGTNONE
J075094I24AAGGCCCACGTNONE
J075094K10AAGGCCCACGTNONE
J075095C18AAGGCCCACGTNONE
J075097B05AAGGCCCACGTNONE
J075099C13AAGGCCCACGTNONE
J075099H22AAGGCCCACGTNONE
J075099L16AAGGCCCACGTNONE
J075104K08AAGGCCCACGTNONE
J075118O06AAGGCCCACGTNONE
J075119E15AAGGCCCACGTNONE
J075124N06AAGGCCCACGTNONE
J075126G02AAGGCCCACGTNONE
J075127L24AAGGCCCACGTNONE
J075131E23AAGGCCCACGTNONE
J075140H06AAGGCCCACGTNONE
J075146I20AAGGCCCACGTNONE
J075146N24AAGGCCCACGTNONE
J075147I19AAGGCCCACGTNONE
J075155K07AAGGCCCACGTNONE
J075156C05AAGGCCCACGTNONE
J075161G07AAGGCCCACGTNONE
J075164G01AAGGCCCACGTNONE
J075170J18AAGGCCCACGTNONE
J075172G17AAGGCCCACGTNONE
J075176G10AAGGCCCACGTNONE
J075178C05AAGGCCCACGTNONE
J075179G01AAGGCCCACGTNONE
J075181E24AAGGCCCACGTNONE
J080029D19AAGGCCCACGTNONE
J080034L11AAGGCCCACGTNONE
J080039G07AAGGCCCACGTNONE
J080062M23AAGGCCCACGTNONE
J080302A01AAGGCCCACGTNONE
J100042I15AAGGCCCACGTNONE
J100043G22AAGGCCCACGTNONE
J100056L12AAGGCCCACGTNONE
J100061A12AAGGCCCACGTNONE
J100073O20AAGGCCCACGTNONE
J100082I08AAGGCCCACGTNONE
Os06g0113600016-067-E03ACGTGGGCCAGNONE
AK062095ACGTGGGCCAGNONE
AK101235ACGTGGGCCAGCyclin-like F-box domain containing protein.
AK122025ACGTGGGCCAGNONE
J013022O19ACGTGGGCCAGNONE
J023045P05ACGTGGGCCAGNONE
J033031K01ACGTGGGCCAGNONE
J033034I09ACGTGGGCCAGNONE
J033041O04ACGTGGGCCAGNONE
J033071K03ACGTGGGCCAGNONE
J033075K16ACGTGGGCCAGNONE
J033097M01ACGTGGGCCAGNONE
J033099M22ACGTGGGCCAGNONE
J033108N15ACGTGGGCCAGNONE
J033121D18ACGTGGGCCAGNONE
J033125O06ACGTGGGCCAGNONE
J033139M16ACGTGGGCCAGNONE
J033145P18ACGTGGGCCAGNONE
J033149D05ACGTGGGCCAGNONE
Os06g0122500AK108322ACGTGGGCConserved hypothetical protein.
AK108322ACGTGGGCConserved hypothetical protein.
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein.
Os06g0136900AK107405GAGACGTGGGCProtein of unknown function DUF296 domain containing protein.
Os06g0140100011-063-A02GCCCACGTGNONE
AK063371GCCCACGTGLeucine carboxyl methyltransferase family protein.
Os06g0144000AK068998TGTGGGCCCACGTGBRCT domain containing protein.
J023001F16TGTGGGCCCACGTGNONE
Os06g0147600AK107817ACGTGGGCTGTConserved hypothetical protein.
Os06g0199300J065045H01ACGTGGGCCTCNONE
J075177C22ACGTGGGCCTCNONE
J080068H06ACGTGGGCCTCNONE
J090048F01ACGTGGGCCTCNONE
J100066F17ACGTGGGCCTCNONE
Os06g0291600AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment).
J023063D14GACACGTGGGCCACNONE
J090041B12GACACGTGGGCCACNONE
Os06g0309000AK121021ACGTGGGCTTTTZinc finger, FYVE/PHD-type domain containing protein.
Os06g0335500AK121989CACGTGGGCAUX/IAA protein family protein.
Os06g0552300011-011-G12GCCACGTGGGCCCCACCNONE
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein.
J023061O03GCCACGTGGGCCCCACCNONE
J033031H19GCCACGTGGGCCCCACCNONE
J075103K14GCCACGTGGGCCCCACCNONE
J075108I16GCCACGTGGGCCCCACCNONE
J075194I23GCCACGTGGGCCCCACCNONE
J090008K01GCCACGTGGGCCCCACCNONE
J100062P15GCCACGTGGGCCCCACCNONE
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein.
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein.
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein.
J033030G15CACTGACACGTGGGCCCACGGNONE
J033148N18CACTGACACGTGGGCCCACGGNONE
Os06g0606800AK066355ACGTGGGCCACTargeting for Xklp2 family protein.
