
Summary of CGACG (All list)

Organism Oryza sativa
Description "CGACG element" found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene; May function as a coupling element for the G box element;
Total Entry Count 5170

Entry Sequences (5170 entries)

LocusGene modelSequenceDescription
AK103808GACGCGACGCACCGCC-type lectin domain containing protein.
Os01g0104100AK072797GCGGTGCGTCGCGTCZinc finger, RING-type domain containing protein.
Os01g0139900AK121677CGCGACGCConserved hypothetical protein.
Os01g0158100AK109233ATCCGACGGPentatricopeptide repeat containing protein.
AK109475CGCGACGCConserved hypothetical protein.
D73411CGCGACGCGACPhospholipase D alpha 1 precursor (EC (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1).
AK066179CGCGACGCGConserved hypothetical protein.
AK071130CCGTCGGATCNUC156 family protein.
Os01g0201400AK070397CGCGTCGCGRapid ALkalinization Factor family protein.
AK105932CGCACGCGACGCGACSimilar to Class III peroxidase GvPx2b (Fragment).
Os01g0211600AK060710GCGTCGCGCytochrome P450 family protein.
Os01g0223600AK110821CGCGTCGCSimilar to Pto kinase interactor 1-like protein.
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein.
Os01g0226400AK102301CGCGACGCGAAA ATPase domain containing protein.
Os01g0231500AK111599CGCGTCGCSimilar to Casein kinase I (Fragment).
Os01g0268000AK107975GTCGCGTCGCHypothetical protein.
Os01g0276300AK108165CGCGACGCSimilar to Group 3 late embryogenesis abundant protein (Fragment).
AK100107CGCGTCGCGTCMajor facilitator superfamily protein.
Os01g0295700AK070333CCCCCGCGCGTCGCSimilar to Protein phosphatase-2C.
Os01g0305900Os01g0305900CGCGTCGCGTCGCSimilar to A-type R2R3 Myb protein (Fragment).
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein.
AK063667CCGTCGGATConserved hypothetical protein.
AK061870CCGAGCCGAGCCGCGTCGCSimilar to Gda-1 protein.
Os01g0571000AK066090CGCGACGCMitochondrial substrate carrier family protein.
Os01g0571700AK120410CCGTCGGATCNucleic acid-binding, OB-fold domain containing protein.
Os01g0594900AK070921CGCGCGACGCCGCGACGCGConserved hypothetical protein.
Os01g0606900AK065697CGCGTCGCGHeat shock protein DnaJ, N-terminal domain containing protein.
Os01g0623500AK066142CGCGACGCGACAAA ATPase domain containing protein.
J090084L02CACGCCACGCCACGCGACGCGACSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein).
AK119723GCGTCGCGTCTCSimilar to NifU-like protein.
AK072283CCGATCCGACGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-).
AK105335CGCGTCGCGGlutaredoxin-like, plant II family protein.
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein.
Os01g0679400AK107970CGCGTCGCConserved hypothetical protein.
Os01g0681900AB008845GTGTGGGGACGCGACGCGNADH dependent Glutamate Synthase precursor (EC
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein.
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein.
AK105196CGCGACGCGProtein kinase-like domain containing protein.
Os01g0701900AK066793CGCGACGCGTGGSimilar to Phosphatidylinositol transfer-like protein III.
AK066793GCGTCGCGSimilar to Phosphatidylinositol transfer-like protein III.
Os01g0704100AK072215CGCGACGCGSimilar to Membrane transporter.
AK064946CGCGACGCSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116).
Os01g0723600AK109735GCGACGCGRibose-phosphate pyrophosphokinase 3 (EC (Phosphoribosyl pyrophosphate synthetase 3).
Os01g0727100AK068181CGCGTCGCGlycosyl transferase, family 8 protein.
Os01g0730900AK120751GTTGGTGGCGTCGCGTCChaperonin clpA/B family protein.
Os01g0733200AK066316CGCGACGCGACSimilar to Heat shock transcription factor 29 (Fragment).
AK064298CCGTCGGATCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os01g0748100AK071261GCGTCGCGTCHypothetical protein.
Os01g0749000AK107255GCGTCGCGProtein of unknown function DUF1264 family protein.
AK103612GTCGCGTCGCSimilar to HASP protein-like protein (Fragment).
AK067551CGCGTCGCNucleic acid-binding, OB-fold domain containing protein.
Os01g0757900AK105476CGCGCGACGCHaloacid dehalogenase/epoxide hydrolase family protein.
Os01g0760900AK107573CGCGTCGCConserved hypothetical protein.
Os01g0761100AK122112GCGACGCGTesmin/TSO1-like, CXC domain containing protein.
AK106246CCCATCCACGCGACGCGProteinase inhibitor I4, serpin family protein.
Os01g0774500AK069241GCGACGCGACGCGConserved hypothetical protein.
