version

Summary of CGACG (All list)

Organism Oryza sativa
PLACE Motif CGACG
Description "CGACG element" found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene; May function as a coupling element for the G box element;
Total Entry Count 5170

Entry Sequences (5170 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087GACGCGACGCACCGCNONE
AK103808GACGCGACGCACCGCC-type lectin domain containing protein.
Os01g0104100AK072797GCGGTGCGTCGCGTCZinc finger, RING-type domain containing protein.
AK104280GCGGTGCGTCGCGTCNONE
Os01g0139900AK121677CGCGACGCConserved hypothetical protein.
J033069D19CGCGACGCNONE
Os01g0141100012-043-A12GCGACGCGNONE
AK062139GCGACGCGNONE
J013110M14GCGACGCGNONE
J013114F09GCGACGCGNONE
J033036J01GCGACGCGNONE
Os01g0158100AK109233ATCCGACGGPentatricopeptide repeat containing protein.
Os01g0171200AK107515CGCGACGCNONE
AK109475CGCGACGCConserved hypothetical protein.
Os01g0172400AK065102CGCGACGCGACNONE
AK100365CGCGACGCGACNONE
AK119523CGCGACGCGACNONE
D73411CGCGACGCGACPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1).
J013001N03CGCGACGCGACNONE
J013052B12CGCGACGCGACNONE
J013071F15CGCGACGCGACNONE
J013108F19CGCGACGCGACNONE
J023025E17CGCGACGCGACNONE
J023083O10CGCGACGCGACNONE
J023084M17CGCGACGCGACNONE
J023100D16CGCGACGCGACNONE
J023107O10CGCGACGCGACNONE
J023119F08CGCGACGCGACNONE
J033035B07CGCGACGCGACNONE
J033052C18CGCGACGCGACNONE
J033092H11CGCGACGCGACNONE
J033096D02CGCGACGCGACNONE
J033117A16CGCGACGCGACNONE
J043010E08CGCGACGCGACNONE
J043013C12CGCGACGCGACNONE
J065001M15CGCGACGCGACNONE
J065021O11CGCGACGCGACNONE
J065089O20CGCGACGCGACNONE
J065117N05CGCGACGCGACNONE
J065129L11CGCGACGCGACNONE
J065170F18CGCGACGCGACNONE
J090066E11CGCGACGCGACNONE
J090076N24CGCGACGCGACNONE
J090093G21CGCGACGCGACNONE
J100041H17CGCGACGCGACNONE
J100050D07CGCGACGCGACNONE
J100063A06CGCGACGCGACNONE
Os01g0179300AB118015CGCGACGCGNONE
AK066179CGCGACGCGConserved hypothetical protein.
J013027I24CGCGACGCGNONE
J013057C04CGCGACGCGNONE
J013114A12CGCGACGCGNONE
J033044D13CGCGACGCGNONE
J033088C17CGCGACGCGNONE
J065079P13CGCGACGCGNONE
J065097I15CGCGACGCGNONE
J100025A19CGCGACGCGNONE
J100027L07CGCGACGCGNONE
J100035E12CGCGACGCGNONE
J100076G01CGCGACGCGNONE
Os01g0184000015-008-B06CCGTCGGATCNONE
AK071130CCGTCGGATCNUC156 family protein.
AK100604CCGTCGGATCNONE
Os01g0201400AK070397CGCGTCGCGRapid ALkalinization Factor family protein.
Os01g0205900006-057-B04CGCACGCGACGCGACNONE
AK060687CGCACGCGACGCGACNONE
AK105932CGCACGCGACGCGACSimilar to Class III peroxidase GvPx2b (Fragment).
J033143I12CGCACGCGACGCGACNONE
J075013J08CGCACGCGACGCGACNONE
J075090B11CGCACGCGACGCGACNONE
J075143C17CGCACGCGACGCGACNONE
J075147O13CGCACGCGACGCGACNONE
J075161L02CGCACGCGACGCGACNONE
Os01g0211600AK060710GCGTCGCGCytochrome P450 family protein.
Os01g0223600AK110821CGCGTCGCSimilar to Pto kinase interactor 1-like protein.
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein.
Os01g0226400AK102301CGCGACGCGAAA ATPase domain containing protein.
Os01g0231500AK111599CGCGTCGCSimilar to Casein kinase I (Fragment).
J013002P18CGCGTCGCNONE
J013021D19CGCGTCGCNONE
J013075E24CGCGTCGCNONE
J013095J05CGCGTCGCNONE
J013098O18CGCGTCGCNONE
J013126P20CGCGTCGCNONE
J033123B12CGCGTCGCNONE
J090048M08CGCGTCGCNONE
Os01g0268000AK107975GTCGCGTCGCHypothetical protein.
J065065G10GTCGCGTCGCNONE
J065196O11GTCGCGTCGCNONE
Os01g0276300AK108165CGCGACGCSimilar to Group 3 late embryogenesis abundant protein (Fragment).
Os01g0279700AK067683CGCGTCGCGTCNONE
AK100107CGCGTCGCGTCMajor facilitator superfamily protein.
J023004N09CGCGTCGCGTCNONE
J075019L14CGCGTCGCGTCNONE
J075187F21CGCGTCGCGTCNONE
Os01g0295700AK070333CCCCCGCGCGTCGCSimilar to Protein phosphatase-2C.
Os01g0305900Os01g0305900CGCGTCGCGTCGCSimilar to A-type R2R3 Myb protein (Fragment).
Os01g0331900013-026-D04GCCACGTCGGATNONE
AK064784GCCACGTCGGATNONE
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein.
J013000B15GCCACGTCGGATNONE
J033090D07GCCACGTCGGATNONE
J090006L21GCCACGTCGGATNONE
Os01g0363600014-029-H08CCGTCGGATNONE
AK063667CCGTCGGATConserved hypothetical protein.
Os01g0390400AK067433ACGTGTCGCGACGCGNONE
AK106834ACGTGTCGCGACGCGNONE
J033069B09ACGTGTCGCGACGCGNONE
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE
Os01g0550300006-081-F12CCGAGCCGAGCCGCGTCGCNONE
006-114-A02CCGAGCCGAGCCGCGTCGCNONE
006-117-A04CCGAGCCGAGCCGCGTCGCNONE
011-003-H03CCGAGCCGAGCCGCGTCGCNONE
011-025-B09CCGAGCCGAGCCGCGTCGCNONE
011-069-B06CCGAGCCGAGCCGCGTCGCNONE
011-074-D07CCGAGCCGAGCCGCGTCGCNONE
012-029-E03CCGAGCCGAGCCGCGTCGCNONE
012-050-F04CCGAGCCGAGCCGCGTCGCNONE
012-072-D11CCGAGCCGAGCCGCGTCGCNONE
013-093-E04CCGAGCCGAGCCGCGTCGCNONE
015-070-C10CCGAGCCGAGCCGCGTCGCNONE
015-089-A01CCGAGCCGAGCCGCGTCGCNONE
015-095-H06CCGAGCCGAGCCGCGTCGCNONE
016-014-H08CCGAGCCGAGCCGCGTCGCNONE
016-056-E07CCGAGCCGAGCCGCGTCGCNONE
016-089-A01CCGAGCCGAGCCGCGTCGCNONE
AK061870CCGAGCCGAGCCGCGTCGCSimilar to Gda-1 protein.
AK067529CCGAGCCGAGCCGCGTCGCNONE
AK106151CCGAGCCGAGCCGCGTCGCNONE
J013039D11CCGAGCCGAGCCGCGTCGCNONE
J013050K19CCGAGCCGAGCCGCGTCGCNONE
J013069F08CCGAGCCGAGCCGCGTCGCNONE
J013108E24CCGAGCCGAGCCGCGTCGCNONE
J013132D19CCGAGCCGAGCCGCGTCGCNONE
J023039B18CCGAGCCGAGCCGCGTCGCNONE
J023088C10CCGAGCCGAGCCGCGTCGCNONE
J023121M13CCGAGCCGAGCCGCGTCGCNONE
J033034I21CCGAGCCGAGCCGCGTCGCNONE
J033118N14CCGAGCCGAGCCGCGTCGCNONE
J033150M22CCGAGCCGAGCCGCGTCGCNONE
J043004F18CCGAGCCGAGCCGCGTCGCNONE
J043005J04CCGAGCCGAGCCGCGTCGCNONE
J043020E12CCGAGCCGAGCCGCGTCGCNONE
J065063C02CCGAGCCGAGCCGCGTCGCNONE
J065102D15CCGAGCCGAGCCGCGTCGCNONE
J065200P03CCGAGCCGAGCCGCGTCGCNONE
J065208C22CCGAGCCGAGCCGCGTCGCNONE
J065215B03CCGAGCCGAGCCGCGTCGCNONE
J075013N21CCGAGCCGAGCCGCGTCGCNONE
J075024P21CCGAGCCGAGCCGCGTCGCNONE
J075027L19CCGAGCCGAGCCGCGTCGCNONE
J075037F12CCGAGCCGAGCCGCGTCGCNONE
J075084P15CCGAGCCGAGCCGCGTCGCNONE
J075086M06CCGAGCCGAGCCGCGTCGCNONE
J075116A02CCGAGCCGAGCCGCGTCGCNONE
J075136P18CCGAGCCGAGCCGCGTCGCNONE
J075181A01CCGAGCCGAGCCGCGTCGCNONE
J075198O11CCGAGCCGAGCCGCGTCGCNONE
J080002B20CCGAGCCGAGCCGCGTCGCNONE
J080003E05CCGAGCCGAGCCGCGTCGCNONE
J080005A18CCGAGCCGAGCCGCGTCGCNONE
J080005E02CCGAGCCGAGCCGCGTCGCNONE
J080005O18CCGAGCCGAGCCGCGTCGCNONE
J080007B04CCGAGCCGAGCCGCGTCGCNONE
J080007L18CCGAGCCGAGCCGCGTCGCNONE
J080008C17CCGAGCCGAGCCGCGTCGCNONE
J080011I03CCGAGCCGAGCCGCGTCGCNONE
J080014B07CCGAGCCGAGCCGCGTCGCNONE
J080014B09CCGAGCCGAGCCGCGTCGCNONE
J080015A11CCGAGCCGAGCCGCGTCGCNONE
J080016B07CCGAGCCGAGCCGCGTCGCNONE
J080017H23CCGAGCCGAGCCGCGTCGCNONE
J080020G09CCGAGCCGAGCCGCGTCGCNONE
J080020I23CCGAGCCGAGCCGCGTCGCNONE
J080021E15CCGAGCCGAGCCGCGTCGCNONE
J080023O13CCGAGCCGAGCCGCGTCGCNONE
J080024H17CCGAGCCGAGCCGCGTCGCNONE
J080029P12CCGAGCCGAGCCGCGTCGCNONE
J080030A15CCGAGCCGAGCCGCGTCGCNONE
J080032I03CCGAGCCGAGCCGCGTCGCNONE
J080032P18CCGAGCCGAGCCGCGTCGCNONE
J080034E10CCGAGCCGAGCCGCGTCGCNONE
J080038I23CCGAGCCGAGCCGCGTCGCNONE
J080040B22CCGAGCCGAGCCGCGTCGCNONE
J080040M13CCGAGCCGAGCCGCGTCGCNONE
J080041E07CCGAGCCGAGCCGCGTCGCNONE
J080042C08CCGAGCCGAGCCGCGTCGCNONE
J080042H08CCGAGCCGAGCCGCGTCGCNONE
J080043H10CCGAGCCGAGCCGCGTCGCNONE
J080046J02CCGAGCCGAGCCGCGTCGCNONE
J080050D12CCGAGCCGAGCCGCGTCGCNONE
J080052C17CCGAGCCGAGCCGCGTCGCNONE
J080054A05CCGAGCCGAGCCGCGTCGCNONE
J080054J23CCGAGCCGAGCCGCGTCGCNONE
J080056A15CCGAGCCGAGCCGCGTCGCNONE
J080056F18CCGAGCCGAGCCGCGTCGCNONE
J080059P07CCGAGCCGAGCCGCGTCGCNONE
J080063J18CCGAGCCGAGCCGCGTCGCNONE
J080066F15CCGAGCCGAGCCGCGTCGCNONE
J080067G12CCGAGCCGAGCCGCGTCGCNONE
J080070G15CCGAGCCGAGCCGCGTCGCNONE
J080071B08CCGAGCCGAGCCGCGTCGCNONE
J080071M08CCGAGCCGAGCCGCGTCGCNONE
J080071N03CCGAGCCGAGCCGCGTCGCNONE
J080074C01CCGAGCCGAGCCGCGTCGCNONE
J080076F22CCGAGCCGAGCCGCGTCGCNONE
J080076N23CCGAGCCGAGCCGCGTCGCNONE
J080077F23CCGAGCCGAGCCGCGTCGCNONE
J080077P10CCGAGCCGAGCCGCGTCGCNONE
J080078A19CCGAGCCGAGCCGCGTCGCNONE
J080078H07CCGAGCCGAGCCGCGTCGCNONE
J080079G16CCGAGCCGAGCCGCGTCGCNONE
J080079N23CCGAGCCGAGCCGCGTCGCNONE
J080084L04CCGAGCCGAGCCGCGTCGCNONE
J080084N12CCGAGCCGAGCCGCGTCGCNONE
J080084N17CCGAGCCGAGCCGCGTCGCNONE
J080086H08CCGAGCCGAGCCGCGTCGCNONE
J080088M01CCGAGCCGAGCCGCGTCGCNONE
J080090M14CCGAGCCGAGCCGCGTCGCNONE
J080092F06CCGAGCCGAGCCGCGTCGCNONE
J080095B14CCGAGCCGAGCCGCGTCGCNONE
J080095C09CCGAGCCGAGCCGCGTCGCNONE
J080095F20CCGAGCCGAGCCGCGTCGCNONE
J080095H12CCGAGCCGAGCCGCGTCGCNONE
J080096H22CCGAGCCGAGCCGCGTCGCNONE
J090010O21CCGAGCCGAGCCGCGTCGCNONE
J090012K22CCGAGCCGAGCCGCGTCGCNONE
J090051I21CCGAGCCGAGCCGCGTCGCNONE
J090065G14CCGAGCCGAGCCGCGTCGCNONE
J090077H03CCGAGCCGAGCCGCGTCGCNONE
J100035M10CCGAGCCGAGCCGCGTCGCNONE
J100049C19CCGAGCCGAGCCGCGTCGCNONE
J100051K11CCGAGCCGAGCCGCGTCGCNONE
J100064C12CCGAGCCGAGCCGCGTCGCNONE
J100064F13CCGAGCCGAGCCGCGTCGCNONE
J100084H08CCGAGCCGAGCCGCGTCGCNONE
Os01g0571000AK066090CGCGACGCMitochondrial substrate carrier family protein.
AK121334CGCGACGCNONE
Os01g0571700AK120410CCGTCGGATCNucleic acid-binding, OB-fold domain containing protein.
Os01g0594900AK070921CGCGCGACGCCGCGACGCGConserved hypothetical protein.
J023074J04CGCGCGACGCCGCGACGCGNONE
J023078B04CGCGCGACGCCGCGACGCGNONE
J023078N11CGCGCGACGCCGCGACGCGNONE
J075143E19CGCGCGACGCCGCGACGCGNONE
J075187L10CGCGCGACGCCGCGACGCGNONE
J080010N23CGCGCGACGCCGCGACGCGNONE
J080013C01CGCGCGACGCCGCGACGCGNONE
J080013G03CGCGCGACGCCGCGACGCGNONE
J080016I23CGCGCGACGCCGCGACGCGNONE
J080017E01CGCGCGACGCCGCGACGCGNONE
J080029E18CGCGCGACGCCGCGACGCGNONE
J080034L24CGCGCGACGCCGCGACGCGNONE
J080039N12CGCGCGACGCCGCGACGCGNONE
J080067L11CGCGCGACGCCGCGACGCGNONE
J080068N08CGCGCGACGCCGCGACGCGNONE
J080069E19CGCGCGACGCCGCGACGCGNONE
J080071E16CGCGCGACGCCGCGACGCGNONE
J080077J09CGCGCGACGCCGCGACGCGNONE
J080085E03CGCGCGACGCCGCGACGCGNONE
J080301J09CGCGCGACGCCGCGACGCGNONE
J080303L19CGCGCGACGCCGCGACGCGNONE
J080308B12CGCGCGACGCCGCGACGCGNONE
Os01g0598600AK104992GCGTCGCGNONE
Os01g0606900AK065697CGCGTCGCGHeat shock protein DnaJ, N-terminal domain containing protein.
Os01g0609300AK100135CGCGTCGCNONE
Os01g0623500AK066142CGCGACGCGACAAA ATPase domain containing protein.
J013055O07CGCGACGCGACNONE
J053069D06CGCGACGCGACNONE
J053095J11CGCGACGCGACNONE
J065106D24CGCGACGCGACNONE
J065134H18CGCGACGCGACNONE
J075066D09CGCGACGCGACNONE
J090004M17CGCGACGCGACNONE
J100039L05CGCGACGCGACNONE
J100042E15CGCGACGCGACNONE
J100043B18CGCGACGCGACNONE
J100057L11CGCGACGCGACNONE
J100067C24CGCGACGCGACNONE
J100073H01CGCGACGCGACNONE
J100081J21CGCGACGCGACNONE
Os01g0623900J090025M21CACGCCACGCCACGCGACGCGACNONE
J090082F22CACGCCACGCCACGCGACGCGACNONE
J090084L02CACGCCACGCCACGCGACGCGACSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein).
Os01g0662600009-056-E10GCGTCGCGTCTCNONE
AK062234GCGTCGCGTCTCNONE
AK098887GCGTCGCGTCTCNONE
AK099656GCGTCGCGTCTCNONE
AK119723GCGTCGCGTCTCSimilar to NifU-like protein.
J013001K01GCGTCGCGTCTCNONE
J013090F20GCGTCGCGTCTCNONE
J013119A14GCGTCGCGTCTCNONE
J013121P12GCGTCGCGTCTCNONE
J033132I15GCGTCGCGTCTCNONE
J075023F22GCGTCGCGTCTCNONE
J075023M13GCGTCGCGTCTCNONE
J100024D10GCGTCGCGTCTCNONE
J100024N01GCGTCGCGTCTCNONE
J100026H09GCGTCGCGTCTCNONE
J100027H07GCGTCGCGTCTCNONE
J100045K07GCGTCGCGTCTCNONE
J100057K18GCGTCGCGTCTCNONE
J100085C22GCGTCGCGTCTCNONE
Os01g0663400016-054-B01CCGATCCGACGGNONE
AK072283CCGATCCGACGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-).
AK072645CCGATCCGACGGNONE
AK072645CGCGACGCGNONE
J065180A21CCGATCCGACGGNONE
J075026E13CCGATCCGACGGNONE
J075109M23CCGATCCGACGGNONE
J075151A02CCGATCCGACGGNONE
J090004B07CCGATCCGACGGNONE
J090023O22CCGATCCGACGGNONE
J090023O22CGCGACGCGNONE
J090054G09CCGATCCGACGGNONE
J090054G09CGCGACGCGNONE
J090058H13CCGATCCGACGGNONE
J090058H13CGCGACGCGNONE
J090076G13CCGATCCGACGGNONE
J090076G13CGCGACGCGNONE
J100057F11CCGATCCGACGGNONE
Os01g0667900013-097-A02CGCGTCGCGNONE
013-097-A02GCGTCGCGCGGGCCCCACCNONE
014-011-C01CGCGTCGCGNONE
014-011-C01GCGTCGCGCGGGCCCCACCNONE
AK105335CGCGTCGCGGlutaredoxin-like, plant II family protein.
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein.
J065156F10CGCGTCGCGNONE
J065156F10GCGTCGCGCGGGCCCCACCNONE
J065163D22CGCGTCGCGNONE
J065163D22GCGTCGCGCGGGCCCCACCNONE
J065197J04CGCGTCGCGNONE
J065197J04GCGTCGCGCGGGCCCCACCNONE
J075122C02CGCGTCGCGNONE
J075122C02GCGTCGCGCGGGCCCCACCNONE
J100047L16CGCGTCGCGNONE
J100047L16GCGTCGCGCGGGCCCCACCNONE
Os01g0679400AK107970CGCGTCGCConserved hypothetical protein.
Os01g0681900AB008845GTGTGGGGACGCGACGCGNADH dependent Glutamate Synthase precursor (EC 1.4.1.14).
AK105755GTGTGGGGACGCGACGCGNONE
Os01g0693900AK066034CCGTCGGATNONE
AK066034CCGTCGGATNONE
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein.
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein.
J065165G19CCGTCGGATNONE
J065165G19CCGTCGGATNONE
J100042C04CCGTCGGATNONE
J100042C04CCGTCGGATNONE
Os01g0699600009-111-F06CGCGACGCGNONE
AK105196CGCGACGCGProtein kinase-like domain containing protein.
J065128A07CGCGACGCGNONE
Os01g0701900AK066793CGCGACGCGTGGSimilar to Phosphatidylinositol transfer-like protein III.
AK066793GCGTCGCGSimilar to Phosphatidylinositol transfer-like protein III.
Os01g0704100AK072215CGCGACGCGSimilar to Membrane transporter.
AK109776CGCGACGCGNONE
J080037E03CGCGACGCGNONE
J080041H13CGCGACGCGNONE
J080046B15CGCGACGCGNONE
J080058K14CGCGACGCGNONE
J080065E14CGCGACGCGNONE
J080079C08CGCGACGCGNONE
J080088J12CGCGACGCGNONE
J080088M19CGCGACGCGNONE
J100043G11CGCGACGCGNONE
J100059M22CGCGACGCGNONE
Os01g0705700003-130-H06CGCGACGCNONE
AK064946CGCGACGCSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116).
J013000P16CGCGACGCNONE
Os01g0723600AK109735GCGACGCGRibose-phosphate pyrophosphokinase 3 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 3).
Os01g0727100AK068181CGCGTCGCGlycosyl transferase, family 8 protein.
AK105758CGCGTCGCNONE
J013126C21CGCGTCGCNONE
J023049F24CGCGTCGCNONE
J033140G15CGCGTCGCNONE
Os01g0730900AK120751GTTGGTGGCGTCGCGTCChaperonin clpA/B family protein.
J023004P12GTTGGTGGCGTCGCGTCNONE
J065006G23GTTGGTGGCGTCGCGTCNONE
Os01g0733200AK066316CGCGACGCGACSimilar to Heat shock transcription factor 29 (Fragment).
AY344493CGCGACGCGACNONE
J013066G03CGCGACGCGACNONE
J090034J08CGCGACGCGACNONE
Os01g0736100011-091-H04CCGTCGGATCNONE
015-004-D10CCGTCGGATCNONE
AK064298CCGTCGGATCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK099365CCGTCGGATCNONE
AK103355CCGTCGGATCNONE
J033044B20CCGTCGGATCNONE
J033094G06CCGTCGGATCNONE
J033111N02CCGTCGGATCNONE
J033111P10CCGTCGGATCNONE
J033126K03CCGTCGGATCNONE
J043034D12CCGTCGGATCNONE
Os01g0748100AK071261GCGTCGCGTCHypothetical protein.
J023084C08GCGTCGCGTCNONE
J065058A07GCGTCGCGTCNONE
Os01g0749000AK107255GCGTCGCGProtein of unknown function DUF1264 family protein.
AK107265GCGTCGCGNONE
AK107290GCGTCGCGNONE
J075001C07GCGTCGCGNONE
Os01g0752800009-155-D12GTCGCGTCGCNONE
AK103612GTCGCGTCGCSimilar to HASP protein-like protein (Fragment).
J013063A16GTCGCGTCGCNONE
J023007N11GTCGCGTCGCNONE
J033141J21GTCGCGTCGCNONE
Os01g0754100009-056-C10CGCGTCGCNONE
AK067551CGCGTCGCNucleic acid-binding, OB-fold domain containing protein.
J065144A01CGCGTCGCNONE
J065152E22CGCGTCGCNONE
J065203O16CGCGTCGCNONE
J075190L18CGCGTCGCNONE
J090084A09CGCGTCGCNONE
Os01g0757900AK105476CGCGCGACGCHaloacid dehalogenase/epoxide hydrolase family protein.
Os01g0760900AK107573CGCGTCGCConserved hypothetical protein.
J075002J19CGCGTCGCNONE
Os01g0761100AK122112GCGACGCGTesmin/TSO1-like, CXC domain containing protein.
Os01g0765400015-011-F09CCCATCCACGCGACGCGNONE
AK106246CCCATCCACGCGACGCGProteinase inhibitor I4, serpin family protein.
J100034N10CCCATCCACGCGACGCGNONE
J100054I23CCCATCCACGCGACGCGNONE
J100055K02CCCATCCACGCGACGCGNONE
J100082D02CCCATCCACGCGACGCGNONE
Os01g0774500AK069241GCGACGCGACGCGConserved hypothetical protein.
Os01g0778500J065046B15GCGTCGCGNONE
J065167B09GCGTCGCGNONE
J065181M19GCGTCGCGConserved hypothetical protein.
Os01g0794100009-027-B12CGCGTCGCGNONE
AK062404CGCGTCGCGConserved hypothetical protein.
Os01g0796700AK120491CGCGTCGCGCGZinc finger, RING-type domain containing protein.
Os01g0812900009-200-B11CGCGTCGCGTCNONE
AK121582CGCGTCGCGTCConserved hypothetical protein.
J013120B14CGCGTCGCGTCNONE
J023049H09CGCGTCGCGTCNONE
J023107J02CGCGTCGCGTCNONE
J033025F24CGCGTCGCGTCNONE
J033037D14CGCGTCGCGTCNONE
J033084J01CGCGTCGCGTCNONE
J033128E11CGCGTCGCGTCNONE
J065140B08CGCGTCGCGTCNONE
J075019M06CGCGTCGCGTCNONE
J075023B03CGCGTCGCGTCNONE
J075053H24CGCGTCGCGTCNONE
J075067J23CGCGTCGCGTCNONE
J075069E12CGCGTCGCGTCNONE
J075122C03CGCGTCGCGTCNONE
J075146G01CGCGTCGCGTCNONE
J075150L21CGCGTCGCGTCNONE
J075156M23CGCGTCGCGTCNONE
J075161H02CGCGTCGCGTCNONE
J075170F21CGCGTCGCGTCNONE
Os01g0813900AK101729CGCGACGCGTCCSimilar to ZIGA1 protein (Fragment).
Os01g0817800AK073827CCGTCGGACGGACWD40-like domain containing protein.
J033068H02CCGTCGGACGGACNONE
J065042H22CCGTCGGACGGACNONE
J090083M24CCGTCGGACGGACNONE
Os01g0823600J075039G17GCGCGCGACGCConserved hypothetical protein.