AK106565ACGTGGGCCACNONE
J013067N05ACGTGGGCCACNONE
J023127B01ACGTGGGCCACNONE
J033023J04ACGTGGGCCACNONE
J033025J18ACGTGGGCCACNONE
J033032A15ACGTGGGCCACNONE
J033079F03ACGTGGGCCACNONE
J033115D22ACGTGGGCCACNONE
J033119N01ACGTGGGCCACNONE
J033138G24ACGTGGGCCACNONE
J033149E08ACGTGGGCCACNONE
J033150A09ACGTGGGCCACNONE
J043024B06ACGTGGGCCACNONE
J065028O13ACGTGGGCCACNONE
J065070C05ACGTGGGCCACNONE
J065175H22ACGTGGGCCACNONE
J090008L08ACGTGGGCCACNONE
J090009M07ACGTGGGCCACNONE
J090039L01ACGTGGGCCACNONE
J090049A02ACGTGGGCCACNONE
J090050A11ACGTGGGCCACNONE
J090051G16ACGTGGGCCACNONE
J090062P20ACGTGGGCCACNONE
J090073P12ACGTGGGCCACNONE
J090076B19ACGTGGGCCACNONE
J090084I23ACGTGGGCCACNONE
J090088N05ACGTGGGCCACNONE
J100037J10ACGTGGGCCACNONE
J100043B06ACGTGGGCCACNONE
J100058C13ACGTGGGCCACNONE
J100089N01ACGTGGGCCACNONE
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein.
Os06g0709300AK108588ACGTGGGCTTGFAR1 domain containing protein.
Os07g0100500J033026C11GGGGCCCACGTGGCNONE
Os07g0112600AK109561CACGTGGGCCTCConserved hypothetical protein.
Os07g0124100014-015-G11GTTGGGCCCACGTGTNONE
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)].
AK063647GTTGGGCCCACGTGTNONE
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE
006-021-E02GATCCGACGTGGGCCAANONE
006-025-C06GATCCGACGTGGGCCAANONE
006-027-H11GATCCGACGTGGGCCAANONE
006-036-C05GATCCGACGTGGGCCAANONE
006-046-D07GATCCGACGTGGGCCAANONE
006-047-A02GATCCGACGTGGGCCAANONE
006-050-F02GATCCGACGTGGGCCAANONE
006-053-D07GATCCGACGTGGGCCAANONE
006-054-E06GATCCGACGTGGGCCAANONE
006-055-E01GATCCGACGTGGGCCAANONE
006-055-F01GATCCGACGTGGGCCAANONE
006-056-H12GATCCGACGTGGGCCAANONE
006-057-D07GATCCGACGTGGGCCAANONE
006-074-G10GATCCGACGTGGGCCAANONE
006-077-C02GATCCGACGTGGGCCAANONE
006-081-E01GATCCGACGTGGGCCAANONE
006-089-B08GATCCGACGTGGGCCAANONE
006-089-C10GATCCGACGTGGGCCAANONE
006-092-E07GATCCGACGTGGGCCAANONE
006-096-C11GATCCGACGTGGGCCAANONE
006-096-H06GATCCGACGTGGGCCAANONE
006-097-E07GATCCGACGTGGGCCAANONE
006-098-D03GATCCGACGTGGGCCAANONE
006-102-C05GATCCGACGTGGGCCAANONE
006-107-E09GATCCGACGTGGGCCAANONE
006-110-C09GATCCGACGTGGGCCAANONE
006-113-C01GATCCGACGTGGGCCAANONE
006-114-D09GATCCGACGTGGGCCAANONE
006-115-H06GATCCGACGTGGGCCAANONE
009-016-G06GATCCGACGTGGGCCAANONE
009-031-C05GATCCGACGTGGGCCAANONE
009-060-B05GATCCGACGTGGGCCAANONE
009-123-H12GATCCGACGTGGGCCAANONE
009-154-B09GATCCGACGTGGGCCAANONE
009-172-F07GATCCGACGTGGGCCAANONE
009-193-A04GATCCGACGTGGGCCAANONE
AF022732GATCCGACGTGGGCCAANONE
AF052203GATCCGACGTGGGCCAANONE
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II.
AK104722GATCCGACGTGGGCCAANONE
D49713GATCCGACGTGGGCCAANONE
J013002J02GATCCGACGTGGGCCAANONE
J065051O13GATCCGACGTGGGCCAANONE
J065066J18GATCCGACGTGGGCCAANONE
J065077G23GATCCGACGTGGGCCAANONE
J065162C22GATCCGACGTGGGCCAANONE
J065162G22GATCCGACGTGGGCCAANONE
J075091B13GATCCGACGTGGGCCAANONE
J075099J22GATCCGACGTGGGCCAANONE
J100056O22GATCCGACGTGGGCCAANONE
J100059E01GATCCGACGTGGGCCAANONE
J100079F20GATCCGACGTGGGCCAANONE
Os07g0152800AK065458TACTGGGCCCACGTGTConserved hypothetical protein.
J013022G05TACTGGGCCCACGTGTNONE
J013023D18TACTGGGCCCACGTGTNONE
J013048J16TACTGGGCCCACGTGTNONE
J013055I03TACTGGGCCCACGTGTNONE
J013057F12TACTGGGCCCACGTGTNONE
J023109A22TACTGGGCCCACGTGTNONE
J023148E09TACTGGGCCCACGTGTNONE
J033069G17TACTGGGCCCACGTGTNONE
J033092I18TACTGGGCCCACGTGTNONE
J033093C02TACTGGGCCCACGTGTNONE
J033141M17TACTGGGCCCACGTGTNONE
J043016M18TACTGGGCCCACGTGTNONE
J090016D12TACTGGGCCCACGTGTNONE
J090071B10TACTGGGCCCACGTGTNONE
J090098K07TACTGGGCCCACGTGTNONE
J100035K14TACTGGGCCCACGTGTNONE
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein.