J065181M19GCGTCGCGConserved hypothetical protein.
AK062404CGCGTCGCGConserved hypothetical protein.
Os01g0796700AK120491CGCGTCGCGCGZinc finger, RING-type domain containing protein.
AK121582CGCGTCGCGTCConserved hypothetical protein.
Os01g0813900AK101729CGCGACGCGTCCSimilar to ZIGA1 protein (Fragment).
Os01g0817800AK073827CCGTCGGACGGACWD40-like domain containing protein.
Os01g0823600J075039G17GCGCGCGACGCConserved hypothetical protein.
Os01g0830100AK069755GATCCGACGGTGGGGGAGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein.
Os01g0833200AK121629CGCGTCGCGCGConserved hypothetical protein.
Os01g0833500AK073320CGCGTCGCSimilar to Serine carboxypeptidase II-1 precursor (EC (CP-MII.1) (Fragment).
Os01g0835500AK100241ATCCGACGGSimilar to Respiratory burst oxidase protein.
Os01g0837900AK103207TCCGACGGSimilar to Protein kinase AFC1 (EC 2.7.1.-).
AK059601CGCGACGCENTH/VHS domain containing protein.
Os01g0844800AK099801GATCCGACGGSimilar to Pumilio RBD (Fragment).
Os01g0844900AK066659TCCGACGGHomeodomain-like containing protein.
AK122126CGCGTCGCSimilar to Mannose-1-phosphate guanyltransferase (EC (ATP-mannose-1- phosphate guanylyltransferase) (GDP-mannose pyrophosphorylase) (NDP- hexose pyrophosphorylase).
Os01g0848200AK069425ATCCGACGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
Os01g0848550J065073P06CGTCGGATConserved hypothetical protein.
Os01g0849600AK108159CGCGACGCSimilar to ENOD18 protein (Fragment).
Os01g0851400J065070P10GCGTCGCGMachado-Joseph disease protein MJD family protein.
Os01g0856900AK107570GATCCGACGGlycoside hydrolase, starch-binding domain containing protein.
AK072151GCGACGCGTGCGCyclin-like F-box domain containing protein.
Os01g0867900AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein.
AK058284CGCGTCGCGSimilar to Photosystem II subunit PsbS.
AK101399CGCGACGCSimilar to Beta-galactosidase (EC
AK101399CGCGTCGCGTCGCGSimilar to Beta-galactosidase (EC
Os01g0877400AK106754ATCCGACGSimilar to Avr9 elicitor response-like protein.
AK071407CGTCGGATCSimilar to LOB domain protein 6 (ASYMMETRIC LEAVES2).
Os01g0896200AK105622GCGTCGCGCGConserved hypothetical protein.
AK068254GATCCGACGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os01g0904200AK068432CGCGTCGCGProtein kinase-like domain containing protein.
Os01g0913600AK071735CCTCGCCCCCCGCGACGCSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1).
Os01g0917100AK107234CCGTCGGATCConserved hypothetical protein.
AK073976GTCGCGTCGCSimilar to Pectin-glucuronyltransferase.
AK068780CCGTCGGAConserved hypothetical protein.
AF309383TCCGACGGSimilar to Glutathione transferase III(B) (EC
Os01g0937100AK105806CGCGTCGCSimilar to Xylanase inhibitor precursor (Xylanase inhibitor TAXI-I).
Os01g0950900AK101121CCGAGCCGCGTCGCProtein of unknown function DUF221 domain containing protein.
Os01g0962500AK073163CGCGTCGCGZinc finger, HIT-type domain containing protein.
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM.
AK065743CCGTCGGATCEndosperm lumenal binding protein.
Os02g0160900J075127G12GCGACGCGConserved hypothetical protein.
AK070041GCGACGCGSimilar to Phosphoglycerate kinase, cytosolic (EC
Os02g0170200AK107753CGTCGGATGAGACGTGConserved hypothetical protein.
AK100596CGCGTCGCSimilar to Cytochrome P450 97B3 (EC 1.14.-.-).
Os02g0179200AK111348CGCGACGCGTCGCGlutamine amidotransferase class-I domain containing protein.
Os02g0223700J013106E03ATCCGACGGConserved hypothetical protein.
AK099886GATCCGACGGSimilar to Peroxidase (EC
Os02g0302200Os02g0302200GCGACGCGConserved hypothetical protein.
AK109380CGTCGGATConserved hypothetical protein.
Os02g0462800AK110587CGCGTCGCGTCGCGTCGCGWRKY transcription factor 42 (Transcription factor WRKY02).
AK120927GTCGCGTCGCProtein phosphatase 2C-like domain containing protein.
Os02g0509600AK111075CGCGACGCConserved hypothetical protein.
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein.
Os02g0531450J065097O14CGCGTCGCHypothetical protein.
AK121139ATCCGACGGConserved hypothetical protein.
Os02g0537500AK068689CGCGACGCGSimilar to E2F homolog.