J075042I11GCGCGCGACGCNONE
J075054M24GCGCGCGACGCNONE
J075074C22GCGCGCGACGCNONE
J075081G13GCGCGCGACGCNONE
J075099I03GCGCGCGACGCNONE
J075108D14GCGCGCGACGCNONE
J075129O14GCGCGCGACGCNONE
J075136P07GCGCGCGACGCNONE
J075149P09GCGCGCGACGCNONE
J075157K12GCGCGCGACGCNONE
J075176K20GCGCGCGACGCNONE
J080302C21GCGCGCGACGCNONE
Os01g0830100AK069755GATCCGACGGTGGGGGAGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein.
Os01g0833200AK121629CGCGTCGCGCGConserved hypothetical protein.
J023093N07CGCGTCGCGCGNONE
J033050C20CGCGTCGCGCGNONE
J080302F22CGCGTCGCGCGNONE
J080303H06CGCGTCGCGCGNONE
J080306J04CGCGTCGCGCGNONE
J080309K06CGCGTCGCGCGNONE
J080311E18CGCGTCGCGCGNONE
J080318A20CGCGTCGCGCGNONE
J100031F20CGCGTCGCGCGNONE
J100034P21CGCGTCGCGCGNONE
J100042K08CGCGTCGCGCGNONE
J100047H24CGCGTCGCGCGNONE
J100065C14CGCGTCGCGCGNONE
J100074E23CGCGTCGCGCGNONE
Os01g0833500AK073320CGCGTCGCSimilar to Serine carboxypeptidase II-1 precursor (EC 3.4.16.6) (CP-MII.1) (Fragment).
Os01g0835500AK100241ATCCGACGGSimilar to Respiratory burst oxidase protein.
Os01g0837900AK103207TCCGACGGSimilar to Protein kinase AFC1 (EC 2.7.1.-).
Os01g0841000009-005-A12CGCGACGCNONE
AK059601CGCGACGCENTH/VHS domain containing protein.
AK103342CGCGACGCNONE
J023022C02CGCGACGCNONE
J023030C09CGCGACGCNONE
J033075D24CGCGACGCNONE
J033123O16CGCGACGCNONE
J033126C16CGCGACGCNONE
J065120M23CGCGACGCNONE
J065190I23CGCGACGCNONE
J090090G01CGCGACGCNONE
Os01g0844800AK099801GATCCGACGGSimilar to Pumilio RBD (Fragment).
AK102882GATCCGACGGNONE
AK103686GATCCGACGGNONE
Os01g0844900AK066659TCCGACGGHomeodomain-like containing protein.
Os01g0847200AK061976CGCGTCGCNONE
AK064779CGCGTCGCNONE
AK122126CGCGTCGCSimilar to Mannose-1-phosphate guanyltransferase (EC 2.7.7.13) (ATP-mannose-1- phosphate guanylyltransferase) (GDP-mannose pyrophosphorylase) (NDP- hexose pyrophosphorylase).
J033050F01CGCGTCGCNONE
J033132D02CGCGTCGCNONE
Os01g0848200AK069425ATCCGACGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
AK101230ATCCGACGNONE
Os01g0848550J065073P06CGTCGGATConserved hypothetical protein.
Os01g0849600AK108159CGCGACGCSimilar to ENOD18 protein (Fragment).
Os01g0851100AK071217CGCGTCGCGNONE
Os01g0851400J065070P10GCGTCGCGMachado-Joseph disease protein MJD family protein.
J065153F01GCGTCGCGNONE
Os01g0856900AK107570GATCCGACGGlycoside hydrolase, starch-binding domain containing protein.
J065081B03GATCCGACGNONE
J075028J03GATCCGACGNONE
J075052C05GATCCGACGNONE
J075199J04GATCCGACGNONE
J090052L20GATCCGACGNONE
J090075L24GATCCGACGNONE
Os01g0859600011-041-F12GCGACGCGTGCGNONE
AK072151GCGACGCGTGCGCyclin-like F-box domain containing protein.
J013031O08GCGACGCGTGCGNONE
J013049K06GCGACGCGTGCGNONE
J013095P13GCGACGCGTGCGNONE
J013108J06GCGACGCGTGCGNONE
J013109C18GCGACGCGTGCGNONE
J013111E15GCGACGCGTGCGNONE
J013132O07GCGACGCGTGCGNONE
J023086B20GCGACGCGTGCGNONE
J023101N16GCGACGCGTGCGNONE
J033025C17GCGACGCGTGCGNONE
J033103E23GCGACGCGTGCGNONE
J033105C11GCGACGCGTGCGNONE
J033126A20GCGACGCGTGCGNONE
J090018G15GCGACGCGTGCGNONE
J090031F06GCGACGCGTGCGNONE
J090056E09GCGACGCGTGCGNONE
J090075M18GCGACGCGTGCGNONE
J100024M05GCGACGCGTGCGNONE
J100032F09GCGACGCGTGCGNONE
Os01g0867900AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein.
Os01g0869800006-029-F03CGCGTCGCGNONE
006-067-H02CGCGTCGCGNONE
006-084-A06CGCGTCGCGNONE
AK058284CGCGTCGCGSimilar to Photosystem II subunit PsbS.
AK071827CGCGTCGCGNONE
AK104275CGCGTCGCGNONE
J013049J07CGCGTCGCGNONE
J033089F12CGCGTCGCGNONE
J090094I11CGCGTCGCGNONE
Os01g0875500012-063-E07CGCGACGCNONE
012-063-E07CGCGTCGCGTCGCGNONE
AK101399CGCGACGCSimilar to Beta-galactosidase (EC 3.2.1.23).
AK101399CGCGTCGCGTCGCGSimilar to Beta-galactosidase (EC 3.2.1.23).
AK102715CGCGACGCNONE
AK102715CGCGTCGCGTCGCGNONE
J023104F17CGCGACGCNONE
J023104F17CGCGTCGCGTCGCGNONE
J023128M07CGCGACGCNONE
J023128M07CGCGTCGCGTCGCGNONE
J033022B13CGCGACGCNONE
J033022B13CGCGTCGCGTCGCGNONE
J033034C09CGCGACGCNONE
J033034C09CGCGTCGCGTCGCGNONE
J033037E13CGCGACGCNONE
J033037E13CGCGTCGCGTCGCGNONE
J033044E15CGCGACGCNONE
J033044E15CGCGTCGCGTCGCGNONE
J033085M16CGCGACGCNONE
J033085M16CGCGTCGCGTCGCGNONE
J033087L24CGCGACGCNONE
J033087L24CGCGTCGCGTCGCGNONE
J033089G01CGCGACGCNONE
J033089G01CGCGTCGCGTCGCGNONE
J033093D16CGCGACGCNONE
J033093D16CGCGTCGCGTCGCGNONE
J033102B22CGCGACGCNONE
J033102B22CGCGTCGCGTCGCGNONE
J033108E02CGCGACGCNONE
J033108E02CGCGTCGCGTCGCGNONE
J033115P07CGCGACGCNONE
J033115P07CGCGTCGCGTCGCGNONE
J033122A10CGCGACGCNONE
J033122A10CGCGTCGCGTCGCGNONE
J090033B09CGCGACGCNONE
J090033B09CGCGTCGCGTCGCGNONE
J090038A15CGCGACGCNONE
J090038A15CGCGTCGCGTCGCGNONE
J090053G04CGCGACGCNONE
J090053G04CGCGTCGCGTCGCGNONE
J090069H01CGCGACGCNONE
J090069H01CGCGTCGCGTCGCGNONE
J090093F16CGCGACGCNONE
J090093F16CGCGTCGCGTCGCGNONE
Os01g0877400AK106754ATCCGACGSimilar to Avr9 elicitor response-like protein.
Os01g0889400012-011-B10CGTCGGATCNONE
AB200237CGTCGGATCNONE
AK071407CGTCGGATCSimilar to LOB domain protein 6 (ASYMMETRIC LEAVES2).
AK119575CGTCGGATCNONE
J023089G14CGTCGGATCNONE
J075028N06CGTCGGATCNONE
J075121D21CGTCGGATCNONE
J075122K20CGTCGGATCNONE
J075176J05CGTCGGATCNONE
J080025B12CGTCGGATCNONE
J080040M21CGTCGGATCNONE
J080041I06CGTCGGATCNONE
J080047F15CGTCGGATCNONE
J080067B19CGTCGGATCNONE
J080068J04CGTCGGATCNONE
J080068M01CGTCGGATCNONE
J080077C15CGTCGGATCNONE
J080079M04CGTCGGATCNONE
J080306O05CGTCGGATCNONE
J090004J23CGTCGGATCNONE
Os01g0896200AK105622GCGTCGCGCGConserved hypothetical protein.
Os01g0900800009-086-C08GATCCGACGNONE
AK068254GATCCGACGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK105713GATCCGACGNONE
J053025O10GATCCGACGNONE
J065063K24GATCCGACGNONE
J065167N21GATCCGACGNONE
J100060A20GATCCGACGNONE
J100079J03GATCCGACGNONE
J100087D11GATCCGACGNONE
J100089K10GATCCGACGNONE
Os01g0904200AK068432CGCGTCGCGProtein kinase-like domain containing protein.
J100027C22CGCGTCGCGNONE
J100064A19CGCGTCGCGNONE
Os01g0913600AK071735CCTCGCCCCCCGCGACGCSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1).
J023003J11CCTCGCCCCCCGCGACGCNONE
J023037O11CCTCGCCCCCCGCGACGCNONE
J023109K10CCTCGCCCCCCGCGACGCNONE
Os01g0917100AK107234CCGTCGGATCConserved hypothetical protein.
Os01g0926400AK063916GTCGCGTCGCNONE
AK073976GTCGCGTCGCSimilar to Pectin-glucuronyltransferase.
Os01g0931100AK059213CCGTCGGANONE
AK068780CCGTCGGAConserved hypothetical protein.
J013159E17CCGTCGGANONE
J065059I12CCGTCGGANONE
J065064G11CCGTCGGANONE
J065138H23CCGTCGGANONE
J065167P22CCGTCGGANONE
Os01g0933900006-115-F10TCCGACGGNONE
009-130-C11TCCGACGGNONE
009-183-F07TCCGACGGNONE
009-196-F08TCCGACGGNONE
012-078-H05TCCGACGGNONE
015-004-D01TCCGACGGNONE
015-083-F05TCCGACGGNONE
AF309383TCCGACGGSimilar to Glutathione transferase III(B) (EC 2.5.1.18).
AK059985TCCGACGGNONE
AK103927TCCGACGGNONE
J065026P12TCCGACGGNONE
J065041M20TCCGACGGNONE
J065043H06TCCGACGGNONE
J065049E19TCCGACGGNONE
J065097D10TCCGACGGNONE
J065143I07TCCGACGGNONE
J065152F10TCCGACGGNONE
J065163F22TCCGACGGNONE
J065166O17TCCGACGGNONE
J065188B21TCCGACGGNONE
J065197D18TCCGACGGNONE
J065198E06TCCGACGGNONE
J065199D17TCCGACGGNONE
J065212I10TCCGACGGNONE
J075001L04TCCGACGGNONE
J090051G02TCCGACGGNONE
J090074K01TCCGACGGNONE
Os01g0937100AK105806CGCGTCGCSimilar to Xylanase inhibitor precursor (Xylanase inhibitor TAXI-I).
J033069E12CGCGTCGCNONE
Os01g0950900AK101121CCGAGCCGCGTCGCProtein of unknown function DUF221 domain containing protein.
J023036H24CCGAGCCGCGTCGCNONE
J023084G23CCGAGCCGCGTCGCNONE
J033025J04CCGAGCCGCGTCGCNONE
J033139J18CCGAGCCGCGTCGCNONE
J090006A09CCGAGCCGCGTCGCNONE
J090036D02CCGAGCCGCGTCGCNONE
Os01g0962500AK073163CGCGTCGCGZinc finger, HIT-type domain containing protein.
AK105822CGCGTCGCGNONE
J033024I07CGCGTCGCGNONE
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM.
Os02g0115900AF006825CCGTCGGATCNONE
AK065743CCGTCGGATCEndosperm lumenal binding protein.
AK119653CCGTCGGATCNONE
Os02g0160900J075127G12GCGACGCGConserved hypothetical protein.
Os02g0169300006-023-D12GCGACGCGNONE
006-062-B01GCGACGCGNONE
015-049-F11GCGACGCGNONE
015-057-G02GCGACGCGNONE
015-092-F04GCGACGCGNONE
015-095-H02GCGACGCGNONE
015-097-B07GCGACGCGNONE
AK070041GCGACGCGSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3).
J013042K07GCGACGCGNONE
J013134H23GCGACGCGNONE
J013134J23GCGACGCGNONE
J023036N24GCGACGCGNONE
J023049C06GCGACGCGNONE
J023077E10GCGACGCGNONE
J023077F10GCGACGCGNONE
J023105N12GCGACGCGNONE
J033036O12GCGACGCGNONE
J033064P11GCGACGCGNONE
J033079F01GCGACGCGNONE
J033123M22GCGACGCGNONE
J033143E10GCGACGCGNONE
J075013D12GCGACGCGNONE
Os02g0170200AK107753CGTCGGATGAGACGTGConserved hypothetical protein.
J065117F22CGTCGGATGAGACGTGNONE
Os02g0173100AK066680CGCGTCGCNONE
AK100596CGCGTCGCSimilar to Cytochrome P450 97B3 (EC 1.14.-.-).
J023106P10CGCGTCGCNONE
Os02g0179200AK111348CGCGACGCGTCGCGlutamine amidotransferase class-I domain containing protein.
J065218O07CGCGACGCGTCGCNONE
Os02g0195500AK062207CGCGACGCGNONE
Os02g0223700J013106E03ATCCGACGGConserved hypothetical protein.
J100061D19ATCCGACGGNONE
J100088J17ATCCGACGGNONE
Os02g0236800014-080-B04GATCCGACGGNONE
AK068642GATCCGACGGNONE
AK099886GATCCGACGGSimilar to Peroxidase (EC 1.11.1.7).
AK104670GATCCGACGGNONE
Os02g0302200Os02g0302200GCGACGCGConserved hypothetical protein.
Os02g0453300006-099-D03CGTCGGATNONE
009-120-D02CGTCGGATNONE
AK071220CGTCGGATNONE
AK109380CGTCGGATConserved hypothetical protein.
J023083M17CGTCGGATNONE
Os02g0462800AK110587CGCGTCGCGTCGCGTCGCGWRKY transcription factor 42 (Transcription factor WRKY02).
AY676923CGCGTCGCGTCGCGTCGCGNONE
Os02g0471500AK120615GTCGCGTCGCNONE
AK120927GTCGCGTCGCProtein phosphatase 2C-like domain containing protein.
Os02g0497700011-094-A10CGCGTCGCNONE
011-094-A10CGCGTCGCGNONE
012-073-H02CGCGTCGCNONE
012-073-H02CGCGTCGCGNONE
016-056-G05CGCGTCGCNONE
016-056-G05CGCGTCGCGNONE
AK070143CGCGTCGCNONE
AK070143CGCGTCGCGNONE
J023041O14CGCGTCGCNONE
J023041O14CGCGTCGCGNONE
J023092H01CGCGTCGCNONE
J023092H01CGCGTCGCGNONE
J033048A17CGCGTCGCNONE
J033048A17CGCGTCGCGNONE
J033051K21CGCGTCGCNONE
J033051K21CGCGTCGCGNONE
J033122D01CGCGTCGCNONE
J033122D01CGCGTCGCGNONE
J090032E23CGCGTCGCNONE
J090032E23CGCGTCGCGNONE
J090055K13CGCGTCGCNONE
J090055K13CGCGTCGCGNONE
Os02g0509600AK111075CGCGACGCConserved hypothetical protein.
J065033B09CGCGACGCNONE
J065069L04CGCGACGCNONE
J065089H14CGCGACGCNONE
J065119J16CGCGACGCNONE
J065142J22CGCGACGCNONE
J065168B14CGCGACGCNONE
J065203L03CGCGACGCNONE
J075044C18CGCGACGCNONE
J075068D13CGCGACGCNONE
J075152O09CGCGACGCNONE
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein.
Os02g0531450J065097O14CGCGTCGCHypothetical protein.
J075155C16CGCGTCGCNONE
Os02g0533800009-149-F12ATCCGACGGNONE
013-058-H02ATCCGACGGNONE
014-017-G07ATCCGACGGNONE
014-028-F04ATCCGACGGNONE
014-050-G04ATCCGACGGNONE
014-095-F04ATCCGACGGNONE
014-099-C08ATCCGACGGNONE
016-046-F05ATCCGACGGNONE
AK121139ATCCGACGGConserved hypothetical protein.
J013104A14ATCCGACGGNONE
J023077F13ATCCGACGGNONE
J023145I11ATCCGACGGNONE
J065033D14ATCCGACGGNONE
J065079I15ATCCGACGGNONE
J065104E21ATCCGACGGNONE
J065128E06ATCCGACGGNONE
J065174F07ATCCGACGGNONE
J065195B12ATCCGACGGNONE
J065207B12ATCCGACGGNONE
J080304M24ATCCGACGGNONE
J090040A13ATCCGACGGNONE
J090054B18ATCCGACGGNONE
J100037A06ATCCGACGGNONE
J100042F24ATCCGACGGNONE
J100043N23ATCCGACGGNONE
J100044H14ATCCGACGGNONE
J100056K24ATCCGACGGNONE
J100063O22ATCCGACGGNONE
J100071G05ATCCGACGGNONE
J100078G15ATCCGACGGNONE
Os02g0537500AK068689CGCGACGCGSimilar to E2F homolog.
Os02g0556800AK060580CGCACGCGACGCGACNONE
AK100187CGCACGCGACGCGACConserved hypothetical protein.
J065162A21CGCACGCGACGCGACNONE
J075093B20CGCACGCGACGCGACNONE
J075097N04CGCACGCGACGCGACNONE
Os02g0580700AK073664CTCTCCGCGACGCGConserved hypothetical protein.
J090060F24CTCTCCGCGACGCGNONE
Os02g0597800AK072807CGCGACGCSteroid nuclear receptor, ligand-binding domain containing protein.
Os02g0605600016-017-B02CGCGTCGCGTCNONE
016-017-B02GATCCGACGGCCCGNONE
AK066104CGCGTCGCGTCLUC7 related family protein.
AK066104GATCCGACGGCCCGLUC7 related family protein.
J013052G16CGCGTCGCGTCNONE
J013052G16GATCCGACGGCCCGNONE
J043022E03CGCGTCGCGTCNONE
J043022E03GATCCGACGGCCCGNONE
J065105P10CGCGTCGCGTCNONE
J065105P10GATCCGACGGCCCGNONE
Os02g0625500011-025-C06AGCTGAGCGTCGCGNONE
AB050624AGCTGAGCGTCGCGNONE
AK059188AGCTGAGCGTCGCGNONE
AK059771AGCTGAGCGTCGCGNONE
AK101791AGCTGAGCGTCGCGSimilar to Adenosine kinase-like protein (Fragment).
AY224510AGCTGAGCGTCGCGNONE
J013152H02AGCTGAGCGTCGCGNONE
J023012P09AGCTGAGCGTCGCGNONE
J023127D16AGCTGAGCGTCGCGNONE
J033024G01AGCTGAGCGTCGCGNONE
J033025L19AGCTGAGCGTCGCGNONE
J033080M04AGCTGAGCGTCGCGNONE
J033101A08AGCTGAGCGTCGCGNONE
J033121L12AGCTGAGCGTCGCGNONE
J043017N15AGCTGAGCGTCGCGNONE
J065207J01AGCTGAGCGTCGCGNONE
J090049G12AGCTGAGCGTCGCGNONE
J100036A07AGCTGAGCGTCGCGNONE
J100076C04AGCTGAGCGTCGCGNONE
J100080N22AGCTGAGCGTCGCGNONE
Os02g0626100003-107-B06ATCCGACGGNONE
003-107-B06CAGGTGGGCCACGCGTCGCGNONE
AK120127ATCCGACGGNONE
AK120127CAGGTGGGCCACGCGTCGCGNONE
Os02g0627100AK068993CGCGACGCGSimilar to Phenylalanine ammonia-lyase (EC 4.3.1.5).
D21290CGCGACGCGNONE
J023001A06CGCGACGCGNONE
J065156K20CGCGACGCGNONE
J065187O09CGCGACGCGNONE
J100036D20CGCGACGCGNONE
J100089I01CGCGACGCGNONE
Os02g0631000AK068667CCGTCGGATCConserved hypothetical protein.
J013159L03CCGTCGGATCNONE
J023119O20CCGTCGGATCNONE
J090098N20CCGTCGGATCNONE
Os02g0633400AK073723CGCGTCGCGCGCSimilar to 61 kDa protein homolog.
J100031K17CGCGTCGCGCGCNONE
Os02g0638200J065176A11GCGACGCGConserved hypothetical protein.
Os02g0640000AK120841CGCGACGCGC2 calcium/lipid-binding region, CaLB domain containing protein.
AK120841GCGACGCGGCGACGCGC2 calcium/lipid-binding region, CaLB domain containing protein.
J023022G19CGCGACGCGNONE
J023022G19GCGACGCGGCGACGCGNONE
J023081F22CGCGACGCGNONE
J023081F22GCGACGCGGCGACGCGNONE
Os02g0641800AK066504GCGACGCGSimilar to RNA helicase (Fragment).
AK072124GCGACGCGNONE
Os02g0643000009-051-D01GCGACGCGNONE
AK073818GCGACGCGSimilar to VAP27.
J023068D06GCGACGCGNONE
J033068O06GCGACGCGNONE
J075019O08GCGACGCGNONE
J075140B16GCGACGCGNONE
J100036D07GCGACGCGNONE
J100067I05GCGACGCGNONE
J100070D07GCGACGCGNONE
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE
AK101360GTGGCGTGGGCCGTCGGATCNONE
AY062178GTGGCGTGGGCCGTCGGATCNONE
J023043E22GTGGCGTGGGCCGTCGGATCNONE
J033024F05GTGGCGTGGGCCGTCGGATCNONE
J033035H01GTGGCGTGGGCCGTCGGATCNONE
J033042J19GTGGCGTGGGCCGTCGGATCNONE
J033057G18GTGGCGTGGGCCGTCGGATCNONE
J033111F09GTGGCGTGGGCCGTCGGATCNONE
J033115L11GTGGCGTGGGCCGTCGGATCNONE
J033143I16GTGGCGTGGGCCGTCGGATCNONE
J033143M21GTGGCGTGGGCCGTCGGATCNONE
J075072B10GTGGCGTGGGCCGTCGGATCNONE
J075072L04GTGGCGTGGGCCGTCGGATCNONE
J075088F01GTGGCGTGGGCCGTCGGATCNONE
J075196H23GTGGCGTGGGCCGTCGGATCNONE
Os02g0651900AK101633GCGACGCGNONE
AK102949GCGACGCGConserved hypothetical protein.
J080018N20GCGACGCGNONE
J080062I19GCGACGCGNONE
J100064N12GCGACGCGNONE
J100083B11GCGACGCGNONE
J100089D08GCGACGCGNONE
Os02g0658100AK064728CGTCGGATCNONE
Os02g0669100012-068-E10CGCGTCGCNONE
012-068-E10CGCGTCGCGNONE
016-075-F09CGCGTCGCNONE
016-075-F09CGCGTCGCGNONE
AB011367CGCGTCGCNONE
AB011367CGCGTCGCGNONE
AK070197CGCGTCGCNONE
AK070197CGCGTCGCGNONE
AY587109CGCGTCGCDehydrin family protein.
AY587109CGCGTCGCGDehydrin family protein.
AY786415CGCGTCGCNONE
AY786415CGCGTCGCGNONE
J023042N13CGCGTCGCNONE
J023042N13CGCGTCGCGNONE
J023128F01CGCGTCGCNONE
J023128F01CGCGTCGCGNONE
J065002K05CGCGTCGCNONE
J065002K05CGCGTCGCGNONE
J090057I09CGCGTCGCNONE
J090057I09CGCGTCGCGNONE
J090067J23CGCGTCGCNONE
J090067J23CGCGTCGCGNONE
J090071B04CGCGTCGCNONE
J090071B04CGCGTCGCGNONE
J100018L23CGCGTCGCNONE
J100018L23CGCGTCGCGNONE
J100036A11CGCGTCGCNONE
J100036A11CGCGTCGCGNONE
J100063L18CGCGTCGCNONE
J100063L18CGCGTCGCGNONE
J100071G02CGCGTCGCNONE
J100071G02CGCGTCGCGNONE
J100084P19CGCGTCGCNONE
J100084P19CGCGTCGCGNONE
Os02g0670400009-189-H11CCCACGCGTCGCNONE
AB079636CCCACGCGTCGCSimilar to HMGc1 protein.
J090001B08CCCACGCGTCGCNONE
Os02g0671100012-049-H09GCGACGCGNONE
015-077-A04GCGACGCGNONE
AK100120GCGACGCGNONE
AK109758GCGACGCGProtein of unknown function DUF295 family protein.
J023007K16GCGACGCGNONE
J065139P07GCGACGCGNONE
J065181I06GCGACGCGNONE
J065186I20GCGACGCGNONE
J075052H09GCGACGCGNONE
J075065J01GCGACGCGNONE
J075069J15GCGACGCGNONE
J100036N09GCGACGCGNONE
J100054J19GCGACGCGNONE
J100055A12GCGACGCGNONE
J100065P09GCGACGCGNONE
J100074E08GCGACGCGNONE
J100074N13GCGACGCGNONE
J100087G18GCGACGCGNONE
Os02g0671200J065152N20GCCCACCCCGCGACGCNONE
J075053E22GCCCACCCCGCGACGCConserved hypothetical protein.
Os02g0672500AK109266GCGTCGCGNONE
Os02g0675000AK109532CGCGACGCConserved hypothetical protein.
Os02g0693700AK103774CGCGACGCGSimilar to P-glycoprotein ABCB5.
AK106518CGCGACGCGNONE
Os02g0708100AK059630CGCGACGCGACNONE
AK102055CGCGACGCGACSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5).
Os02g0715400013-046-F07CGCGTCGCConserved hypothetical protein.
J053064L02CGCGTCGCNONE
J053089K10CGCGTCGCNONE
J075030C14CGCGTCGCNONE
J075033J20CGCGTCGCNONE
J075122H10CGCGTCGCNONE
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein.
Os02g0726000AK072936CGCGACGCGNONE
AK099178CGCGACGCGBeta-Ig-H3/fasciclin domain containing protein.
J090014C14CGCGACGCGNONE
J090014G22CGCGACGCGNONE
J090031H04CGCGACGCGNONE
J090054D18CGCGACGCGNONE
J090054I05CGCGACGCGNONE
J090064M02CGCGACGCGNONE
J090073C19CGCGACGCGNONE
Os02g0728600AK063054GCGTCGCGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).