Os07g0173200AK061624ACCGGGCCCACGTFrigida-like family protein.
AK065275ACCGGGCCCACGTNONE
AK098856ACCGGGCCCACGTNONE
AK098899ACCGGGCCCACGTNONE
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein.
Os07g0190600AK070975AGCCCACGTGSimilar to Helicase.
Os07g0301200AB110202AGCCCACGTGNONE
AB110202CACGTGGGCCGGCNONE
AK073463AGCCCACGTGSimilar to RNA helicase (Fragment).
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment).
Os07g0435100AB037153ACGTGGGCCTCNONE
AK061383ACGTGGGCCTCSimilar to 26S proteasome subunit RPN12.
AK061408ACGTGGGCCTCNONE
AK101316ACGTGGGCCTCNONE
J023133D07ACGTGGGCCTCNONE
J023136B17ACGTGGGCCTCNONE
J033065M08ACGTGGGCCTCNONE
J033070F05ACGTGGGCCTCNONE
J033070L20ACGTGGGCCTCNONE
J033108J15ACGTGGGCCTCNONE
J053080M19ACGTGGGCCTCNONE
J053091B15ACGTGGGCCTCNONE
J065067J03ACGTGGGCCTCNONE
J065102C02ACGTGGGCCTCNONE
J065135H09ACGTGGGCCTCNONE
J080302K03ACGTGGGCCTCNONE
J090059J11ACGTGGGCCTCNONE
J090074G14ACGTGGGCCTCNONE
J100025F20ACGTGGGCCTCNONE
J100028L08ACGTGGGCCTCNONE
J100049L14ACGTGGGCCTCNONE
J100054O07ACGTGGGCCTCNONE
Os07g0486000AK069343AGGTGGGCCCACGTGSimilar to MSH4.
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein.
AK068175CGGGCCCACGTGTCGNONE
J013130L24CGGGCCCACGTGTCGNONE
J013156J03CGGGCCCACGTGTCGNONE
J033031L21CGGGCCCACGTGTCGNONE
J043001A20CGGGCCCACGTGTCGNONE
J043007B17CGGGCCCACGTGTCGNONE
J043017M19CGGGCCCACGTGTCGNONE
J043024H09CGGGCCCACGTGTCGNONE
J043030B12CGGGCCCACGTGTCGNONE
J065177C18CGGGCCCACGTGTCGNONE
J075004K10CGGGCCCACGTGTCGNONE
J075004K12CGGGCCCACGTGTCGNONE
J075088G07CGGGCCCACGTGTCGNONE
J075107M02CGGGCCCACGTGTCGNONE
J075126G01CGGGCCCACGTGTCGNONE
J075185J08CGGGCCCACGTGTCGNONE
J100034E04CGGGCCCACGTGTCGNONE
J100038G12CGGGCCCACGTGTCGNONE
Os07g0515700AK103117ACGTGGGCGGTGGGCTAnkyrin repeat containing protein.
Os07g0555400AK070977CACGTGGGCCGGAConserved hypothetical protein.
Os07g0561300AK072982ACGTGGGCTGCCyclin-like F-box domain containing protein.
J023149I22ACGTGGGCTGCNONE
J065149C18ACGTGGGCTGCNONE
J065166N15ACGTGGGCTGCNONE
J075011J01ACGTGGGCTGCNONE
J075013I05ACGTGGGCTGCNONE
J075039H11ACGTGGGCTGCNONE
J075067J09ACGTGGGCTGCNONE
J075084E08ACGTGGGCTGCNONE
J075085E12ACGTGGGCTGCNONE
J075090D11ACGTGGGCTGCNONE
J075092D12ACGTGGGCTGCNONE
J075126N17ACGTGGGCTGCNONE
J075179F01ACGTGGGCTGCNONE
J075184P21ACGTGGGCTGCNONE
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein.
J013002I12AGTTGGGCCCAAGCCCACGTGNONE
Os07g0589400AK072501CACGTGGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein.
AK104617CACGTGGGCCGGTNONE
AK104756CACGTGGGCCGGTNONE
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE
Os07g0591400TGGGGCCCACGTGGGCCCACANONE
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein.
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE
Os07g0616900AK071047ACGTGGGCCCTProtein of unknown function DUF500 family protein.
J013106G03ACGTGGGCCCTNONE
J013124C20ACGTGGGCCCTNONE
J033096D16ACGTGGGCCCTNONE
J043005E08ACGTGGGCCCTNONE
J065197K12ACGTGGGCCCTNONE
J065211I03ACGTGGGCCCTNONE
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein.
Os07g0694700006-021-A10GCCACGTGGGCNONE
006-027-C12GCCACGTGGGCNONE
006-070-B12GCCACGTGGGCNONE
006-077-D01GCCACGTGGGCNONE
006-105-E07GCCACGTGGGCNONE
006-111-H07GCCACGTGGGCNONE
009-066-B07GCCACGTGGGCNONE
009-199-H12GCCACGTGGGCNONE
AB050724GCCACGTGGGCNONE
AB053297GCCACGTGGGCNONE
AK061715GCCACGTGGGCNONE
AK068430GCCACGTGGGCL-ascorbate peroxidase.