AK100187CGCACGCGACGCGACConserved hypothetical protein.
Os02g0580700AK073664CTCTCCGCGACGCGConserved hypothetical protein.
Os02g0597800AK072807CGCGACGCSteroid nuclear receptor, ligand-binding domain containing protein.
AK066104CGCGTCGCGTCLUC7 related family protein.
AK066104GATCCGACGGCCCGLUC7 related family protein.
AK101791AGCTGAGCGTCGCGSimilar to Adenosine kinase-like protein (Fragment).
Os02g0627100AK068993CGCGACGCGSimilar to Phenylalanine ammonia-lyase (EC
Os02g0631000AK068667CCGTCGGATCConserved hypothetical protein.
Os02g0633400AK073723CGCGTCGCGCGCSimilar to 61 kDa protein homolog.
Os02g0638200J065176A11GCGACGCGConserved hypothetical protein.
Os02g0640000AK120841CGCGACGCGC2 calcium/lipid-binding region, CaLB domain containing protein.
AK120841GCGACGCGGCGACGCGC2 calcium/lipid-binding region, CaLB domain containing protein.
Os02g0641800AK066504GCGACGCGSimilar to RNA helicase (Fragment).
AK073818GCGACGCGSimilar to VAP27.
AK102949GCGACGCGConserved hypothetical protein.
AY587109CGCGTCGCDehydrin family protein.
AY587109CGCGTCGCGDehydrin family protein.
AB079636CCCACGCGTCGCSimilar to HMGc1 protein.
AK109758GCGACGCGProtein of unknown function DUF295 family protein.
J075053E22GCCCACCCCGCGACGCConserved hypothetical protein.
Os02g0675000AK109532CGCGACGCConserved hypothetical protein.
Os02g0693700AK103774CGCGACGCGSimilar to P-glycoprotein ABCB5.
AK102055CGCGACGCGACSimilar to Carbamoyl phosphate synthetase small subunit (EC
Os02g0715400013-046-F07CGCGTCGCConserved hypothetical protein.
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein.
AK099178CGCGACGCGBeta-Ig-H3/fasciclin domain containing protein.
Os02g0728600AK063054GCGTCGCGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).
Os02g0752300AK072544CGCGACGCGConserved hypothetical protein.
Os02g0753800AK101787CGCGACGCGACGCGACGCSimilar to Annexin p35.
AK062958GATCCGACGGSimilar to ER6 protein (Fragment).
Os02g0762400AK103084CCGTCGGATCGGCyclin-dependent kinase inhibitor family protein.
AK103084GCGACGCGACGCGCyclin-dependent kinase inhibitor family protein.
Os02g0767700AK071237CCGTCGGAConserved hypothetical protein.
Os02g0770100AK111651CGCGTCGCGConserved hypothetical protein.
AK111651GACGCGACGCGACConserved hypothetical protein.
Os02g0775300AK111093CGCGACGCConserved hypothetical protein.
AK111093CGCGTCGCConserved hypothetical protein.
Os02g0785000AK103670ATCCGACGGlycosyl transferase, family 31 protein.
Os02g0788800AK066747CGCGACGCGAmino acid/polyamine transporter II family protein.
AK112100CGCGTCGCGTCSimilar to DEM2.
AK120644ATCCGACGGConserved hypothetical protein.
Os02g0816200AK060243GCGACGCGLipolytic enzyme, G-D-S-L family protein.
Os02g0820600AK066549GCGACGCGConserved hypothetical protein.
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein.
AK066955CCCACGCGACGCGACConserved hypothetical protein.
Os03g0124300AK069148CGCACGCGACGCGConserved hypothetical protein.
Os03g0126900AK109217GTCGCGTCGCGTCConserved hypothetical protein.
Os03g0128300AK064718GCGTCGCGCGCConserved hypothetical protein.
AK063608CGCGTCGCHypothetical protein.
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein.
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC
Os03g0143700AK066360CGCGACGCGACGCGACConserved hypothetical protein.
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein.
AK105642GTCGCGTCGCSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
Os03g0177000AK071368CGCGACGCGCN5-related N-acetyltransferase domain containing protein.
Os03g0177100AK068092ATCCGACGGTCCAGAConserved hypothetical protein.
Os03g0179400AK107046ATCCGACGSimilar to Avr9/Cf-9 induced kinase 1.
AK101031ATCCGACGProteasome subunit alpha type 6 (EC (20S proteasome alpha subunit A) (20S proteasome subunit alpha-1).
Os03g0186800AK100356CGCGTCGCModifier of rudimentary, Modr family protein.
Os03g0191200AK070228CCGTCGGAWW/Rsp5/WWP domain containing protein.
Os03g0210600AK070125CGCGTCGCGConserved hypothetical protein.
Os03g0213600AK100407CCGTCGGATCConserved hypothetical protein.