J065121P04GCGTCGCGNONE
Os02g0752300AK072544CGCGACGCGConserved hypothetical protein.
J023132N16CGCGACGCGNONE
J033069F17CGCGACGCGNONE
Os02g0753800AK101787CGCGACGCGACGCGACGCSimilar to Annexin p35.
Os02g0760500009-140-F05GATCCGACGGNONE
AK062958GATCCGACGGSimilar to ER6 protein (Fragment).
J065057E02GATCCGACGGNONE
J075060D20GATCCGACGGNONE
J090090E17GATCCGACGGNONE
Os02g0762400AK103084CCGTCGGATCGGCyclin-dependent kinase inhibitor family protein.
AK103084GCGACGCGACGCGCyclin-dependent kinase inhibitor family protein.
Os02g0767700AK071237CCGTCGGAConserved hypothetical protein.
J023086E09CCGTCGGANONE
J075002J17CCGTCGGANONE
J075016K13CCGTCGGANONE
J075017J06CCGTCGGANONE
J075041J23CCGTCGGANONE
J075067D22CCGTCGGANONE
J075073N10CCGTCGGANONE
J075118N03CCGTCGGANONE
J075135A02CCGTCGGANONE
J075135L09CCGTCGGANONE
J075144D06CCGTCGGANONE
J075157I20CCGTCGGANONE
J075168J16CCGTCGGANONE
J075183A03CCGTCGGANONE
J075186M12CCGTCGGANONE
J075188F18CCGTCGGANONE
Os02g0770100AK111651CGCGTCGCGConserved hypothetical protein.
AK111651GACGCGACGCGACConserved hypothetical protein.
J023029P14CGCGTCGCGNONE
J023029P14GACGCGACGCGACNONE
J065119C17CGCGTCGCGNONE
J065119C17GACGCGACGCGACNONE
Os02g0775300AK111093CGCGACGCConserved hypothetical protein.
AK111093CGCGTCGCConserved hypothetical protein.
J100039N18CGCGACGCNONE
J100039N18CGCGTCGCNONE
Os02g0785000AK103670ATCCGACGGlycosyl transferase, family 31 protein.
J065179I04ATCCGACGNONE
J065179J03ATCCGACGNONE
Os02g0788800AK066747CGCGACGCGAmino acid/polyamine transporter II family protein.
Os02g0789600AK101046CGCGTCGCGTCNONE
AK112100CGCGTCGCGTCSimilar to DEM2.
Os02g0797600004-004-A08ATCCGACGGNONE
006-050-H07ATCCGACGGNONE
006-092-B02ATCCGACGGNONE
006-100-B08ATCCGACGGNONE
013-037-D09ATCCGACGGNONE
013-068-H02ATCCGACGGNONE
AK060857ATCCGACGGNONE
AK098882ATCCGACGGNONE
AK104474ATCCGACGGNONE
AK120644ATCCGACGGConserved hypothetical protein.
J013001F21ATCCGACGGNONE
J013074D07ATCCGACGGNONE
J013096H23ATCCGACGGNONE
J013098H07ATCCGACGGNONE
J013132L13ATCCGACGGNONE
J013134K05ATCCGACGGNONE
J013155B15ATCCGACGGNONE
J023002L17ATCCGACGGNONE
J023013B08ATCCGACGGNONE
J023087I01ATCCGACGGNONE
J033071O04ATCCGACGGNONE
J065161N23ATCCGACGGNONE
J075055G11ATCCGACGGNONE
J075106J02ATCCGACGGNONE
J080009D06ATCCGACGGNONE
J080009N22ATCCGACGGNONE
J080016L03ATCCGACGGNONE
J080023E17ATCCGACGGNONE
J080027A12ATCCGACGGNONE
J080036M24ATCCGACGGNONE
J080038N07ATCCGACGGNONE
J080041A04ATCCGACGGNONE
J080042K11ATCCGACGGNONE
J080050A04ATCCGACGGNONE
J080053G16ATCCGACGGNONE
J080063D03ATCCGACGGNONE
J080063F07ATCCGACGGNONE
J080067H13ATCCGACGGNONE
J080068F12ATCCGACGGNONE
J080072G17ATCCGACGGNONE
J080072I06ATCCGACGGNONE
J080072J24ATCCGACGGNONE
J080076G09ATCCGACGGNONE
J080085H10ATCCGACGGNONE
J080092I17ATCCGACGGNONE
J080092N20ATCCGACGGNONE
J080093G10ATCCGACGGNONE
J090074C23ATCCGACGGNONE
J090083O18ATCCGACGGNONE
J100046M05ATCCGACGGNONE
J100050N16ATCCGACGGNONE
J100054D07ATCCGACGGNONE
J100054O11ATCCGACGGNONE
J100055F04ATCCGACGGNONE
J100055H22ATCCGACGGNONE
J100063A05ATCCGACGGNONE
J100063I24ATCCGACGGNONE
J100067I12ATCCGACGGNONE
J100074A22ATCCGACGGNONE
J100078B22ATCCGACGGNONE
J100079B03ATCCGACGGNONE
Os02g0816200AK060243GCGACGCGLipolytic enzyme, G-D-S-L family protein.
AK099251GCGACGCGNONE
AK106084GCGACGCGNONE
J065039F12GCGACGCGNONE
J065099G01GCGACGCGNONE
J090005E15GCGACGCGNONE
Os02g0816300009-030-G05GCGACGCGNONE
Os02g0820600AK066549GCGACGCGConserved hypothetical protein.
J013070F02GCGACGCGNONE
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein.
Os03g0116800012-097-D10CCCACGCGACGCGACNONE
016-024-H10CCCACGCGACGCGACNONE
AK066955CCCACGCGACGCGACConserved hypothetical protein.
AK068678CCCACGCGACGCGACNONE
AK104839CCCACGCGACGCGACNONE
J013033G16CCCACGCGACGCGACNONE
J013091C10CCCACGCGACGCGACNONE
J013158H22CCCACGCGACGCGACNONE
J023106K11CCCACGCGACGCGACNONE
J065051O15CCCACGCGACGCGACNONE
J065129G22CCCACGCGACGCGACNONE
J075001K02CCCACGCGACGCGACNONE
J075011O03CCCACGCGACGCGACNONE
J075024K04CCCACGCGACGCGACNONE
J075026E07CCCACGCGACGCGACNONE
J075037O14CCCACGCGACGCGACNONE
J075071D17CCCACGCGACGCGACNONE
J075084M05CCCACGCGACGCGACNONE
J075114B06CCCACGCGACGCGACNONE
J075128C23CCCACGCGACGCGACNONE
J075153A13CCCACGCGACGCGACNONE
J075158A15CCCACGCGACGCGACNONE
J075165P09CCCACGCGACGCGACNONE
J075167M21CCCACGCGACGCGACNONE
J075170F11CCCACGCGACGCGACNONE
J075186F12CCCACGCGACGCGACNONE
J075186L13CCCACGCGACGCGACNONE
J075189A01CCCACGCGACGCGACNONE
J075192D19CCCACGCGACGCGACNONE
Os03g0124300AK069148CGCACGCGACGCGConserved hypothetical protein.
AK106076CGCACGCGACGCGNONE
J023003G19CGCACGCGACGCGNONE
Os03g0126800J075039C05CGCGTCGCGNONE
J075172P07CGCGTCGCGNONE
J075176L13CGCGTCGCGNONE
J075180L10CGCGTCGCGNONE
J090019H18CGCGTCGCGNONE
J090024P22CGCGTCGCGNONE
Os03g0126900AK109217GTCGCGTCGCGTCConserved hypothetical protein.
J065085G16GTCGCGTCGCGTCNONE
J100086C03GTCGCGTCGCGTCNONE
Os03g0128300AK064718GCGTCGCGCGCConserved hypothetical protein.
Os03g0133100013-080-E12CGCGTCGCNONE
AK063608CGCGTCGCHypothetical protein.
AK119680CGCGTCGCNONE
J075192B05CGCGTCGCNONE
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein.
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2).
AK100092AGCCCACGCGTCGCGNONE
J023003L18AGCCCACGCGTCGCGNONE
J023022K18AGCCCACGCGTCGCGNONE
J023107H13AGCCCACGCGTCGCGNONE
J023107K02AGCCCACGCGTCGCGNONE
Os03g0143700AK066360CGCGACGCGACGCGACConserved hypothetical protein.
J013066M09CGCGACGCGACGCGACNONE
J023087N24CGCGACGCGACGCGACNONE
Os03g0146000006-105-H06GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE
AK061250GTCGCGTCGCGTCGCGTCGAGTCGAGTCSimilar to RAB1X.
AK099130GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE
J023043D11GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE
J043009O17GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein.
AK106245CGCGCGACGCGGGCCGAGNONE
J075144I02CGCGCGACGCGGGCCGAGNONE
Os03g0171900006-070-A01GTCGCGTCGCNONE
AK061079GTCGCGTCGCNONE
AK105642GTCGCGTCGCSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
Os03g0177000AK071368CGCGACGCGCN5-related N-acetyltransferase domain containing protein.
Os03g0177100AK068092ATCCGACGGTCCAGAConserved hypothetical protein.
J100036F01ATCCGACGGTCCAGANONE
J100040N06ATCCGACGGTCCAGANONE
J100043E08ATCCGACGGTCCAGANONE
Os03g0179400AK107046ATCCGACGSimilar to Avr9/Cf-9 induced kinase 1.
Os03g0180400006-067-C02ATCCGACGNONE
006-091-E05ATCCGACGNONE
006-094-F06ATCCGACGNONE
009-126-C06ATCCGACGNONE
AB026558ATCCGACGNONE
AK059929ATCCGACGNONE
AK060026ATCCGACGNONE
AK101031ATCCGACGProteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (20S proteasome subunit alpha-1).
AK104324ATCCGACGNONE
J023001I24ATCCGACGNONE
J023150K05ATCCGACGNONE
J033086P06ATCCGACGNONE
J043017O21ATCCGACGNONE
J043021K10ATCCGACGNONE
J053034G22ATCCGACGNONE
J053055G07ATCCGACGNONE
J053095K16ATCCGACGNONE
J065012G02ATCCGACGNONE
J065022K22ATCCGACGNONE
J065030B18ATCCGACGNONE
J065030N19ATCCGACGNONE
J065032A17ATCCGACGNONE
J065032G24ATCCGACGNONE
J065040M17ATCCGACGNONE
J065071D18ATCCGACGNONE
J065072E08ATCCGACGNONE
J065085G14ATCCGACGNONE
J065091H03ATCCGACGNONE
J065108B21ATCCGACGNONE
J065120G08ATCCGACGNONE
J065124L20ATCCGACGNONE
J065130M23ATCCGACGNONE
J065138N18ATCCGACGNONE
J065150F03ATCCGACGNONE
J065169L24ATCCGACGNONE
J065173G21ATCCGACGNONE
J065201E10ATCCGACGNONE
J065209P07ATCCGACGNONE
J065218B04ATCCGACGNONE
J075062P08ATCCGACGNONE
J075097O11ATCCGACGNONE
J090060L06ATCCGACGNONE
J090067F04ATCCGACGNONE
J090074G17ATCCGACGNONE
Os03g0186800AK100356CGCGTCGCModifier of rudimentary, Modr family protein.
Os03g0191200AK070228CCGTCGGAWW/Rsp5/WWP domain containing protein.
Os03g0210600AK070125CGCGTCGCGConserved hypothetical protein.
Os03g0212700009-144-B11CGCGTCGCNONE
AK060718CGCGTCGCNONE
Os03g0213600AK100407CCGTCGGATCConserved hypothetical protein.
Os03g0214400AK067931GACGCGACGCSimilar to Digalactosyldiacylglycerol synthase 2.
Os03g0217900AK119980CCGTCGGATCConserved hypothetical protein.
J053089K18CCGTCGGATCNONE
J090058B20CCGTCGGATCNONE
J090081L09CCGTCGGATCNONE
Os03g0227800016-033-F09CGCGTCGCNONE
AK063571CGCGTCGCNONE
AK103846CGCGTCGCNONE
J013028J20CGCGTCGCNONE
J013091I04CGCGTCGCNONE
J013100P18CGCGTCGCNONE
J013128L15CGCGTCGCNONE
J013153M09CGCGTCGCNONE
J033072J03CGCGTCGCNONE
J033074L07CGCGTCGCNONE
J033106H15CGCGTCGCNONE
J033148J22CGCGTCGCNONE
J065005B02CGCGTCGCNONE
J065009M20CGCGTCGCNONE
J065035E23CGCGTCGCNONE
J065039E24CGCGTCGCNONE
J065057P20CGCGTCGCNONE
J065066E10CGCGTCGCNONE
J065072G21CGCGTCGCNONE
J065076N07CGCGTCGCNONE
J065093G14CGCGTCGCNONE
J065127K10CGCGTCGCNONE
J065142O20CGCGTCGCNONE
J065165O18CGCGTCGCNONE
J065179O07CGCGTCGCNONE
J065203E15CGCGTCGCNONE
J080305J16CGCGTCGCNONE
J090008C14CGCGTCGCNONE
J090083E01CGCGTCGCNONE
J090092B02CGCGTCGCNONE
J090098O14CGCGTCGCNONE
J100042A12CGCGTCGCNONE
J100090K14CGCGTCGCNONE
Os03g0245200003-116-E09CGCGACGCNONE
AK062288CGCGACGCProtein of unknown function DUF1210 family protein.
J075022G03CGCGACGCNONE
J075088C24CGCGACGCNONE
J075110L07CGCGACGCNONE
J075112K01CGCGACGCNONE
J075131F24CGCGACGCNONE
J075149D10CGCGACGCNONE
Os03g0246800AK070145CGCACGCGACGCGNONE
AK102770CGCACGCGACGCGNONE
Os03g0273800AK059223CGCGACGCCATGGGCTTCNONE
AK067356CGCGACGCCATGGGCTTCNONE
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein.
Os03g0275700AK111329TCCGACGGConserved hypothetical protein.
Os03g0276500011-014-A06ATCCGACGGNONE
012-043-E04ATCCGACGGNONE
012-096-G01ATCCGACGGNONE
014-005-A07ATCCGACGGNONE
014-031-F09ATCCGACGGNONE
014-040-C09ATCCGACGGNONE
014-092-G02ATCCGACGGNONE
AK072830ATCCGACGGNONE
AK099275ATCCGACGGNONE
AK109474ATCCGACGGSimilar to Heat shock protein 70.
J013036E08ATCCGACGGNONE
J013047P03ATCCGACGGNONE
J013048H14ATCCGACGGNONE
J013060E24ATCCGACGGNONE
J013093N10ATCCGACGGNONE
J013123K11ATCCGACGGNONE
J013153C09ATCCGACGGNONE
J023010D20ATCCGACGGNONE
J023027O13ATCCGACGGNONE
J023029B01ATCCGACGGNONE
J023063G14ATCCGACGGNONE
J023083D09ATCCGACGGNONE
J023091M13ATCCGACGGNONE
J023121M10ATCCGACGGNONE
J023126D10ATCCGACGGNONE
J023139H01ATCCGACGGNONE
J023145B18ATCCGACGGNONE
J033029G15ATCCGACGGNONE
J033050K13ATCCGACGGNONE
J033057L09ATCCGACGGNONE
J033092M15ATCCGACGGNONE
J065007N14ATCCGACGGNONE
J065038E07ATCCGACGGNONE
J065043A09ATCCGACGGNONE
J065100C19ATCCGACGGNONE
J065117C02ATCCGACGGNONE
J065213I04ATCCGACGGNONE
J090001F01ATCCGACGGNONE
J090025D07ATCCGACGGNONE
J090037C11ATCCGACGGNONE
J090047N11ATCCGACGGNONE
J090053O05ATCCGACGGNONE
J090070F11ATCCGACGGNONE
J090082O16ATCCGACGGNONE
J090085F20ATCCGACGGNONE
J090096N08ATCCGACGGNONE
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1.
Os03g0285800AF216315CCCCCGCGTCGCNONE
AF332873CCCCCGCGTCGCNONE
AF479883CCCCCGCGTCGCNONE
AF479884CCCCCGCGTCGCNONE
AJ250311CCCCCGCGTCGCNONE
AJ486975CCCCCGCGTCGCNONE
AK067339CCCCCGCGTCGCMAP Kinase.
AK104834CCCCCGCGTCGCNONE
J013102O17CCCCCGCGTCGCNONE
J023055N19CCCCCGCGTCGCNONE
J023099F06CCCCCGCGTCGCNONE
J065144H06CCCCCGCGTCGCNONE
J065153A14CCCCCGCGTCGCNONE
J065212K01CCCCCGCGTCGCNONE
Os03g0294200AK069285ATCCGACGSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase.
Os03g0297400AK060653GCCACGTCGCGTCGCNONE
AK061403GCCACGTCGCGTCGCNONE
AK101597GCCACGTCGCGTCGCMalonyl CoA-acyl carrier protein transacylase family protein.
Os03g0302800AK061293GCGACGCGACGCGConserved hypothetical protein.
Os03g0312500AK106657GCGACGCGSimilar to Inhibitor of apoptosis-like protein.
AK109328GCGACGCGNONE
Os03g0319300006-021-E05GTCGCGTCGCGNONE
006-022-H12GTCGCGTCGCGNONE
009-187-E02GTCGCGTCGCGNONE
AF042840GTCGCGTCGCGNONE
AK059756GTCGCGTCGCGCalmodulin (CaM).
AK070090GTCGCGTCGCGNONE
J065017J02GTCGCGTCGCGNONE
J065028G17GTCGCGTCGCGNONE
J065045N09GTCGCGTCGCGNONE
J065078F21GTCGCGTCGCGNONE
J065091H01GTCGCGTCGCGNONE
J065112B19GTCGCGTCGCGNONE
J065186E08GTCGCGTCGCGNONE
J065199G12GTCGCGTCGCGNONE
J075030K07GTCGCGTCGCGNONE
J075050B02GTCGCGTCGCGNONE
J075057G07GTCGCGTCGCGNONE
J075070F01GTCGCGTCGCGNONE
J075093N12GTCGCGTCGCGNONE
J075095K13GTCGCGTCGCGNONE
J075102D14GTCGCGTCGCGNONE
J075103B17GTCGCGTCGCGNONE
J075114K05GTCGCGTCGCGNONE
J075142F18GTCGCGTCGCGNONE
J075154L11GTCGCGTCGCGNONE
J075185F08GTCGCGTCGCGNONE
J090012A14GTCGCGTCGCGNONE
J090044L10GTCGCGTCGCGNONE
J100044C12GTCGCGTCGCGNONE
J100088J19GTCGCGTCGCGNONE
Os03g0320500AK108145ATCCGACGVQ domain containing protein.
J065122I01ATCCGACGNONE
J100057H12ATCCGACGNONE
J100078A15ATCCGACGNONE
Os03g0323100009-108-G02CGGGTGGGGCGTCGGATCNONE
AK062803CGGGTGGGGCGTCGGATCHypothetical protein.
AK070776CGGGTGGGGCGTCGGATCNONE
Os03g0323200AK067323GATCCGACGCCCCACCCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor.
Os03g0330300AK060756CGCGTCGCGViral attachment protein, fibre shaft repeat containing protein.
AK072405CGCGTCGCGNONE
J013043H13CGCGTCGCGNONE
J013097M19CGCGTCGCGNONE
J023080M15CGCGTCGCGNONE
Os03g0337600AF119232ATCCGACGNONE
AK070859ATCCGACGSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment).
J013110I18ATCCGACGNONE
J013147M17ATCCGACGNONE
J065083M01ATCCGACGNONE
J065199H24ATCCGACGNONE
Os03g0342900006-032-D01CGCGTCGCNONE
006-033-E10CGCGTCGCNONE
006-051-G06CGCGTCGCNONE
006-053-E05CGCGTCGCNONE
006-056-B05CGCGTCGCNONE
006-058-F04CGCGTCGCNONE
006-059-E05CGCGTCGCNONE
006-060-F10CGCGTCGCNONE
006-104-D12CGCGTCGCNONE
009-129-C12CGCGTCGCNONE
AK060136CGCGTCGCNONE
AK060980CGCGTCGCNONE
AK064815CGCGTCGCDormancyauxin associated family protein.
AK104244CGCGTCGCNONE
AK104391CGCGTCGCNONE
AK104590CGCGTCGCNONE
AK104744CGCGTCGCNONE
AK106100CGCGTCGCNONE
J013000E10CGCGTCGCNONE
J075027O22CGCGTCGCNONE
J075052J03CGCGTCGCNONE
J075066E15CGCGTCGCNONE
J075095C17CGCGTCGCNONE
J075118N05CGCGTCGCNONE
J075187K22CGCGTCGCNONE
J090026L04CGCGTCGCNONE
J090059G16CGCGTCGCNONE
J100055P20CGCGTCGCNONE
J100062A10CGCGTCGCNONE
J100068G20CGCGTCGCNONE
Os03g0343500009-042-G06CCGTCGGATCNONE
009-063-D01CCGTCGGATCNONE
009-156-H09CCGTCGGATCNONE
AB117995CCGTCGGATCNONE
AK058737CCGTCGGATCNONE
AK059599CCGTCGGATCSimilar to 60S ribosomal protein L22-2.
AK121502CCGTCGGATCNONE
J023082D10CCGTCGGATCNONE
J033022G11CCGTCGGATCNONE
J075048M16CCGTCGGATCNONE
J075049O20CCGTCGGATCNONE
J075082I02CCGTCGGATCNONE
J075105G01CCGTCGGATCNONE
J075131K05CCGTCGGATCNONE
J080002H01CCGTCGGATCNONE
J080003H01CCGTCGGATCNONE
J080005G08CCGTCGGATCNONE
J080011M13CCGTCGGATCNONE
J080020M02CCGTCGGATCNONE
J080026N24CCGTCGGATCNONE
J080028L09CCGTCGGATCNONE
J080032O14CCGTCGGATCNONE
J080033J12CCGTCGGATCNONE
J080035D05CCGTCGGATCNONE
J080039H01CCGTCGGATCNONE
J080044B07CCGTCGGATCNONE
J080044E23CCGTCGGATCNONE
J080049N11CCGTCGGATCNONE
J080050A21CCGTCGGATCNONE
J080055L24CCGTCGGATCNONE
J080059N20CCGTCGGATCNONE
J080061F04CCGTCGGATCNONE
J080078I16CCGTCGGATCNONE
J080079G24CCGTCGGATCNONE
J080080K13CCGTCGGATCNONE
J080083G20CCGTCGGATCNONE
J080087B08CCGTCGGATCNONE
J080091L19CCGTCGGATCNONE
J080094D06CCGTCGGATCNONE
J090038L06CCGTCGGATCNONE
J090075H06CCGTCGGATCNONE
J090081D12CCGTCGGATCNONE
Os03g0374400016-027-B12GCGTCGCGCCCACCTNONE
AK069719GCGTCGCGCCCACCTConserved hypothetical protein.
J023020L05GCGTCGCGCCCACCTNONE
J023026H16GCGTCGCGCCCACCTNONE
J033025P22GCGTCGCGCCCACCTNONE
J075016I21GCGTCGCGCCCACCTNONE
J090015G21GCGTCGCGCCCACCTNONE
Os03g0374500Os03g0374500GCGTCGCGCCCACCTHypothetical protein.
Os03g0410700J065102A22CCGTCGGANONE
Os03g0410900J065067F10TCCGACGGNONE
J065073D08TCCGACGGNONE
J065176C06TCCGACGGNONE
J065189O13TCCGACGGNONE
J065214E05TCCGACGGNONE
J080007H09TCCGACGGNONE
J080012B19TCCGACGGNONE
J080020J16TCCGACGGNONE
J080038J22TCCGACGGNONE
J080045I09TCCGACGGNONE
J080059M16TCCGACGGNONE
J080060C19TCCGACGGNONE
J080080P22TCCGACGGNONE
J080083C03TCCGACGGNONE
J080093M17TCCGACGGNONE
J100029F12TCCGACGGLike-Sm ribonucleoprotein, core family protein.
Os03g0428800AK060233CCGTCGGATetratricopeptide-like helical domain containing protein.
Os03g0437200006-066-E02GCGTCGCGTCGCNONE
AK059839GCGTCGCGTCGCZinc finger, C2H2-type domain containing protein.
AY295345GCGTCGCGTCGCNONE
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39.
J023106M18CCGATCCGACGGCCCGNONE
J065178J05CCGATCCGACGGCCCGNONE
J065196F10CCGATCCGACGGCCCGNONE
Os03g0561249J065016H04CGCGACGCGTGGConserved hypothetical protein.
Os03g0577200006-030-H11ATCCGACGGCCCAGGNONE
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A).
AK098953ATCCGACGGCCCAGGNONE
AK099558ATCCGACGGCCCAGGNONE
AK104547ATCCGACGGCCCAGGNONE
J013034B14ATCCGACGGCCCAGGNONE
J013066J17ATCCGACGGCCCAGGNONE
J090033N14ATCCGACGGCCCAGGNONE
Os03g0611200AK065587CGCGTCGCAldo/keto reductase family protein.
Os03g0633800AK073044CGCGTCGCSimilar to IAA6 (Fragment).
AK073044GATCCGACGGCCCSimilar to IAA6 (Fragment).
J065038L22CGCGTCGCNONE
J065038L22GATCCGACGGCCCNONE
J065185C13CGCGTCGCNONE
J065185C13GATCCGACGGCCCNONE
Os03g0634000014-034-A03CGCGTCGCGTCGCNONE
AK063673CGCGTCGCGTCGCSimilar to THA4.
Os03g0654800013-068-E05CCGTCGGATNONE
AK103330CCGTCGGATHypothetical protein.
J033125N05CCGTCGGATNONE
J065171F15CCGTCGGATNONE
J100056J05CCGTCGGATNONE
J100069D02CCGTCGGATNONE
Os03g0669300006-050-A06CGCGTCGCGNONE
AK061572CGCGTCGCGGlycoside hydrolase, family 17 protein.
AK120399CGCGTCGCGNONE
AK120903CGCGTCGCGNONE
J075023N09CGCGTCGCGNONE
J075083N02CGCGTCGCGNONE
J075097I22CGCGTCGCGNONE
J100070D08CGCGTCGCGNONE
J100086L13CGCGTCGCGNONE
Os03g0675300015-081-H08CGCGACGCNONE
AK106417CGCGACGCAntihaemostatic protein domain containing protein.
Os03g0696000AK109661CGCGTCGCHarpin-induced 1 domain containing protein.
Os03g0703000011-082-B01CGCGACGCNONE
014-041-E03CGCGACGCNONE
AK100165CGCGACGCNONE
AK103027CGCGACGCNONE
AK105026CGCGACGCNONE
J013146C10CGCGACGCNONE
J023050B03CGCGACGCNONE
J033117C01CGCGACGCNONE
J080039D22CGCGACGCNONE
J090013G10CGCGACGCNONE
J090025K21CGCGACGCNONE
J090052K21CGCGACGCNONE
J090074F22CGCGACGCNONE
J100063C18CGCGACGCNONE
J100083C15CGCGACGCNONE
U28047CGCGACGCSimilar to Beta-glucosidase.