J013021I10GCCACGTGGGCNONE
J013034P12GCCACGTGGGCNONE
J013045L04GCCACGTGGGCNONE
J013050F21GCCACGTGGGCNONE
J013066C16GCCACGTGGGCNONE
J013067N13GCCACGTGGGCNONE
J013111K04GCCACGTGGGCNONE
J013123I20GCCACGTGGGCNONE
J013126F24GCCACGTGGGCNONE
J013134J06GCCACGTGGGCNONE
J013155B13GCCACGTGGGCNONE
J013156P11GCCACGTGGGCNONE
J023003N11GCCACGTGGGCNONE
J023008D23GCCACGTGGGCNONE
J023011I01GCCACGTGGGCNONE
J023014M13GCCACGTGGGCNONE
J023020A10GCCACGTGGGCNONE
J023028F09GCCACGTGGGCNONE
J023034I04GCCACGTGGGCNONE
J023037L11GCCACGTGGGCNONE
J023065M21GCCACGTGGGCNONE
J023072C05GCCACGTGGGCNONE
J023073M06GCCACGTGGGCNONE
J023079M21GCCACGTGGGCNONE
J023081M07GCCACGTGGGCNONE
J023082O15GCCACGTGGGCNONE
J023086M10GCCACGTGGGCNONE
J023087H15GCCACGTGGGCNONE
J023088K10GCCACGTGGGCNONE
J023091G08GCCACGTGGGCNONE
J023098C04GCCACGTGGGCNONE
J023102D23GCCACGTGGGCNONE
J023106M19GCCACGTGGGCNONE
J023110D18GCCACGTGGGCNONE
J023111B03GCCACGTGGGCNONE
J023115I03GCCACGTGGGCNONE
J023120G01GCCACGTGGGCNONE
J023126C05GCCACGTGGGCNONE
J023126C11GCCACGTGGGCNONE
J023126F22GCCACGTGGGCNONE
J023131L23GCCACGTGGGCNONE
J023132K24GCCACGTGGGCNONE
J023139P05GCCACGTGGGCNONE
J023140F02GCCACGTGGGCNONE
J023141F15GCCACGTGGGCNONE
J023149G01GCCACGTGGGCNONE
J033024O13GCCACGTGGGCNONE
J033026M13GCCACGTGGGCNONE
J033061C14GCCACGTGGGCNONE
J033103E18GCCACGTGGGCNONE
J033103L21GCCACGTGGGCNONE
J033107I09GCCACGTGGGCNONE
J033111N15GCCACGTGGGCNONE
J033120G04GCCACGTGGGCNONE
J033124J05GCCACGTGGGCNONE
J043015A21GCCACGTGGGCNONE
J043022H01GCCACGTGGGCNONE
J043027O20GCCACGTGGGCNONE
J043031F14GCCACGTGGGCNONE
J065047K03GCCACGTGGGCNONE
J065093N11GCCACGTGGGCNONE
J065105P20GCCACGTGGGCNONE
J065164L16GCCACGTGGGCNONE
J065167K06GCCACGTGGGCNONE
J075087I15GCCACGTGGGCNONE
J080032F23GCCACGTGGGCNONE
J080061N21GCCACGTGGGCNONE
J080064L14GCCACGTGGGCNONE
J080064L20GCCACGTGGGCNONE
J080304B21GCCACGTGGGCNONE
J080305A04GCCACGTGGGCNONE
J080308L24GCCACGTGGGCNONE
J080312J04GCCACGTGGGCNONE
J080319N10GCCACGTGGGCNONE
J090011C08GCCACGTGGGCNONE
J090028G14GCCACGTGGGCNONE
J090037N03GCCACGTGGGCNONE
J090041I10GCCACGTGGGCNONE
J090057B14GCCACGTGGGCNONE
J090062P18GCCACGTGGGCNONE
J090072L03GCCACGTGGGCNONE
J090073A02GCCACGTGGGCNONE
J090073C10GCCACGTGGGCNONE
J090078N11GCCACGTGGGCNONE
J090085L16GCCACGTGGGCNONE
J100023N07GCCACGTGGGCNONE
J100028F02GCCACGTGGGCNONE
J100033K09GCCACGTGGGCNONE
J100038K23GCCACGTGGGCNONE
J100038O11GCCACGTGGGCNONE
J100040G12GCCACGTGGGCNONE
J100057L23GCCACGTGGGCNONE
J100058N21GCCACGTGGGCNONE
J100059N10GCCACGTGGGCNONE
J100063D09GCCACGTGGGCNONE
J100065O12GCCACGTGGGCNONE
J100066G11GCCACGTGGGCNONE
J100067I01GCCACGTGGGCNONE
J100069J23GCCACGTGGGCNONE
J100071M03GCCACGTGGGCNONE
J100072C11GCCACGTGGGCNONE
J100072D01GCCACGTGGGCNONE
J100079M19GCCACGTGGGCNONE
Os07g0695400015-036-B08ACGTGGGCTGCNONE
AK100615ACGTGGGCTGCNONE
AK106304ACGTGGGCTGCKIP1-like domain containing protein.
J023108B01ACGTGGGCTGCNONE
Os08g0150800AK101530AGCCCACGTSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS.
Os08g0195400006-057-E04CACGTGGGCTGGNONE
006-060-B10CACGTGGGCTGGNONE
AK070464CACGTGGGCTGGConserved hypothetical protein.