Os03g0214400AK067931GACGCGACGCSimilar to Digalactosyldiacylglycerol synthase 2.
Os03g0217900AK119980CCGTCGGATCConserved hypothetical protein.
AK062288CGCGACGCProtein of unknown function DUF1210 family protein.
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein.
Os03g0275700AK111329TCCGACGGConserved hypothetical protein.
AK109474ATCCGACGGSimilar to Heat shock protein 70.
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1.
Os03g0294200AK069285ATCCGACGSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase.
AK101597GCCACGTCGCGTCGCMalonyl CoA-acyl carrier protein transacylase family protein.
Os03g0302800AK061293GCGACGCGACGCGConserved hypothetical protein.
Os03g0312500AK106657GCGACGCGSimilar to Inhibitor of apoptosis-like protein.
AK059756GTCGCGTCGCGCalmodulin (CaM).
Os03g0320500AK108145ATCCGACGVQ domain containing protein.
AK062803CGGGTGGGGCGTCGGATCHypothetical protein.
Os03g0323200AK067323GATCCGACGCCCCACCCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor.
Os03g0330300AK060756CGCGTCGCGViral attachment protein, fibre shaft repeat containing protein.
AK070859ATCCGACGSimilar to Uroporphyrinogen decarboxylase (EC (URO-D) (UPD) (Fragment).
AK064815CGCGTCGCDormancyauxin associated family protein.
AK059599CCGTCGGATCSimilar to 60S ribosomal protein L22-2.
AK069719GCGTCGCGCCCACCTConserved hypothetical protein.
Os03g0374500Os03g0374500GCGTCGCGCCCACCTHypothetical protein.
J100029F12TCCGACGGLike-Sm ribonucleoprotein, core family protein.
Os03g0428800AK060233CCGTCGGATetratricopeptide-like helical domain containing protein.
AK059839GCGTCGCGTCGCZinc finger, C2H2-type domain containing protein.
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39.
Os03g0561249J065016H04CGCGACGCGTGGConserved hypothetical protein.
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A).
Os03g0611200AK065587CGCGTCGCAldo/keto reductase family protein.
Os03g0633800AK073044CGCGTCGCSimilar to IAA6 (Fragment).
AK073044GATCCGACGGCCCSimilar to IAA6 (Fragment).
AK103330CCGTCGGATHypothetical protein.
AK061572CGCGTCGCGGlycoside hydrolase, family 17 protein.
AK106417CGCGACGCAntihaemostatic protein domain containing protein.
Os03g0696000AK109661CGCGTCGCHarpin-induced 1 domain containing protein.
U28047CGCGACGCSimilar to Beta-glucosidase.
Os03g0709300AK100153CGCGTCGCSimilar to Chemocyanin precursor (Basic blue protein) (Plantacyanin).
Os03g0711600X88799CGCGTCGCGSimilar to DNA binding protein (Fragment).
Os03g0716200Os03g0716200GCGACGCGCACCGCACCGCConserved hypothetical protein.
Os03g0722500AK099926CCGTCGGATCGGGlycoside hydrolase, family 17 protein.
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein.
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein.
AK061252CGCGACGCConserved hypothetical protein.
Os03g0753600AK067449CCGTCGGATCChromo domain containing protein.
AK060387GATCCGACGGSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D).
AK103255GCGTCGCGSimilar to Subtilisin-like protease (Fragment).
Os03g0762400AK071181GCGACGCGSimilar to Peroxidase2 precursor (EC
Os03g0772600AK120949GAGACGCGACGCGACGCGACGCGSimilar to Lectin-like receptor kinase 7;2.
Os03g0784400AK103474GCGTCGCGTCProtein of unknown function DUF1692 domain containing protein.
Os03g0785500AK067718CGCGACGCGProtein of unknown function DUF284, transmembrane eukaryotic family protein.
AK067718CGCGTCGCProtein of unknown function DUF284, transmembrane eukaryotic family protein.
AK106487CGCGTCGCACGCCACSimilar to Glycine-rich protein 2.
Os03g0793700AK121667CGCGACGCCupin 1 domain containing protein.
Os03g0794800AK070933GCGACGCGACSimilar to XRN3.
Os03g0800400AK071430CGCGTCGCProtein of unknown function DUF1618 domain containing protein.
AK106415GCGACGCGProtein of unknown function DUF569 family protein.
AK121701CGCGACGCHistidine acid phosphatase family protein.
AK058941ATCCGACGSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3).
AK119215CGCGACGCGAlpha-expansin OsEXPA7.
AK119707CGCGACGCGConserved hypothetical protein.
Os03g0832200AK070712CGCGTCGCSimilar to Calcium-binding protein precursor (Calreticulin).
Os03g0848600AK065662ATCCGACGSimilar to NOI protein.
Os03g0855700AK070400CGCGACGCGNucleic acid-binding, OB-fold domain containing protein.
AK071444CCGTCGGASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis.