Os03g0709300AK100153CGCGTCGCSimilar to Chemocyanin precursor (Basic blue protein) (Plantacyanin).
J065192M19CGCGTCGCNONE
Os03g0711300AK060694CGCGACGCNONE
Os03g0711600X88799CGCGTCGCGSimilar to DNA binding protein (Fragment).
Os03g0716200Os03g0716200GCGACGCGCACCGCACCGCConserved hypothetical protein.
Os03g0722500AK099926CCGTCGGATCGGGlycoside hydrolase, family 17 protein.
AK100108CCGTCGGATCGGNONE
J023004N24CCGTCGGATCGGNONE
J100018K24CCGTCGGATCGGNONE
J100032B22CCGTCGGATCGGNONE
J100036K14CCGTCGGATCGGNONE
J100043B05CCGTCGGATCGGNONE
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein.
J065100I07ATCCGACGGCCCAGGNONE
Os03g0745600014-030-E09CGCCACGTCGGATCNONE
J053057E07CGCCACGTCGGATCNONE
J075044L08CGCCACGTCGGATCNONE
J075069C24CGCCACGTCGGATCNONE
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein.
J075180G21CGCCACGTCGGATCNONE
J075189M22CGCCACGTCGGATCNONE
J075192P11CGCCACGTCGGATCNONE
Os03g0749900006-112-A05CGCGACGCNONE
AK061252CGCGACGCConserved hypothetical protein.
J023020I01CGCGACGCNONE
J033060N21CGCGACGCNONE
Os03g0752800AB041020CGCACGCGTCGCNONE
AF058697CGCACGCGTCGCMADS14 protein.
AF139664CGCACGCGTCGCNONE
AK121171CGCACGCGTCGCNONE
AY332478CGCACGCGTCGCNONE
AY551916CGCACGCGTCGCNONE
J023081C04CGCACGCGTCGCNONE
Os03g0753600AK067449CCGTCGGATCChromo domain containing protein.
J013107L13CCGTCGGATCNONE
Os03g0758800AJ252135GATCCGACGGNONE
AJ312906GATCCGACGGNONE
AK060387GATCCGACGGSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D).
AK121592GATCCGACGGNONE
J023109G09GATCCGACGGNONE
J033038B14GATCCGACGGNONE
J043013C09GATCCGACGGNONE
J053096E21GATCCGACGGNONE
J065026B08GATCCGACGGNONE
J065062B16GATCCGACGGNONE
J065066E03GATCCGACGGNONE
J065091J12GATCCGACGGNONE
J065164A06GATCCGACGGNONE
J075014I20GATCCGACGGNONE
J075117N07GATCCGACGGNONE
J075142M03GATCCGACGGNONE
J075175D04GATCCGACGGNONE
J075188M01GATCCGACGGNONE
J075199I20GATCCGACGGNONE
J090010J12GATCCGACGGNONE
J090025O16GATCCGACGGNONE
J090041H05GATCCGACGGNONE
J090078P07GATCCGACGGNONE
J100031K10GATCCGACGGNONE
J100055F23GATCCGACGGNONE
J100064G05GATCCGACGGNONE
J100080C24GATCCGACGGNONE
J100080O07GATCCGACGGNONE
J100090F01GATCCGACGGNONE
Os03g0761500AK101646GCGTCGCGNONE
AK103255GCGTCGCGSimilar to Subtilisin-like protease (Fragment).
J023001N03GCGTCGCGNONE
J023019D14GCGTCGCGNONE
J023022B15GCGTCGCGNONE
J023132H08GCGTCGCGNONE
J033024J07GCGTCGCGNONE
J033028J10GCGTCGCGNONE
J033034N16GCGTCGCGNONE
J033058G12GCGTCGCGNONE
J033068F19GCGTCGCGNONE
J033090C13GCGTCGCGNONE
J033112H13GCGTCGCGNONE
J033123P12GCGTCGCGNONE
J033131E23GCGTCGCGNONE
J033131P18GCGTCGCGNONE
J033132E16GCGTCGCGNONE
J065047J15GCGTCGCGNONE
J065059O05GCGTCGCGNONE
J065061N22GCGTCGCGNONE
J065086O08GCGTCGCGNONE
J065117P15GCGTCGCGNONE
J065217N21GCGTCGCGNONE
J075017I08GCGTCGCGNONE
J075025D11GCGTCGCGNONE
J075026P19GCGTCGCGNONE
J075027G19GCGTCGCGNONE
J075060K14GCGTCGCGNONE
J075069G18GCGTCGCGNONE
J075088H13GCGTCGCGNONE
J075094E18GCGTCGCGNONE
J075095K22GCGTCGCGNONE
J075097O06GCGTCGCGNONE
J075116H10GCGTCGCGNONE
J075140M17GCGTCGCGNONE
J075172N22GCGTCGCGNONE
J075178C01GCGTCGCGNONE
J075179M02GCGTCGCGNONE
J075180E18GCGTCGCGNONE
J075181N01GCGTCGCGNONE
J075191C02GCGTCGCGNONE
J090003N22GCGTCGCGNONE
J090040H23GCGTCGCGNONE
J090051D11GCGTCGCGNONE
J090060E01GCGTCGCGNONE
J090073O06GCGTCGCGNONE
J090095G24GCGTCGCGNONE
J100027P22GCGTCGCGNONE
J100055A18GCGTCGCGNONE
J100088C12GCGTCGCGNONE
Os03g0762400AK071181GCGACGCGSimilar to Peroxidase2 precursor (EC 1.11.1.7).
J023084I20GCGACGCGNONE
J033039C18GCGACGCGNONE
J033108N03GCGACGCGNONE
J043017N16GCGACGCGNONE
J065026C13GCGACGCGNONE
J065045C01GCGACGCGNONE
J065045D11GCGACGCGNONE
J065050N09GCGACGCGNONE
J065058P21GCGACGCGNONE
J065075I20GCGACGCGNONE
J065077I17GCGACGCGNONE
J065081I20GCGACGCGNONE
J065085B14GCGACGCGNONE
J065101K21GCGACGCGNONE
J065112A17GCGACGCGNONE
J065112N13GCGACGCGNONE
J065118J02GCGACGCGNONE
J065123E01GCGACGCGNONE
J065134N12GCGACGCGNONE
J065139L04GCGACGCGNONE
J065141I11GCGACGCGNONE
J065161J24GCGACGCGNONE
J065164I10GCGACGCGNONE
J065171L01GCGACGCGNONE
J065178P21GCGACGCGNONE
J065185L24GCGACGCGNONE
J065219C04GCGACGCGNONE
J075029B07GCGACGCGNONE
J075033G20GCGACGCGNONE
J075054N01GCGACGCGNONE
J075068B22GCGACGCGNONE
J075096N11GCGACGCGNONE
J075098C11GCGACGCGNONE
J075115J22GCGACGCGNONE
J075127D11GCGACGCGNONE
J075156J21GCGACGCGNONE
J075166G08GCGACGCGNONE
J075166P17GCGACGCGNONE
J075170O18GCGACGCGNONE
J075181A16GCGACGCGNONE
J075195J11GCGACGCGNONE
Os03g0772600AK120949GAGACGCGACGCGACGCGACGCGSimilar to Lectin-like receptor kinase 7;2.
Os03g0784400AK103474GCGTCGCGTCProtein of unknown function DUF1692 domain containing protein.
J023135I15GCGTCGCGTCNONE
J033130D12GCGTCGCGTCNONE
J043035E20GCGTCGCGTCNONE
J065206K15GCGTCGCGTCNONE
J075053J20GCGTCGCGTCNONE
J075129B11GCGTCGCGTCNONE
J090003E22GCGTCGCGTCNONE
J100023E23GCGTCGCGTCNONE
Os03g0784500AK109744CATCCACCCGCGTCGCGTCTCNONE
Os03g0785500AK067718CGCGACGCGProtein of unknown function DUF284, transmembrane eukaryotic family protein.
AK067718CGCGTCGCProtein of unknown function DUF284, transmembrane eukaryotic family protein.
Os03g0786500016-056-D08CGCGTCGCACGCCACNONE
AK106487CGCGTCGCACGCCACSimilar to Glycine-rich protein 2.
J080001C23CGCGTCGCACGCCACNONE
J080005A02CGCGTCGCACGCCACNONE
J080009A14CGCGTCGCACGCCACNONE
J080009B11CGCGTCGCACGCCACNONE
J080011L03CGCGTCGCACGCCACNONE
J080017E21CGCGTCGCACGCCACNONE
J080018H08CGCGTCGCACGCCACNONE
J080021E11CGCGTCGCACGCCACNONE
J080025O20CGCGTCGCACGCCACNONE
J080026H21CGCGTCGCACGCCACNONE
J080029I10CGCGTCGCACGCCACNONE
J080036L01CGCGTCGCACGCCACNONE
J080038M15CGCGTCGCACGCCACNONE
J080051H09CGCGTCGCACGCCACNONE
J080053E18CGCGTCGCACGCCACNONE
J080054I12CGCGTCGCACGCCACNONE
J080055B14CGCGTCGCACGCCACNONE
J080060L16CGCGTCGCACGCCACNONE
J080067G06CGCGTCGCACGCCACNONE
J080069K14CGCGTCGCACGCCACNONE
J080070N14CGCGTCGCACGCCACNONE
J080071G10CGCGTCGCACGCCACNONE
J080076D08CGCGTCGCACGCCACNONE
J080076O11CGCGTCGCACGCCACNONE
J080078E10CGCGTCGCACGCCACNONE
J080079B15CGCGTCGCACGCCACNONE
J080079K03CGCGTCGCACGCCACNONE
J080079O15CGCGTCGCACGCCACNONE
J080087B18CGCGTCGCACGCCACNONE
Os03g0789800AK106804ATCCGACGNONE
AK106804GCGACGCGNONE
AK106804TCCGACGGNONE
J065068E17ATCCGACGNONE
J065068E17GCGACGCGNONE
J065068E17TCCGACGGNONE
J090016H22ATCCGACGNONE
J090016H22GCGACGCGNONE
J090016H22TCCGACGGNONE
Os03g0790900AK059698GCGACGCGNONE
Os03g0793700AK121667CGCGACGCCupin 1 domain containing protein.
AY098743CGCGACGCNONE
Os03g0794800AK070933GCGACGCGACSimilar to XRN3.
Os03g0800400AK071430CGCGTCGCProtein of unknown function DUF1618 domain containing protein.
J023019H20CGCGTCGCNONE
J023097A10CGCGTCGCNONE
J023100K15CGCGTCGCNONE
J075095I09CGCGTCGCNONE
J090014B19CGCGTCGCNONE
J090072D02CGCGTCGCNONE
J100029E17CGCGTCGCNONE
J100047F04CGCGTCGCNONE
Os03g0801900015-081-G06GCGACGCGNONE
AK106415GCGACGCGProtein of unknown function DUF569 family protein.
J090099L17GCGACGCGNONE
J100024B03GCGACGCGNONE
J100088I08GCGACGCGNONE
Os03g0818100015-098-A09CGCGACGCNONE
AK064366CGCGACGCNONE
AK121701CGCGACGCHistidine acid phosphatase family protein.
Os03g0820600013-030-F01ATCCGACGNONE
AK058941ATCCGACGSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3).
J065038I10ATCCGACGNONE
J065043C23ATCCGACGNONE
J065060H20ATCCGACGNONE
J065065E06ATCCGACGNONE
J065078K18ATCCGACGNONE
J065116J24ATCCGACGNONE
J065118G22ATCCGACGNONE
J065129D16ATCCGACGNONE
J065153G20ATCCGACGNONE
J065159I03ATCCGACGNONE
J065176E14ATCCGACGNONE
J065187B11ATCCGACGNONE
J065203D14ATCCGACGNONE
J065217P15ATCCGACGNONE
J075105D14ATCCGACGNONE
J100036F11ATCCGACGNONE
J100044M07ATCCGACGNONE
Os03g0822000AF247164CGCGACGCGNONE
AK101784CGCGACGCGNONE
AK119215CGCGACGCGAlpha-expansin OsEXPA7.
J033065B20CGCGACGCGNONE
J065038A10CGCGACGCGNONE
J065049A16CGCGACGCGNONE
J065085B11CGCGACGCGNONE
J065205I19CGCGACGCGNONE
J065210L24CGCGACGCGNONE
Os03g0829600AK071298CGCGACGCGNONE
AK119707CGCGACGCGConserved hypothetical protein.
J023084A07CGCGACGCGNONE
Os03g0832200AK070712CGCGTCGCSimilar to Calcium-binding protein precursor (Calreticulin).
Os03g0848600AK065662ATCCGACGSimilar to NOI protein.
J013041L20ATCCGACGNONE
J053074F15ATCCGACGNONE
J090098L10ATCCGACGNONE
Os03g0855700AK070400CGCGACGCGNucleic acid-binding, OB-fold domain containing protein.
Os04g0105500AK068066CCGTCGGANONE
AK071444CCGTCGGASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis.
J013130G18CCGTCGGANONE
J023093I17CCGTCGGANONE
J033079J01CCGTCGGANONE
J043027J02CCGTCGGANONE
J065135G05CCGTCGGANONE
Os04g0253000005-012-H08ATCCGACGGNONE
005-012-H08CGCGACGCNONE
009-095-D01ATCCGACGGNONE
009-095-D01CGCGACGCNONE
016-090-D11ATCCGACGGNONE
016-090-D11CGCGACGCNONE
AK073668ATCCGACGGSimilar to Histone H1.
AK073668CGCGACGCSimilar to Histone H1.
J013088G23ATCCGACGGNONE
J013088G23CGCGACGCNONE
J013162C07ATCCGACGGNONE
J013162C07CGCGACGCNONE
J023031N06ATCCGACGGNONE
J023031N06CGCGACGCNONE
J023039N07ATCCGACGGNONE
J023039N07CGCGACGCNONE
J023083I01ATCCGACGGNONE
J023083I01CGCGACGCNONE
J023083O14ATCCGACGGNONE
J023083O14CGCGACGCNONE
J023122B19ATCCGACGGNONE
J023122B19CGCGACGCNONE
J023133L08ATCCGACGGNONE
J023133L08CGCGACGCNONE
J033052L06ATCCGACGGNONE
J033052L06CGCGACGCNONE
J033080E10ATCCGACGGNONE
J033080E10CGCGACGCNONE
J090032L14ATCCGACGGNONE
J090032L14CGCGACGCNONE
J100022N05ATCCGACGGNONE
J100022N05CGCGACGCNONE
J100029A08ATCCGACGGNONE
J100029A08CGCGACGCNONE
J100029H18ATCCGACGGNONE
J100029H18CGCGACGCNONE
J100066D09ATCCGACGGNONE
J100066D09CGCGACGCNONE
J100077M22ATCCGACGGNONE
J100077M22CGCGACGCNONE
Os04g0269900J065139P11CGTCGGATCGGNONE
J100034P12CGTCGGATCGGNONE
J100045D21CGTCGGATCGGNONE
Os04g0293600AK063003GCGACGCGHypothetical protein.
Os04g0304200AB018443CCGTCGGANONE
AK067128CCGTCGGASimilar to Nonphototropic hypocotyl protein 1 (EC 2.7.1.37) (Phototropin).
Os04g0370600AK103855GCGACGCG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein.
J023115N20GCGACGCGNONE
J033148N10GCGACGCGNONE
J090031L24GCGACGCGNONE
J090089F12GCGACGCGNONE
Os04g0382100AK108218CGCGTCGCSWIB/MDM2 domain containing protein.
J065059M07CGCGTCGCNONE
J065104M04CGCGTCGCNONE
Os04g0401000006-024-G01GATCCGACGGNONE
009-047-D03GATCCGACGGNONE
009-078-G04GATCCGACGGNONE
009-083-C06GATCCGACGGNONE
009-094-D02GATCCGACGGNONE
009-129-B02GATCCGACGGNONE
009-186-E03GATCCGACGGNONE
AK070581GATCCGACGGNONE
AK072320GATCCGACGGNONE
AK106153GATCCGACGGHeavy metal transport/detoxification protein domain containing protein.
Os04g0405500011-007-D12CGCGTCGCGTCCCTCANONE
AK063263CGCGTCGCGTCCCTCAConserved hypothetical protein.
J065166G19CGCGTCGCGTCCCTCANONE
J075180M09CGCGTCGCGTCCCTCANONE
Os04g0405600015-003-G04ATCCGACGGNONE
AK068579ATCCGACGGProtein of unknown function DUF1350 family protein.
AK101565ATCCGACGGNONE
J013023M11ATCCGACGGNONE
J013055A13ATCCGACGGNONE
J013157C11ATCCGACGGNONE
J033128I12ATCCGACGGNONE
J065193N19ATCCGACGGNONE
J090055C15ATCCGACGGNONE
J090058C22ATCCGACGGNONE
J090077L18ATCCGACGGNONE
J090086C04ATCCGACGGNONE
J090095D03ATCCGACGGNONE
J100040K04ATCCGACGGNONE
J100040M11ATCCGACGGNONE
Os04g0406600AK103609CGCGACGCGPrephenate dehydratase domain containing protein.
J033133I10CGCGACGCGNONE
J075092D11CGCGACGCGNONE
J100031M09CGCGACGCGNONE
Os04g0407900AK064758GCGTCGCGSimilar to Cytochrom P450-like protein.
Os04g0412300AK110902CGCGCGACGCGNONE
AK121151CGCGCGACGCGGlycoside hydrolase, family 17 protein.
J013126I01CGCGCGACGCGNONE
J023078I08CGCGCGACGCGNONE
J090006M17CGCGCGACGCGNONE
J090060D03CGCGCGACGCGNONE
J090063F12CGCGCGACGCGNONE
J100040E06CGCGCGACGCGNONE
J100057F18CGCGCGACGCGNONE
J100058B19CGCGCGACGCGNONE
J100058C20CGCGCGACGCGNONE
J100067G08CGCGCGACGCGNONE
J100082C09CGCGCGACGCGNONE
J100086D14CGCGCGACGCGNONE
Os04g0414500AK121479CGCGTCGCGConserved hypothetical protein.
J023149I19CGCGTCGCGNONE
J090084C07CGCGTCGCGNONE
Os04g0430600009-014-G12CGCGTCGCGTCNONE
015-019-A08CGCGTCGCGTCNONE
015-048-C08CGCGTCGCGTCNONE
015-085-E11CGCGTCGCGTCNONE
AK072050CGCGTCGCGTCNONE
AK106337CGCGTCGCGTCConserved hypothetical protein.
J065037C09CGCGTCGCGTCNONE
J075125G18CGCGTCGCGTCNONE
Os04g0434400014-079-B10CGCGCGACGCGNONE
AK063725CGCGCGACGCGConserved hypothetical protein.
Os04g0449100AK110929CCGTCGGATXyloglucan fucosyltransferase family protein.
Os04g0464200AK103582GCGTCGCGBetaine-aldehyde dehydrogenase (EC 1.2.1.8) (BADH).
J033133A13GCGTCGCGNONE
J090026I06GCGTCGCGNONE
J090096B12GCGTCGCGNONE
Os04g0470300AK059742ATCCGACGGNONE
AK070483ATCCGACGGProtein of unknown function UPF0136, Transmembrane family protein.
J065200F06ATCCGACGGNONE
J090047A18ATCCGACGGNONE
Os04g0481100AK099817CGCGTCGCGSimilar to Seed imbibition protein (Fragment).
AK100197CGCGTCGCGNONE
AK111421CGCGTCGCGNONE
Os04g0484900AK122179GATCCGACGGSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis.
J023093A12GATCCGACGGNONE
J033024H07GATCCGACGGNONE
J033149C03GATCCGACGGNONE
Os04g0494600AK110895CGCGTCGCGCGProtein of unknown function DUF642 family protein.
Os04g0505200004-004-B07GCGACGCGNONE
006-025-D10GCGACGCGNONE
006-038-D07GCGACGCGNONE
006-044-H11GCGACGCGNONE
006-061-A09GCGACGCGNONE
006-083-C02GCGACGCGNONE
009-167-F06GCGACGCGNONE
013-093-B02GCGACGCGNONE
AK061301GCGACGCGLeucine-rich repeat, plant specific containing protein.
AK066703GCGACGCGNONE
AK104903GCGACGCGNONE
J013027H24GCGACGCGNONE
J013075O17GCGACGCGNONE
J013130D11GCGACGCGNONE
J033069B22GCGACGCGNONE
J033102K15GCGACGCGNONE
J090004A17GCGACGCGNONE
J090008L22GCGACGCGNONE
J090063C05GCGACGCGNONE
Os04g0529100AK107680CGCACGCGTCGCGPathogenesis-related transcriptional factor and ERF domain containing protein.
Os04g0530300009-053-E04CGTCGGATCGGNONE
009-074-E03CGTCGGATCGGNONE
AK066705CGTCGGATCGGConserved hypothetical protein.
Os04g0542900AK068610CGACACGTCGGATCConserved hypothetical protein.
Os04g0545100AK071451GCGTCGCGEngulfment and cell motility, ELM domain containing protein.
Os04g0556300009-065-A04CGCGACGCNONE
009-124-C05CGCGACGCNONE
AK062772CGCGACGCGlutathione peroxidase.
AY100689CGCGACGCNONE
J065008N06CGCGACGCNONE
J065012C13CGCGACGCNONE
J065017J06CGCGACGCNONE
J065033M15CGCGACGCNONE
J065086O21CGCGACGCNONE
J065102K04CGCGACGCNONE
J065141D21CGCGACGCNONE
J065159K20CGCGACGCNONE
J065164C12CGCGACGCNONE
J065170F10CGCGACGCNONE
J065181F20CGCGACGCNONE
J065205N07CGCGACGCNONE
J065209N21CGCGACGCNONE
J075001M12CGCGACGCNONE
J075007D22CGCGACGCNONE
J075026H04CGCGACGCNONE
J075042O08CGCGACGCNONE
J075044G20CGCGACGCNONE
J075057D10CGCGACGCNONE
J075096L23CGCGACGCNONE
J075104K12CGCGACGCNONE
J075119H14CGCGACGCNONE
J075136C14CGCGACGCNONE
J075172D01CGCGACGCNONE
J075184M01CGCGACGCNONE
J075186E06CGCGACGCNONE
J075192M08CGCGACGCNONE
J080006D18CGCGACGCNONE
J080044G16CGCGACGCNONE
J080087G15CGCGACGCNONE
J100021I05CGCGACGCNONE
J100039D10CGCGACGCNONE
J100073B05CGCGACGCNONE
J100074M12CGCGACGCNONE
Os04g0560100006-090-B07GCGACGCGNONE
AK071033GCGACGCGNONE
AK106001GCGACGCGCytochrome P450 family protein.
J023063N21GCGACGCGNONE
J023078O09GCGACGCGNONE
J090062K20GCGACGCGNONE
Os04g0563700015-005-B06CGCGTCGCCCATCCANONE
AB024987CGCGTCGCCCATCCANONE
AK070211CGCGTCGCCCATCCACyclin.
Os04g0574100006-087-B01GCGACGCGNONE
006-087-B01GGATGGGCCCCGCGTCGCNONE
AK061150GCGACGCGNONE
AK061150GGATGGGCCCCGCGTCGCNONE
AK069178GCGACGCGExostosin-like family protein.
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein.
AK121041GCGACGCGNONE
AK121041GGATGGGCCCCGCGTCGCNONE
J023008D04GCGACGCGNONE
J023008D04GGATGGGCCCCGCGTCGCNONE
J023052A13GCGACGCGNONE
J023052A13GGATGGGCCCCGCGTCGCNONE
J065046P18GCGACGCGNONE
J065046P18GGATGGGCCCCGCGTCGCNONE
J065105D10GCGACGCGNONE
J065105D10GGATGGGCCCCGCGTCGCNONE
Os04g0576300J065199E10GATCCGACGPseudouridylate synthase TruB, N-terminal domain containing protein.
Os04g0576800AK073542CGCGACGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein.
AK104042CGCGACGCNONE
Os04g0579200AK100603CGCGACGCZinc finger, RING-type domain containing protein.
Os04g0586100009-190-F11CGCGACGCGACGCCCCACCNONE
AK063206CGCGACGCGACGCCCCACCProtein of unknown function DUF581 family protein.
Os04g0594100014-046-H12GCGACGCGNONE
014-049-F01GCGACGCGNONE
AK111960GCGACGCGSimilar to P-type R2R3 Myb protein (Fragment).
Os04g0612600AB042115TCCGACGGGCCCACCTNONE
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit.
AK099008TCCGACGGGCCCACCTNONE
AK104427TCCGACGGGCCCACCTNONE
J023043H02TCCGACGGGCCCACCTNONE
J033033I23TCCGACGGGCCCACCTNONE
J033067P21TCCGACGGGCCCACCTNONE
J033088M21TCCGACGGGCCCACCTNONE
J033133M08TCCGACGGGCCCACCTNONE
J043030I16TCCGACGGGCCCACCTNONE
J075049H08TCCGACGGGCCCACCTNONE
Os04g0623800AK059270CGCGTCGCGCGCNONE
AK099234CGCGTCGCGCGCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT).
Os04g0627900AK108443ATCCGACGTranslation initiation factor SUI1 domain containing protein.
AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein.
J065178D17ATCCGACGNONE
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE
Os04g0634800AK107772GCGACGCGConserved hypothetical protein.
J065046O17GCGACGCGNONE
J065121F10GCGACGCGNONE
J075173G21GCGACGCGNONE
J090081F22GCGACGCGNONE
J100037A09GCGACGCGNONE
J100056M24GCGACGCGNONE
Os04g0639100009-158-D03CGCGTCGCCCAACCNONE
AK063036CGCGTCGCCCAACCConserved hypothetical protein.
J075045D14CGCGTCGCCCAACCNONE
J075047L16CGCGTCGCCCAACCNONE
J075048D20CGCGTCGCCCAACCNONE
J075056E20CGCGTCGCCCAACCNONE
J075074E14CGCGTCGCCCAACCNONE
J075108F16CGCGTCGCCCAACCNONE
J075143L19CGCGTCGCCCAACCNONE
J075146L07CGCGTCGCCCAACCNONE
J075158I04CGCGTCGCCCAACCNONE
J075172B20CGCGTCGCCCAACCNONE
J090061M08CGCGTCGCCCAACCNONE
Os04g0642100011-074-F06CGCGACGCGNONE
J043006J10CGCGACGCGSimilar to Microtubule-associated protein EB1.