AK104389CACGTGGGCTGGNONE
AK106140CACGTGGGCTGGNONE
J023013G08CACGTGGGCTGGNONE
J023054K19CACGTGGGCTGGNONE
J023089D18CACGTGGGCTGGNONE
J023092K05CACGTGGGCTGGNONE
J033025A08CACGTGGGCTGGNONE
J033067P12CACGTGGGCTGGNONE
J033098A10CACGTGGGCTGGNONE
J065219L04CACGTGGGCTGGNONE
J090021P06CACGTGGGCTGGNONE
J090062M05CACGTGGGCTGGNONE
J090079F15CACGTGGGCTGGNONE
J100041H19CACGTGGGCTGGNONE
Os08g0224200AK101331CACGTGGGCTGGSimilar to Ythdf2-prov protein.
Os08g0305000AK102896TGTGGGGCCCACGTGGGNONE
AK107492TGTGGGGCCCACGTGGGHypothetical protein.
Os08g0386300AK059323GTGGCCCACGTGGCNONE
AK070379GTGGCCCACGTGGCCytochrome b5 domain containing protein.
J023054P20GTGGCCCACGTGGCNONE
J033089H01GTGGCCCACGTGGCNONE
J065013I01GTGGCCCACGTGGCNONE
J065212E17GTGGCCCACGTGGCNONE
J080317O15GTGGCCCACGTGGCNONE
J090018O07GTGGCCCACGTGGCNONE
Os08g0398000AK101910CACTGACACGTGGGCCCCACAABC transporter related domain containing protein.
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein.
J065129E01AATTGGGCCCACGTGTCNONE
J065134I05AATTGGGCCCACGTGTCNONE
J065212K13AATTGGGCCCACGTGTCNONE
J065217M14AATTGGGCCCACGTGTCNONE
Os08g0485700AK068131TCGGCCCACGTNONE
AK069097TCGGCCCACGTMethyl-CpG binding domain containing protein.
J013130L03TCGGCCCACGTNONE
Os08g0535400004-001-H10GAGACGTGGGCCCCACCCTCGCGCGCNONE
AK071527GAGACGTGGGCCCCACCCTCGCGCGCZinc finger, DHHC-type domain containing protein.
J023107B02GAGACGTGGGCCCCACCCTCGCGCGCNONE
Os08g0544500AK071354ACGTGGGCCCGSimilar to ARP2/3 regulatory protein subunit NAPP.
Os08g0549300009-008-F01CGCCACGTGGGCCCCACCNONE
009-033-G10CGCCACGTGGGCCCCACCNONE
AK120938CGCCACGTGGGCCCCACCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III).
D10420CGCCACGTGGGCCCCACCNONE
J023037A21CGCCACGTGGGCCCCACCNONE
J023066D20CGCCACGTGGGCCCCACCNONE
J033099K13CGCCACGTGGGCCCCACCNONE
J065116C14CGCCACGTGGGCCCCACCNONE
J075009K15CGCCACGTGGGCCCCACCNONE
J075071P13CGCCACGTGGGCCCCACCNONE
J075080D18CGCCACGTGGGCCCCACCNONE
J075124F24CGCCACGTGGGCCCCACCNONE
J075198F23CGCCACGTGGGCCCCACCNONE
J080006B15CGCCACGTGGGCCCCACCNONE
J090078H13CGCCACGTGGGCCCCACCNONE
J090089J09CGCCACGTGGGCCCCACCNONE
J100017A03CGCCACGTGGGCCCCACCNONE
J100023G03CGCCACGTGGGCCCCACCNONE
Os08g0556200009-008-D12ACGTGGGCCCCNONE
AK121222ACGTGGGCCCCSimilar to Dihydroneopterin aldolase.
J023090H22ACGTGGGCCCCNONE
J075027J23ACGTGGGCCCCNONE
J075032L14ACGTGGGCCCCNONE
J075053H04ACGTGGGCCCCNONE
J075171P20ACGTGGGCCCCNONE
J100057F12ACGTGGGCCCCNONE
Os09g0113000009-104-D11GCCCACGTNONE
AK062770GCCCACGTHypothetical protein.
Os09g0332700AK067899CACGGCCCACGTSimilar to PDR-type ABC transporter 2 (Fragment).
Os09g0462200AK064734CACGTGGGCCACEsterase/lipase/thioesterase domain containing protein.
Os09g0462300J065097M23GTGGCCCACGTGEsterase/lipase/thioesterase domain containing protein.
J065161K12GTGGCCCACGTGNONE
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein.
J013123P13TCGGCCCATCAGGCCCACGTNONE
J023013I09TCGGCCCATCAGGCCCACGTNONE
J023023G08TCGGCCCATCAGGCCCACGTNONE
J023043E08TCGGCCCATCAGGCCCACGTNONE
J033124D24TCGGCCCATCAGGCCCACGTNONE
J065047I07TCGGCCCATCAGGCCCACGTNONE
J065093C16TCGGCCCATCAGGCCCACGTNONE
J090088O03TCGGCCCATCAGGCCCACGTNONE
J100032M21TCGGCCCATCAGGCCCACGTNONE
Os09g0517800012-034-H10CCACGGCCTGGATGGGCCCACGTNONE
AK121391CCACGGCCTGGATGGGCCCACGTCyclin-like F-box domain containing protein.