AK073668ATCCGACGGSimilar to Histone H1.
AK073668CGCGACGCSimilar to Histone H1.
Os04g0293600AK063003GCGACGCGHypothetical protein.
AK067128CCGTCGGASimilar to Nonphototropic hypocotyl protein 1 (EC (Phototropin).
Os04g0370600AK103855GCGACGCG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein.
Os04g0382100AK108218CGCGTCGCSWIB/MDM2 domain containing protein.
AK106153GATCCGACGGHeavy metal transport/detoxification protein domain containing protein.
AK063263CGCGTCGCGTCCCTCAConserved hypothetical protein.
AK068579ATCCGACGGProtein of unknown function DUF1350 family protein.
Os04g0406600AK103609CGCGACGCGPrephenate dehydratase domain containing protein.
Os04g0407900AK064758GCGTCGCGSimilar to Cytochrom P450-like protein.
AK121151CGCGCGACGCGGlycoside hydrolase, family 17 protein.
Os04g0414500AK121479CGCGTCGCGConserved hypothetical protein.
AK106337CGCGTCGCGTCConserved hypothetical protein.
AK063725CGCGCGACGCGConserved hypothetical protein.
Os04g0449100AK110929CCGTCGGATXyloglucan fucosyltransferase family protein.
Os04g0464200AK103582GCGTCGCGBetaine-aldehyde dehydrogenase (EC (BADH).
AK070483ATCCGACGGProtein of unknown function UPF0136, Transmembrane family protein.
Os04g0481100AK099817CGCGTCGCGSimilar to Seed imbibition protein (Fragment).
Os04g0484900AK122179GATCCGACGGSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis.
Os04g0494600AK110895CGCGTCGCGCGProtein of unknown function DUF642 family protein.
AK061301GCGACGCGLeucine-rich repeat, plant specific containing protein.
Os04g0529100AK107680CGCACGCGTCGCGPathogenesis-related transcriptional factor and ERF domain containing protein.
AK066705CGTCGGATCGGConserved hypothetical protein.
Os04g0542900AK068610CGACACGTCGGATCConserved hypothetical protein.
Os04g0545100AK071451GCGTCGCGEngulfment and cell motility, ELM domain containing protein.
AK062772CGCGACGCGlutathione peroxidase.
AK106001GCGACGCGCytochrome P450 family protein.
AK069178GCGACGCGExostosin-like family protein.
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein.
Os04g0576300J065199E10GATCCGACGPseudouridylate synthase TruB, N-terminal domain containing protein.
Os04g0576800AK073542CGCGACGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein.
Os04g0579200AK100603CGCGACGCZinc finger, RING-type domain containing protein.
AK063206CGCGACGCGACGCCCCACCProtein of unknown function DUF581 family protein.
AK111960GCGACGCGSimilar to P-type R2R3 Myb protein (Fragment).
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit.
AK099234CGCGTCGCGCGCSimilar to Aminomethyltransferase, mitochondrial precursor (EC (Glycine cleavage system T protein) (GCVT).
Os04g0627900AK108443ATCCGACGTranslation initiation factor SUI1 domain containing protein.
AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein.
Os04g0634800AK107772GCGACGCGConserved hypothetical protein.
AK063036CGCGTCGCCCAACCConserved hypothetical protein.
J043006J10CGCGACGCGSimilar to Microtubule-associated protein EB1.
AK121820CGCGACGCGSimilar to L-asparaginase (L-asparagine amidohydrolase).
AK119253CGCGACGCGNucleolar, Nop52 family protein.
Os04g0661200AK102842GCGACGCGProtein of unknown function DUF941 family protein.
Os04g0661300AK070723ATCCGACGGConserved hypothetical protein.
AK105321GCGACGCGSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC (Rotamase Pin1) (PPIase Pin1) (PIN1At).
AK068657CGCGTCGCHeavy metal transport/detoxification protein domain containing protein.
AK065237ATCCGACGPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein.
Os04g0669300AK071148CGCGTCGCDynamin family protein.
AK071148GCGACGCGDynamin family protein.
AK109377CCCCCGCGACGCConserved hypothetical protein.
J065167I12GCGACGCGHypothetical protein.
AK102124CGCGTCGCSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2.
AK069752CCGTCGGAProtein of unknown function DUF639 family protein.
Os04g0686700AK105746CGCGACGCKelch repeat containing protein.
AK105982CGCGTCGCConserved hypothetical protein.
Os05g0110900AK073169CCGTTGGATGCCCATCCGACGGSimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-).
Os05g0116500AK102231CGCGTCGCGConserved hypothetical protein.
Os05g0119200AK067943CGCGTCGCGConserved hypothetical protein.
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
AK121766CGCGACGCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
Os05g0129400AK102359ATCCGACGTGGCAnkyrin repeat containing protein.
Os05g0151200J065041L18ATCCGACGTspO/MBR-related protein family protein.