J043006P09CGCGACGCGNONE
Os04g0650700006-037-H03CGCGACGCGNONE
AK061502CGCGACGCGNONE
AK068693CGCGACGCGNONE
AK121820CGCGACGCGSimilar to L-asparaginase (L-asparagine amidohydrolase).
J043030P10CGCGACGCGNONE
J065084D09CGCGACGCGNONE
Os04g0658600AK064729CGCGACGCGNONE
AK119253CGCGACGCGNucleolar, Nop52 family protein.
J075132J07CGCGACGCGNONE
J075157N21CGCGACGCGNONE
Os04g0661200AK102842GCGACGCGProtein of unknown function DUF941 family protein.
J033075E19GCGACGCGNONE
J033109O19GCGACGCGNONE
J065002J12GCGACGCGNONE
J065026E22GCGACGCGNONE
J065061F05GCGACGCGNONE
J065068D22GCGACGCGNONE
J065072N14GCGACGCGNONE
J065085F02GCGACGCGNONE
J075055G19GCGACGCGNONE
J075105B14GCGACGCGNONE
J075118M17GCGACGCGNONE
J075193H02GCGACGCGNONE
J100040O05GCGACGCGNONE
J100064I04GCGACGCGNONE
Os04g0661300AK070723ATCCGACGGConserved hypothetical protein.
AK103942ATCCGACGGNONE
Os04g0663800013-021-G09GCGACGCGNONE
AK105321GCGACGCGSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At).
Os04g0667600009-131-H09CGCGTCGCNONE
009-200-A04CGCGTCGCNONE
AK068657CGCGTCGCHeavy metal transport/detoxification protein domain containing protein.
J065013M12CGCGTCGCNONE
J065024H17CGCGTCGCNONE
J065025P10CGCGTCGCNONE
J065028I11CGCGTCGCNONE
J065044K11CGCGTCGCNONE
J065045B14CGCGTCGCNONE
J065052B02CGCGTCGCNONE
J065061F20CGCGTCGCNONE
J065061K16CGCGTCGCNONE
J065063E12CGCGTCGCNONE
J065065E16CGCGTCGCNONE
J065082M02CGCGTCGCNONE
J065084O10CGCGTCGCNONE
J065096H18CGCGTCGCNONE
J065122F02CGCGTCGCNONE
J065131F09CGCGTCGCNONE
J065139P06CGCGTCGCNONE
J065148L17CGCGTCGCNONE
J065164D23CGCGTCGCNONE
J065167M17CGCGTCGCNONE
J065174B15CGCGTCGCNONE
J065176G01CGCGTCGCNONE
J065186K17CGCGTCGCNONE
J065186N05CGCGTCGCNONE
J065213N24CGCGTCGCNONE
J075001P17CGCGTCGCNONE
J075004A15CGCGTCGCNONE
J075007B03CGCGTCGCNONE
J075026D23CGCGTCGCNONE
J075032D17CGCGTCGCNONE
J075058C22CGCGTCGCNONE
J075080L14CGCGTCGCNONE
J075094K18CGCGTCGCNONE
J075097K15CGCGTCGCNONE
J075098E02CGCGTCGCNONE
J075104D11CGCGTCGCNONE
J075120L16CGCGTCGCNONE
J075126A18CGCGTCGCNONE
J075129M08CGCGTCGCNONE
J075143N14CGCGTCGCNONE
J075146D07CGCGTCGCNONE
J075149L10CGCGTCGCNONE
J075171F22CGCGTCGCNONE
J090058C05CGCGTCGCNONE
J100018N19CGCGTCGCNONE
J100024K09CGCGTCGCNONE
J100036F15CGCGTCGCNONE
J100042A15CGCGTCGCNONE
J100042P14CGCGTCGCNONE
J100051N18CGCGTCGCNONE
J100055K14CGCGTCGCNONE
J100056F05CGCGTCGCNONE
J100058L10CGCGTCGCNONE
J100083J17CGCGTCGCNONE
J100086N07CGCGTCGCNONE
Os04g0668700012-043-D01ATCCGACGNONE
AK065237ATCCGACGPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein.
J013002G17ATCCGACGNONE
J013002I02ATCCGACGNONE
J013059C11ATCCGACGNONE
J013059D22ATCCGACGNONE
J013063G18ATCCGACGNONE
J013088O04ATCCGACGNONE
J013095K03ATCCGACGNONE
J013096K15ATCCGACGNONE
J013100O17ATCCGACGNONE
J013102F10ATCCGACGNONE
J013111L07ATCCGACGNONE
J013127E24ATCCGACGNONE
J013130A10ATCCGACGNONE
J013134L13ATCCGACGNONE
J023109G08ATCCGACGNONE
J033022E17ATCCGACGNONE
J033022N13ATCCGACGNONE
J033026D04ATCCGACGNONE
J033028M05ATCCGACGNONE
J033037E04ATCCGACGNONE
J033042D11ATCCGACGNONE
J033044N20ATCCGACGNONE
J033046K11ATCCGACGNONE
J033046M21ATCCGACGNONE
J033076E19ATCCGACGNONE
J033076J24ATCCGACGNONE
J033086N03ATCCGACGNONE
J033095F22ATCCGACGNONE
J033115F17ATCCGACGNONE
J033117M06ATCCGACGNONE
J033125D22ATCCGACGNONE
J033129J10ATCCGACGNONE
J033145E18ATCCGACGNONE
J043021F24ATCCGACGNONE
J053046G14ATCCGACGNONE
J053090P03ATCCGACGNONE
J065042N10ATCCGACGNONE
J065053B13ATCCGACGNONE
J065085G03ATCCGACGNONE
J065173J11ATCCGACGNONE
J090014M14ATCCGACGNONE
J090027J07ATCCGACGNONE
J090039E23ATCCGACGNONE
J090051C15ATCCGACGNONE
J090055H06ATCCGACGNONE
J090062L03ATCCGACGNONE
J100017L21ATCCGACGNONE
J100024B07ATCCGACGNONE
J100032G07ATCCGACGNONE
J100040N09ATCCGACGNONE
J100062N03ATCCGACGNONE
J100078E07ATCCGACGNONE
J100080E14ATCCGACGNONE
J100084D07ATCCGACGNONE
Os04g0669300AK071148CGCGTCGCDynamin family protein.
AK071148GCGACGCGDynamin family protein.
Os04g0674000006-093-C01CCCCCGCGACGCNONE
009-040-F06CCCCCGCGACGCNONE
AK071276CCCCCGCGACGCNONE
AK109377CCCCCGCGACGCConserved hypothetical protein.
AK119671CCCCCGCGACGCNONE
J023084J11CCCCCGCGACGCNONE
J023088F18CCCCCGCGACGCNONE
J065099M12CCCCCGCGACGCNONE
J065136J08CCCCCGCGACGCNONE
J065167H22CCCCCGCGACGCNONE
J075046L21CCCCCGCGACGCNONE
J080029F17CCCCCGCGACGCNONE
J080053C16CCCCCGCGACGCNONE
J080053E24CCCCCGCGACGCNONE
J080074D14CCCCCGCGACGCNONE
J100029C12CCCCCGCGACGCNONE
J100030D01CCCCCGCGACGCNONE
J100044E16CCCCCGCGACGCNONE
J100065N18CCCCCGCGACGCNONE
J100077D18CCCCCGCGACGCNONE
J100090P13CCCCCGCGACGCNONE
Os04g0674350J065104O14GCGACGCGNONE
J065118J19GCGACGCGNONE
J065167I12GCGACGCGHypothetical protein.
Os04g0674400015-042-B08CGCGTCGCNONE
AK102124CGCGTCGCSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2.
J013129O22CGCGTCGCNONE
J023022I24CGCGTCGCNONE
J023120A15CGCGTCGCNONE
J023123P20CGCGTCGCNONE
J033068P09CGCGTCGCNONE
J033107G22CGCGTCGCNONE
J033116G12CGCGTCGCNONE
J033133F03CGCGTCGCNONE
J033143B20CGCGTCGCNONE
J043006G12CGCGTCGCNONE
J043027M18CGCGTCGCNONE
J043034H17CGCGTCGCNONE
J090091E20CGCGTCGCNONE
J100035H09CGCGTCGCNONE
J100037J04CGCGTCGCNONE
J100047J24CGCGTCGCNONE
J100059G06CGCGTCGCNONE
J100066O12CGCGTCGCNONE
J100074G23CGCGTCGCNONE
J100077M12CGCGTCGCNONE
Os04g0677400AK069563CCGTCGGANONE
AK069752CCGTCGGAProtein of unknown function DUF639 family protein.
J023022G06CCGTCGGANONE
J023030K02CCGTCGGANONE
J023030L01CCGTCGGANONE
Os04g0686700AK105746CGCGACGCKelch repeat containing protein.
J065021K04CGCGACGCNONE
J065097E18CGCGACGCNONE
J075004C12CGCGACGCNONE
J080301H10CGCGACGCNONE
J090087N02CGCGACGCNONE
J100060E19CGCGACGCNONE
Os04g0692600006-056-F05CGCGTCGCNONE
006-074-F09CGCGTCGCNONE
006-078-B07CGCGTCGCNONE
006-081-H09CGCGTCGCNONE
006-111-A10CGCGTCGCNONE
AK070001CGCGTCGCNONE
AK105888CGCGTCGCNONE
AK105982CGCGTCGCConserved hypothetical protein.
Os05g0110900AK073169CCGTTGGATGCCCATCCGACGGSimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-).
Os05g0116500AK102231CGCGTCGCGConserved hypothetical protein.
J033088A05CGCGTCGCGNONE
Os05g0119200AK067943CGCGTCGCGConserved hypothetical protein.
J013122C02CGCGTCGCGNONE
J065077M14CGCGTCGCGNONE
J065108P21CGCGTCGCGNONE
J065138G20CGCGTCGCGNONE
J065148H07CGCGTCGCGNONE
J065205P09CGCGTCGCGNONE
J075061H16CGCGTCGCGNONE
J075140H13CGCGTCGCGNONE
J075153H02CGCGTCGCGNONE
J075170B14CGCGTCGCGNONE
Os05g0127300AK106429CCGATCCGACGCGTCCGTCCGNONE
AK106429CGCGACGCGNONE
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
AK121766CGCGACGCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
J065021F23CCGATCCGACGCGTCCGTCCGNONE
J065021F23CGCGACGCGNONE
J100041J04CCGATCCGACGCGTCCGTCCGNONE
J100041J04CGCGACGCGNONE
Os05g0129400AK102359ATCCGACGTGGCAnkyrin repeat containing protein.
J033091I05ATCCGACGTGGCNONE
Os05g0151200J065041L18ATCCGACGTspO/MBR-related protein family protein.
J065168L08ATCCGACGNONE
Os05g0164100AF456329CGCGTCGCNONE
AK065086CGCGTCGCNONE
AK072243CGCGTCGCSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment).
J013001L18CGCGTCGCNONE
J013132O12CGCGTCGCNONE
J023003N09CGCGTCGCNONE
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein.
AK103412CCGATCCGACGGCCCAGANONE
J023045H21CCGATCCGACGGCCCAGANONE
J033128G01CCGATCCGACGGCCCAGANONE
J065017O10CCGATCCGACGGCCCAGANONE
J065032H11CCGATCCGACGGCCCAGANONE
J065120G09CCGATCCGACGGCCCAGANONE
Os05g0171200009-093-B06CGCGACGCCCCCACNONE
009-157-F06CGCGACGCCCCCACNONE
009-197-H10CGCGACGCCCCCACNONE
AK062702CGCGACGCCCCCACEmbryo-specific 3 family protein.
Os05g0176100AF030052ATCCGACGGNONE
AF030052ATCCGACGGCCGAGATNONE
AK067850ATCCGACGGNONE
AK067850ATCCGACGGCCGAGATNONE
AK067967ATCCGACGGNONE
AK067967ATCCGACGGCCGAGATNONE
AK098978ATCCGACGGNONE
AK098978ATCCGACGGCCGAGATNONE
AK099228ATCCGACGGNONE
AK099228ATCCGACGGCCGAGATNONE
AK099281ATCCGACGGNONE
AK099281ATCCGACGGCCGAGATNONE
AK100188ATCCGACGGSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment).
AK100188ATCCGACGGCCGAGATSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment).
AK102140ATCCGACGGNONE
AK102140ATCCGACGGCCGAGATNONE
Os05g0187100012-066-F01GACGCGACGCNONE
AK067988GACGCGACGCSimilar to Hexokinase.
Os05g0189900AK061489ATCCGACGGVirulence factor, pectin lyase fold family protein.
Os05g0195200015-031-H09GCGTCGCGNONE
015-070-C11GCGTCGCGNONE
016-063-C11GCGTCGCGNONE
AK106392GCGTCGCGZinc finger, CCCH-type domain containing protein.
J033051N05GCGTCGCGNONE
J065118P05GCGTCGCGNONE
J100071H15GCGTCGCGNONE
J100078J22GCGTCGCGNONE
Os05g0249100016-087-B02CGTCGGATNONE
AK064291CGTCGGATConserved hypothetical protein.
AK103049CGTCGGATNONE
J033117G22CGTCGGATNONE
J065021C19CGTCGGATNONE
J065205P17CGTCGGATNONE
Os05g0267800006-099-A08ACGTGTCGCGACGCNONE
AK061207ACGTGTCGCGACGCCellular retinaldehyde-binding/triple function, N-terminal domain containing protein.
Os05g0316200AK060608GCGACGCGCCCATCTNONE
AK101705GCGACGCGCCCATCTConserved hypothetical protein.
AK111481GCGACGCGCCCATCTNONE
Os05g0323900006-105-F01CGCGACGCNONE
009-161-D06CGCGACGCNONE
AK070528CGCGACGCManganese-superoxide dismutase precursor (EC 1.15.1.1).
AK104030CGCGACGCNONE
AK104160CGCGACGCNONE
AK119904CGCGACGCNONE
J023060D13CGCGACGCNONE
J033057E10CGCGACGCNONE
J043034F19CGCGACGCNONE
J053099K12CGCGACGCNONE
J065022N03CGCGACGCNONE
J065035G13CGCGACGCNONE
J065059M24CGCGACGCNONE
J065059N23CGCGACGCNONE
J065073I02CGCGACGCNONE
J065095L15CGCGACGCNONE
J065104I24CGCGACGCNONE
J065104J24CGCGACGCNONE
J065112L13CGCGACGCNONE
J065114J24CGCGACGCNONE
J065120J16CGCGACGCNONE
J065141I09CGCGACGCNONE
J065165E17CGCGACGCNONE
J065170C14CGCGACGCNONE
J065182I05CGCGACGCNONE
J065191K20CGCGACGCNONE
J065205L14CGCGACGCNONE
J075017M10CGCGACGCNONE
J075019O04CGCGACGCNONE
J075019O15CGCGACGCNONE
J075032E07CGCGACGCNONE
J075042D13CGCGACGCNONE
J075054J07CGCGACGCNONE
J075089O11CGCGACGCNONE
J075104G09CGCGACGCNONE
J075150N03CGCGACGCNONE
J075187A09CGCGACGCNONE
J075187D04CGCGACGCNONE
J090006G06CGCGACGCNONE
J090045C09CGCGACGCNONE
J090083D13CGCGACGCNONE
J090084B13CGCGACGCNONE
J100021H22CGCGACGCNONE
J100034A15CGCGACGCNONE
J100041N15CGCGACGCNONE
J100042D05CGCGACGCNONE
J100042D08CGCGACGCNONE
J100059P21CGCGACGCNONE
L19436CGCGACGCNONE
L34038CGCGACGCNONE
Os05g0332600AK098926GCGACGCGNONE
Os05g0335800AK108393GCGACGCGTGF-beta receptor, type I/II extracellular region family protein.
Os05g0348100006-028-F04CGCGACGCCCCAGCCCAAGNONE
009-036-C03CGCGACGCCCCAGCCCAAGNONE
009-040-H02CGCGACGCCCCAGCCCAAGNONE
009-173-H12CGCGACGCCCCAGCCCAAGNONE
AK061434CGCGACGCCCCAGCCCAAGConserved hypothetical protein.
J065137N04CGCGACGCCCCAGCCCAAGNONE
J065164C10CGCGACGCCCCAGCCCAAGNONE
J065210H22CGCGACGCCCCAGCCCAAGNONE
Os05g0349800011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1.
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
Os05g0358500AK060575CGCACCGCGACGCACGCCACNONE
AK100777CGCACCGCGACGCACGCCACProtein phosphatase 2C-like domain containing protein.
Os05g0361700AJ575218GAGACGCGCGACGCGNONE
AK100184GAGACGCGCGACGCGSimilar to EREBP-2 protein (Fragment).
AK111676GAGACGCGCGACGCGNONE
J013155B14GAGACGCGCGACGCGNONE
J065073N01GAGACGCGCGACGCGNONE
J065161J12GAGACGCGCGACGCGNONE
J075074A07GAGACGCGCGACGCGNONE
J100029H13GAGACGCGCGACGCGNONE
Os05g0379300AK109293CCGTCGGATConserved hypothetical protein.
Os05g0381400014-036-H12CGCGTCGCNONE
014-036-H12CGCGTCGCGNONE
014-085-H12CGCGTCGCNONE
014-085-H12CGCGTCGCGNONE
AK102039CGCGTCGCSimilar to ABA induced plasma membrane protein PM 19.
AK102039CGCGTCGCGSimilar to ABA induced plasma membrane protein PM 19.
J075011E17CGCGTCGCNONE
J075011E17CGCGTCGCGNONE
J075057P04CGCGTCGCNONE
J075057P04CGCGTCGCGNONE
J075066K19CGCGTCGCNONE
J075066K19CGCGTCGCGNONE
J075068L13CGCGTCGCNONE
J075068L13CGCGTCGCGNONE
J075074J21CGCGTCGCNONE
J075074J21CGCGTCGCGNONE
J075076N10CGCGTCGCNONE
J075076N10CGCGTCGCGNONE
J075078L14CGCGTCGCNONE
J075078L14CGCGTCGCGNONE
J075099O16CGCGTCGCNONE
J075099O16CGCGTCGCGNONE
J075120C05CGCGTCGCNONE
J075120C05CGCGTCGCGNONE
J075140I24CGCGTCGCNONE
J075140I24CGCGTCGCGNONE
J075148F21CGCGTCGCNONE
J075148F21CGCGTCGCGNONE
J075151F01CGCGTCGCNONE
J075151F01CGCGTCGCGNONE
J075151I10CGCGTCGCNONE
J075151I10CGCGTCGCGNONE
J075156M15CGCGTCGCNONE
J075156M15CGCGTCGCGNONE
J075191F07CGCGTCGCNONE
J075191F07CGCGTCGCGNONE
J075192K20CGCGTCGCNONE
J075192K20CGCGTCGCGNONE
J075195M22CGCGTCGCNONE
J075195M22CGCGTCGCGNONE
Os05g0382600AK068231CGCGACGCGAnnexin family protein.
J013147O19CGCGACGCGNONE
Os05g0386800AK060897CGCGTCGCNONE
AK070472CGCGTCGCSimilar to Phytochelatin synthetase-like protein 2.
Os05g0388500AK065313CCCCCGCGACGCGCGAGSimilar to 50S ribosomal protein L1.
AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1.
AK098990CCCCCGCGACGCGCGAGNONE
AK098990TTTTGGGCCCAATCCGACGNONE
AK104689CCCCCGCGACGCGCGAGNONE
AK104689TTTTGGGCCCAATCCGACGNONE
J013094L23CCCCCGCGACGCGCGAGNONE
J013094L23TTTTGGGCCCAATCCGACGNONE
J065118O04CCCCCGCGACGCGCGAGNONE
J065118O04TTTTGGGCCCAATCCGACGNONE
Os05g0395300AK066212CGGACGGCATCCGACGGProtein of unknown function DUF21 domain containing protein.
Os05g0399300AK108949TCCGACGGCGTGGGCTNONE
Os05g0400700009-099-F02GATCCGACGGNONE
AK072739GATCCGACGGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5).
AK103913GATCCGACGGNONE
J023138C10GATCCGACGGNONE
Os05g0407100AK063349CGCGTCGCGCGCFour F5 protein family protein.
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein.
J065182F20GCGGGCCCCACGCGCGACGCNONE
Os05g0411600AK101609CGTCGGATCCGACSingle-stranded nucleic acid binding R3H domain containing protein.
AY224459CGTCGGATCCGACNONE
J065042L01CGTCGGATCCGACNONE
J100068I05CGTCGGATCCGACNONE
J100075L14CGTCGGATCCGACNONE
Os05g0414200015-033-G02TCCGACGGCGGCCCGGCCNONE
AK106297TCCGACGGCGGCCCGGCCDisease resistance protein family protein.
Os05g0415600AK065818CCGTCGGATCNONE
J013042K21CCGTCGGATCNONE
J013114E15CCGTCGGATCNONE
J013131H02CCGTCGGATCNONE
J023041G06CCGTCGGATCNONE
J100037M21CCGTCGGATCNONE
Os05g0422900AK073629GATCCGACGConserved hypothetical protein.
J023126I07GATCCGACGNONE
J023143K12GATCCGACGNONE
J033051N08GATCCGACGNONE
J033128I04GATCCGACGNONE
J065067M02GATCCGACGNONE
J080312N05GATCCGACGNONE
J100032G23GATCCGACGNONE
Os05g0424800AK121054CTCGCGCGTCGCGTCSimilar to AER274Wp.
J023055P22CTCGCGCGTCGCGTCNONE
J023102M21CTCGCGCGTCGCGTCNONE
J033088E13CTCGCGCGTCGCGTCNONE
J033123K17CTCGCGCGTCGCGTCNONE
J065176L18CTCGCGCGTCGCGTCNONE
J075002F14CTCGCGCGTCGCGTCNONE
J075005E10CTCGCGCGTCGCGTCNONE
J075005K21CTCGCGCGTCGCGTCNONE
J075007A18CTCGCGCGTCGCGTCNONE
J075021J16CTCGCGCGTCGCGTCNONE
J075040K11CTCGCGCGTCGCGTCNONE
J075061A14CTCGCGCGTCGCGTCNONE
J075106H07CTCGCGCGTCGCGTCNONE
J075109M22CTCGCGCGTCGCGTCNONE
J075121O13CTCGCGCGTCGCGTCNONE
J075132M08CTCGCGCGTCGCGTCNONE
J075153B19CTCGCGCGTCGCGTCNONE
J075158L15CTCGCGCGTCGCGTCNONE
J075187G20CTCGCGCGTCGCGTCNONE
J100079N17CTCGCGCGTCGCGTCNONE
Os05g0429700AK069203CGTTGGATGGGGATCCGACGGNONE
AK103559CGTTGGATGGGGATCCGACGGC2 calcium/lipid-binding region, CaLB domain containing protein.
Os05g0430200J090095K16ATCCGACGGCCCGNONE
Os05g0444200AK102658CGCGCGACGCSimilar to T6J4.5 protein (WIP6 protein).
Os05g0450300AK071191GACGCGACGCGConserved hypothetical protein.
J023084G11GACGCGACGCGNONE
Os05g0451300AK108341CGCGTCGCGConserved hypothetical protein.
Os05g0454400AK107942ATCCGACGConserved hypothetical protein.
Os05g0458000AK060188CGCGACGCNONE
AK068989CGCGACGCZinc finger, DHHC-type domain containing protein.
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH.
Os05g0459900AK058918CGCGACGCGSimilar to 60S ribosomal protein L36-1.
AK111268CGCGACGCGNONE
J013129N08CGCGACGCGNONE
J065191E01CGCGACGCGNONE
J065216P03CGCGACGCGNONE
J075089K21CGCGACGCGNONE
Os05g0460000011-074-F09ATCCGACGGNONE
J023002L01ATCCGACGGNONE
J023060I12ATCCGACGGNONE
J023060O12ATCCGACGGNONE
J023106P08ATCCGACGGNONE
J023141D17ATCCGACGGNONE
J023150E11ATCCGACGGSimilar to 70 kDa heat shock cognate protein 1.
J033030A20ATCCGACGGNONE
J033039H14ATCCGACGGNONE
J033101B11ATCCGACGGNONE
J033101B12ATCCGACGGNONE
J033114A09ATCCGACGGNONE
J090037G06ATCCGACGGNONE
J090048G13ATCCGACGGNONE
J090090F15ATCCGACGGNONE
Os05g0462400AK099608CGCGTCGCGLipin, N-terminal conserved region domain containing protein.
J033138E12CGCGTCGCGNONE
Os05g0478000AK111029CGCGTCGCGZinc finger, RING-type domain containing protein.
Os05g0494700Os05g0494700CGCGACGCNONE
Os05g0506000AF031609CCGTCGGATCAGGCCCCGCGTCGCNONE
AK062012CCGTCGGATCAGGCCCCGCGTCGCNONE
AK098900CCGTCGGATCAGGCCCCGCGTCGCNONE
AK122090CCGTCGGATCAGGCCCCGCGTCGCSimilar to MS5-like protein (Fragment).
J013002B13CCGTCGGATCAGGCCCCGCGTCGCNONE
J023149G13CCGTCGGATCAGGCCCCGCGTCGCNONE
J033123O20CCGTCGGATCAGGCCCCGCGTCGCNONE
J080315O17CCGTCGGATCAGGCCCCGCGTCGCNONE
Os05g0508300Os05g0508300GTCGCGTCGCSimilar to Papain-like cysteine peptidase XBCP3.
Os05g0510100Os05g0510100GCGACGCGProtein of unknown function DUF567 family protein.
Os05g0512000AK102433CGCGTCGCZinc finger, RING-type domain containing protein.
Os05g0519700014-100-B04CGCGTCGCCCATCGNONE
AF332981CGCGTCGCCCATCGNONE
AK100903CGCGTCGCCCATCGNONE
AK105433CGCGTCGCCCATCGHeat shock protein 101.
Os05g0519800AK069435CGCGTCGCGTCProtein of unknown function DUF28 family protein.
J023024L22CGCGTCGCGTCNONE
Os05g0521600013-027-G05CGCGTCGCNONE
AK063238CGCGTCGCVirulence factor, pectin lyase fold family protein.
Os05g0524500AK073571GCGACGCGProtein kinase-like domain containing protein.
Os05g0539400AK068572GCGACGCGGlycoside hydrolase, family 35 protein.
J013063P08GCGACGCGNONE
J013110N24GCGACGCGNONE
J013156K22GCGACGCGNONE
J043038A08GCGACGCGNONE
J090004K18GCGACGCGNONE
J090085F03GCGACGCGNONE
Os05g0540900006-038-F02CGCGACGCNONE
AK060489CGCGACGCNONE
AK072284CGCGACGCConserved hypothetical protein.
Os05g0551700AK071216GTCGCGTCGCGtRNA isopentenyltransferase family protein.
Os05g0552300AK062179ATCCGACGGSimilar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD).