J023129D04CCACGGCCTGGATGGGCCCACGTNONE
J043012D11CCACGGCCTGGATGGGCCCACGTNONE
Os11g0187500012-002-D06TCATGGGCTATGGCCCACGTNONE
012-035-H04TCATGGGCTATGGCCCACGTNONE
012-065-F08TCATGGGCTATGGCCCACGTNONE
AK063977TCATGGGCTATGGCCCACGTSimilar to Heat shock protein 70.
AK103083TCATGGGCTATGGCCCACGTNONE
J033118G15TCATGGGCTATGGCCCACGTNONE
J065115E02TCATGGGCTATGGCCCACGTNONE
J065178K04TCATGGGCTATGGCCCACGTNONE
J065178L03TCATGGGCTATGGCCCACGTNONE
J090064A22TCATGGGCTATGGCCCACGTNONE
Os11g0199600AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein.
AK120040TCGGCCCATTAACGGCCCACGTNONE
J023047I06TCGGCCCATTAACGGCCCACGTNONE
J033064L23TCGGCCCATTAACGGCCCACGTNONE
J033117I01TCGGCCCATTAACGGCCCACGTNONE
J033123I18TCGGCCCATTAACGGCCCACGTNONE
J053026H17TCGGCCCATTAACGGCCCACGTNONE
J053078G05TCGGCCCATTAACGGCCCACGTNONE
J065102A09TCGGCCCATTAACGGCCCACGTNONE
J065113G11TCGGCCCATTAACGGCCCACGTNONE
J065207F20TCGGCCCATTAACGGCCCACGTNONE
J075027K21TCGGCCCATTAACGGCCCACGTNONE
Os11g0200600AK101818GCCACGTGGGCCyclin-like F-box domain containing protein.
AK111444GCCACGTGGGCNONE
J065098I12GCCACGTGGGCNONE
Os11g0216100AK059179ACGTGGGCCCGGGSimilar to Chaperone protein dnaJ.
Os11g0530600AB000801AGCCCACGTGGCSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2).
AK067810AGCCCACGTGGCNONE
D29697AGCCCACGTGGCNONE
J013119K06AGCCCACGTGGCNONE
J023001C21AGCCCACGTGGCNONE
J023081C19AGCCCACGTGGCNONE
J065026K21AGCCCACGTGGCNONE
J065040A17AGCCCACGTGGCNONE
J065043H01AGCCCACGTGGCNONE
J065093P05AGCCCACGTGGCNONE
J065104P15AGCCCACGTGGCNONE
J065127C09AGCCCACGTGGCNONE
J065140D08AGCCCACGTGGCNONE
X89859AGCCCACGTGGCNONE
Os11g0582400AF049348CCCCCGCGCGCGACGTGGGCTConserved hypothetical protein.
AF516927CCCCCGCGCGCGACGTGGGCTNONE
AK073083CCCCCGCGCGCGACGTGGGCTNONE
AK108352CCCCCGCGCGCGACGTGGGCTNONE
J075005O16CCCCCGCGCGCGACGTGGGCTNONE
J075007D15CCCCCGCGCGCGACGTGGGCTNONE
J075007L04CCCCCGCGCGCGACGTGGGCTNONE
J075009C11CCCCCGCGCGCGACGTGGGCTNONE
J075012L11CCCCCGCGCGCGACGTGGGCTNONE
J075013A14CCCCCGCGCGCGACGTGGGCTNONE
J075015K01CCCCCGCGCGCGACGTGGGCTNONE
J075019O21CCCCCGCGCGCGACGTGGGCTNONE
J075020G20CCCCCGCGCGCGACGTGGGCTNONE
J075020H06CCCCCGCGCGCGACGTGGGCTNONE
J075022D07CCCCCGCGCGCGACGTGGGCTNONE
J075024M12CCCCCGCGCGCGACGTGGGCTNONE
J075025G04CCCCCGCGCGCGACGTGGGCTNONE
J075026F09CCCCCGCGCGCGACGTGGGCTNONE
J075027D19CCCCCGCGCGCGACGTGGGCTNONE
J075030A12CCCCCGCGCGCGACGTGGGCTNONE
J075030C16CCCCCGCGCGCGACGTGGGCTNONE
J075030D15CCCCCGCGCGCGACGTGGGCTNONE
J075034M20CCCCCGCGCGCGACGTGGGCTNONE
J075041H12CCCCCGCGCGCGACGTGGGCTNONE
J075052D12CCCCCGCGCGCGACGTGGGCTNONE
J075052G11CCCCCGCGCGCGACGTGGGCTNONE
J075053L09CCCCCGCGCGCGACGTGGGCTNONE
J075064G05CCCCCGCGCGCGACGTGGGCTNONE
J075067J01CCCCCGCGCGCGACGTGGGCTNONE
J075071O03CCCCCGCGCGCGACGTGGGCTNONE
J075072G12CCCCCGCGCGCGACGTGGGCTNONE
J075078H06CCCCCGCGCGCGACGTGGGCTNONE
J075081D06CCCCCGCGCGCGACGTGGGCTNONE
J075084G23CCCCCGCGCGCGACGTGGGCTNONE
J075085M10CCCCCGCGCGCGACGTGGGCTNONE