AK072243CGCGTCGCSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC (EC (Fragment).
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein.
AK062702CGCGACGCCCCCACEmbryo-specific 3 family protein.
AK100188ATCCGACGGSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment).
AK100188ATCCGACGGCCGAGATSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment).
AK067988GACGCGACGCSimilar to Hexokinase.
Os05g0189900AK061489ATCCGACGGVirulence factor, pectin lyase fold family protein.
AK106392GCGTCGCGZinc finger, CCCH-type domain containing protein.
AK064291CGTCGGATConserved hypothetical protein.
AK061207ACGTGTCGCGACGCCellular retinaldehyde-binding/triple function, N-terminal domain containing protein.
AK101705GCGACGCGCCCATCTConserved hypothetical protein.
AK070528CGCGACGCManganese-superoxide dismutase precursor (EC
Os05g0335800AK108393GCGACGCGTGF-beta receptor, type I/II extracellular region family protein.
AK061434CGCGACGCCCCAGCCCAAGConserved hypothetical protein.
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1.
AK100777CGCACCGCGACGCACGCCACProtein phosphatase 2C-like domain containing protein.
AK100184GAGACGCGCGACGCGSimilar to EREBP-2 protein (Fragment).
Os05g0379300AK109293CCGTCGGATConserved hypothetical protein.
AK102039CGCGTCGCSimilar to ABA induced plasma membrane protein PM 19.
AK102039CGCGTCGCGSimilar to ABA induced plasma membrane protein PM 19.
Os05g0382600AK068231CGCGACGCGAnnexin family protein.
AK070472CGCGTCGCSimilar to Phytochelatin synthetase-like protein 2.
Os05g0388500AK065313CCCCCGCGACGCGCGAGSimilar to 50S ribosomal protein L1.
AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1.
Os05g0395300AK066212CGGACGGCATCCGACGGProtein of unknown function DUF21 domain containing protein.
AK072739GATCCGACGGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC (RNA polymerase II subunit 5).
Os05g0407100AK063349CGCGTCGCGCGCFour F5 protein family protein.
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein.
Os05g0411600AK101609CGTCGGATCCGACSingle-stranded nucleic acid binding R3H domain containing protein.
AK106297TCCGACGGCGGCCCGGCCDisease resistance protein family protein.
Os05g0422900AK073629GATCCGACGConserved hypothetical protein.
Os05g0424800AK121054CTCGCGCGTCGCGTCSimilar to AER274Wp.
AK103559CGTTGGATGGGGATCCGACGGC2 calcium/lipid-binding region, CaLB domain containing protein.
Os05g0444200AK102658CGCGCGACGCSimilar to T6J4.5 protein (WIP6 protein).
Os05g0450300AK071191GACGCGACGCGConserved hypothetical protein.
Os05g0451300AK108341CGCGTCGCGConserved hypothetical protein.
Os05g0454400AK107942ATCCGACGConserved hypothetical protein.
AK068989CGCGACGCZinc finger, DHHC-type domain containing protein.
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH.
Os05g0459900AK058918CGCGACGCGSimilar to 60S ribosomal protein L36-1.
J023150E11ATCCGACGGSimilar to 70 kDa heat shock cognate protein 1.
Os05g0462400AK099608CGCGTCGCGLipin, N-terminal conserved region domain containing protein.
Os05g0478000AK111029CGCGTCGCGZinc finger, RING-type domain containing protein.
AK122090CCGTCGGATCAGGCCCCGCGTCGCSimilar to MS5-like protein (Fragment).
Os05g0508300Os05g0508300GTCGCGTCGCSimilar to Papain-like cysteine peptidase XBCP3.
Os05g0510100Os05g0510100GCGACGCGProtein of unknown function DUF567 family protein.
Os05g0512000AK102433CGCGTCGCZinc finger, RING-type domain containing protein.
AK105433CGCGTCGCCCATCGHeat shock protein 101.
Os05g0519800AK069435CGCGTCGCGTCProtein of unknown function DUF28 family protein.
AK063238CGCGTCGCVirulence factor, pectin lyase fold family protein.
Os05g0524500AK073571GCGACGCGProtein kinase-like domain containing protein.
Os05g0539400AK068572GCGACGCGGlycoside hydrolase, family 35 protein.
AK072284CGCGACGCConserved hypothetical protein.
Os05g0551700AK071216GTCGCGTCGCGtRNA isopentenyltransferase family protein.
Os05g0552300AK062179ATCCGACGGSimilar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD).
Os05g0562200AK061766GCGACGCGDrought induced 19 family protein.
AK063781CGCGACGCGProtein of unknown function DUF1645 family protein.
AK063033ATCCGACGGConserved hypothetical protein.
AK121699ATCCGACGGCCGAAASimilar to GTP-binding nuclear protein Ran1B (Fragment).