AK065272ATCCGACGGNONE
AK121567ATCCGACGGNONE
J013002L07ATCCGACGGNONE
J013096F06ATCCGACGGNONE
J013111B06ATCCGACGGNONE
J023024K23ATCCGACGGNONE
J023036P19ATCCGACGGNONE
J033034A18ATCCGACGGNONE
J033034P13ATCCGACGGNONE
J033051E12ATCCGACGGNONE
J033087M05ATCCGACGGNONE
J033092G03ATCCGACGGNONE
J033098N21ATCCGACGGNONE
J033103B15ATCCGACGGNONE
J043038F23ATCCGACGGNONE
J065096K22ATCCGACGGNONE
J065167D17ATCCGACGGNONE
J100040H06ATCCGACGGNONE
J100048M06ATCCGACGGNONE
J100087G01ATCCGACGGNONE
Os05g0562200AK061766GCGACGCGDrought induced 19 family protein.
AK109438GCGACGCGNONE
Os05g0568600009-024-B09CGCGACGCGNONE
AK063781CGCGACGCGProtein of unknown function DUF1645 family protein.
J080049H14CGCGACGCGNONE
J080062M08CGCGACGCGNONE
J080064I07CGCGACGCGNONE
J080068A12CGCGACGCGNONE
J080086J10CGCGACGCGNONE
Os05g0571800009-157-G07ATCCGACGGNONE
AK063033ATCCGACGGConserved hypothetical protein.
Os05g0574500006-021-A08ATCCGACGGCCGAAANONE
006-049-A11ATCCGACGGCCGAAANONE
006-086-F03ATCCGACGGCCGAAANONE
009-051-F06ATCCGACGGCCGAAANONE
AB015287ATCCGACGGCCGAAANONE
AB015972ATCCGACGGCCGAAANONE
AK061714ATCCGACGGCCGAAANONE
AK098889ATCCGACGGCCGAAANONE
AK121699ATCCGACGGCCGAAASimilar to GTP-binding nuclear protein Ran1B (Fragment).
J013001L15ATCCGACGGCCGAAANONE
J013072D17ATCCGACGGCCGAAANONE
J023028M04ATCCGACGGCCGAAANONE
J023031F01ATCCGACGGCCGAAANONE
J023114L22ATCCGACGGCCGAAANONE
J033058L12ATCCGACGGCCGAAANONE
J033073D17ATCCGACGGCCGAAANONE
J043031D08ATCCGACGGCCGAAANONE
J043036G01ATCCGACGGCCGAAANONE
J065144O04ATCCGACGGCCGAAANONE
J065181O08ATCCGACGGCCGAAANONE
J080066B20ATCCGACGGCCGAAANONE
Os05g0576600AK107732GACGCGACGCGACConserved hypothetical protein.
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase.
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE
Os05g0579600Os05g0579600CGCGACGCGACHomeodomain-like containing protein.
Os05g0591400AK120015GATCCGACGGHeat shock protein Hsp70 family protein.
Os05g0592600011-064-D09ATCCGACGNONE
015-032-B11ATCCGACGNONE
AK073484ATCCGACGInitiation factor 2 family protein.
AK099632ATCCGACGNONE
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2).
AK070388CGCGTCGCCACGTGTCCACGCCNONE
AK104323CGCGTCGCCACGTGTCCACGCCNONE
Os05g0593000013-075-E08CGCGTCGCGNONE
014-081-D06CGCGTCGCGNONE
015-061-D11CGCGTCGCGNONE
016-061-B10CGCGTCGCGNONE
016-066-C11CGCGTCGCGNONE
AK064253CGCGTCGCGConserved hypothetical protein.
Os05g0594500AK100617TCCGACGGNONE
Os06g0130400AK065212GCGTCGCGTCSimilar to 1-aminocyclopropane-1-carboxylate synthase (EC 4.4.1.14) (Fragment).
Os06g0140700009-041-G05CGCGTCGCNONE
AF145726CGCGTCGCNONE
AK105150CGCGTCGCNONE
AY206864CGCGTCGCSimilar to Homeodomain leucine zipper protein (Fragment).
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase).
J075086I24ATCCGACGGCCCAGATNONE
J075127E23ATCCGACGGCCCAGATNONE
J075157B19ATCCGACGGCCCAGATNONE
J090038E06ATCCGACGGCCCAGATNONE
Os06g0153200AK072625CGCGTCGCGNONE
AK106752CGCGTCGCGProtein of unknown function DUF250 domain containing protein.
Os06g0153600AK099903CCGAGCCGTCGGATNONE
AK109685CCGAGCCGTCGGATConserved hypothetical protein.
Os06g0166000009-023-G02CGCGTCGCGTCGCGTCNONE
AK060317CGCGTCGCGTCGCGTCCyclin-like F-box domain containing protein.
J075052L22CGCGTCGCGTCGCGTCNONE
J075078E03CGCGTCGCGTCGCGTCNONE
J075115M08CGCGTCGCGTCGCGTCNONE
J075192G08CGCGTCGCGTCGCGTCNONE
J100036C01CGCGTCGCGTCGCGTCNONE
J100070J02CGCGTCGCGTCGCGTCNONE
J100088C24CGCGTCGCGTCGCGTCNONE
Os06g0179200AK101156CCGTCGGASimilar to Nodulin-like protein.
J033025B06CCGTCGGANONE
J033027I22CCGTCGGANONE
J033030M16CCGTCGGANONE
J033068C12CCGTCGGANONE
J065158N16CCGTCGGANONE
Os06g0192600AB033535ATCCGACGGNONE
AB033535CCGTCGGATCNONE
AK061876ATCCGACGG26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7).
AK061876CCGTCGGATC26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7).
AK070538ATCCGACGGNONE
AK070538CCGTCGGATCNONE
AK100060ATCCGACGGNONE
AK100060CCGTCGGATCNONE
AK103801ATCCGACGGNONE
AK103801CCGTCGGATCNONE
Os06g0206100AK099498CGCGTCGCGNONE
AK121282CGCGTCGCGSimilar to Gb protein.
Os06g0216100Os06g0216100TCCGACGGSimilar to Oxo-phytodienoic acid reductase (12-oxophytodienoic acid reductase).
Os06g0223300AK111776GCGTCGCGTCGCGTCSimilar to TDR8 protein.
J023075K19GCGTCGCGTCGCGTCNONE
Os06g0225300AK065224CGCGACGCGACNONE
AK065224CGCGTCGCCTCGCCCNONE
AK100258CGCGACGCGACSimilar to SERK1 (Fragment).
AK100258CGCGTCGCCTCGCCCSimilar to SERK1 (Fragment).
J013002G23CGCGACGCGACNONE
J013002G23CGCGTCGCCTCGCCCNONE
Os06g0247800AK102187GCCCCCACCGCGTCGCSimilar to Dynamin-like protein (Fragment).
AY224491GCCCCCACCGCGTCGCNONE
Os06g0265000AK100247ATCCGACGGSimilar to Asparagine synthetase.
D83378ATCCGACGGNONE
J013033O15ATCCGACGGNONE
J013037K20ATCCGACGGNONE
J013058I07ATCCGACGGNONE
J033125M21ATCCGACGGNONE
J033142B02ATCCGACGGNONE
J043030E23ATCCGACGGNONE
J043034K11ATCCGACGGNONE
J053050B10ATCCGACGGNONE
J053061I09ATCCGACGGNONE
J053068F17ATCCGACGGNONE
J053074G11ATCCGACGGNONE
J053095N11ATCCGACGGNONE
J090028M17ATCCGACGGNONE
J090031O08ATCCGACGGNONE
J090094C22ATCCGACGGNONE
J100045M24ATCCGACGGNONE
J100055P03ATCCGACGGNONE
J100073O10ATCCGACGGNONE
J100081K21ATCCGACGGNONE
U55873ATCCGACGGNONE
Os06g0304500AK119441GCGACGCGCRS1/YhbY domain containing protein.
J075143M24GCGACGCGNONE
J075194D03GCGACGCGNONE
Os06g0307900AK119309GCGACGCGTGGProtein of unknown function DUF1618 domain containing protein.
AK120750GCGACGCGTGGNONE
J023004O19GCGACGCGTGGNONE
J033022G01GCGACGCGTGGNONE
Os06g0308300AK059211CCGTCGGATCGGNONE
AK101549CCGTCGGATCGGNONE
AK102553CCGTCGGATCGGSimilar to 65kD microtubule associated protein.
J090014G18CCGTCGGATCGGNONE
J090082B01CCGTCGGATCGGNONE
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE
006-021-B06GATCCGACGTGGCCCAATNONE
006-021-D12GATCCGACGTGGCCCAATNONE
006-022-A12GATCCGACGTGGCCCAATNONE
006-024-B10GATCCGACGTGGCCCAATNONE
006-029-F07GATCCGACGTGGCCCAATNONE
006-029-H12GATCCGACGTGGCCCAATNONE
006-031-A05GATCCGACGTGGCCCAATNONE
006-033-C03GATCCGACGTGGCCCAATNONE
006-036-B12GATCCGACGTGGCCCAATNONE
006-048-C08GATCCGACGTGGCCCAATNONE
006-050-F03GATCCGACGTGGCCCAATNONE
006-051-C12GATCCGACGTGGCCCAATNONE
006-054-C03GATCCGACGTGGCCCAATNONE
006-057-D12GATCCGACGTGGCCCAATNONE
006-067-F01GATCCGACGTGGCCCAATNONE
006-071-G12GATCCGACGTGGCCCAATNONE
006-072-G11GATCCGACGTGGCCCAATNONE
006-072-H01GATCCGACGTGGCCCAATNONE
006-081-E02GATCCGACGTGGCCCAATNONE
006-082-A11GATCCGACGTGGCCCAATNONE
006-084-A04GATCCGACGTGGCCCAATNONE
006-085-C08GATCCGACGTGGCCCAATNONE
006-086-D03GATCCGACGTGGCCCAATNONE
006-088-B05GATCCGACGTGGCCCAATNONE
006-088-G02GATCCGACGTGGCCCAATNONE
006-092-G10GATCCGACGTGGCCCAATNONE
006-094-D11GATCCGACGTGGCCCAATNONE
006-094-E04GATCCGACGTGGCCCAATNONE
006-103-G12GATCCGACGTGGCCCAATNONE
006-106-G08GATCCGACGTGGCCCAATNONE
006-111-E06GATCCGACGTGGCCCAATNONE
006-114-C07GATCCGACGTGGCCCAATNONE
006-115-A04GATCCGACGTGGCCCAATNONE
006-117-G11GATCCGACGTGGCCCAATNONE
006-118-G09GATCCGACGTGGCCCAATNONE
009-010-F03GATCCGACGTGGCCCAATNONE
009-076-G01GATCCGACGTGGCCCAATNONE
009-134-E10GATCCGACGTGGCCCAATNONE
009-193-D07GATCCGACGTGGCCCAATNONE
AF094776GATCCGACGTGGCCCAATNONE
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment).
AK098864GATCCGACGTGGCCCAATNONE
J013001A03GATCCGACGTGGCCCAATNONE
J013098P14GATCCGACGTGGCCCAATNONE
J013127B16GATCCGACGTGGCCCAATNONE
J013169J24GATCCGACGTGGCCCAATNONE
J023084H23GATCCGACGTGGCCCAATNONE
J023093F05GATCCGACGTGGCCCAATNONE
J033041I05GATCCGACGTGGCCCAATNONE
J065196G15GATCCGACGTGGCCCAATNONE
J075019K01GATCCGACGTGGCCCAATNONE
J075053H16GATCCGACGTGGCCCAATNONE
J075055M09GATCCGACGTGGCCCAATNONE
J075099G10GATCCGACGTGGCCCAATNONE
J075099L23GATCCGACGTGGCCCAATNONE
J075127I09GATCCGACGTGGCCCAATNONE
J080001C14GATCCGACGTGGCCCAATNONE
J080016B11GATCCGACGTGGCCCAATNONE
J080029C14GATCCGACGTGGCCCAATNONE
J080029I17GATCCGACGTGGCCCAATNONE
J080034F13GATCCGACGTGGCCCAATNONE
J080039E02GATCCGACGTGGCCCAATNONE
J080040N05GATCCGACGTGGCCCAATNONE
J080042O17GATCCGACGTGGCCCAATNONE
J080043N15GATCCGACGTGGCCCAATNONE
J080056K02GATCCGACGTGGCCCAATNONE
J080063N15GATCCGACGTGGCCCAATNONE
J080069H05GATCCGACGTGGCCCAATNONE
J080070N15GATCCGACGTGGCCCAATNONE
J080075J22GATCCGACGTGGCCCAATNONE
J080076F12GATCCGACGTGGCCCAATNONE
J080086G05GATCCGACGTGGCCCAATNONE
J090046G07GATCCGACGTGGCCCAATNONE
J090059H01GATCCGACGTGGCCCAATNONE
J090099C09GATCCGACGTGGCCCAATNONE
J100028E12GATCCGACGTGGCCCAATNONE
J100048J04GATCCGACGTGGCCCAATNONE
J100054O05GATCCGACGTGGCCCAATNONE
J100062C09GATCCGACGTGGCCCAATNONE
J100075C17GATCCGACGTGGCCCAATNONE
J100075C23GATCCGACGTGGCCCAATNONE
J100075I23GATCCGACGTGGCCCAATNONE
Os06g0335900J065112L04CGCGTCGCNONE
J065216L13CGCGTCGCNONE
Os06g0500000J065064K10CGCGACGCGACConserved hypothetical protein.
J065148C10CGCGACGCGACNONE
J065183N06CGCGACGCGACNONE
J065203F05CGCGACGCGACNONE
Os06g0518100AK119810CGTCGGATCConserved hypothetical protein.
Os06g0552400015-046-G05CGCGTCGCNONE
AK106524CGCGTCGCNONE
AK121387CGCGTCGCProtein of unknown function DUF500 family protein.
J023127P05CGCGTCGCNONE
Os06g0560400AK103575CCGATCCGACGTGTCCNONE
AK108074CCGATCCGACGTGTCCProtein of unknown function DUF862, eukaryotic domain containing protein.
Os06g0567000009-166-G12CGCGACGCNONE
AK121337CGCGACGCProtein of unknown function UPF0197 family protein.
J013122F01CGCGACGCNONE
J023080N12CGCGACGCNONE
J023120F03CGCGACGCNONE
J065013B18CGCGACGCNONE
J065039P21CGCGACGCNONE
J065089E06CGCGACGCNONE
J065095N19CGCGACGCNONE
J065119H03CGCGACGCNONE
J065121D18CGCGACGCNONE
J065149G04CGCGACGCNONE
J075012J04CGCGACGCNONE
J075021G13CGCGACGCNONE
J075106I23CGCGACGCNONE
J075107F19CGCGACGCNONE
J075152J22CGCGACGCNONE
J075186J20CGCGACGCNONE
J075188F16CGCGACGCNONE
J080001G06CGCGACGCNONE
J080002O09CGCGACGCNONE
J080006E10CGCGACGCNONE
J080006F24CGCGACGCNONE
J080012L07CGCGACGCNONE
J080016A10CGCGACGCNONE
J080017D11CGCGACGCNONE
J080017I04CGCGACGCNONE
J080017I10CGCGACGCNONE
J080020P06CGCGACGCNONE
J080024A20CGCGACGCNONE
J080027B10CGCGACGCNONE
J080027E03CGCGACGCNONE
J080027I01CGCGACGCNONE
J080027K20CGCGACGCNONE
J080041L12CGCGACGCNONE
J080043D21CGCGACGCNONE
J080044K11CGCGACGCNONE
J080048I08CGCGACGCNONE
J080049M12CGCGACGCNONE
J080050C14CGCGACGCNONE
J080050N21CGCGACGCNONE
J080053F04CGCGACGCNONE
J080054O16CGCGACGCNONE
J080058O21CGCGACGCNONE
J080059M11CGCGACGCNONE
J080061A11CGCGACGCNONE
J080063B15CGCGACGCNONE
J080063F22CGCGACGCNONE
J080066M18CGCGACGCNONE
J080068D12CGCGACGCNONE
J080070D22CGCGACGCNONE
J080071B06CGCGACGCNONE
J080072B17CGCGACGCNONE
J080081O04CGCGACGCNONE
J080089H05CGCGACGCNONE
J080093K13CGCGACGCNONE
J080095I05CGCGACGCNONE
J080097F19CGCGACGCNONE
J080304C03CGCGACGCNONE
J080304H11CGCGACGCNONE
J080308M21CGCGACGCNONE
J080313O15CGCGACGCNONE
J090020N23CGCGACGCNONE
J100023C12CGCGACGCNONE
Os06g0596300AK120303CCGTCGGATCSimilar to Acyl-ACP thioesterase (Fragment).
Os06g0597600AK120804GCGACGCGACGCGAromatic-ring hydroxylase family protein.
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog.
J023066J03GTCGCGTCGCGCGCNONE
Os06g0621300AK068751ATCCGACGConserved hypothetical protein.
J013159I20ATCCGACGNONE
Os06g0633100AK107791GCGCGCGACGCGConserved hypothetical protein.
AK107791GTCGCGTCGCGTCGCGCCCACAAConserved hypothetical protein.
J065001N11GCGCGCGACGCGNONE
J065001N11GTCGCGTCGCGTCGCGCCCACAANONE
Os06g0644800006-051-A11CGCGTCGCGTCGCGTCGCNONE
006-061-C06CGCGTCGCGTCGCGTCGCNONE
006-086-A03CGCGTCGCGTCGCGTCGCNONE
006-091-B11CGCGTCGCGTCGCGTCGCNONE
AK105643CGCGTCGCGTCGCGTCGCNONE
AK109442CGCGTCGCGTCGCGTCGCMannose-6-phosphate receptor, binding domain containing protein.
J065083E17CGCGTCGCGTCGCGTCGCNONE
Os06g0660400AK111110GCGACGCGConserved hypothetical protein.
Os06g0673500J100018J12GACGCGACGCNONE
J100072F13GACGCGACGCSimilar to Ubiquitin.
Os06g0687800AK072593GCGTCGCGSimilar to Pincher (EH-domain containing 4).
Os06g0687900003-115-E01GGGCCGGCTCCGACGGNONE
AB054003GGGCCGGCTCCGACGGGlycosyl transferase, family 43 protein.
J065212N07GGGCCGGCTCCGACGGNONE
Os06g0696400011-019-C01CCGTCGGATNONE
011-019-C01CGCGACGCGNONE
011-019-C01GCGACGCGNONE
011-027-D04CCGTCGGATNONE
011-027-D04CGCGACGCGNONE
011-027-D04GCGACGCGNONE
013-051-H10CCGTCGGATNONE
013-051-H10CGCGACGCGNONE
013-051-H10GCGACGCGNONE
013-054-A06CCGTCGGATNONE
013-054-A06CGCGACGCGNONE
013-054-A06GCGACGCGNONE
013-061-D06CCGTCGGATNONE
013-061-D06CGCGACGCGNONE
013-061-D06GCGACGCGNONE
013-088-F04CCGTCGGATNONE
013-088-F04CGCGACGCGNONE
013-088-F04GCGACGCGNONE
014-018-C07CCGTCGGATNONE
014-018-C07CGCGACGCGNONE
014-018-C07GCGACGCGNONE
014-026-E10CCGTCGGATNONE
014-026-E10CGCGACGCGNONE
014-026-E10GCGACGCGNONE
AK058291CCGTCGGATNONE
AK058291CGCGACGCGNONE
AK058291GCGACGCGNONE
AK066125CCGTCGGATNONE
AK066125CGCGACGCGNONE
AK066125GCGACGCGNONE
AK104912CCGTCGGATNONE
AK104912CGCGACGCGNONE
AK104912GCGACGCGNONE
BT014685CCGTCGGATSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase).
BT014685CGCGACGCGSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase).
BT014685GCGACGCGSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase).
J013059H08CCGTCGGATNONE
J013059H08CGCGACGCGNONE
J013059H08GCGACGCGNONE
J065065L22CCGTCGGATNONE
J065065L22CGCGACGCGNONE
J065065L22GCGACGCGNONE
J065084O06CCGTCGGATNONE
J065084O06CGCGACGCGNONE
J065084O06GCGACGCGNONE
J075006O13CCGTCGGATNONE
J075006O13CGCGACGCGNONE
J075006O13GCGACGCGNONE
J075013J18CCGTCGGATNONE
J075013J18CGCGACGCGNONE
J075013J18GCGACGCGNONE
J075018L23CCGTCGGATNONE
J075018L23CGCGACGCGNONE
J075018L23GCGACGCGNONE
J075036E14CCGTCGGATNONE
J075036E14CGCGACGCGNONE
J075036E14GCGACGCGNONE
J075039K21CCGTCGGATNONE
J075039K21CGCGACGCGNONE
J075039K21GCGACGCGNONE
J075075H13CCGTCGGATNONE
J075075H13CGCGACGCGNONE
J075075H13GCGACGCGNONE
J075091A14CCGTCGGATNONE
J075091A14CGCGACGCGNONE
J075091A14GCGACGCGNONE
J075093I09CCGTCGGATNONE
J075093I09CGCGACGCGNONE
J075093I09GCGACGCGNONE
J075136L17CCGTCGGATNONE
J075136L17CGCGACGCGNONE
J075136L17GCGACGCGNONE
J075156M24CCGTCGGATNONE
J075156M24CGCGACGCGNONE
J075156M24GCGACGCGNONE
J075174J01CCGTCGGATNONE
J075174J01CGCGACGCGNONE
J075174J01GCGACGCGNONE
J075179P15CCGTCGGATNONE
J075179P15CGCGACGCGNONE
J075179P15GCGACGCGNONE
J075181F02CCGTCGGATNONE
J075181F02CGCGACGCGNONE
J075181F02GCGACGCGNONE
J075194L24CCGTCGGATNONE
J075194L24CGCGACGCGNONE
J075194L24GCGACGCGNONE
J080302J02CCGTCGGATNONE
J080302J02CGCGACGCGNONE
J080302J02GCGACGCGNONE
J080304J11CCGTCGGATNONE
J080304J11CGCGACGCGNONE
J080304J11GCGACGCGNONE
J080308A15CCGTCGGATNONE
J080308A15CGCGACGCGNONE
J080308A15GCGACGCGNONE
J100041B09CCGTCGGATNONE
J100041B09CGCGACGCGNONE
J100041B09GCGACGCGNONE
Os06g0696500J080303G16CGTCGGATSimilar to Xyloglycan endo-transglycosylase precursor.
J080310K14CGTCGGATNONE
J080317J18CGTCGGATNONE
J080318F11CGTCGGATNONE
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein.
Os06g0698748004-013-F09CCACGCGTCGCNONE
006-099-E12CCACGCGTCGCNONE
009-074-D06CCACGCGTCGCNONE
009-081-C02CCACGCGTCGCNONE
013-065-B10CCACGCGTCGCNONE
AK100361CCACGCGTCGCConserved hypothetical protein.
AK105781CCACGCGTCGCNONE
J013088K23CCACGCGTCGCNONE
J013158L05CCACGCGTCGCNONE
J023083M02CCACGCGTCGCNONE
J075034E21CCACGCGTCGCNONE
J075049F24CCACGCGTCGCNONE
J075055A21CCACGCGTCGCNONE
J100044A04CCACGCGTCGCNONE
J100058I01CCACGCGTCGCNONE
Os06g0707200006-022-G09GACGCGACGCNONE
AK059411GACGCGACGCNONE
AK071568GACGCGACGCProtein of unknown function DUF563 family protein.
J065101E21GACGCGACGCNONE
Os06g0717900AK069070CGCGTCGCPeptidase A1, pepsin family protein.
AK121147CGCGTCGCNONE
J023007C05CGCGTCGCNONE
J043040A14CGCGTCGCNONE
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2).
J023055K12GATCCGACGGCCCAGATNONE
J053032B13GATCCGACGGCCCAGATNONE
X82036GATCCGACGGCCCAGATNONE
Os07g0115500AK108206CCGTCGGAConserved hypothetical protein.
AK108206GATCCGACGGConserved hypothetical protein.
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J033042K24GATCCGACGGCCCGGANONE
J033136G07GATCCGACGGCCCGGANONE
J065092I12GATCCGACGGCCCGGANONE
J065132F04GATCCGACGGCCCGGANONE
J065143I11GATCCGACGGCCCGGANONE
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE
006-021-E02GATCCGACGTGGGCCAANONE
006-025-C06GATCCGACGTGGGCCAANONE
006-027-H11GATCCGACGTGGGCCAANONE
006-036-C05GATCCGACGTGGGCCAANONE
006-046-D07GATCCGACGTGGGCCAANONE
006-047-A02GATCCGACGTGGGCCAANONE
006-050-F02GATCCGACGTGGGCCAANONE
006-053-D07GATCCGACGTGGGCCAANONE
006-054-E06GATCCGACGTGGGCCAANONE
006-055-E01GATCCGACGTGGGCCAANONE
006-055-F01GATCCGACGTGGGCCAANONE
006-056-H12GATCCGACGTGGGCCAANONE
006-057-D07GATCCGACGTGGGCCAANONE
006-074-G10GATCCGACGTGGGCCAANONE
006-077-C02GATCCGACGTGGGCCAANONE
006-081-E01GATCCGACGTGGGCCAANONE
006-089-B08GATCCGACGTGGGCCAANONE
006-089-C10GATCCGACGTGGGCCAANONE
006-092-E07GATCCGACGTGGGCCAANONE
006-096-C11GATCCGACGTGGGCCAANONE
006-096-H06GATCCGACGTGGGCCAANONE
006-097-E07GATCCGACGTGGGCCAANONE
006-098-D03GATCCGACGTGGGCCAANONE
006-102-C05GATCCGACGTGGGCCAANONE
006-107-E09GATCCGACGTGGGCCAANONE
006-110-C09GATCCGACGTGGGCCAANONE
006-113-C01GATCCGACGTGGGCCAANONE
006-114-D09GATCCGACGTGGGCCAANONE
006-115-H06GATCCGACGTGGGCCAANONE
009-016-G06GATCCGACGTGGGCCAANONE
009-031-C05GATCCGACGTGGGCCAANONE
009-060-B05GATCCGACGTGGGCCAANONE
009-123-H12GATCCGACGTGGGCCAANONE
009-154-B09GATCCGACGTGGGCCAANONE
009-172-F07GATCCGACGTGGGCCAANONE
009-193-A04GATCCGACGTGGGCCAANONE
AF022732GATCCGACGTGGGCCAANONE
AF052203GATCCGACGTGGGCCAANONE
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II.