J075087N20CCCCCGCGCGCGACGTGGGCTNONE
J075088E11CCCCCGCGCGCGACGTGGGCTNONE
J075088O22CCCCCGCGCGCGACGTGGGCTNONE
J075091E10CCCCCGCGCGCGACGTGGGCTNONE
J075092B12CCCCCGCGCGCGACGTGGGCTNONE
J075093E08CCCCCGCGCGCGACGTGGGCTNONE
J075095D04CCCCCGCGCGCGACGTGGGCTNONE
J075095J10CCCCCGCGCGCGACGTGGGCTNONE
J075095O19CCCCCGCGCGCGACGTGGGCTNONE
J075096H20CCCCCGCGCGCGACGTGGGCTNONE
J075098F10CCCCCGCGCGCGACGTGGGCTNONE
J075100H10CCCCCGCGCGCGACGTGGGCTNONE
J075104C23CCCCCGCGCGCGACGTGGGCTNONE
J075105B10CCCCCGCGCGCGACGTGGGCTNONE
J075106I24CCCCCGCGCGCGACGTGGGCTNONE
J075109H23CCCCCGCGCGCGACGTGGGCTNONE
J075115A03CCCCCGCGCGCGACGTGGGCTNONE
J075118M06CCCCCGCGCGCGACGTGGGCTNONE
J075121G08CCCCCGCGCGCGACGTGGGCTNONE
J075122C09CCCCCGCGCGCGACGTGGGCTNONE
J075122J12CCCCCGCGCGCGACGTGGGCTNONE
J075123E06CCCCCGCGCGCGACGTGGGCTNONE
J075123E16CCCCCGCGCGCGACGTGGGCTNONE
J075124N09CCCCCGCGCGCGACGTGGGCTNONE
J075127F23CCCCCGCGCGCGACGTGGGCTNONE
J075128H17CCCCCGCGCGCGACGTGGGCTNONE
J075129C02CCCCCGCGCGCGACGTGGGCTNONE
J075139P18CCCCCGCGCGCGACGTGGGCTNONE
J075140H17CCCCCGCGCGCGACGTGGGCTNONE
J075146E12CCCCCGCGCGCGACGTGGGCTNONE
J075146I07CCCCCGCGCGCGACGTGGGCTNONE
J075150A08CCCCCGCGCGCGACGTGGGCTNONE
J075150I22CCCCCGCGCGCGACGTGGGCTNONE
J075155D01CCCCCGCGCGCGACGTGGGCTNONE
J075155N10CCCCCGCGCGCGACGTGGGCTNONE
J075155O09CCCCCGCGCGCGACGTGGGCTNONE
J075156K11CCCCCGCGCGCGACGTGGGCTNONE
J075157N01CCCCCGCGCGCGACGTGGGCTNONE
J075164L09CCCCCGCGCGCGACGTGGGCTNONE
J075166F14CCCCCGCGCGCGACGTGGGCTNONE
J075169E20CCCCCGCGCGCGACGTGGGCTNONE
J075170B13CCCCCGCGCGCGACGTGGGCTNONE
J075170F24CCCCCGCGCGCGACGTGGGCTNONE
J075170N16CCCCCGCGCGCGACGTGGGCTNONE
J075172H22CCCCCGCGCGCGACGTGGGCTNONE
J075172I02CCCCCGCGCGCGACGTGGGCTNONE
J075176E08CCCCCGCGCGCGACGTGGGCTNONE
J075177H17CCCCCGCGCGCGACGTGGGCTNONE
J075179C18CCCCCGCGCGCGACGTGGGCTNONE
J075182H23CCCCCGCGCGCGACGTGGGCTNONE
J075187B10CCCCCGCGCGCGACGTGGGCTNONE
J075192L10CCCCCGCGCGCGACGTGGGCTNONE
J075195C04CCCCCGCGCGCGACGTGGGCTNONE
U25969CCCCCGCGCGCGACGTGGGCTNONE
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein.
Os11g0595200009-005-A06GCCCACGTGNONE
AK071115GCCCACGTGNONE
AK106159GCCCACGTGPAP fibrillin family protein.
AY387683GCCCACGTGNONE
AY387684GCCCACGTGNONE
J065166K17GCCCACGTGNONE
Os11g0615700AB026561ACACGTGGGCCCGCANONE
AK059521ACACGTGGGCCCGCANONE
AK103487ACACGTGGGCCCGCAProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5).
J033055A14ACACGTGGGCCCGCANONE
J065044A11ACACGTGGGCCCGCANONE
J065090I02ACACGTGGGCCCGCANONE
J065104I09ACACGTGGGCCCGCANONE
J065187J10ACACGTGGGCCCGCANONE
J075024E07ACACGTGGGCCCGCANONE
J075025O13ACACGTGGGCCCGCANONE
J090062N12ACACGTGGGCCCGCANONE
J090087G06ACACGTGGGCCCGCANONE
J090098K11ACACGTGGGCCCGCANONE
Os11g0620400AK068224ATCGGACGGCCCACGTNONE
AK120270ATCGGACGGCCCACGTConserved hypothetical protein.
Os11g0659500AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment).
AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment).