Os05g0576600AK107732GACGCGACGCGACConserved hypothetical protein.
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase.
Os05g0579600Os05g0579600CGCGACGCGACHomeodomain-like containing protein.
Os05g0591400AK120015GATCCGACGGHeat shock protein Hsp70 family protein.
AK073484ATCCGACGInitiation factor 2 family protein.
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC (PP2C) (Abscisic acid- insensitive 2).
AK064253CGCGTCGCGConserved hypothetical protein.
Os06g0130400AK065212GCGTCGCGTCSimilar to 1-aminocyclopropane-1-carboxylate synthase (EC (Fragment).
AY206864CGCGTCGCSimilar to Homeodomain leucine zipper protein (Fragment).
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase).
AK106752CGCGTCGCGProtein of unknown function DUF250 domain containing protein.
AK109685CCGAGCCGTCGGATConserved hypothetical protein.
AK060317CGCGTCGCGTCGCGTCCyclin-like F-box domain containing protein.
Os06g0179200AK101156CCGTCGGASimilar to Nodulin-like protein.
AK061876ATCCGACGG26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7).
AK061876CCGTCGGATC26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7).
AK121282CGCGTCGCGSimilar to Gb protein.
Os06g0216100Os06g0216100TCCGACGGSimilar to Oxo-phytodienoic acid reductase (12-oxophytodienoic acid reductase).
Os06g0223300AK111776GCGTCGCGTCGCGTCSimilar to TDR8 protein.
AK100258CGCGACGCGACSimilar to SERK1 (Fragment).
AK100258CGCGTCGCCTCGCCCSimilar to SERK1 (Fragment).
Os06g0247800AK102187GCCCCCACCGCGTCGCSimilar to Dynamin-like protein (Fragment).
Os06g0265000AK100247ATCCGACGGSimilar to Asparagine synthetase.
Os06g0304500AK119441GCGACGCGCRS1/YhbY domain containing protein.
Os06g0307900AK119309GCGACGCGTGGProtein of unknown function DUF1618 domain containing protein.
AK102553CCGTCGGATCGGSimilar to 65kD microtubule associated protein.
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment).
Os06g0500000J065064K10CGCGACGCGACConserved hypothetical protein.
Os06g0518100AK119810CGTCGGATCConserved hypothetical protein.
AK121387CGCGTCGCProtein of unknown function DUF500 family protein.
AK108074CCGATCCGACGTGTCCProtein of unknown function DUF862, eukaryotic domain containing protein.
AK121337CGCGACGCProtein of unknown function UPF0197 family protein.
Os06g0596300AK120303CCGTCGGATCSimilar to Acyl-ACP thioesterase (Fragment).
Os06g0597600AK120804GCGACGCGACGCGAromatic-ring hydroxylase family protein.
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog.
Os06g0621300AK068751ATCCGACGConserved hypothetical protein.
Os06g0633100AK107791GCGCGCGACGCGConserved hypothetical protein.
AK107791GTCGCGTCGCGTCGCGCCCACAAConserved hypothetical protein.
AK109442CGCGTCGCGTCGCGTCGCMannose-6-phosphate receptor, binding domain containing protein.
Os06g0660400AK111110GCGACGCGConserved hypothetical protein.
J100072F13GACGCGACGCSimilar to Ubiquitin.
Os06g0687800AK072593GCGTCGCGSimilar to Pincher (EH-domain containing 4).
AB054003GGGCCGGCTCCGACGGGlycosyl transferase, family 43 protein.
BT014685CCGTCGGATSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase).
BT014685CGCGACGCGSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase).
BT014685GCGACGCGSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase).
Os06g0696500J080303G16CGTCGGATSimilar to Xyloglycan endo-transglycosylase precursor.
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein.
AK100361CCACGCGTCGCConserved hypothetical protein.
AK071568GACGCGACGCProtein of unknown function DUF563 family protein.
Os06g0717900AK069070CGCGTCGCPeptidase A1, pepsin family protein.
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2).
Os07g0115500AK108206CCGTCGGAConserved hypothetical protein.
AK108206GATCCGACGGConserved hypothetical protein.
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II.
AK060737CGCGACGCAldo/keto reductase family protein.
Os07g0173200AK061624CCACGCGTCGCFrigida-like family protein.
Os07g0184800AK059544CCGATCCGACGGSimilar to Variant of histone H1.
AK059544CCGTCGGATSimilar to Variant of histone H1.
J100064D20GATCCGACGGSimilar to Mitosis protein dim1.
Os07g0209000AK059111CCGTCGGATCSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like.
Os07g0240300AK072205CGCGCGACGCConserved hypothetical protein.
AK069407ATCCGACGBTB domain containing protein.
Os07g0262950J033120B02CGCGCGACGCGTGGConserved hypothetical protein.
AK101796CCGTCGGATRibosomal L23 and L15e, core domain containing protein.
U57639CGCGTCGCAWPM-19-like family protein.
Os07g0456700AK100891CGCGACGCSimilar to (1,4)-beta-xylan endohydrolase (EC
Os07g0490400AK067941CGCGACGCPeptidylprolyl isomerase, FKBP-type domain containing protein.
AK065801CGCGTCGCGSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC (NAD-ME).
AK067845GCGACGCGPhospholipid/glycerol acyltransferase domain containing protein.
Os07g0541500AK111550ATCCGACGGSimilar to KI domain interacting kinase 1.
AK069170CGCGTCGCSimilar to Oxygen-evolving enhancer protein 3-2, chloroplast precursor (OEE3) (16 kDa subunit of oxygen evolving system of photosystem II) (OEC 16 kDa subunit) (Ferredoxin-NADP reductase binding protein) (BP).
AK061510CGCGACGCSimilar to Light induced protein like.
Os07g0557500AK101830ATCCGACGZinc finger, RING-type domain containing protein.
AK109399ATCCGACGTGGCSimilar to Type III chlorophyll a/b-binding protein (Fragment).
AK062834CGCGCGACGCConserved hypothetical protein.
AK067895CGCGACGCGSimilar to ZF protein (Fragment).
AK119176CGCGACGCGSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor.
AK067725GTCGCGTCGCGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein.
Os07g0592200AK099740GCGACGCGPeptidase A1, pepsin family protein.
AK105907CGCGACGCCCAACCConserved hypothetical protein.
AK064704GATCCGACGGMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7).
AK119518CCGTCGGATClathrin adaptor complex, medium chain family protein.
Os07g0633200AK061338GATCCGACGGSimilar to SC35-like splicing factor SCL30a, 30a kD.
Os07g0637100AK111132ATCCGACGGHeat shock protein DnaJ, N-terminal domain containing protein.
AF009413CGCGTCGCSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES).
Os07g0656700J065166M23GCGACGCGUncharacterized protein UPF0114 family protein.
Os07g0657100AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein.
AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein.
Os07g0659300AK069789CGCGACGCGConserved hypothetical protein.
AK062850CGCACGCGTCGCGSimilar to Calcium-binding protein CAST.
AK069499CGCGACGCGWound-induced WI12 family protein.
AK106304CGCGTCGCGTCGCKIP1-like domain containing protein.
AK106304GCGTCGCGTCGCGTGCGKIP1-like domain containing protein.
Os08g0101100AK069900CCGTCGGATCHigh mobility group box domain containing protein.
AK067360CGCGTCGCLongin domain containing protein.
AK060602GCGTCGCGSimilar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)].
Os08g0127600AK058365CGCGACGCGHeat shock protein DnaJ, N-terminal domain containing protein.
AK121348GACGCGACGCConserved hypothetical protein.
AK061187CGCGACGCProtein of unknown function DUF26 domain containing protein.
Os08g0144100AK071435TCGCGCGCGCGACGCGSimilar to Avr9/Cf-9 rapidly elicited protein 31.
Os08g0163400AB005290CGCGTCGCGSigma-70 factor family protein.
Os08g0171000AK071278CCGTCGGATCConserved hypothetical protein.
Os08g0175200AK072367CGCGTCGCProtein of unknown function DUF292, eukaryotic domain containing protein.
Os08g0187700AK099689CGTCGGATCRegulation of nuclear pre-mRNA protein domain containing protein.
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2.
Os08g0248800AB037416ATCCGACGSimilar to Aspartate carbamoyltransferase 3, chloroplast precursor (EC (Aspartate transcarbamylase 3) (ATCase 3).
AK103873CGCGACGCGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1).
AK070379CGTCGGATCytochrome b5 domain containing protein.
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein.
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein.
Os08g0416100AK070406CGCCACGTCGGATDEAD/DEAH box helicase, N-terminal domain containing protein.
Os08g0430000AK120950GATCCGACGGCCGAGATConserved hypothetical protein.
Os08g0442900AK110520CGCGACGCEggshell protein family protein.
Os08g0454600AK060308CCGTCGGAConserved hypothetical protein.
AK067364GCGACGCGConserved hypothetical protein.
Os08g0464000AK059195CCGTCGGAActivator of Hsp90 ATPase homologue 1-like family protein.
Os08g0465300AK108076ATCCGACGTGGCConserved hypothetical protein.
Os08g0471800AK105281GCGTCGCGRemorin, C-terminal region domain containing protein.
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
Os08g0481500J065054C23CGTCGGATConserved hypothetical protein.
Os08g0484700J065041E01CGCGACGCGACHomeodomain-like containing protein.
AK069097GCGCGCGACGCGMethyl-CpG binding domain containing protein.
AK068227GCGACGCGSimilar to Thylakoid lumen protein, chloroplast.
Os08g0512700AK060545GCGACGCGSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC (Fragment).
AK067267CGCGACGCConserved hypothetical protein.