AK104722GATCCGACGTGGGCCAANONE
D49713GATCCGACGTGGGCCAANONE
J013002J02GATCCGACGTGGGCCAANONE
J065051O13GATCCGACGTGGGCCAANONE
J065066J18GATCCGACGTGGGCCAANONE
J065077G23GATCCGACGTGGGCCAANONE
J065162C22GATCCGACGTGGGCCAANONE
J065162G22GATCCGACGTGGGCCAANONE
J075091B13GATCCGACGTGGGCCAANONE
J075099J22GATCCGACGTGGGCCAANONE
J100056O22GATCCGACGTGGGCCAANONE
J100059E01GATCCGACGTGGGCCAANONE
J100079F20GATCCGACGTGGGCCAANONE
Os07g0142900003-001-H01CGCGACGCNONE
AK060737CGCGACGCAldo/keto reductase family protein.
AK064848CGCGACGCNONE
Os07g0173200AK061624CCACGCGTCGCFrigida-like family protein.
AK065275CCACGCGTCGCNONE
AK098856CCACGCGTCGCNONE
AK098899CCACGCGTCGCNONE
Os07g0184800AK059544CCGATCCGACGGSimilar to Variant of histone H1.
AK059544CCGTCGGATSimilar to Variant of histone H1.
AK099050CCGATCCGACGGNONE
AK099050CCGTCGGATNONE
AK102642CCGATCCGACGGNONE
AK102642CCGTCGGATNONE
AK106132CCGATCCGACGGNONE
AK106132CCGTCGGATNONE
J023037O08CCGATCCGACGGNONE
J023037O08CCGTCGGATNONE
J023050M02CCGATCCGACGGNONE
J023050M02CCGTCGGATNONE
J023087A10CCGATCCGACGGNONE
J023087A10CCGTCGGATNONE
J033027D14CCGATCCGACGGNONE
J033027D14CCGTCGGATNONE
J033028N17CCGATCCGACGGNONE
J033028N17CCGTCGGATNONE
J033043P10CCGATCCGACGGNONE
J033043P10CCGTCGGATNONE
J033051D07CCGATCCGACGGNONE
J033051D07CCGTCGGATNONE
J033073M07CCGATCCGACGGNONE
J033073M07CCGTCGGATNONE
J033075H01CCGATCCGACGGNONE
J033075H01CCGTCGGATNONE
J033084E04CCGATCCGACGGNONE
J033084E04CCGTCGGATNONE
J033096D10CCGATCCGACGGNONE
J033096D10CCGTCGGATNONE
J033100F04CCGATCCGACGGNONE
J033100F04CCGTCGGATNONE
J033114B06CCGATCCGACGGNONE
J033114B06CCGTCGGATNONE
J033117C10CCGATCCGACGGNONE
J033117C10CCGTCGGATNONE
J033140B21CCGATCCGACGGNONE
J033140B21CCGTCGGATNONE
J043034J07CCGATCCGACGGNONE
J043034J07CCGTCGGATNONE
J065006F04CCGATCCGACGGNONE
J065006F04CCGTCGGATNONE
J065130H16CCGATCCGACGGNONE
J065130H16CCGTCGGATNONE
J075020G13CCGATCCGACGGNONE
J075020G13CCGTCGGATNONE
J075108M17CCGATCCGACGGNONE
J075108M17CCGTCGGATNONE
J080018A06CCGATCCGACGGNONE
J080018A06CCGTCGGATNONE
J080037J11CCGATCCGACGGNONE
J080037J11CCGTCGGATNONE
J080048F15CCGATCCGACGGNONE
J080048F15CCGTCGGATNONE
J080057D16CCGATCCGACGGNONE
J080057D16CCGTCGGATNONE
J080069A10CCGATCCGACGGNONE
J080069A10CCGTCGGATNONE
J080086L09CCGATCCGACGGNONE
J080086L09CCGTCGGATNONE
J080088A17CCGATCCGACGGNONE
J080088A17CCGTCGGATNONE
J100046F24CCGATCCGACGGNONE
J100046F24CCGTCGGATNONE
Os07g0202450J065010G16GATCCGACGGNONE
J065085G13GATCCGACGGNONE
J065117M22GATCCGACGGNONE
J065147K06GATCCGACGGNONE
J065207G15GATCCGACGGNONE
J090089M07GATCCGACGGNONE
J100064D20GATCCGACGGSimilar to Mitosis protein dim1.
Os07g0209000AK059111CCGTCGGATCSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like.
AK099319CCGTCGGATCNONE
Os07g0223100006-044-G07CGCGTCGCNONE
006-071-E10CGCGTCGCNONE
006-077-A04CGCGTCGCNONE
009-162-H05CGCGTCGCNONE
J023050M10CGCGTCGCNONE
J023055F05CGCGTCGCNONE
J023060I11CGCGTCGCNONE
J023101M01CGCGTCGCNONE
J065059J21CGCGTCGCNONE
J065087I18CGCGTCGCNONE
J065113L17CGCGTCGCNONE
J065123E19CGCGTCGCNONE
J065137O04CGCGTCGCNONE
J065217M03CGCGTCGCNONE
J090012O14CGCGTCGCNONE
J090014C13CGCGTCGCNONE
J090060C24CGCGTCGCNONE
J100037H14CGCGTCGCNONE
J100060E10CGCGTCGCNONE
J100067L04CGCGTCGCNONE
J100075G09CGCGTCGCNONE
J100077C15CGCGTCGCNONE
Os07g0240300AK072205CGCGCGACGCConserved hypothetical protein.
AK098977CGCGCGACGCNONE
Os07g0258700AK068718ATCCGACGNONE
AK069407ATCCGACGBTB domain containing protein.
AK106061ATCCGACGNONE
J080039L24ATCCGACGNONE
Os07g0262950J033120B02CGCGCGACGCGTGGConserved hypothetical protein.
J075040G05CGCGCGACGCGTGGNONE
J075160F23CGCGCGACGCGTGGNONE
Os07g0415200006-105-B10CCGTCGGATNONE
AK061243CCGTCGGATNONE
AK101796CCGTCGGATRibosomal L23 and L15e, core domain containing protein.
AK104106CCGTCGGATNONE
J033066C05CCGTCGGATNONE
J065188B11CCGTCGGATNONE
J065211E07CCGTCGGATNONE
J090003E03CCGTCGGATNONE
Os07g0419800J080309B06CCGTCGGATNONE
Os07g0422100013-054-G11CGCGTCGCNONE
AK063592CGCGTCGCNONE
J065165K10CGCGTCGCNONE
J075021B01CGCGTCGCNONE
J075087H22CGCGTCGCNONE
J075118C10CGCGTCGCNONE
J075134N03CGCGTCGCNONE
J075151F23CGCGTCGCNONE
U57639CGCGTCGCAWPM-19-like family protein.
Os07g0456700AK100891CGCGACGCSimilar to (1,4)-beta-xylan endohydrolase (EC 3.2.1.8).
Os07g0490400AK067941CGCGACGCPeptidylprolyl isomerase, FKBP-type domain containing protein.
J013121F22CGCGACGCNONE
Os07g0496200AK064866CGCGTCGCGNONE
AK065801CGCGTCGCGSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME).
Os07g0530700AK060014GACGCGACGCNONE
Os07g0531600015-098-E11GCGACGCGNONE
AK067845GCGACGCGPhospholipid/glycerol acyltransferase domain containing protein.
J013124G01GCGACGCGNONE
J065008E15GCGACGCGNONE
J065052K14GCGACGCGNONE
J065052L13GCGACGCGNONE
J065058M02GCGACGCGNONE
J065069M10GCGACGCGNONE
J065135A14GCGACGCGNONE
J065168O18GCGACGCGNONE
J075070D14GCGACGCGNONE
J075169B16GCGACGCGNONE
Os07g0541500AK111550ATCCGACGGSimilar to KI domain interacting kinase 1.
Os07g0544800009-021-C02CGCGTCGCNONE
009-170-G02CGCGTCGCNONE
009-178-H12CGCGTCGCNONE
AK069170CGCGTCGCSimilar to Oxygen-evolving enhancer protein 3-2, chloroplast precursor (OEE3) (16 kDa subunit of oxygen evolving system of photosystem II) (OEC 16 kDa subunit) (Ferredoxin-NADP reductase binding protein) (BP).
AK099127CGCGTCGCNONE
J065088D21CGCGTCGCNONE
J065106G19CGCGTCGCNONE
J065156I24CGCGTCGCNONE
J065162C10CGCGTCGCNONE
J065211G14CGCGTCGCNONE
J075003F05CGCGTCGCNONE
J075046I10CGCGTCGCNONE
J075055M11CGCGTCGCNONE
J075074I12CGCGTCGCNONE
J075088B06CGCGTCGCNONE
J075091K13CGCGTCGCNONE
J075093I10CGCGTCGCNONE
J075097M09CGCGTCGCNONE
J075106H11CGCGTCGCNONE
J075121C22CGCGTCGCNONE
J075145F05CGCGTCGCNONE
J075173H16CGCGTCGCNONE
J075190L07CGCGTCGCNONE
J100063N21CGCGTCGCNONE
J100073C24CGCGTCGCNONE
J100085E01CGCGTCGCNONE
J100088I23CGCGTCGCNONE
Os07g0545400009-136-E03CCGATCCGACGGNONE
013-015-G08CCGATCCGACGGNONE
AK059228CCGATCCGACGGNONE
J065040D09CCGATCCGACGGNONE
J065051C19CCGATCCGACGGNONE
J065139B05CCGATCCGACGGNONE
J065160E20CCGATCCGACGGNONE
J065207I17CCGATCCGACGGNONE
J080319M24CCGATCCGACGGNONE
Os07g0546100AK058282GCGACGCGNONE
Os07g0553700006-039-A02CGCGACGCNONE
AK061510CGCGACGCSimilar to Light induced protein like.
J013170D04CGCGACGCNONE
J053024G19CGCGACGCNONE
J053032K14CGCGACGCNONE
J053048O04CGCGACGCNONE
J053050C13CGCGACGCNONE
J053054B17CGCGACGCNONE
J053066M01CGCGACGCNONE
J100044H05CGCGACGCNONE
Os07g0557500AK101830ATCCGACGZinc finger, RING-type domain containing protein.
J013075M04ATCCGACGNONE
J033068I24ATCCGACGNONE
Os07g0562700003-111-G08ATCCGACGTGGCNONE
004-013-E07ATCCGACGTGGCNONE
006-021-D03ATCCGACGTGGCNONE
006-021-D07ATCCGACGTGGCNONE
006-021-F09ATCCGACGTGGCNONE
006-023-D01ATCCGACGTGGCNONE
006-024-F04ATCCGACGTGGCNONE
006-024-G09ATCCGACGTGGCNONE
006-024-G11ATCCGACGTGGCNONE
006-025-A10ATCCGACGTGGCNONE
006-025-B08ATCCGACGTGGCNONE
006-025-E10ATCCGACGTGGCNONE
006-025-F10ATCCGACGTGGCNONE
006-026-B04ATCCGACGTGGCNONE
006-026-C08ATCCGACGTGGCNONE
006-026-D03ATCCGACGTGGCNONE
006-026-F03ATCCGACGTGGCNONE
006-026-F08ATCCGACGTGGCNONE
006-026-F12ATCCGACGTGGCNONE
006-027-A10ATCCGACGTGGCNONE
006-027-C03ATCCGACGTGGCNONE
006-028-C03ATCCGACGTGGCNONE
006-029-E02ATCCGACGTGGCNONE
006-029-G05ATCCGACGTGGCNONE
006-030-A10ATCCGACGTGGCNONE
006-030-C06ATCCGACGTGGCNONE
006-030-D03ATCCGACGTGGCNONE
006-030-D06ATCCGACGTGGCNONE
006-030-G05ATCCGACGTGGCNONE
006-031-B10ATCCGACGTGGCNONE
006-031-D04ATCCGACGTGGCNONE
006-031-D11ATCCGACGTGGCNONE
006-031-H09ATCCGACGTGGCNONE
006-032-C09ATCCGACGTGGCNONE
006-032-H09ATCCGACGTGGCNONE
006-033-B02ATCCGACGTGGCNONE
006-033-B09ATCCGACGTGGCNONE
006-033-E01ATCCGACGTGGCNONE
006-033-F06ATCCGACGTGGCNONE
006-033-G03ATCCGACGTGGCNONE
006-034-A08ATCCGACGTGGCNONE
006-034-C09ATCCGACGTGGCNONE
006-034-F06ATCCGACGTGGCNONE
006-035-B12ATCCGACGTGGCNONE
006-035-C12ATCCGACGTGGCNONE
006-035-H04ATCCGACGTGGCNONE
006-035-H12ATCCGACGTGGCNONE
006-036-A05ATCCGACGTGGCNONE
006-036-A09ATCCGACGTGGCNONE
006-036-B10ATCCGACGTGGCNONE
006-036-C03ATCCGACGTGGCNONE
006-036-E06ATCCGACGTGGCNONE
006-037-H11ATCCGACGTGGCNONE
006-038-G01ATCCGACGTGGCNONE
006-039-B01ATCCGACGTGGCNONE
006-039-B12ATCCGACGTGGCNONE
006-039-C02ATCCGACGTGGCNONE
006-039-E06ATCCGACGTGGCNONE
006-039-G12ATCCGACGTGGCNONE
006-040-G07ATCCGACGTGGCNONE
006-041-H04ATCCGACGTGGCNONE
006-042-A11ATCCGACGTGGCNONE
006-042-E07ATCCGACGTGGCNONE
006-042-F12ATCCGACGTGGCNONE
006-043-C01ATCCGACGTGGCNONE
006-045-H12ATCCGACGTGGCNONE
006-046-A12ATCCGACGTGGCNONE
006-046-F03ATCCGACGTGGCNONE
006-047-A07ATCCGACGTGGCNONE
006-047-A09ATCCGACGTGGCNONE
006-047-E10ATCCGACGTGGCNONE
006-047-G12ATCCGACGTGGCNONE
006-048-B04ATCCGACGTGGCNONE
006-049-D01ATCCGACGTGGCNONE
006-049-G02ATCCGACGTGGCNONE
006-049-G10ATCCGACGTGGCNONE
006-049-H04ATCCGACGTGGCNONE
006-050-D05ATCCGACGTGGCNONE
006-050-F05ATCCGACGTGGCNONE
006-051-B05ATCCGACGTGGCNONE
006-051-G12ATCCGACGTGGCNONE
006-052-D12ATCCGACGTGGCNONE
006-053-D06ATCCGACGTGGCNONE
006-054-H02ATCCGACGTGGCNONE
006-055-A03ATCCGACGTGGCNONE
006-055-C01ATCCGACGTGGCNONE
006-055-E07ATCCGACGTGGCNONE
006-055-H06ATCCGACGTGGCNONE
006-056-F06ATCCGACGTGGCNONE
006-057-D03ATCCGACGTGGCNONE
006-057-D05ATCCGACGTGGCNONE
006-057-G01ATCCGACGTGGCNONE
006-058-A03ATCCGACGTGGCNONE
006-058-B06ATCCGACGTGGCNONE
006-059-A09ATCCGACGTGGCNONE
006-059-H11ATCCGACGTGGCNONE
006-060-A04ATCCGACGTGGCNONE
006-060-A09ATCCGACGTGGCNONE
006-060-C11ATCCGACGTGGCNONE
006-060-D08ATCCGACGTGGCNONE
006-061-A04ATCCGACGTGGCNONE
006-061-E01ATCCGACGTGGCNONE
006-061-G10ATCCGACGTGGCNONE
006-061-H12ATCCGACGTGGCNONE
006-062-B07ATCCGACGTGGCNONE
006-062-G03ATCCGACGTGGCNONE
006-062-H12ATCCGACGTGGCNONE
006-063-D05ATCCGACGTGGCNONE
006-063-E04ATCCGACGTGGCNONE
006-063-F05ATCCGACGTGGCNONE
006-063-G05ATCCGACGTGGCNONE
006-064-B07ATCCGACGTGGCNONE
006-065-C11ATCCGACGTGGCNONE
006-065-H02ATCCGACGTGGCNONE
006-067-C12ATCCGACGTGGCNONE
006-067-F10ATCCGACGTGGCNONE
006-068-E02ATCCGACGTGGCNONE
006-068-G04ATCCGACGTGGCNONE
006-069-A02ATCCGACGTGGCNONE
006-071-A07ATCCGACGTGGCNONE
006-072-F11ATCCGACGTGGCNONE
006-072-F12ATCCGACGTGGCNONE
006-073-E12ATCCGACGTGGCNONE
006-073-F08ATCCGACGTGGCNONE
006-073-H07ATCCGACGTGGCNONE
006-074-A07ATCCGACGTGGCNONE
006-075-A12ATCCGACGTGGCNONE
006-075-B01ATCCGACGTGGCNONE
006-075-H10ATCCGACGTGGCNONE
006-075-H12ATCCGACGTGGCNONE
006-076-B06ATCCGACGTGGCNONE
006-077-A09ATCCGACGTGGCNONE
006-077-D05ATCCGACGTGGCNONE
006-078-C11ATCCGACGTGGCNONE
006-078-D12ATCCGACGTGGCNONE
006-078-E02ATCCGACGTGGCNONE
006-079-A01ATCCGACGTGGCNONE
006-079-E02ATCCGACGTGGCNONE
006-079-F03ATCCGACGTGGCNONE
006-080-G11ATCCGACGTGGCNONE
006-081-C02ATCCGACGTGGCNONE
006-081-C08ATCCGACGTGGCNONE
006-082-B06ATCCGACGTGGCNONE
006-082-C11ATCCGACGTGGCNONE
006-082-H04ATCCGACGTGGCNONE
006-083-E04ATCCGACGTGGCNONE
006-083-H12ATCCGACGTGGCNONE
006-084-C08ATCCGACGTGGCNONE
006-084-E07ATCCGACGTGGCNONE
006-084-E10ATCCGACGTGGCNONE
006-085-E06ATCCGACGTGGCNONE
006-085-E10ATCCGACGTGGCNONE
006-086-F06ATCCGACGTGGCNONE
006-087-D08ATCCGACGTGGCNONE
006-087-F03ATCCGACGTGGCNONE
006-087-F10ATCCGACGTGGCNONE
006-087-G07ATCCGACGTGGCNONE
006-088-A02ATCCGACGTGGCNONE
006-089-A04ATCCGACGTGGCNONE
006-089-B12ATCCGACGTGGCNONE
006-089-D06ATCCGACGTGGCNONE
006-089-D10ATCCGACGTGGCNONE
006-089-H05ATCCGACGTGGCNONE
006-090-C06ATCCGACGTGGCNONE
006-091-A03ATCCGACGTGGCNONE
006-091-E04ATCCGACGTGGCNONE
006-091-H12ATCCGACGTGGCNONE
006-092-A08ATCCGACGTGGCNONE
006-092-F01ATCCGACGTGGCNONE
006-092-G08ATCCGACGTGGCNONE
006-093-B12ATCCGACGTGGCNONE
006-093-D04ATCCGACGTGGCNONE
006-093-F01ATCCGACGTGGCNONE
006-094-A08ATCCGACGTGGCNONE
006-094-F01ATCCGACGTGGCNONE
006-094-F03ATCCGACGTGGCNONE
006-095-C12ATCCGACGTGGCNONE
006-095-E10ATCCGACGTGGCNONE
006-095-E12ATCCGACGTGGCNONE
006-095-G06ATCCGACGTGGCNONE
006-096-B12ATCCGACGTGGCNONE
006-096-C12ATCCGACGTGGCNONE
006-096-G02ATCCGACGTGGCNONE
006-097-D01ATCCGACGTGGCNONE
006-097-D07ATCCGACGTGGCNONE
006-097-F04ATCCGACGTGGCNONE
006-098-C07ATCCGACGTGGCNONE
006-098-D04ATCCGACGTGGCNONE
006-099-E06ATCCGACGTGGCNONE
006-099-F02ATCCGACGTGGCNONE
006-099-F10ATCCGACGTGGCNONE
006-100-A07ATCCGACGTGGCNONE
006-100-B10ATCCGACGTGGCNONE
006-100-G01ATCCGACGTGGCNONE
006-100-H06ATCCGACGTGGCNONE
006-101-D01ATCCGACGTGGCNONE
006-101-F03ATCCGACGTGGCNONE
006-102-A12ATCCGACGTGGCNONE
006-102-B11ATCCGACGTGGCNONE
006-102-C03ATCCGACGTGGCNONE
006-102-F11ATCCGACGTGGCNONE
006-103-A08ATCCGACGTGGCNONE
006-103-B06ATCCGACGTGGCNONE
006-103-D01ATCCGACGTGGCNONE
006-103-F02ATCCGACGTGGCNONE
006-104-B02ATCCGACGTGGCNONE
006-104-C01ATCCGACGTGGCNONE
006-104-F09ATCCGACGTGGCNONE
006-104-H11ATCCGACGTGGCNONE
006-105-A03ATCCGACGTGGCNONE
006-105-D09ATCCGACGTGGCNONE
006-106-B10ATCCGACGTGGCNONE
006-107-A06ATCCGACGTGGCNONE
006-107-C04ATCCGACGTGGCNONE
006-107-E03ATCCGACGTGGCNONE
006-107-F05ATCCGACGTGGCNONE
006-108-C09ATCCGACGTGGCNONE
006-109-C09ATCCGACGTGGCNONE
006-109-D10ATCCGACGTGGCNONE
006-109-E06ATCCGACGTGGCNONE
006-109-E10ATCCGACGTGGCNONE
006-110-A06ATCCGACGTGGCNONE
006-110-C11ATCCGACGTGGCNONE
006-111-A02ATCCGACGTGGCNONE
006-111-F02ATCCGACGTGGCNONE
006-112-A08ATCCGACGTGGCNONE
006-112-H06ATCCGACGTGGCNONE
006-113-A08ATCCGACGTGGCNONE
006-113-B01ATCCGACGTGGCNONE
006-113-C05ATCCGACGTGGCNONE
006-113-D01ATCCGACGTGGCNONE
006-113-D04ATCCGACGTGGCNONE
006-113-D06ATCCGACGTGGCNONE
006-113-E09ATCCGACGTGGCNONE
006-114-F06ATCCGACGTGGCNONE
006-116-B02ATCCGACGTGGCNONE
006-117-B07ATCCGACGTGGCNONE
006-117-G04ATCCGACGTGGCNONE
006-118-D01ATCCGACGTGGCNONE
006-118-D12ATCCGACGTGGCNONE
006-118-F12ATCCGACGTGGCNONE
006-118-G12ATCCGACGTGGCNONE
006-119-B08ATCCGACGTGGCNONE
006-120-E09ATCCGACGTGGCNONE
006-120-G05ATCCGACGTGGCNONE
006-120-G10ATCCGACGTGGCNONE
009-022-D12ATCCGACGTGGCNONE
009-051-H08ATCCGACGTGGCNONE
009-065-F05ATCCGACGTGGCNONE
009-070-A06ATCCGACGTGGCNONE
009-073-B07ATCCGACGTGGCNONE
009-092-C10ATCCGACGTGGCNONE
009-093-D03ATCCGACGTGGCNONE
009-103-B04ATCCGACGTGGCNONE
009-106-H08ATCCGACGTGGCNONE
009-120-B05ATCCGACGTGGCNONE
009-121-F05ATCCGACGTGGCNONE
009-122-B04ATCCGACGTGGCNONE
009-122-D08ATCCGACGTGGCNONE
009-123-F07ATCCGACGTGGCNONE
009-125-G02ATCCGACGTGGCNONE
009-128-F02ATCCGACGTGGCNONE
009-128-H07ATCCGACGTGGCNONE
009-131-C06ATCCGACGTGGCNONE
009-132-F08ATCCGACGTGGCNONE
009-133-G08ATCCGACGTGGCNONE
009-134-D09ATCCGACGTGGCNONE
009-135-F01ATCCGACGTGGCNONE
009-149-E11ATCCGACGTGGCNONE
009-153-H04ATCCGACGTGGCNONE
009-161-E04ATCCGACGTGGCNONE
009-163-A09ATCCGACGTGGCNONE
009-163-C05ATCCGACGTGGCNONE
009-163-E10ATCCGACGTGGCNONE
009-165-F04ATCCGACGTGGCNONE
009-166-A07ATCCGACGTGGCNONE
009-169-G12ATCCGACGTGGCNONE
009-172-G08ATCCGACGTGGCNONE
009-179-E06ATCCGACGTGGCNONE
009-181-F09ATCCGACGTGGCNONE
009-190-G07ATCCGACGTGGCNONE
009-191-D01ATCCGACGTGGCNONE
009-195-G02ATCCGACGTGGCNONE
AF022738ATCCGACGTGGCNONE
AK061512ATCCGACGTGGCNONE
AK068972ATCCGACGTGGCNONE
AK103926ATCCGACGTGGCNONE
AK103999ATCCGACGTGGCNONE
AK104224ATCCGACGTGGCNONE
AK104465ATCCGACGTGGCNONE
AK104495ATCCGACGTGGCNONE
AK109399ATCCGACGTGGCSimilar to Type III chlorophyll a/b-binding protein (Fragment).
AK119533ATCCGACGTGGCNONE
AK119545ATCCGACGTGGCNONE
J013043L10ATCCGACGTGGCNONE
J013050A09ATCCGACGTGGCNONE
J023001G03ATCCGACGTGGCNONE
J023024D14ATCCGACGTGGCNONE
J023072E11ATCCGACGTGGCNONE
J023149E18ATCCGACGTGGCNONE
J033029B16ATCCGACGTGGCNONE
J065001O21ATCCGACGTGGCNONE
J065035B04ATCCGACGTGGCNONE
J065044D18ATCCGACGTGGCNONE
J065057F12ATCCGACGTGGCNONE
J065060A11ATCCGACGTGGCNONE
J065062G15ATCCGACGTGGCNONE
J065080F13ATCCGACGTGGCNONE
J065084N12ATCCGACGTGGCNONE
J065101D02ATCCGACGTGGCNONE
J065107C07ATCCGACGTGGCNONE
J065112N24ATCCGACGTGGCNONE
J065141I16ATCCGACGTGGCNONE
J065147D05ATCCGACGTGGCNONE
J065167H02ATCCGACGTGGCNONE
J065207K23ATCCGACGTGGCNONE
J075008E16ATCCGACGTGGCNONE
J075014F03ATCCGACGTGGCNONE
J075015O17ATCCGACGTGGCNONE
J075020H20ATCCGACGTGGCNONE
J075021E22ATCCGACGTGGCNONE
J075023N13ATCCGACGTGGCNONE
J075028H10ATCCGACGTGGCNONE
J075040F20ATCCGACGTGGCNONE
J075051L23ATCCGACGTGGCNONE
J075069G16ATCCGACGTGGCNONE
J075084F24ATCCGACGTGGCNONE
J075090H09ATCCGACGTGGCNONE
J075092M21ATCCGACGTGGCNONE
J075110C10ATCCGACGTGGCNONE
J075111J12ATCCGACGTGGCNONE
J075114L04ATCCGACGTGGCNONE
J075139E02ATCCGACGTGGCNONE
J075160M10ATCCGACGTGGCNONE
J075176J03ATCCGACGTGGCNONE
J075183I17ATCCGACGTGGCNONE
J075191N10ATCCGACGTGGCNONE
J075193D07ATCCGACGTGGCNONE
J075194M16ATCCGACGTGGCNONE
J075197K04ATCCGACGTGGCNONE
J080032I11ATCCGACGTGGCNONE
J080076M11ATCCGACGTGGCNONE
J080311J08ATCCGACGTGGCNONE
J080317E05ATCCGACGTGGCNONE
J090034L08ATCCGACGTGGCNONE
J100040D19ATCCGACGTGGCNONE
J100074C11ATCCGACGTGGCNONE
Os07g0565800009-114-F12CGCGCGACGCNONE
AK062834CGCGCGACGCConserved hypothetical protein.