J013072O18ACGTGGGCCACNONE
J013072O18ACGTGGGCCACNONE
J013097B18ACGTGGGCCACNONE
J013097B18ACGTGGGCCACNONE
J013157H03ACGTGGGCCACNONE
J013157H03ACGTGGGCCACNONE
J023001D14ACGTGGGCCACNONE
J023001D14ACGTGGGCCACNONE
J080311F23ACGTGGGCCACNONE
J080311F23ACGTGGGCCACNONE
J090030F08ACGTGGGCCACNONE
J090030F08ACGTGGGCCACNONE
J090036B09ACGTGGGCCACNONE
J090036B09ACGTGGGCCACNONE
J090045G05ACGTGGGCCACNONE
J090045G05ACGTGGGCCACNONE
J100054J10ACGTGGGCCACNONE
J100054J10ACGTGGGCCACNONE
Os12g0133600AK103096ACGTGGGCTTTConserved hypothetical protein.
J033118M03ACGTGGGCTTTNONE
Os12g0145200AK111428GTGGGACCCACGTGGGCCCCACASimilar to Protein MONOCULM 1.
J065208D22GTGGGACCCACGTGGGCCCCACANONE
Os12g0233500Os12g0233500CCCACGTGGGCCCCANONE
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein.
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein.
Os12g0403800AK059940ACGTGGGCCTCACGTGGGNONE
AK064189ACGTGGGCCTCACGTGGGExoribonuclease domain containing protein.
Os12g0460800J023003J21CACTGACACGTGGGCCACNONE
Os12g0507600009-155-B05TGGGGCCCACGTNONE
AK070613TGGGGCCCACGTConserved hypothetical protein.
J023063G03TGGGGCCCACGTNONE
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein.
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment).
AK099125CCCGGGCCCACGTGTCNONE
AK099149CCCGGGCCCACGTGTCNONE
J023044P12CCCGGGCCCACGTGTCNONE
J023063C05CCCGGGCCCACGTGTCNONE
J043006H11CCCGGGCCCACGTGTCNONE
J065055C21CCCGGGCCCACGTGTCNONE
J065104A14CCCGGGCCCACGTGTCNONE
J075156I06CCCGGGCCCACGTGTCNONE
J090083J19CCCGGGCCCACGTGTCNONE
J100069A17CCCGGGCCCACGTGTCNONE
Os12g0573000AK067552AACGGCCCACGGCCCACGTHypothetical protein.
AK069292AACGGCCCACGGCCCACGTNONE
Os12g0578500AK065485ACACGTGGGCGlycosyl transferase, family 8 protein.
J043027D21ACACGTGGGCNONE
J075120F12ACACGTGGGCNONE
J080010J21ACACGTGGGCNONE
J080015L10ACACGTGGGCNONE
J080016C19ACACGTGGGCNONE
J080016F10ACACGTGGGCNONE
J080022A12ACACGTGGGCNONE
J080024B10ACACGTGGGCNONE
J080025C16ACACGTGGGCNONE
J080026B03ACACGTGGGCNONE
J080028B11ACACGTGGGCNONE
J080028M19ACACGTGGGCNONE
J080030I02ACACGTGGGCNONE
J080032F18ACACGTGGGCNONE
J080038O16ACACGTGGGCNONE
J080040D01ACACGTGGGCNONE
J080043H19ACACGTGGGCNONE
J080045N21ACACGTGGGCNONE
J080046H14ACACGTGGGCNONE
J080053B20ACACGTGGGCNONE
J080053P14ACACGTGGGCNONE
J080056L15ACACGTGGGCNONE
J080057F14ACACGTGGGCNONE
J080060C10ACACGTGGGCNONE
J080061D20ACACGTGGGCNONE
J080061J12ACACGTGGGCNONE
J080062F17ACACGTGGGCNONE
J080065M15ACACGTGGGCNONE
J080066N15ACACGTGGGCNONE
J080069K21ACACGTGGGCNONE
J080070L14ACACGTGGGCNONE
J080072L05ACACGTGGGCNONE
J080072L16ACACGTGGGCNONE
J080075D08ACACGTGGGCNONE
J080075I19ACACGTGGGCNONE
J080076M24ACACGTGGGCNONE
J080077M11ACACGTGGGCNONE
J080078O10ACACGTGGGCNONE
J080081K24ACACGTGGGCNONE
J080082J02ACACGTGGGCNONE
J080083N20ACACGTGGGCNONE
J080085M09ACACGTGGGCNONE
J080093K05ACACGTGGGCNONE
J080094J19ACACGTGGGCNONE
J080095E06ACACGTGGGCNONE
J080096B04ACACGTGGGCNONE
J080096H08ACACGTGGGCNONE
J090034I21ACACGTGGGCNONE
J090045J19ACACGTGGGCNONE
J090065F20ACACGTGGGCNONE
J100077M24ACACGTGGGCNONE
Os12g0580400AK099986GCCACGTGGGCCCACCAmino acid/polyamine transporter I family protein.
J065120C05GCCACGTGGGCCCACCNONE
Os12g0596000AK073530ACAGCCCACGTSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B).
AK101541ACAGCCCACGTNONE
Os12g0609800AK101303CCCGGCCCACGTCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein.
J033032I01CCCGGCCCACGTNONE
J033033K21CCCGGCCCACGTNONE
J033082L13CCCGGCCCACGTNONE
J043034M20CCCGGCCCACGTNONE
J065137J24CCCGGCCCACGTNONE
J065141A11CCCGGCCCACGTNONE
J065217H09CCCGGCCCACGTNONE
Os12g0621500AK111785TGTGGGGCCCACGTGSimilar to IRE.


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.