J065026L16CGCGCGACGCNONE
Os07g0568300AK067784CGCGACGCGNONE
AK067895CGCGACGCGSimilar to ZF protein (Fragment).
J013119M01CGCGACGCGNONE
J013120B09CGCGACGCGNONE
J013123G12CGCGACGCGNONE
J023012C12CGCGACGCGNONE
J023020G17CGCGACGCGNONE
J023037E23CGCGACGCGNONE
J033076I01CGCGACGCGNONE
J033108A07CGCGACGCGNONE
J033138J02CGCGACGCGNONE
J075033L09CGCGACGCGNONE
J075049E02CGCGACGCGNONE
J075060N23CGCGACGCGNONE
J075094H13CGCGACGCGNONE
J075179L18CGCGACGCGNONE
J080005P09CGCGACGCGNONE
J080044J03CGCGACGCGNONE
J080062G20CGCGACGCGNONE
J080063L23CGCGACGCGNONE
J080065B16CGCGACGCGNONE
J080071K09CGCGACGCGNONE
J080089C23CGCGACGCGNONE
J090008P21CGCGACGCGNONE
J090046B22CGCGACGCGNONE
J090094C19CGCGACGCGNONE
J090096B19CGCGACGCGNONE
J100060G03CGCGACGCGNONE
J100082D16CGCGACGCGNONE
Os07g0577600006-021-H11CGCGACGCGNONE
006-022-B11CGCGACGCGNONE
006-022-D10CGCGACGCGNONE
006-022-E02CGCGACGCGNONE
006-022-F03CGCGACGCGNONE
006-023-C11CGCGACGCGNONE
006-024-C10CGCGACGCGNONE
006-024-C12CGCGACGCGNONE
006-024-G12CGCGACGCGNONE
006-026-C04CGCGACGCGNONE
006-026-E05CGCGACGCGNONE
006-026-E11CGCGACGCGNONE
006-026-F09CGCGACGCGNONE
006-026-H05CGCGACGCGNONE
006-027-D03CGCGACGCGNONE
006-028-C04CGCGACGCGNONE
006-029-G10CGCGACGCGNONE
006-030-A11CGCGACGCGNONE
006-030-D12CGCGACGCGNONE
006-031-G05CGCGACGCGNONE
006-032-H06CGCGACGCGNONE
006-033-A02CGCGACGCGNONE
006-033-A06CGCGACGCGNONE
006-034-B10CGCGACGCGNONE
006-034-F07CGCGACGCGNONE
006-035-A08CGCGACGCGNONE
006-035-F07CGCGACGCGNONE
006-036-A04CGCGACGCGNONE
006-036-B04CGCGACGCGNONE
006-037-D02CGCGACGCGNONE
006-037-F12CGCGACGCGNONE
006-037-H12CGCGACGCGNONE
006-040-G12CGCGACGCGNONE
006-040-H03CGCGACGCGNONE
006-040-H06CGCGACGCGNONE
006-042-B12CGCGACGCGNONE
006-042-H10CGCGACGCGNONE
006-044-G09CGCGACGCGNONE
006-045-C04CGCGACGCGNONE
006-046-B10CGCGACGCGNONE
006-047-A05CGCGACGCGNONE
006-048-D05CGCGACGCGNONE
006-049-A08CGCGACGCGNONE
006-050-C07CGCGACGCGNONE
006-050-H10CGCGACGCGNONE
006-051-G03CGCGACGCGNONE
006-052-A01CGCGACGCGNONE
006-052-A05CGCGACGCGNONE
006-052-B03CGCGACGCGNONE
006-052-D10CGCGACGCGNONE
006-054-D03CGCGACGCGNONE
006-055-A12CGCGACGCGNONE
006-055-C05CGCGACGCGNONE
006-055-F05CGCGACGCGNONE
006-055-H10CGCGACGCGNONE
006-056-A02CGCGACGCGNONE
006-056-D07CGCGACGCGNONE
006-057-A03CGCGACGCGNONE
006-057-B06CGCGACGCGNONE
006-057-H08CGCGACGCGNONE
006-058-C04CGCGACGCGNONE
006-058-F06CGCGACGCGNONE
006-059-C10CGCGACGCGNONE
006-059-G08CGCGACGCGNONE
006-060-E10CGCGACGCGNONE
006-061-B10CGCGACGCGNONE
006-062-A05CGCGACGCGNONE
006-062-B04CGCGACGCGNONE
006-063-A04CGCGACGCGNONE
006-063-D01CGCGACGCGNONE
006-063-G12CGCGACGCGNONE
006-064-D12CGCGACGCGNONE
006-066-A03CGCGACGCGNONE
006-066-C03CGCGACGCGNONE
006-067-A03CGCGACGCGNONE
006-067-G07CGCGACGCGNONE
006-068-A06CGCGACGCGNONE
006-069-D04CGCGACGCGNONE
006-069-G05CGCGACGCGNONE
006-070-H08CGCGACGCGNONE
006-071-A05CGCGACGCGNONE
006-071-H11CGCGACGCGNONE
006-072-A07CGCGACGCGNONE
006-072-B02CGCGACGCGNONE
006-072-D11CGCGACGCGNONE
006-072-H12CGCGACGCGNONE
006-075-G06CGCGACGCGNONE
006-077-B09CGCGACGCGNONE
006-078-D01CGCGACGCGNONE
006-078-D02CGCGACGCGNONE
006-078-E05CGCGACGCGNONE
006-078-G07CGCGACGCGNONE
006-079-C03CGCGACGCGNONE
006-079-F12CGCGACGCGNONE
006-079-H01CGCGACGCGNONE
006-080-D04CGCGACGCGNONE
006-080-H04CGCGACGCGNONE
006-081-A10CGCGACGCGNONE
006-082-G02CGCGACGCGNONE
006-082-H07CGCGACGCGNONE
006-083-B03CGCGACGCGNONE
006-085-A09CGCGACGCGNONE
006-085-A12CGCGACGCGNONE
006-085-F07CGCGACGCGNONE
006-086-B11CGCGACGCGNONE
006-086-D01CGCGACGCGNONE
006-086-G04CGCGACGCGNONE
006-087-E04CGCGACGCGNONE
006-087-G09CGCGACGCGNONE
006-088-E11CGCGACGCGNONE
006-088-G10CGCGACGCGNONE
006-088-H01CGCGACGCGNONE
006-089-B04CGCGACGCGNONE
006-089-D05CGCGACGCGNONE
006-089-F07CGCGACGCGNONE
006-089-H07CGCGACGCGNONE
006-090-B06CGCGACGCGNONE
006-090-H05CGCGACGCGNONE
006-091-E11CGCGACGCGNONE
006-092-H01CGCGACGCGNONE
006-093-B08CGCGACGCGNONE
006-093-C07CGCGACGCGNONE
006-093-F02CGCGACGCGNONE
006-093-G05CGCGACGCGNONE
006-093-G06CGCGACGCGNONE
006-094-D10CGCGACGCGNONE
006-094-H07CGCGACGCGNONE
006-095-G03CGCGACGCGNONE
006-096-A06CGCGACGCGNONE
006-096-E03CGCGACGCGNONE
006-097-B03CGCGACGCGNONE
006-097-D03CGCGACGCGNONE
006-098-B07CGCGACGCGNONE
006-098-G05CGCGACGCGNONE
006-099-F05CGCGACGCGNONE
006-100-H10CGCGACGCGNONE
006-100-H12CGCGACGCGNONE
006-101-A06CGCGACGCGNONE
006-101-A08CGCGACGCGNONE
006-101-A12CGCGACGCGNONE
006-101-D04CGCGACGCGNONE
006-101-G07CGCGACGCGNONE
006-102-B12CGCGACGCGNONE
006-102-E09CGCGACGCGNONE
006-102-F02CGCGACGCGNONE
006-103-D09CGCGACGCGNONE
006-105-D05CGCGACGCGNONE
006-105-D08CGCGACGCGNONE
006-106-C07CGCGACGCGNONE
006-106-F12CGCGACGCGNONE
006-107-D01CGCGACGCGNONE
006-109-C05CGCGACGCGNONE
006-109-C08CGCGACGCGNONE
006-109-D02CGCGACGCGNONE
006-111-F03CGCGACGCGNONE
006-112-C12CGCGACGCGNONE
006-112-D08CGCGACGCGNONE
006-113-A01CGCGACGCGNONE
006-113-B03CGCGACGCGNONE
006-113-C11CGCGACGCGNONE
006-113-E07CGCGACGCGNONE
006-113-F08CGCGACGCGNONE
006-114-D08CGCGACGCGNONE
006-114-H08CGCGACGCGNONE
006-115-A08CGCGACGCGNONE
006-115-A09CGCGACGCGNONE
006-115-G05CGCGACGCGNONE
006-117-B06CGCGACGCGNONE
006-117-B09CGCGACGCGNONE
006-117-F11CGCGACGCGNONE
006-117-G10CGCGACGCGNONE
006-117-H08CGCGACGCGNONE
006-118-C06CGCGACGCGNONE
006-118-G11CGCGACGCGNONE
006-119-H03CGCGACGCGNONE
006-120-D01CGCGACGCGNONE
006-120-D12CGCGACGCGNONE
006-120-H04CGCGACGCGNONE
009-022-E12CGCGACGCGNONE
009-044-H02CGCGACGCGNONE
009-074-B08CGCGACGCGNONE
009-145-B08CGCGACGCGNONE
009-156-D09CGCGACGCGNONE
009-163-F03CGCGACGCGNONE
009-193-G03CGCGACGCGNONE
AF010321CGCGACGCGNONE
AK060987CGCGACGCGNONE
AK070051CGCGACGCGNONE
AK103966CGCGACGCGNONE
AK104016CGCGACGCGNONE
AK104127CGCGACGCGNONE
AK104177CGCGACGCGNONE
AK104283CGCGACGCGNONE
AK104608CGCGACGCGNONE
AK104651CGCGACGCGNONE
AK119176CGCGACGCGSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor.
J065013J05CGCGACGCGNONE
J065129D23CGCGACGCGNONE
J065138E06CGCGACGCGNONE
J065179N22CGCGACGCGNONE
J065192A07CGCGACGCGNONE
J065208G16CGCGACGCGNONE
J075013K01CGCGACGCGNONE
J075017B12CGCGACGCGNONE
J075018O17CGCGACGCGNONE
J075023H05CGCGACGCGNONE
J075053L02CGCGACGCGNONE
J075067I01CGCGACGCGNONE
J075083D19CGCGACGCGNONE
J075083G03CGCGACGCGNONE
J075084F12CGCGACGCGNONE
J075088K18CGCGACGCGNONE
J075094A18CGCGACGCGNONE
J075094I22CGCGACGCGNONE
J075097E17CGCGACGCGNONE
J075098I24CGCGACGCGNONE
J075110K19CGCGACGCGNONE
J075118G21CGCGACGCGNONE
J075118J20CGCGACGCGNONE
J075120G14CGCGACGCGNONE
J075120H20CGCGACGCGNONE
J075127H23CGCGACGCGNONE
J075139M03CGCGACGCGNONE
J075142E17CGCGACGCGNONE
J075149N17CGCGACGCGNONE
J075152A20CGCGACGCGNONE
J075157N22CGCGACGCGNONE
J075159K21CGCGACGCGNONE
J075173B20CGCGACGCGNONE
J075192N20CGCGACGCGNONE
J075196A07CGCGACGCGNONE
J075199N04CGCGACGCGNONE
J080005P10CGCGACGCGNONE
J080025I24CGCGACGCGNONE
J080064D09CGCGACGCGNONE
J080064N24CGCGACGCGNONE
J080068B02CGCGACGCGNONE
J080097K04CGCGACGCGNONE
J080097K19CGCGACGCGNONE
J080097N20CGCGACGCGNONE
J100055P07CGCGACGCGNONE
Os07g0584500003-129-F05GTCGCGTCGCGTCNONE
006-119-H08GTCGCGTCGCGTCNONE
011-022-G03GTCGCGTCGCGTCNONE
AK067725GTCGCGTCGCGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
AK121109GTCGCGTCGCGTCNONE
J013055C05GTCGCGTCGCGTCNONE
J013062F12GTCGCGTCGCGTCNONE
J013069J22GTCGCGTCGCGTCNONE
J013114I11GTCGCGTCGCGTCNONE
J023072P12GTCGCGTCGCGTCNONE
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein.
J023030F23CCGATCCGACGGCCCGNONE
J065165H21CCGATCCGACGGCCCGNONE
J065193G01CCGATCCGACGGCCCGNONE
J075093F03CCGATCCGACGGCCCGNONE
Os07g0592200AK099740GCGACGCGPeptidase A1, pepsin family protein.
AK110717GCGACGCGNONE
Os07g0600000006-021-B09CGCGACGCCCAACCNONE
006-028-D09CGCGACGCCCAACCNONE
013-065-H09CGCGACGCCCAACCNONE
AK105907CGCGACGCCCAACCConserved hypothetical protein.
Os07g0605200AF091458GATCCGACGGNONE
AF139665GATCCGACGGNONE
AJ011675GATCCGACGGNONE
AK064704GATCCGACGGMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7).
J075159J15GATCCGACGGNONE
J090034M06GATCCGACGGNONE
J090079L24GATCCGACGGNONE
Os07g0620300AK059588CCGTCGGATNONE
AK099000CCGTCGGATNONE
AK099150CCGTCGGATNONE
AK119518CCGTCGGATClathrin adaptor complex, medium chain family protein.
Os07g0633200AK061338GATCCGACGGSimilar to SC35-like splicing factor SCL30a, 30a kD.
AK073451GATCCGACGGNONE
J033096E22GATCCGACGGNONE
J033125D06GATCCGACGGNONE
J075048C23GATCCGACGGNONE
J075050G02GATCCGACGGNONE
J075104J04GATCCGACGGNONE
J075144N04GATCCGACGGNONE
Os07g0637100AK111132ATCCGACGGHeat shock protein DnaJ, N-terminal domain containing protein.
Os07g0641700009-030-F09CGCGTCGCNONE
014-030-D10CGCGTCGCNONE
AF009413CGCGTCGCSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES).
AK059154CGCGTCGCNONE
AK119728CGCGTCGCNONE
AK122129CGCGTCGCNONE
J023057A19CGCGTCGCNONE
J023143P09CGCGTCGCNONE
J033132M21CGCGTCGCNONE
J065039D07CGCGTCGCNONE
J065062M22CGCGTCGCNONE
J065071L10CGCGTCGCNONE
J065088N13CGCGTCGCNONE
J065115D21CGCGTCGCNONE
J065187D07CGCGTCGCNONE
J075011B03CGCGTCGCNONE
J075011K23CGCGTCGCNONE
J075029J17CGCGTCGCNONE
J075038J07CGCGTCGCNONE
J075065A18CGCGTCGCNONE
J075083P05CGCGTCGCNONE
J075101G24CGCGTCGCNONE
J075127E19CGCGTCGCNONE
J075161K23CGCGTCGCNONE
J075175D23CGCGTCGCNONE
J090044M07CGCGTCGCNONE
J090065G16CGCGTCGCNONE
J090065J11CGCGTCGCNONE
J090097M02CGCGTCGCNONE
J090099D02CGCGTCGCNONE
J100056A20CGCGTCGCNONE
J100063M21CGCGTCGCNONE
Os07g0656700J065166M23GCGACGCGUncharacterized protein UPF0114 family protein.
Os07g0657100AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein.
AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein.
J075072F01CGCGACGCGACGCGNONE
J075072F01CGCGACGCGACGCGNONE
J075078C21CGCGACGCGACGCGNONE
J075078C21CGCGACGCGACGCGNONE
J075147E12CGCGACGCGACGCGNONE
J075147E12CGCGACGCGACGCGNONE
J075180N10CGCGACGCGACGCGNONE
J075180N10CGCGACGCGACGCGNONE
J075197D01CGCGACGCGACGCGNONE
J075197D01CGCGACGCGACGCGNONE
Os07g0659300AK069789CGCGACGCGConserved hypothetical protein.
Os07g0681400009-117-B11CGCACGCGTCGCGNONE
AK062850CGCACGCGTCGCGSimilar to Calcium-binding protein CAST.
J065025F13CGCACGCGTCGCGNONE
Os07g0683900004-013-C10CCGTCGGANONE
AK060899CCGTCGGANONE
J065096G16CCGTCGGANONE
J090003A20CCGTCGGANONE
J090058E17CCGTCGGANONE
J100028P13CCGTCGGANONE
J100046H21CCGTCGGANONE
J100078H20CCGTCGGANONE
Os07g0691300009-078-C12CGCGACGCGNONE
009-132-H04CGCGACGCGNONE
AK069499CGCGACGCGWound-induced WI12 family protein.
Os07g0695400015-036-B08CGCGTCGCGTCGCNONE
015-036-B08GCGTCGCGTCGCGTGCGNONE
AK100615CGCGTCGCGTCGCNONE
AK100615GCGTCGCGTCGCGTGCGNONE
AK106304CGCGTCGCGTCGCKIP1-like domain containing protein.
AK106304GCGTCGCGTCGCGTGCGKIP1-like domain containing protein.
J023108B01CGCGTCGCGTCGCNONE
J023108B01GCGTCGCGTCGCGTGCGNONE
Os08g0101100AK069900CCGTCGGATCHigh mobility group box domain containing protein.
Os08g0110300016-022-A12CGCGTCGCNONE
AK067360CGCGTCGCLongin domain containing protein.
J013102A15CGCGTCGCNONE
J065047M18CGCGTCGCNONE
J065068F21CGCGTCGCNONE
J065090H15CGCGTCGCNONE
J065096I06CGCGTCGCNONE
J065166D03CGCGTCGCNONE
J090014K09CGCGTCGCNONE
J090024I21CGCGTCGCNONE
J090079I01CGCGTCGCNONE
Os08g0119800AJ437536GCGTCGCGNONE
AK060602GCGTCGCGSimilar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)].
AK067636GCGTCGCGNONE
AK068273GCGTCGCGNONE
J100075K05GCGTCGCGNONE
Os08g0127600AK058365CGCGACGCGHeat shock protein DnaJ, N-terminal domain containing protein.
AK068373CGCGACGCGNONE
J013149L10CGCGACGCGNONE
J075027H17CGCGACGCGNONE
J075060F10CGCGACGCGNONE
Os08g0127700012-086-F03GACGCGACGCNONE
AK059350GACGCGACGCNONE
AK099242GACGCGACGCNONE
AK121348GACGCGACGCConserved hypothetical protein.
J033027J18GACGCGACGCNONE
J065012F22GACGCGACGCNONE
J065046N17GACGCGACGCNONE
J065197B02GACGCGACGCNONE
J100018P04GACGCGACGCNONE
J100052C14GACGCGACGCNONE
J100083A12GACGCGACGCNONE
Os08g0136500006-092-G03CGCGACGCNONE
AK061187CGCGACGCProtein of unknown function DUF26 domain containing protein.
J065057C18CGCGACGCNONE
Os08g0144100AK071435TCGCGCGCGCGACGCGSimilar to Avr9/Cf-9 rapidly elicited protein 31.
Os08g0163400AB005290CGCGTCGCGSigma-70 factor family protein.
AK065997CGCGTCGCGNONE
AK071725CGCGTCGCGNONE
Os08g0171000AK071278CCGTCGGATCConserved hypothetical protein.
J023113L21CCGTCGGATCNONE
Os08g0175200AK072367CGCGTCGCProtein of unknown function DUF292, eukaryotic domain containing protein.
J013149H16CGCGTCGCNONE
J023075K04CGCGTCGCNONE
J023082L15CGCGTCGCNONE
J043015G07CGCGTCGCNONE
J065052L17CGCGTCGCNONE
J065202P07CGCGTCGCNONE
J075061D17CGCGTCGCNONE
J100088P13CGCGTCGCNONE
Os08g0187700AK099689CGTCGGATCRegulation of nuclear pre-mRNA protein domain containing protein.
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2.
AK099083CGCGTCGCGCGCCCAATTNONE
Os08g0248800AB037416ATCCGACGSimilar to Aspartate carbamoyltransferase 3, chloroplast precursor (EC 2.1.3.2) (Aspartate transcarbamylase 3) (ATCase 3).
AK065010ATCCGACGNONE
J013001F02ATCCGACGNONE
Os08g0346400003-103-D08CGCGACGCGNONE
009-135-G12CGCGACGCGNONE
AK059644CGCGACGCGNONE
AK062928CGCGACGCGNONE
AK103873CGCGACGCGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1).
J033149L11CGCGACGCGNONE
J065137E08CGCGACGCGNONE
J065194M22CGCGACGCGNONE
J075083O16CGCGACGCGNONE
Os08g0379400006-112-H05CGCGTCGCNONE
AK112013CGCGTCGCNONE
J023019N13CGCGTCGCNONE
Os08g0386300AK059323CGTCGGATNONE
AK070379CGTCGGATCytochrome b5 domain containing protein.
J023054P20CGTCGGATNONE
J033089H01CGTCGGATNONE
J065013I01CGTCGGATNONE
J065212E17CGTCGGATNONE
J080317O15CGTCGGATNONE
J090018O07CGTCGGATNONE
Os08g0389733J065044M19GTGTGGGCCGGCCGTCGGATNONE
J065104D10GTGTGGGCCGGCCGTCGGATNONE
J065110F18GTGTGGGCCGGCCGTCGGATNONE
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein.
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein.
J065039C07ATCCGACGGCCCAGATNONE
J065098N11ATCCGACGGCCCAGATNONE
J065120J15ATCCGACGGCCCAGATNONE
J075076H12ATCCGACGGCCCAGATNONE
J075101N16ATCCGACGGCCCAGATNONE
J080010A07ATCCGACGGCCCAGATNONE
J080023C16ATCCGACGGCCCAGATNONE
J080027G22ATCCGACGGCCCAGATNONE
J080053D02ATCCGACGGCCCAGATNONE
J080065E17ATCCGACGGCCCAGATNONE
J080068C15ATCCGACGGCCCAGATNONE
J090061J10ATCCGACGGCCCAGATNONE
Os08g0416100AK070406CGCCACGTCGGATDEAD/DEAH box helicase, N-terminal domain containing protein.
AY644647CGCCACGTCGGATNONE
Os08g0428400AK060047GCGACGCGNONE
J033129L12GCGACGCGNONE
Os08g0430000AK120950GATCCGACGGCCGAGATConserved hypothetical protein.
Os08g0442900AK110520CGCGACGCEggshell protein family protein.
Os08g0454600AK060308CCGTCGGAConserved hypothetical protein.
J080005B13CCGTCGGANONE
J080005H16CCGTCGGANONE
J080009H19CCGTCGGANONE
J080011C20CCGTCGGANONE
J080011F11CCGTCGGANONE
J080013C22CCGTCGGANONE
J080017G13CCGTCGGANONE
J080023L01CCGTCGGANONE
J080024K05CCGTCGGANONE
J080031F01CCGTCGGANONE
J080033L05CCGTCGGANONE
J080035D18CCGTCGGANONE
J080036H15CCGTCGGANONE
J080036M23CCGTCGGANONE
J080037F16CCGTCGGANONE
J080040K05CCGTCGGANONE
J080045K06CCGTCGGANONE
J080052E15CCGTCGGANONE
J080058K08CCGTCGGANONE
J080065G10CCGTCGGANONE
J080067C13CCGTCGGANONE
J080070D10CCGTCGGANONE
J080072P07CCGTCGGANONE
J080075H14CCGTCGGANONE
J080076O13CCGTCGGANONE
J080077G03CCGTCGGANONE
J080079O22CCGTCGGANONE
J080081E04CCGTCGGANONE
J080083D04CCGTCGGANONE
J080090K23CCGTCGGANONE
J080093E16CCGTCGGANONE
J080095D23CCGTCGGANONE
Os08g0461800012-071-E12GCGACGCGNONE
AK066516GCGACGCGNONE
AK067364GCGACGCGConserved hypothetical protein.
AK098966GCGACGCGNONE
Os08g0464000AK059195CCGTCGGAActivator of Hsp90 ATPase homologue 1-like family protein.
AK102612CCGTCGGANONE
J033099D06CCGTCGGANONE
Os08g0465300AK108076ATCCGACGTGGCConserved hypothetical protein.
Os08g0465800AY428025GCGTCGCGNONE
J013029M24GCGTCGCGNONE
J013030K15GCGTCGCGNONE
J013048G12GCGTCGCGNONE
J023041H10GCGTCGCGNONE
J023065G12GCGTCGCGNONE
J023074A02GCGTCGCGNONE
J023092B20GCGTCGCGNONE
J023147A01GCGTCGCGNONE
J023150L07GCGTCGCGNONE
J043007P21GCGTCGCGNONE
J090004P19GCGTCGCGNONE
J100030K13GCGTCGCGNONE
J100060N03GCGTCGCGNONE
Os08g0471800AK105281GCGTCGCGRemorin, C-terminal region domain containing protein.
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
Os08g0481500J065054C23CGTCGGATConserved hypothetical protein.
J065218E06CGTCGGATNONE
Os08g0484700J065041E01CGCGACGCGACHomeodomain-like containing protein.
Os08g0485700AK068131GCGCGCGACGCGNONE
AK069097GCGCGCGACGCGMethyl-CpG binding domain containing protein.
J013130L03GCGCGCGACGCGNONE
Os08g0512500009-155-B08GCGACGCGNONE
AK068227GCGACGCGSimilar to Thylakoid lumen protein, chloroplast.
Os08g0512700AK060545GCGACGCGSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment).
Os08g0521800006-099-A01CGCGACGCNONE
009-031-C06CGCGACGCNONE
AK067267CGCGACGCConserved hypothetical protein.
AK104809CGCGACGCNONE
J013098C23CGCGACGCNONE
J065043L13CGCGACGCNONE
Os08g0535400004-001-H10CCGTCGGANONE
AK071527CCGTCGGAZinc finger, DHHC-type domain containing protein.
J023107B02CCGTCGGANONE
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein.
J090058N13GATCCGACGGCCCAGATNONE
Os08g0544500AK071354CGTCGGATSimilar to ARP2/3 regulatory protein subunit NAPP.
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE