version

Summary of ACGTGKC (All list)

Organism Oryza sativa
PLACE Motif ACGTGKC
Description Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;
Total Entry Count 10770

Entry Sequences (10770 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09ACGTGGCGTGNONE
015-011-E06ACGTGGCGTGNONE
016-083-H11ACGTGGCGTGNONE
AK100002ACGTGGCGTGConserved hypothetical protein.
J065063K05ACGTGGCGTGNONE
J065191H24ACGTGGCGTGNONE
J100079N16ACGTGGCGTGNONE
Os01g0103600006-072-A01GCCACGTCGGCCCATTNONE
009-148-C12GCCACGTCGGCCCATTNONE
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein.
AK102848GCCACGTCGGCCCATTNONE
J033036P20GCCACGTCGGCCCATTNONE
J065171N21GCCACGTCGGCCCATTNONE
J065209M02GCCACGTCGGCCCATTNONE
J075067A03GCCACGTCGGCCCATTNONE
J075110C09GCCACGTCGGCCCATTNONE
Os01g0104900012-050-A08GGACACGTNONE
AK121535GGACACGTTransferase family protein.
Os01g0138500AK073435CACGTGTCCProtein of unknown function DUF789 family protein.
J023118K18CACGTGTCCNONE
J033039C22CACGTGTCCNONE
Os01g0144100006-118-E08GACGTGGCGNONE
AK058909GACGTGGCGSimilar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15).
AK068113GACGTGGCGNONE
AK104051GACGTGGCGNONE
J065163E12GACGTGGCGNONE
Os01g0149800009-003-D05GCCACGTGTNONE
009-075-F04GCCACGTGTNONE
009-164-H05GCCACGTGTNONE
J013021G22GCCACGTGTNONE
J013026A08GCCACGTGTNONE
J013055B05GCCACGTGTNONE
J013064G22GCCACGTGTNONE
J013105C09GCCACGTGTNONE
J013129K15GCCACGTGTNONE
J023129B01GCCACGTGTNONE
J033036H01GCCACGTGTNONE
J033057B09GCCACGTGTNONE
J043037E20GCCACGTGTNONE
J043039C11GCCACGTGTNONE
J043039D02GCCACGTGTNONE
J043039G15GCCACGTGTNONE
J043040L16GCCACGTGTNONE
J053034B13GCCACGTGTNONE
J053061F14GCCACGTGTNONE
J053097D22GCCACGTGTNONE
J065032N05GCCACGTGTNONE
J065050F21GCCACGTGTNONE
J065052D11GCCACGTGTNONE
J065097I08GCCACGTGTNONE
J065109M12GCCACGTGTNONE
J065162C19GCCACGTGTNONE
J065162C20GCCACGTGTNONE
J065171G23GCCACGTGTNONE
J065206I03GCCACGTGTNONE
J065218O18GCCACGTGTNONE
J080020M17GCCACGTGTNONE
J080030J11GCCACGTGTNONE
J080032A22GCCACGTGTNONE
J080036E19GCCACGTGTNONE
J080037I16GCCACGTGTNONE
J080051D03GCCACGTGTNONE
J080051D05GCCACGTGTNONE
J080054K06GCCACGTGTNONE
J080076G01GCCACGTGTNONE
J080077P08GCCACGTGTNONE
J080085E13GCCACGTGTNONE
J080087A22GCCACGTGTNONE
J080310A13GCCACGTGTNONE
J090080A15GCCACGTGTNONE
J090087N14GCCACGTGTNONE
J100017E03GCCACGTGTNONE
J100024B10GCCACGTGTNONE
J100025A07GCCACGTGTNONE
J100026G16GCCACGTGTNONE
J100030A10GCCACGTGTNONE
J100030M18GCCACGTGTNONE
J100044D08GCCACGTGTNONE
J100045F20GCCACGTGTNONE
J100046L06GCCACGTGTNONE
J100050J10GCCACGTGTNONE
J100054E07GCCACGTGTNONE
J100054G22GCCACGTGTNONE
J100054L21GCCACGTGTNONE
J100058A12GCCACGTGTNONE
J100064O14GCCACGTGTNONE
J100069M10GCCACGTGTNONE
J100073C18GCCACGTGTNONE
J100077H21GCCACGTGTNONE
J100078A09GCCACGTGTNONE
J100081F01GCCACGTGTNONE
J100082H17GCCACGTGTNONE
J100090C20GCCACGTGTNONE
U43530GCCACGTGTMetallothionein-like protein type 2.
Os01g0151600AK063435GCCGGCCCGCCACGTGTConserved hypothetical protein.
J065010E12GCCGGCCCGCCACGTGTNONE
J065067D06GCCGGCCCGCCACGTGTNONE
J090043F21GCCGGCCCGCCACGTGTNONE
Os01g0155600006-048-F03GCCACGTCNONE
AK060171GCCACGTCNONE
AK071635GCCACGTCSimilar to Splicing factor RSZ33.
J023080A03GCCACGTCNONE
J023100L15GCCACGTCNONE
J033075I17GCCACGTCNONE
J033085O09GCCACGTCNONE
J033105E15GCCACGTCNONE
J033132N10GCCACGTCNONE
J033132P12GCCACGTCNONE
J033149H12GCCACGTCNONE
J043026M03GCCACGTCNONE
J080305J10GCCACGTCNONE
J080308K03GCCACGTCNONE
J090023M04GCCACGTCNONE
J090078F24GCCACGTCNONE
J100066P05GCCACGTCNONE
Os01g0155800J065061I19GACGTGGCConserved hypothetical protein.
Os01g0167100009-183-G08GCCACGTCNONE
AK063153GCCACGTCNONE
J065154C02GCCACGTCNONE
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein.
J023088B10CGCCACGTGTCCNONE
J065122H15CGCCACGTGTCCNONE
J065140B19CGCCACGTGTCCNONE
J100031E12CGCCACGTGTCCNONE
J100068J03CGCCACGTGTCCNONE
J100083E12CGCCACGTGTCCNONE
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein.
Os01g0180300AK120377ACACGTGGCGLipoprotein, type 6 family protein.
J013071N06ACACGTGGCGNONE
J023088F12ACACGTGGCGNONE
J100027H24ACACGTGGCGNONE
J100053K15ACACGTGGCGNONE
J100082M15ACACGTGGCGNONE
Os01g0187700AK101445GCCACGTGGCGConserved hypothetical protein.
J033039I17GCCACGTGGCGNONE
Os01g0198100AK119908CGACACGTGGCConserved hypothetical protein.
Os01g0206600J065041P19CACGTGTCConserved hypothetical protein.
J065041P19GCCACGTCConserved hypothetical protein.
Os01g0218700AK064992GGACACGTGTCCABC transporter, transmembrane region, type 1 domain containing protein.
Os01g0246400009-143-G05CACTGACACGTGGCNONE
009-143-G05GACGTGGCNONE
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
AK062972GACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
Os01g0254000006-037-A11GACGTGGCGNONE
006-059-H09GACGTGGCGNONE
006-088-D11GACGTGGCGNONE
006-112-B06GACGTGGCGNONE
006-120-E12GACGTGGCGNONE
AK111904GACGTGGCGNONE
AK111979GACGTGGCGNONE
AK119548GACGTGGCGNONE
AY620417GACGTGGCGSimilar to NTGB2 (Fragment).
J023112F13GACGTGGCGNONE
J053066C19GACGTGGCGNONE
J065006L12GACGTGGCGNONE
J065019L17GACGTGGCGNONE
J065081J05GACGTGGCGNONE
J065085D02GACGTGGCGNONE
J065203D03GACGTGGCGNONE
J065210O20GACGTGGCGNONE
J090062P06GACGTGGCGNONE
J090063N07GACGTGGCGNONE
J100061H24GACGTGGCGNONE
Os01g0257100J100030B03CGCCACGTCACCNONE
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein.
Os01g0258600J075028F17GCCACGTCNONE
J075061L04GCCACGTCConserved hypothetical protein.
J075071B09GCCACGTCNONE
J075093E04GCCACGTCNONE
J100033B11GCCACGTCNONE
Os01g0261500J033071B09GCCACGTCNONE
J090095O22GCCACGTCNONE
Os01g0266600AK058396CGCCACGTCNONE
AK069749CGCCACGTCRedoxin domain containing protein.
J023030N01CGCCACGTCNONE
J065065E03CGCCACGTCNONE
J075006N11CGCCACGTCNONE
J075017G04CGCCACGTCNONE
J075023L15CGCCACGTCNONE
J075126F05CGCCACGTCNONE
Os01g0270100006-096-H09CGCCACGTGTNONE
009-009-C10CGCCACGTGTNONE
009-054-E06CGCCACGTGTNONE
014-085-F09CGCCACGTGTNONE
AK073275CGCCACGTGTNONE
AK104155CGCCACGTGTNONE
AK119511CGCCACGTGTSimilar to Cysteine protease inhibitor.
J033025K21CGCCACGTGTNONE
J075065H10CGCCACGTGTNONE
J075143G10CGCCACGTGTNONE
J100059J02CGCCACGTGTNONE
Os01g0276300AK108165ACGTGTCCSimilar to Group 3 late embryogenesis abundant protein (Fragment).
Os01g0280200J065103B05GCCACGTGNONE
J065103B05GCCACGTGTNONE
J065183G15GCCACGTGConserved hypothetical protein.
J065183G15GCCACGTGTConserved hypothetical protein.
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein.
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE
009-084-B05ACAGCCCACGTGGCNONE
009-100-E07ACAGCCCACGTGGCNONE
009-133-B03ACAGCCCACGTGGCNONE
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment).
AK066266ACAGCCCACGTGGCNONE
AK102013ACAGCCCACGTGGCNONE
J065001I21ACAGCCCACGTGGCNONE
J065025D22ACAGCCCACGTGGCNONE
J065098M18ACAGCCCACGTGGCNONE
J065105O22ACAGCCCACGTGGCNONE
J065121F07ACAGCCCACGTGGCNONE
J065181F03ACAGCCCACGTGGCNONE
J075020M03ACAGCCCACGTGGCNONE
J075028O06ACAGCCCACGTGGCNONE
J075032F15ACAGCCCACGTGGCNONE
J075033H07ACAGCCCACGTGGCNONE
J075062F22ACAGCCCACGTGGCNONE
J075083P19ACAGCCCACGTGGCNONE
J075097J16ACAGCCCACGTGGCNONE
J075099A15ACAGCCCACGTGGCNONE
J075104P03ACAGCCCACGTGGCNONE
J075118K12ACAGCCCACGTGGCNONE
J075125H01ACAGCCCACGTGGCNONE
J075127K12ACAGCCCACGTGGCNONE
J075128F24ACAGCCCACGTGGCNONE
J075151P06ACAGCCCACGTGGCNONE
J075169K22ACAGCCCACGTGGCNONE
J075170K24ACAGCCCACGTGGCNONE
J075182A01ACAGCCCACGTGGCNONE
J075199H16ACAGCCCACGTGGCNONE
J080010O12ACAGCCCACGTGGCNONE
J080013A02ACAGCCCACGTGGCNONE
J080013F09ACAGCCCACGTGGCNONE
J080017C19ACAGCCCACGTGGCNONE
J080017G05ACAGCCCACGTGGCNONE
J080022L04ACAGCCCACGTGGCNONE
J080025B17ACAGCCCACGTGGCNONE
J080029A08ACAGCCCACGTGGCNONE
J080037C12ACAGCCCACGTGGCNONE
J080037L14ACAGCCCACGTGGCNONE
J080037M24ACAGCCCACGTGGCNONE
J080038M21ACAGCCCACGTGGCNONE
J080039E06ACAGCCCACGTGGCNONE
J080039I10ACAGCCCACGTGGCNONE
J080042H01ACAGCCCACGTGGCNONE
J080042L18ACAGCCCACGTGGCNONE
J080042N21ACAGCCCACGTGGCNONE
J080043E01ACAGCCCACGTGGCNONE
J080044H05ACAGCCCACGTGGCNONE
J080047H10ACAGCCCACGTGGCNONE
J080050H03ACAGCCCACGTGGCNONE
J080060N21ACAGCCCACGTGGCNONE
J080061M09ACAGCCCACGTGGCNONE
J080062D15ACAGCCCACGTGGCNONE
J080062I18ACAGCCCACGTGGCNONE
J080063G05ACAGCCCACGTGGCNONE
J080063H16ACAGCCCACGTGGCNONE
J080067G16ACAGCCCACGTGGCNONE
J080067M07ACAGCCCACGTGGCNONE
J080068M13ACAGCCCACGTGGCNONE
J080069A19ACAGCCCACGTGGCNONE
J080069G14ACAGCCCACGTGGCNONE
J080070F04ACAGCCCACGTGGCNONE
J080070K15ACAGCCCACGTGGCNONE
J080072O20ACAGCCCACGTGGCNONE
J080075L02ACAGCCCACGTGGCNONE
J080077I10ACAGCCCACGTGGCNONE
J080077P03ACAGCCCACGTGGCNONE
J080078F14ACAGCCCACGTGGCNONE
J080092H15ACAGCCCACGTGGCNONE
J080097J15ACAGCCCACGTGGCNONE
J080305C10ACAGCCCACGTGGCNONE
Os01g0303300J053035N19GCCCCCACACACGTGGCNONE
J053035N19GGACACGTNONE
J075042F02GCCCCCACACACGTGGCNONE
J075042F02GGACACGTNONE
J075068E10GCCCCCACACACGTGGCNONE
J075068E10GGACACGTNONE
J075116E19GCCCCCACACACGTGGCNONE
J075116E19GGACACGTNONE
J075131C10GCCCCCACACACGTGGCNONE
J075131C10GGACACGTNONE
J075145J11GCCCCCACACACGTGGCNONE
J075145J11GGACACGTNONE
J075157P20GCCCCCACACACGTGGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J075157P20GGACACGTMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J075164G12GCCCCCACACACGTGGCNONE
J075164G12GGACACGTNONE
Os01g0305900Os01g0305900CCCACGTGTCSimilar to A-type R2R3 Myb protein (Fragment).
Os01g0314300AK073419GCCACGTCUncharacterized domain 2 containing protein.
AK104939GCCACGTCNONE
J033044B03GCCACGTCNONE
J033060E12GCCACGTCNONE
J043037E21GCCACGTCNONE
J065019O18GCCACGTCNONE
J065025P22GCCACGTCNONE
J065042P06GCCACGTCNONE
J065074C19GCCACGTCNONE
J065074E13GCCACGTCNONE
J065094E05GCCACGTCNONE
J065108N08GCCACGTCNONE
J065134L13GCCACGTCNONE
J065152N24GCCACGTCNONE
J065162N24GCCACGTCNONE
J065170P16GCCACGTCNONE
J065177M20GCCACGTCNONE
J065187N01GCCACGTCNONE
J075012N12GCCACGTCNONE
J075046C17GCCACGTCNONE
J075055N06GCCACGTCNONE
J075141H03GCCACGTCNONE
J075150M11GCCACGTCNONE
J090005B16GCCACGTCNONE
J090079L11GCCACGTCNONE
J100039F16GCCACGTCNONE
Os01g0314800AF323612ACACGTGGCGLate embryogenesis abundant protein 3 family protein.
AF323612GCCACGTCLate embryogenesis abundant protein 3 family protein.
J043003O18ACACGTGGCGNONE
J043003O18GCCACGTCNONE
J065105K07ACACGTGGCGNONE
J065105K07GCCACGTCNONE
J065123H16ACACGTGGCGNONE
J065123H16GCCACGTCNONE
J065198K17ACACGTGGCGNONE
J065198K17GCCACGTCNONE
J100027C20ACACGTGGCGNONE
J100027C20GCCACGTCNONE
Os01g0324400AK102854GCCACGTGGGNONE
AK111299GCCACGTGGGNONE
J033032A11GCCACGTGGGNONE
J033110L02GCCACGTGGGNONE
Os01g0331900013-026-D04GCCACGTCGGATNONE
AK064784GCCACGTCGGATNONE
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein.
J013000B15GCCACGTCGGATNONE
J033090D07GCCACGTCGGATNONE
J090006L21GCCACGTCGGATNONE
Os01g0349000AK108540GCCACGTCConserved hypothetical protein.
AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein.
J065059M15GCCACGTCNONE
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE
Os01g0372100J075029A10GACGTGGCConserved hypothetical protein.
Os01g0372400AK108314CGACACGTGlutathione S-transferase, N-terminal domain containing protein.
Os01g0379400016-006-B06GCCACGTCNONE
AK064420GCCACGTCNONE
AK102388GCCACGTCNONE
AK110939GCCACGTCCyclin-like F-box domain containing protein.
J033092D18GCCACGTCNONE
J065070N09GCCACGTCNONE
J065078L01GCCACGTCNONE
J065083G15GCCACGTCNONE
Os01g0382450J065084M05GCCACGTGGCHypothetical protein.
J065084M05GCCACGTGTCCHypothetical protein.
J065155G18GCCACGTGGCNONE
J065155G18GCCACGTGTCCNONE
Os01g0390400AK067433ACGTGTCGCGACGCGNONE
AK106834ACGTGTCGCGACGCGNONE
J033069B09ACGTGTCGCGACGCGNONE
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE
Os01g0501800006-021-B07GACGTGGCNONE
006-021-B07GCCACGTCNONE
006-021-E12GACGTGGCNONE
006-021-E12GCCACGTCNONE
006-022-B08GACGTGGCNONE
006-022-B08GCCACGTCNONE
006-022-C09GACGTGGCNONE
006-022-C09GCCACGTCNONE
006-022-C12GACGTGGCNONE
006-022-C12GCCACGTCNONE
006-022-F10GACGTGGCNONE
006-022-F10GCCACGTCNONE
006-023-A09GACGTGGCNONE
006-023-A09GCCACGTCNONE
006-023-D02GACGTGGCNONE
006-023-D02GCCACGTCNONE
006-023-E06GACGTGGCNONE
006-023-E06GCCACGTCNONE
006-023-E11GACGTGGCNONE
006-023-E11GCCACGTCNONE
006-025-A01GACGTGGCNONE
006-025-A01GCCACGTCNONE
006-025-B07GACGTGGCNONE
006-025-B07GCCACGTCNONE
006-025-F04GACGTGGCNONE
006-025-F04GCCACGTCNONE
006-025-F11GACGTGGCNONE
006-025-F11GCCACGTCNONE
006-027-F05GACGTGGCNONE
006-027-F05GCCACGTCNONE
006-028-C02GACGTGGCNONE
006-028-C02GCCACGTCNONE
006-029-B01GACGTGGCNONE
006-029-B01GCCACGTCNONE
006-029-D09GACGTGGCNONE
006-029-D09GCCACGTCNONE
006-029-G02GACGTGGCNONE
006-029-G02GCCACGTCNONE
006-029-H08GACGTGGCNONE
006-029-H08GCCACGTCNONE
006-030-A02GACGTGGCNONE
006-030-A02GCCACGTCNONE
006-030-B05GACGTGGCNONE
006-030-B05GCCACGTCNONE
006-031-A01GACGTGGCNONE
006-031-A01GCCACGTCNONE
006-032-E09GACGTGGCNONE
006-032-E09GCCACGTCNONE
006-032-G10GACGTGGCNONE
006-032-G10GCCACGTCNONE
006-032-H11GACGTGGCNONE
006-032-H11GCCACGTCNONE
006-033-B08GACGTGGCNONE
006-033-B08GCCACGTCNONE
006-033-E11GACGTGGCNONE
006-033-E11GCCACGTCNONE
006-034-H01GACGTGGCNONE
006-034-H01GCCACGTCNONE
006-035-B09GACGTGGCNONE
006-035-B09GCCACGTCNONE
006-035-D08GACGTGGCNONE
006-035-D08GCCACGTCNONE
006-036-F01GACGTGGCNONE
006-036-F01GCCACGTCNONE
006-036-G01GACGTGGCNONE
006-036-G01GCCACGTCNONE
006-037-E12GACGTGGCNONE
006-037-E12GCCACGTCNONE
006-039-D07GACGTGGCNONE
006-039-D07GCCACGTCNONE
006-040-A03GACGTGGCNONE
006-040-A03GCCACGTCNONE
006-042-G11GACGTGGCNONE
006-042-G11GCCACGTCNONE
006-044-F11GACGTGGCNONE
006-044-F11GCCACGTCNONE
006-045-H04GACGTGGCNONE
006-045-H04GCCACGTCNONE
006-046-A09GACGTGGCNONE
006-046-A09GCCACGTCNONE
006-046-C12GACGTGGCNONE
006-046-C12GCCACGTCNONE
006-046-F10GACGTGGCNONE
006-046-F10GCCACGTCNONE
006-046-H08GACGTGGCNONE
006-046-H08GCCACGTCNONE
006-047-G05GACGTGGCNONE
006-047-G05GCCACGTCNONE
006-047-G06GACGTGGCNONE
006-047-G06GCCACGTCNONE
006-048-C05GACGTGGCNONE
006-048-C05GCCACGTCNONE
006-049-A07GACGTGGCNONE
006-049-A07GCCACGTCNONE
006-049-E03GACGTGGCNONE
006-049-E03GCCACGTCNONE
006-050-D08GACGTGGCNONE
006-050-D08GCCACGTCNONE
006-050-E02GACGTGGCNONE
006-050-E02GCCACGTCNONE
006-050-E07GACGTGGCNONE
006-050-E07GCCACGTCNONE
006-050-F11GACGTGGCNONE
006-050-F11GCCACGTCNONE
006-051-D04GACGTGGCNONE
006-051-D04GCCACGTCNONE
006-051-G07GACGTGGCNONE
006-051-G07GCCACGTCNONE
006-052-B06GACGTGGCNONE
006-052-B06GCCACGTCNONE
006-052-B11GACGTGGCNONE
006-052-B11GCCACGTCNONE
006-052-C06GACGTGGCNONE
006-052-C06GCCACGTCNONE
006-053-G03GACGTGGCNONE
006-053-G03GCCACGTCNONE
006-054-C01GACGTGGCNONE
006-054-C01GCCACGTCNONE
006-054-D09GACGTGGCNONE
006-054-D09GCCACGTCNONE
006-056-B11GACGTGGCNONE
006-056-B11GCCACGTCNONE
006-056-C07GACGTGGCNONE
006-056-C07GCCACGTCNONE
006-056-C12GACGTGGCNONE
006-056-C12GCCACGTCNONE
006-057-C05GACGTGGCNONE
006-057-C05GCCACGTCNONE
006-057-E08GACGTGGCNONE
006-057-E08GCCACGTCNONE
006-058-F03GACGTGGCNONE
006-058-F03GCCACGTCNONE
006-059-A03GACGTGGCNONE
006-059-A03GCCACGTCNONE
006-059-C12GACGTGGCNONE
006-059-C12GCCACGTCNONE
006-062-A06GACGTGGCNONE
006-062-A06GCCACGTCNONE
006-062-H04GACGTGGCNONE
006-062-H04GCCACGTCNONE
006-063-B08GACGTGGCNONE
006-063-B08GCCACGTCNONE
006-063-B10GACGTGGCNONE
006-063-B10GCCACGTCNONE
006-063-D11GACGTGGCNONE
006-063-D11GCCACGTCNONE
006-063-H07GACGTGGCNONE
006-063-H07GCCACGTCNONE
006-065-F08GACGTGGCNONE
006-065-F08GCCACGTCNONE
006-067-F07GACGTGGCNONE
006-067-F07GCCACGTCNONE
006-067-G04GACGTGGCNONE
006-067-G04GCCACGTCNONE
006-067-G12GACGTGGCNONE
006-067-G12GCCACGTCNONE
006-068-A12GACGTGGCNONE
006-068-A12GCCACGTCNONE
006-068-E08GACGTGGCNONE
006-068-E08GCCACGTCNONE
006-068-H01GACGTGGCNONE
006-068-H01GCCACGTCNONE
006-069-C01GACGTGGCNONE
006-069-C01GCCACGTCNONE
006-069-E08GACGTGGCNONE
006-069-E08GCCACGTCNONE
006-070-D05GACGTGGCNONE
006-070-D05GCCACGTCNONE
006-070-E10GACGTGGCNONE
006-070-E10GCCACGTCNONE
006-071-A02GACGTGGCNONE
006-071-A02GCCACGTCNONE
006-072-C01GACGTGGCNONE
006-072-C01GCCACGTCNONE
006-073-B07GACGTGGCNONE
006-073-B07GCCACGTCNONE
006-073-D02GACGTGGCNONE
006-073-D02GCCACGTCNONE
006-073-F06GACGTGGCNONE
006-073-F06GCCACGTCNONE
006-075-B10GACGTGGCNONE
006-075-B10GCCACGTCNONE
006-075-C01GACGTGGCNONE
006-075-C01GCCACGTCNONE
006-076-E10GACGTGGCNONE
006-076-E10GCCACGTCNONE
006-076-H12GACGTGGCNONE
006-076-H12GCCACGTCNONE
006-077-B10GACGTGGCNONE
006-077-B10GCCACGTCNONE
006-077-F12GACGTGGCNONE
006-077-F12GCCACGTCNONE
006-078-C04GACGTGGCNONE
006-078-C04GCCACGTCNONE
006-078-C10GACGTGGCNONE
006-078-C10GCCACGTCNONE
006-078-H11GACGTGGCNONE
006-078-H11GCCACGTCNONE
006-079-A05GACGTGGCNONE
006-079-A05GCCACGTCNONE
006-079-C01GACGTGGCNONE
006-079-C01GCCACGTCNONE
006-079-E04GACGTGGCNONE
006-079-E04GCCACGTCNONE
006-079-H06GACGTGGCNONE
006-079-H06GCCACGTCNONE
006-080-G05GACGTGGCNONE
006-080-G05GCCACGTCNONE
006-081-C07GACGTGGCNONE
006-081-C07GCCACGTCNONE
006-081-H07GACGTGGCNONE
006-081-H07GCCACGTCNONE
006-082-A09GACGTGGCNONE
006-082-A09GCCACGTCNONE
006-082-D02GACGTGGCNONE
006-082-D02GCCACGTCNONE
006-084-B11GACGTGGCNONE
006-084-B11GCCACGTCNONE
006-085-G10GACGTGGCNONE
006-085-G10GCCACGTCNONE
006-086-A05GACGTGGCNONE
006-086-A05GCCACGTCNONE
006-086-B05GACGTGGCNONE
006-086-B05GCCACGTCNONE
006-086-F09GACGTGGCNONE
006-086-F09GCCACGTCNONE
006-088-B09GACGTGGCNONE
006-088-B09GCCACGTCNONE
006-088-D02GACGTGGCNONE
006-088-D02GCCACGTCNONE
006-088-D10GACGTGGCNONE
006-088-D10GCCACGTCNONE
006-088-F05GACGTGGCNONE
006-088-F05GCCACGTCNONE
006-089-C06GACGTGGCNONE
006-089-C06GCCACGTCNONE
006-092-C07GACGTGGCNONE
006-092-C07GCCACGTCNONE
006-092-C08GACGTGGCNONE
006-092-C08GCCACGTCNONE
006-092-G09GACGTGGCNONE
006-092-G09GCCACGTCNONE
006-093-D12GACGTGGCNONE
006-093-D12GCCACGTCNONE
006-093-H10GACGTGGCNONE
006-093-H10GCCACGTCNONE
006-094-E07GACGTGGCNONE
006-094-E07GCCACGTCNONE
006-095-G01GACGTGGCNONE
006-095-G01GCCACGTCNONE
006-096-A10GACGTGGCNONE
006-096-A10GCCACGTCNONE
006-097-B06GACGTGGCNONE
006-097-B06GCCACGTCNONE
006-097-H12GACGTGGCNONE
006-097-H12GCCACGTCNONE
006-098-A08GACGTGGCNONE
006-098-A08GCCACGTCNONE
006-098-A10GACGTGGCNONE
006-098-A10GCCACGTCNONE
006-098-C10GACGTGGCNONE
006-098-C10GCCACGTCNONE
006-098-D02GACGTGGCNONE
006-098-D02GCCACGTCNONE
006-098-F10GACGTGGCNONE
006-098-F10GCCACGTCNONE
006-099-B08GACGTGGCNONE
006-099-B08GCCACGTCNONE
006-099-D02GACGTGGCNONE
006-099-D02GCCACGTCNONE
006-099-D05GACGTGGCNONE
006-099-D05GCCACGTCNONE
006-099-G10GACGTGGCNONE
006-099-G10GCCACGTCNONE
006-100-G06GACGTGGCNONE
006-100-G06GCCACGTCNONE
006-102-G09GACGTGGCNONE
006-102-G09GCCACGTCNONE
006-104-F06GACGTGGCNONE
006-104-F06GCCACGTCNONE
006-105-A12GACGTGGCNONE
006-105-A12GCCACGTCNONE
006-105-D04GACGTGGCNONE
006-105-D04GCCACGTCNONE
006-105-F05GACGTGGCNONE
006-105-F05GCCACGTCNONE
006-106-B01GACGTGGCNONE
006-106-B01GCCACGTCNONE
006-106-D05GACGTGGCNONE
006-106-D05GCCACGTCNONE
006-107-B01GACGTGGCNONE
006-107-B01GCCACGTCNONE
006-107-C02GACGTGGCNONE
006-107-C02GCCACGTCNONE
006-107-E01GACGTGGCNONE
006-107-E01GCCACGTCNONE
006-107-G03GACGTGGCNONE
006-107-G03GCCACGTCNONE
006-108-D09GACGTGGCNONE
006-108-D09GCCACGTCNONE
006-109-G01GACGTGGCNONE
006-109-G01GCCACGTCNONE
006-109-H07GACGTGGCNONE
006-109-H07GCCACGTCNONE
006-110-C04GACGTGGCNONE
006-110-C04GCCACGTCNONE
006-111-B11GACGTGGCNONE
006-111-B11GCCACGTCNONE
006-112-A02GACGTGGCNONE
006-112-A02GCCACGTCNONE
006-112-E03GACGTGGCNONE
006-112-E03GCCACGTCNONE
006-112-H04GACGTGGCNONE
006-112-H04GCCACGTCNONE
006-113-B07GACGTGGCNONE
006-113-B07GCCACGTCNONE
006-113-C08GACGTGGCNONE
006-113-C08GCCACGTCNONE
006-114-C12GACGTGGCNONE
006-114-C12GCCACGTCNONE
006-114-D06GACGTGGCNONE
006-114-D06GCCACGTCNONE
006-115-B06GACGTGGCNONE
006-115-B06GCCACGTCNONE
006-116-B01GACGTGGCNONE
006-116-B01GCCACGTCNONE
006-116-C02GACGTGGCNONE
006-116-C02GCCACGTCNONE
006-117-B05GACGTGGCNONE
006-117-B05GCCACGTCNONE
006-117-C06GACGTGGCNONE
006-117-C06GCCACGTCNONE
006-117-D10GACGTGGCNONE
006-117-D10GCCACGTCNONE
006-118-D04GACGTGGCNONE
006-118-D04GCCACGTCNONE
006-118-E12GACGTGGCNONE
006-118-E12GCCACGTCNONE
006-119-A06GACGTGGCNONE
006-119-A06GCCACGTCNONE
006-119-A09GACGTGGCNONE
006-119-A09GCCACGTCNONE
006-119-D02GACGTGGCNONE
006-119-D02GCCACGTCNONE
006-119-G07GACGTGGCNONE
006-119-G07GCCACGTCNONE
006-120-B03GACGTGGCNONE
006-120-B03GCCACGTCNONE
006-120-B07GACGTGGCNONE
006-120-B07GCCACGTCNONE
006-120-C01GACGTGGCNONE
006-120-C01GCCACGTCNONE
006-120-E04GACGTGGCNONE
006-120-E04GCCACGTCNONE
006-120-F11GACGTGGCNONE
006-120-F11GCCACGTCNONE
009-014-E11GACGTGGCNONE
009-014-E11GCCACGTCNONE
009-079-C06GACGTGGCNONE
009-079-C06GCCACGTCNONE
009-101-H06GACGTGGCNONE
009-101-H06GCCACGTCNONE
009-113-F07GACGTGGCNONE
009-113-F07GCCACGTCNONE
009-126-G04GACGTGGCNONE
009-126-G04GCCACGTCNONE
009-138-F01GACGTGGCNONE
009-138-F01GCCACGTCNONE
009-147-H02GACGTGGCNONE
009-147-H02GCCACGTCNONE
009-198-B08GACGTGGCNONE
009-198-B08GCCACGTCNONE
011-011-H03GACGTGGCNONE
011-011-H03GCCACGTCNONE
013-053-A06GACGTGGCNONE
013-053-A06GCCACGTCNONE
AK060886GACGTGGCNONE
AK060886GCCACGTCNONE
AK067715GACGTGGCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment).
AK067715GCCACGTCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment).
AK103920GACGTGGCNONE
AK103920GCCACGTCNONE
AK103937GACGTGGCNONE
AK103937GCCACGTCNONE
AK104080GACGTGGCNONE
AK104080GCCACGTCNONE
AK104649GACGTGGCNONE
AK104649GCCACGTCNONE
AK104760GACGTGGCNONE
AK104760GCCACGTCNONE
AK119163GACGTGGCNONE
AK119163GCCACGTCNONE
AK119188GACGTGGCNONE
AK119188GCCACGTCNONE
AK119515GACGTGGCNONE
AK119515GCCACGTCNONE
J013071M07GACGTGGCNONE
J013071M07GCCACGTCNONE
J013098E19GACGTGGCNONE
J013098E19GCCACGTCNONE
J013119C03GACGTGGCNONE
J013119C03GCCACGTCNONE
J013135O08GACGTGGCNONE
J013135O08GCCACGTCNONE
J023060H14GACGTGGCNONE
J023060H14GCCACGTCNONE
J023075M20GACGTGGCNONE
J023075M20GCCACGTCNONE
J023098P12GACGTGGCNONE
J023098P12GCCACGTCNONE
J053061C24GACGTGGCNONE
J053061C24GCCACGTCNONE
J053065C19GACGTGGCNONE
J053065C19GCCACGTCNONE
J053094K19GACGTGGCNONE
J053094K19GCCACGTCNONE
J075047M15GACGTGGCNONE
J075047M15GCCACGTCNONE
J075083H07GACGTGGCNONE
J075083H07GCCACGTCNONE
J075108K14GACGTGGCNONE
J075108K14GCCACGTCNONE
J075112B16GACGTGGCNONE
J075112B16GCCACGTCNONE
J075169L16GACGTGGCNONE
J075169L16GCCACGTCNONE
J075180P05GACGTGGCNONE
J075180P05GCCACGTCNONE
J075194D02GACGTGGCNONE
J075194D02GCCACGTCNONE
J080013D18GACGTGGCNONE
J080013D18GCCACGTCNONE
J080016G20GACGTGGCNONE
J080016G20GCCACGTCNONE
J080017E18GACGTGGCNONE
J080017E18GCCACGTCNONE
J080018J18GACGTGGCNONE
J080018J18GCCACGTCNONE
J080018N18GACGTGGCNONE
J080018N18GCCACGTCNONE
J080036G23GACGTGGCNONE
J080036G23GCCACGTCNONE
J080038O04GACGTGGCNONE
J080038O04GCCACGTCNONE
J080038P09GACGTGGCNONE
J080038P09GCCACGTCNONE
J080039N23GACGTGGCNONE
J080039N23GCCACGTCNONE
J080043F01GACGTGGCNONE
J080043F01GCCACGTCNONE
J080064J05GACGTGGCNONE
J080064J05GCCACGTCNONE
J080067C16GACGTGGCNONE
J080067C16GCCACGTCNONE
J080069B15GACGTGGCNONE
J080069B15GCCACGTCNONE
J080071H03GACGTGGCNONE
J080071H03GCCACGTCNONE
J080086L16GACGTGGCNONE
J080086L16GCCACGTCNONE
J080088H01GACGTGGCNONE
J080088H01GCCACGTCNONE
J080089B09GACGTGGCNONE
J080089B09GCCACGTCNONE
J080090K14GACGTGGCNONE
J080090K14GCCACGTCNONE
J080090N19GACGTGGCNONE
J080090N19GCCACGTCNONE
J080093H07GACGTGGCNONE
J080093H07GCCACGTCNONE
J080097B17GACGTGGCNONE
J080097B17GCCACGTCNONE
J080301J11GACGTGGCNONE
J080301J11GCCACGTCNONE
J080301K18GACGTGGCNONE
J080301K18GCCACGTCNONE
J080305K22GACGTGGCNONE
J080305K22GCCACGTCNONE
J090008D23GACGTGGCNONE
J090008D23GCCACGTCNONE
J090013H02GACGTGGCNONE
J090013H02GCCACGTCNONE
J090031N19GACGTGGCNONE
J090031N19GCCACGTCNONE
J090053G01GACGTGGCNONE
J090053G01GCCACGTCNONE
Os01g0511100013-100-E04GCCACGTGGCNONE
AK070914GCCACGTGGCUniversal stress protein (Usp) family protein.
J065068H19GCCACGTGGCNONE
J065186L22GCCACGTGGCNONE
J075039N04GCCACGTGGCNONE
J075040L20GCCACGTGGCNONE
J075040P08GCCACGTGGCNONE
J075094I09GCCACGTGGCNONE
J075097P08GCCACGTGGCNONE
J075115O17GCCACGTGGCNONE
J075132J24GCCACGTGGCNONE
J075148P21GCCACGTGGCNONE
J075166G18GCCACGTGGCNONE
J075172M15GCCACGTGGCNONE
J075187L14GCCACGTGGCNONE
Os01g0514300AK121086ACGTGTCCLissencephaly type-1-like homology motif domain containing protein.
Os01g0530500012-044-D12ACGTGGCGNONE
AK105280ACGTGGCGProtein of unknown function DUF295 family protein.
J065042N01ACGTGGCGNONE
Os01g0541600Os01g0541600GCCACGTGConserved hypothetical protein.
Os01g0549250J065045M13CACGTGGCConserved hypothetical protein.
Os01g0559000006-032-B11GAGACGTGGCGNONE
AK061456GAGACGTGGCGProtein of unknown function DUF1000 family protein.
Os01g0564400J013160K14GCCACGTCACNONE
J065063D15GCCACGTCACNONE
J065162D09GCCACGTCACNONE
J075006C23GCCACGTCACNONE
J075112F15GCCACGTCACNONE
Os01g0571700AK120410ACACGTGGCNucleic acid-binding, OB-fold domain containing protein.
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein.
Os01g0579000AK064700CGCCACGTConserved hypothetical protein.
J075082F24CGCCACGTNONE
J075165I24CGCCACGTNONE
J080309M20CGCCACGTNONE
Os01g0581300AK066182CGCCACGTGSimilar to Lycopene epsilon-cyclase (Fragment).
AK072015CGCCACGTGNONE
Os01g0588700AK066951CGACACGTProtein of unknown function DUF572 family protein.
AK071911CGACACGTNONE
J013059D18CGACACGTNONE
J013090C12CGACACGTNONE
J090043F17CGACACGTNONE
Os01g0612600004-008-D07GACGTGGCGNONE
009-057-C09GACGTGGCGNONE
009-130-C01GACGTGGCGNONE
AK062906GACGTGGCGNONE
AK066561GACGTGGCGProtein of unknown function DUF1644 family protein.
J013065E14GACGTGGCGNONE
J013073D14GACGTGGCGNONE
J023014A21GACGTGGCGNONE
J023073M13GACGTGGCGNONE
J023079F02GACGTGGCGNONE
J023083B16GACGTGGCGNONE
J023090G19GACGTGGCGNONE
J023095F15GACGTGGCGNONE
J023119H11GACGTGGCGNONE
J033040B01GACGTGGCGNONE
J033044F13GACGTGGCGNONE
J033081E23GACGTGGCGNONE
J033121K07GACGTGGCGNONE
J033124D11GACGTGGCGNONE
J033131N22GACGTGGCGNONE
J065179E10GACGTGGCGNONE
J090020A13GACGTGGCGNONE
J090045K17GACGTGGCGNONE
J090047M24GACGTGGCGNONE
J090064G23GACGTGGCGNONE
J090084G08GACGTGGCGNONE
J090086F18GACGTGGCGNONE
J100032D09GACGTGGCGNONE
J100037O18GACGTGGCGNONE
J100042B03GACGTGGCGNONE
J100061D06GACGTGGCGNONE
J100061I03GACGTGGCGNONE
J100063B17GACGTGGCGNONE
Os01g0613900014-018-D04GCCACGTGNONE
AK119181GCCACGTGProtein of unknown function UPF0052 and CofD family protein.
J023119M14GCCACGTGNONE
J065019A15GCCACGTGNONE
J075090J10GCCACGTGNONE
J075195H12GCCACGTGNONE
Os01g0627400015-100-E08ACGTGGCGNONE
AK074025ACGTGGCGSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment).
J033041C10ACGTGGCGNONE
J033076L02ACGTGGCGNONE
J053046G11ACGTGGCGNONE
Os01g0633400AK108988GACGTGGCTGGGCCBS domain containing protein.
Os01g0644200014-007-H12CACGTGTCGNONE
AK063634CACGTGTCGConserved hypothetical protein.
AY549310CACGTGTCGNONE
J075068F10CACGTGTCGNONE
J075082A11CACGTGTCGNONE
Os01g0644900AK106910ACGTGTCCConserved hypothetical protein.
J100038B07ACGTGTCCNONE
J100044M17ACGTGTCCNONE
Os01g0646300AY464568ACGTGTCCSimilar to RGA2 protein.
J080011P15ACGTGTCCNONE
J080017D01ACGTGTCCNONE
J080017H05ACGTGTCCNONE
J080027A16ACGTGTCCNONE
J080039F17ACGTGTCCNONE
J080063E23ACGTGTCCNONE
J080067L23ACGTGTCCNONE
J080068H01ACGTGTCCNONE
J080071F01ACGTGTCCNONE
J080076J05ACGTGTCCNONE
J080092L17ACGTGTCCNONE
Os01g0653700011-003-E09CGCCACGTGNONE
AK073990CGCCACGTGCyclin-like F-box domain containing protein.
AK120129CGCCACGTGNONE
J033036F18CGCCACGTGNONE
J033072D10CGCCACGTGNONE
J033089B18CGCCACGTGNONE
J033089J09CGCCACGTGNONE
J033136J11CGCCACGTGNONE
J065065E24CGCCACGTGNONE
J090065L03CGCCACGTGNONE
Os01g0654400Os01g0654400CGCCACGTConserved hypothetical protein.
Os01g0662600009-056-E10CGCCACGTNONE
AK062234CGCCACGTNONE
AK098887CGCCACGTNONE
AK099656CGCCACGTNONE
AK119723CGCCACGTSimilar to NifU-like protein.
J013001K01CGCCACGTNONE
J013090F20CGCCACGTNONE
J013119A14CGCCACGTNONE
J013121P12CGCCACGTNONE
J033132I15CGCCACGTNONE
J075023F22CGCCACGTNONE
J075023M13CGCCACGTNONE
J100024D10CGCCACGTNONE
J100024N01CGCCACGTNONE
J100026H09CGCCACGTNONE
J100027H07CGCCACGTNONE
J100045K07CGCCACGTNONE
J100057K18CGCCACGTNONE
J100085C22CGCCACGTNONE
Os01g0664500J075157K10GACACGTGTCCNONE
J100023K08GACACGTGTCCNONE
J100052N02GACACGTGTCCNONE
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein.
Os01g0685900AK064024CCCACGTGTCCNONE
AK102005CCCACGTGTCCSimilar to 65kD microtubule associated protein.
Os01g0698100AK100466GACACGTGTCSWAP/Surp domain containing protein.
AK106727GACACGTGTCNONE
J065021C07GACACGTGTCNONE
J065078F04GACACGTGTCNONE
J065184H18GACACGTGTCNONE
J065184L10GACACGTGTCNONE
J075073I11GACACGTGTCNONE
J075083E10GACACGTGTCNONE
J075090K24GACACGTGTCNONE
J075109B11GACACGTGTCNONE
J075123H04GACACGTGTCNONE
J075157O16GACACGTGTCNONE
J075173D06GACACGTGTCNONE
J075199A05GACACGTGTCNONE
J090029H18GACACGTGTCNONE
Os01g0698300AK100582CGCCACGTCZinc finger, BED-type predicted domain containing protein.
J023105O09CGCCACGTCNONE
J023119F15CGCCACGTCNONE
J075007N19CGCCACGTCNONE
J075010F10CGCCACGTCNONE
J075032M22CGCCACGTCNONE
J075038E01CGCCACGTCNONE
J075064J17CGCCACGTCNONE
J075109L20CGCCACGTCNONE
J075131O16CGCCACGTCNONE
J075176A17CGCCACGTCNONE
J075178N11CGCCACGTCNONE
J075181N15CGCCACGTCNONE
J090060I06CGCCACGTCNONE
J090097O21CGCCACGTCNONE
Os01g0701900AK066793GCCCACGTGGCSimilar to Phosphatidylinositol transfer-like protein III.
Os01g0705200011-075-B10CGACACGTGNONE
014-056-F05CGACACGTGNONE
014-072-F08CGACACGTGNONE
014-082-E10CGACACGTGNONE
014-085-E10CGACACGTGNONE
AK064074CGACACGTGLate embryogenesis abundant protein repeat containing protein.
AK073837CGACACGTGNONE
D26536CGACACGTGNONE
J033070H10CGACACGTGNONE
J065138A19CGACACGTGNONE
J065140A10CGACACGTGNONE
Os01g0708300AK060040GCCACGTCNONE
Os01g0718500AK111346ACACGTGGCConserved hypothetical protein.
Os01g0720700J033124M22ACGTGTCCNONE
J065006G21ACGTGTCCNONE
J065025M24ACGTGTCCNONE
J065041J02ACGTGTCCNONE
J065044B14ACGTGTCCNONE
J065061J06ACGTGTCCNONE
J065116L21ACGTGTCCNONE
J075030F18ACGTGTCCNONE
J075034K17ACGTGTCCNONE
J075063I02ACGTGTCCNONE
J075110D21ACGTGTCCSimilar to Serine acetyltransferase.
J075188L15ACGTGTCCNONE
J075197B17ACGTGTCCNONE
Os01g0727400AK065692GCCACGTCConserved hypothetical protein.
Os01g0728700AK108000GACACGTGProtein of unknown function DUF1264 family protein.
J065045G01GACACGTGNONE
J065082L05GACACGTGNONE
J065140O06GACACGTGNONE
J065180C21GACACGTGNONE
J075099B15GACACGTGNONE
J075099P12GACACGTGNONE
J075110I24GACACGTGNONE
J075178E23GACACGTGNONE
Os01g0733200AK066316GCCACACGTGGCSimilar to Heat shock transcription factor 29 (Fragment).
AY344493GCCACACGTGGCNONE
J013066G03GCCACACGTGGCNONE
J090034J08GCCACACGTGGCNONE
Os01g0734600012-079-G06CCCACGTGGCNONE
AK065450CCCACGTGGCNONE
AK103129CCCACGTGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK119562CCCACGTGGCNONE
J075086F18CCCACGTGGCNONE
J075147G07CCCACGTGGCNONE
Os01g0738400AK110661ACGTGTCGSimilar to Zn-finger transcription factor.
Os01g0738600AK073479GACACGTGENTH/VHS domain containing protein.
AK120616GACACGTGNONE
J013046M12GACACGTGNONE
J013152B11GACACGTGNONE
J023007A09GACACGTGNONE
J023007N03GACACGTGNONE
J023042A01GACACGTGNONE
J023059P06GACACGTGNONE
J023113A05GACACGTGNONE
J033044K11GACACGTGNONE
J033082E04GACACGTGNONE
J090033B13GACACGTGNONE
J090062H08GACACGTGNONE
J100086G23GACACGTGNONE
Os01g0743400AK059177CGCCACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment).
AK059177GGACACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment).
AK069114CGCCACGTNONE
AK069114GGACACGTNONE
J065070E07CGCCACGTNONE
J065070E07GGACACGTNONE
J065152G11CGCCACGTNONE
J065152G11GGACACGTNONE
Os01g0745400AK107872CCCACGTGGCSec34-like protein family protein.
AK107872GACGTGGCGSec34-like protein family protein.
AK107872GACGTGGCGSec34-like protein family protein.
Os01g0750500006-028-G02CACGTGGCGNONE
006-105-B02CACGTGGCGNONE
006-117-D04CACGTGGCGNONE
013-066-D08CACGTGGCGNONE
015-058-C06CACGTGGCGNONE
AK067516CACGTGGCGProtein of unknown function DUF814 domain containing protein.
AK104228CACGTGGCGNONE
AK104728CACGTGGCGNONE
J013056K07CACGTGGCGNONE
J013073A21CACGTGGCGNONE
J013112J21CACGTGGCGNONE
J065034L03CACGTGGCGNONE
J100026F22CACGTGGCGNONE
J100073H05CACGTGGCGNONE
J100084P09CACGTGGCGNONE
Os01g0757200AB092485GGACACGTNONE
AK060666GGACACGTNONE
AK060714GGACACGTNONE
AK099350GGACACGTNONE
AK101713GGACACGTSimilar to GA 2-oxidase 4.
Os01g0763300009-022-H12CGCCACGTNONE
009-036-F10CGCCACGTNONE
009-113-G01CGCCACGTNONE
009-184-E02CGCCACGTNONE
014-023-A04CGCCACGTNONE
AK063778CGCCACGTConserved hypothetical protein.
AK122186CGCCACGTNONE
J023086N17CGCCACGTNONE
J033150K13CGCCACGTNONE
J065001D05CGCCACGTNONE
J065042H11CGCCACGTNONE
J065049J22CGCCACGTNONE
J065077E09CGCCACGTNONE
J065171I01CGCCACGTNONE
J090044K23CGCCACGTNONE
J100063M07CGCCACGTNONE
Os01g0764800AK102809GACGTGGCSimilar to Nt-gh3 deduced protein.
Os01g0767100AK109493CACGTGTCACCCGCGCSimilar to Lysosomal Pro-X carboxypeptidase.
Os01g0767600AK070672CCCACGTGGCConserved hypothetical protein.
J013131M12CCCACGTGGCNONE
J023027B15CCCACGTGGCNONE
J023059I06CCCACGTGGCNONE
J023095L05CCCACGTGGCNONE
J033033E20CCCACGTGGCNONE
J033105F24CCCACGTGGCNONE
J033148N05CCCACGTGGCNONE
J065060H14CCCACGTGGCNONE
J090093E17CCCACGTGGCNONE
Os01g0767700AK122168CACGTGGGCACGTGGCSimilar to DEIH-box RNA/DNA helicase.
Os01g0769900AK065563GCCACGTCConserved hypothetical protein.
J013034F04GCCACGTCNONE
J023014B14GCCACGTCNONE
J023077M21GCCACGTCNONE
J023150J16GCCACGTCNONE
J090023N16GCCACGTCNONE
J090088K13GCCACGTCNONE
Os01g0770400006-112-B08GGACACGTNONE
AK061253GGACACGTNONE
AK061585GGACACGTCyclin-like F-box domain containing protein.
Os01g0787400006-097-H03CGCCACGTGTNONE
AK061223CGCCACGTGTConserved hypothetical protein.
J065011G11CGCCACGTGTNONE
J065161F18CGCCACGTGTNONE
Os01g0788400AK109763CACGTGGCSimilar to Pectinesterase (EC 3.1.1.11) (Fragment).
AK120977CACGTGGCNONE
Os01g0793900009-109-G11GGCCGTCCACGTGGCNONE
009-125-A10GGCCGTCCACGTGGCNONE
AK062811GGCCGTCCACGTGGCConserved hypothetical protein.
Os01g0800800AK108093CGACACGTConserved hypothetical protein.
Os01g0803200009-028-E02ACGTGTCGNONE
AF435976ACGTGTCGNONE
AK072206ACGTGTCGNONE
AK121632ACGTGTCGNONE
D29717ACGTGTCGNONE
J013088C04ACGTGTCGNONE
J023110F17ACGTGTCGNONE
J033029J21ACGTGTCGNONE
J033050G08ACGTGTCGNONE
J033121L08ACGTGTCGNONE
J03469ACGTGTCGNONE
J043040J18ACGTGTCGNONE
J065009B11ACGTGTCGNONE
J065037D05ACGTGTCGNONE
J065046C08ACGTGTCGNONE
J065051M08ACGTGTCGNONE
J065059H24ACGTGTCGNONE
J065060A10ACGTGTCGNONE
J065075N07ACGTGTCGNONE
J065088G17ACGTGTCGNONE
J065111I03ACGTGTCGNONE
J065122A02ACGTGTCGNONE
J065128L10ACGTGTCGNONE
J065134A09ACGTGTCGNONE
J065162H09ACGTGTCGNONE
J065178F05ACGTGTCGNONE
J065209J08ACGTGTCGNONE
J065217F08ACGTGTCGNONE
J075023A10ACGTGTCGNONE
J075023H20ACGTGTCGNONE
J075048H09ACGTGTCGNONE
J075062K16ACGTGTCGNONE
J075074F03ACGTGTCGNONE
J075080G02ACGTGTCGNONE
J075125J09ACGTGTCGNONE
J075125L15ACGTGTCGNONE
J075152L15ACGTGTCGNONE
J075173B03ACGTGTCGNONE
J075177M22ACGTGTCGNONE
J080001B16ACGTGTCGNONE
J080005K01ACGTGTCGNONE
J080005L08ACGTGTCGNONE
J080005N22ACGTGTCGNONE
J080007B02ACGTGTCGNONE
J080008E24ACGTGTCGNONE
J080008L18ACGTGTCGNONE
J080009H13ACGTGTCGNONE
J080010E21ACGTGTCGNONE
J080011D21ACGTGTCGNONE
J080011P22ACGTGTCGNONE
J080013A16ACGTGTCGNONE
J080016M01ACGTGTCGNONE
J080017A09ACGTGTCGNONE
J080020A09ACGTGTCGNONE
J080023B21ACGTGTCGNONE
J080023L04ACGTGTCGNONE
J080023M10ACGTGTCGNONE
J080028B02ACGTGTCGNONE
J080031E01ACGTGTCGNONE
J080036N13ACGTGTCGNONE
J080036N17ACGTGTCGNONE
J080037M05ACGTGTCGNONE
J080043K21ACGTGTCGNONE
J080043M11ACGTGTCGNONE
J080044I08ACGTGTCGNONE
J080044N16ACGTGTCGNONE
J080049L02ACGTGTCGNONE
J080050H04ACGTGTCGNONE
J080054G17ACGTGTCGNONE
J080054G21ACGTGTCGNONE
J080057A13ACGTGTCGNONE
J080057G02ACGTGTCGNONE
J080057G23ACGTGTCGNONE
J080061A19ACGTGTCGNONE
J080062A13ACGTGTCGNONE
J080062J22ACGTGTCGNONE
J080063G15ACGTGTCGNONE
J080066A18ACGTGTCGNONE
J080066E03ACGTGTCGNONE
J080067E10ACGTGTCGNONE
J080069L14ACGTGTCGNONE
J080071I09ACGTGTCGNONE
J080076E22ACGTGTCGNONE
J080078L03ACGTGTCGNONE
J080078L15ACGTGTCGNONE
J080081G17ACGTGTCGNONE
J080083C20ACGTGTCGNONE
J080083J03ACGTGTCGNONE
J080086C02ACGTGTCGNONE
J080088E16ACGTGTCGNONE
J080090A03ACGTGTCGNONE
J080090C14ACGTGTCGNONE
J080090F11ACGTGTCGNONE
J080093N06ACGTGTCGNONE
J080094B22ACGTGTCGNONE
J080094C11ACGTGTCGNONE
J080096E22ACGTGTCGNONE
J080096F18ACGTGTCGNONE
J080301K11ACGTGTCGNONE
J080302C22ACGTGTCGNONE
J080304K12ACGTGTCGNONE
J080317G06ACGTGTCGNONE
J080318L23ACGTGTCGNONE
J090047A06ACGTGTCGNONE
J100025M24ACGTGTCGNONE
J100026O09ACGTGTCGNONE
J100027D03ACGTGTCGNONE
J100028C19ACGTGTCGNONE
J100028D07ACGTGTCGNONE
J100031H13ACGTGTCGNONE
J100054J03ACGTGTCGNONE
J100055D24ACGTGTCGNONE
J100059L24ACGTGTCGNONE
J100062D23ACGTGTCGNONE
J100062F02ACGTGTCGNONE
J100063G22ACGTGTCGNONE
J100064A04ACGTGTCGNONE
J100064P17ACGTGTCGNONE
J100065F17ACGTGTCGNONE
J100072F05ACGTGTCGNONE
J100077D21ACGTGTCGNONE
J100081B17ACGTGTCGNONE
J100087G09ACGTGTCGNONE
J100090G01ACGTGTCGNONE
U54702ACGTGTCGNONE
Os01g0805700AK069400ACGTGTCGConserved hypothetical protein.
AK101937ACGTGTCGNONE
J033074F22ACGTGTCGNONE
J090027K02ACGTGTCGNONE
J090033G03ACGTGTCGNONE
Os01g0806400Os01g0806400GAGACGTGTCCProtein of unknown function DUF617, plant family protein.
Os01g0816700AK100654GACGTGGCGTGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase).
AK100654GGACACGTSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase).
Os01g0817700003-108-A10CACGTGGCGNONE
AK060836CACGTGGCGNONE
AK065059CACGTGGCGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I).
J013001J10CACGTGGCGNONE
J013047D19CACGTGGCGNONE
J013056K09CACGTGGCGNONE
J013068P20CACGTGGCGNONE
J013108G18CACGTGGCGNONE
J023007N01CACGTGGCGNONE
J023008A22CACGTGGCGNONE
J023010B02CACGTGGCGNONE
J023029O13CACGTGGCGNONE
J023064F21CACGTGGCGNONE
J023073E22CACGTGGCGNONE
J023143E14CACGTGGCGNONE
J033027N20CACGTGGCGNONE
J033032G14CACGTGGCGNONE
J033037E03CACGTGGCGNONE
J033057N19CACGTGGCGNONE
J033065E16CACGTGGCGNONE
J033066B19CACGTGGCGNONE
J033069G01CACGTGGCGNONE
J033071B03CACGTGGCGNONE
J033080C12CACGTGGCGNONE
J033081K19CACGTGGCGNONE
J033096B19CACGTGGCGNONE
J033101E20CACGTGGCGNONE
J033135L21CACGTGGCGNONE
J033139I07CACGTGGCGNONE
J033150A21CACGTGGCGNONE
J043036J05CACGTGGCGNONE
J043039D03CACGTGGCGNONE
J043039F19CACGTGGCGNONE
J090006K04CACGTGGCGNONE
J090017G14CACGTGGCGNONE
J090034E23CACGTGGCGNONE
J090039D07CACGTGGCGNONE
J090039I09CACGTGGCGNONE
J090044F21CACGTGGCGNONE
J090049J12CACGTGGCGNONE
J090053A19CACGTGGCGNONE
J090061E23CACGTGGCGNONE
J090079K09CACGTGGCGNONE
J090092F21CACGTGGCGNONE
J100022E04CACGTGGCGNONE
J100038I01CACGTGGCGNONE
J100066C22CACGTGGCGNONE
J100067C11CACGTGGCGNONE
J100073F07CACGTGGCGNONE
J100084I24CACGTGGCGNONE
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment).
Os01g0825800009-072-E02ACGTGTCGNONE
AK064301ACGTGTCGNONE
J033087L14ACGTGTCGNONE
Os01g0833400006-112-A07CGCCACGTNONE
AK072813CGCCACGTConserved hypothetical protein.
AK106052CGCCACGTNONE
J065195G24CGCCACGTNONE
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein.
Os01g0836400AK068741GACGTGGCGNONE
AK073540GACGTGGCGSAC3/GANP family protein.
J023019D11GACGTGGCGNONE
J023139O22GACGTGGCGNONE
J033042J20GACGTGGCGNONE
J033046M18GACGTGGCGNONE
J033124J09GACGTGGCGNONE
J090015E05GACGTGGCGNONE
J090076J09GACGTGGCGNONE
Os01g0841600006-045-E03GCCACGTGTNONE
AK059805GCCACGTGTSimilar to Triosephosphate isomerase, cytosolic (EC 5.3.1.1) (TIM) (Triose- phosphate isomerase).
AK099310GCCACGTGTNONE
AK100708GCCACGTGTNONE
AK104017GCCACGTGTNONE
AK104461GCCACGTGTNONE
J065211F22GCCACGTGTNONE
J090054P20GCCACGTGTNONE
Os01g0841800AK111196GCCACGTCRibonuclease II and R domain containing protein.
Os01g0851300AK101770GACGTGGCGTGReticulon family protein.
J033064I03GACGTGGCGTGNONE
J100058A05GACGTGGCGTGNONE
Os01g0851400J065070P10GACGTGGCGMachado-Joseph disease protein MJD family protein.
J065153F01GACGTGGCGNONE
Os01g0858900AK107493CACGTGGCGlycosyl transferase, family 29 protein.
J065097H23CACGTGGCNONE
J100070A02CACGTGGCNONE
J100072M10CACGTGGCNONE
Os01g0860700009-026-D05CCACGTGTCGNONE
009-026-D05GACGTGGCGNONE
AK062402CCACGTGTCGConserved hypothetical protein.
AK062402GACGTGGCGConserved hypothetical protein.
Os01g0865100016-066-A05GGACACGTCACNONE
AK065779GGACACGTCACNONE
AK071410GGACACGTCACSimilar to Uricase (Fragment).
J013039E23GGACACGTCACNONE
J023024I07GGACACGTCACNONE
J065160J15GGACACGTCACNONE
J090052J17GGACACGTCACNONE
Os01g0867900AK061366CACGCCACGTCProtein of unknown function DUF502 family protein.
AK061366CGACACGTGProtein of unknown function DUF502 family protein.
AK061366GCCACGTGGCGGACGGCProtein of unknown function DUF502 family protein.
Os01g0869800006-029-F03GAGACGTGGCNONE
006-067-H02GAGACGTGGCNONE
006-084-A06GAGACGTGGCNONE
AK058284GAGACGTGGCSimilar to Photosystem II subunit PsbS.
AK071827GAGACGTGGCNONE
AK104275GAGACGTGGCNONE
J013049J07GAGACGTGGCNONE
J033089F12GAGACGTGGCNONE
J090094I11GAGACGTGGCNONE
Os01g0871600AK103248GACACGTGTGF-beta receptor, type I/II extracellular region family protein.
Os01g0879200AK109033CGACACGTConserved hypothetical protein.
J065017M17CGACACGTNONE
J065044O21CGACACGTNONE
Os01g0900800009-086-C08GACGTGGCNONE
AK068254GACGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK105713GACGTGGCNONE
J053025O10GACGTGGCNONE
J065063K24GACGTGGCNONE
J065167N21GACGTGGCNONE
J100060A20GACGTGGCNONE
J100079J03GACGTGGCNONE
J100087D11GACGTGGCNONE
J100089K10GACGTGGCNONE
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE
012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-088-G05CGCCACGTGTGGGCCGCANONE
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-099-A01CGCCACGTGTGGGCCGCANONE
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-009-H07CGCCACGTGTGGGCCGCANONE
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-035-H12CGCCACGTGTGGGCCGCANONE
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
016-054-G03CGCCACGTGTGGGCCGCANONE
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1.
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1.
AK105441CGCCACGTGTGGGCCGCANONE
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033069I02CGCCACGTGTGGGCCGCANONE
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033086K01CGCCACGTGTGGGCCGCANONE
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
Os01g0913400AK099881CGCCACGTCProtein prenyltransferase domain containing protein.
Os01g0915200AK121863ACGTGTCCSimilar to Cystatin.
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
J013039J22CCCGGGCCCACGTGTCNONE
J013109E03CCCGGGCCCACGTGTCNONE
J023081J12CCCGGGCCCACGTGTCNONE
J023091E24CCCGGGCCCACGTGTCNONE
J033022A01CCCGGGCCCACGTGTCNONE
J033074C13CCCGGGCCCACGTGTCNONE
J065199E03CCCGGGCCCACGTGTCNONE
J075172O04CCCGGGCCCACGTGTCNONE
J090007G18CCCGGGCCCACGTGTCNONE
J090052B17CCCGGGCCCACGTGTCNONE
J090074H01CCCGGGCCCACGTGTCNONE
J100043J09CCCGGGCCCACGTGTCNONE
J100059J05CCCGGGCCCACGTGTCNONE
Os01g0922100AK110737ACGTGGCGConserved hypothetical protein.
Os01g0923300AK067520GCCACGTGGCCBS domain containing protein.
Os01g0930000009-174-C11GACGTGGCNONE
AK065852GACGTGGCConserved hypothetical protein.
Os01g0933600006-074-G12GCCACGTGNONE
012-065-H08GCCACGTGNONE
013-017-D11GCCACGTGNONE
013-046-C03GCCACGTGNONE
013-068-E06GCCACGTGNONE
015-084-F04GCCACGTGNONE
016-073-A05GCCACGTGNONE
AK067040GCCACGTGConserved hypothetical protein.
J013089P11GCCACGTGNONE
J013155O19GCCACGTGNONE
J023054B01GCCACGTGNONE
J033040D07GCCACGTGNONE
J053090I05GCCACGTGNONE
J065078G21GCCACGTGNONE
J075083B15GCCACGTGNONE
J090063L16GCCACGTGNONE
Os01g0950900AK101121CACGTGTCGProtein of unknown function DUF221 domain containing protein.
AK101121CGCCACGTProtein of unknown function DUF221 domain containing protein.
AK101121CGCCACGTCProtein of unknown function DUF221 domain containing protein.
J023036H24CACGTGTCGNONE
J023036H24CGCCACGTNONE
J023036H24CGCCACGTCNONE
J023084G23CACGTGTCGNONE
J023084G23CGCCACGTNONE
J023084G23CGCCACGTCNONE
J033025J04CACGTGTCGNONE
J033025J04CGCCACGTNONE
J033025J04CGCCACGTCNONE
J033139J18CACGTGTCGNONE
J033139J18CGCCACGTNONE
J033139J18CGCCACGTCNONE
J090006A09CACGTGTCGNONE
J090006A09CGCCACGTNONE
J090006A09CGCCACGTCNONE
J090036D02CACGTGTCGNONE
J090036D02CGCCACGTNONE
J090036D02CGCCACGTCNONE
Os01g0952700AK103457GCCACGTGTMetallo-dependent hydrolase, composite domain containing protein.
Os01g0956200006-108-G08CACGTGTCACTNONE
AK068399CACGTGTCACTProtein of unknown function DUF563 family protein.
AK106051CACGTGTCACTNONE
J013149N20CACGTGTCACTNONE
J023085G19CACGTGTCACTNONE
J033070C20CACGTGTCACTNONE
J065080C11CACGTGTCACTNONE
J090038M06CACGTGTCACTNONE
J100038I20CACGTGTCACTNONE
J100039D17CACGTGTCACTNONE
Os01g0957600AK059235CGACACGTGSimilar to Elicitor-inducible cytochrome P450.
Os01g0965500J075073G20CGCCACGTCNuclear protein SET domain containing protein.
Os01g0966200009-079-H11ACGTGGCGNONE
009-124-G10ACGTGGCGNONE
AK058564ACGTGGCGProtein of unknown function YGGT family protein.
AK098935ACGTGGCGNONE
Os01g0967800012-074-C04CGCCACGTNONE
012-100-F12CGCCACGTNONE
015-061-F12CGCCACGTNONE
AK064854CGCCACGTConserved hypothetical protein.
J013000H07CGCCACGTNONE
J013050A03CGCCACGTNONE
J013063M22CGCCACGTNONE
J013070I04CGCCACGTNONE
J013075C08CGCCACGTNONE
J013104B08CGCCACGTNONE
J013122F05CGCCACGTNONE
J013151F19CGCCACGTNONE
J023093A07CGCCACGTNONE
J023097E21CGCCACGTNONE
J023108P06CGCCACGTNONE
J023138O04CGCCACGTNONE
J033025A05CGCCACGTNONE
J033060A07CGCCACGTNONE
J033060M15CGCCACGTNONE
J033087J19CGCCACGTNONE
J033094F16CGCCACGTNONE
J043009J11CGCCACGTNONE
J043040A12CGCCACGTNONE
J090002D12CGCCACGTNONE
J090024D15CGCCACGTNONE
J090067C12CGCCACGTNONE
J090079G19CGCCACGTNONE
J090090N17CGCCACGTNONE
Os01g0970400AK069207GCCACGTCEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit).
AK099169GCCACGTCNONE
J023009L14GCCACGTCNONE
J075025G03GCCACGTCNONE
J075198E21GCCACGTCNONE
J090004B14GCCACGTCNONE
J090071P11GCCACGTCNONE
J100075A22GCCACGTCNONE
U34597GCCACGTCNONE
Os01g0978100005-013-E01GACGTGGCNONE
011-026-E02GACGTGGCNONE
011-064-C01GACGTGGCNONE
AK065007GACGTGGCNONE
AK065652GACGTGGCSimilar to Cysteine synthase, mitochondrial precursor (EC 2.5.1.47) (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C).
AK099217GACGTGGCNONE
AK104704GACGTGGCNONE
J013001E19GACGTGGCNONE
J013034J22GACGTGGCNONE
J013037A05GACGTGGCNONE
J013038D12GACGTGGCNONE
J013043A14GACGTGGCNONE
J013044E11GACGTGGCNONE
J013058F11GACGTGGCNONE
J013059C10GACGTGGCNONE
J013059E23GACGTGGCNONE
J013071O13GACGTGGCNONE
J013072D12GACGTGGCNONE
J013096G01GACGTGGCNONE
J013110E17GACGTGGCNONE
J013130A19GACGTGGCNONE
J013158G08GACGTGGCNONE
J023037H20GACGTGGCNONE
J023038G11GACGTGGCNONE
J023042A17GACGTGGCNONE
J023045C21GACGTGGCNONE
J023052H13GACGTGGCNONE
J023055O19GACGTGGCNONE
J023065I12GACGTGGCNONE
J023087I12GACGTGGCNONE
J023114D12GACGTGGCNONE
J023126P03GACGTGGCNONE
J023132E20GACGTGGCNONE
J023133N04GACGTGGCNONE
J023134C14GACGTGGCNONE
J033039O20GACGTGGCNONE
J033067L02GACGTGGCNONE
J033094O10GACGTGGCNONE
J043017P11GACGTGGCNONE
J043036C15GACGTGGCNONE
J053090I03GACGTGGCNONE
J065013F14GACGTGGCNONE
J065019J10GACGTGGCNONE
J065036E05GACGTGGCNONE
J065040L23GACGTGGCNONE
J065050A13GACGTGGCNONE
J065089D03GACGTGGCNONE
J065193N04GACGTGGCNONE
J080011O20GACGTGGCNONE
J080015K08GACGTGGCNONE
J080022G05GACGTGGCNONE
J080027N24GACGTGGCNONE
J080032G19GACGTGGCNONE
J080046A18GACGTGGCNONE
J080046B08GACGTGGCNONE
J080051L24GACGTGGCNONE
J080053C23GACGTGGCNONE
J080054I20GACGTGGCNONE
J080074J03GACGTGGCNONE
J080080M04GACGTGGCNONE
J080080P15GACGTGGCNONE
J080086L08GACGTGGCNONE
J090019O07GACGTGGCNONE
J090033L11GACGTGGCNONE
J090036M14GACGTGGCNONE
J100054D04GACGTGGCNONE
J100064M06GACGTGGCNONE
Os02g0103800006-046-H11GCCACGTCNONE
006-060-B05GCCACGTCNONE
006-097-A09GCCACGTCNONE
006-102-A10GCCACGTCNONE
006-104-E11GCCACGTCNONE
006-112-D09GCCACGTCNONE
AK061774GCCACGTCNONE
AK065309GCCACGTCNONE
AK106213GCCACGTCSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
J013002O13GCCACGTCNONE
J013026F06GCCACGTCNONE
J013037O14GCCACGTCNONE
J013066N06GCCACGTCNONE
J013108G22GCCACGTCNONE
J023050M15GCCACGTCNONE
J023054B21GCCACGTCNONE
J023073C23GCCACGTCNONE
J023086H17GCCACGTCNONE
J023105A20GCCACGTCNONE
J065019E16GCCACGTCNONE
J065064G10GCCACGTCNONE
J065071C18GCCACGTCNONE
J065103B02GCCACGTCNONE
J065153G06GCCACGTCNONE
J075152G24GCCACGTCNONE
J075166P04GCCACGTCNONE
J080001F02GCCACGTCNONE
J080001M07GCCACGTCNONE
J080001O05GCCACGTCNONE
J080003I19GCCACGTCNONE
J080004C12GCCACGTCNONE
J080008E17GCCACGTCNONE
J080008M08GCCACGTCNONE
J080010H21GCCACGTCNONE
J080011F22GCCACGTCNONE
J080012C16GCCACGTCNONE
J080013D20GCCACGTCNONE
J080018K15GCCACGTCNONE
J080020O14GCCACGTCNONE
J080020P21GCCACGTCNONE
J080021A07GCCACGTCNONE
J080021B06GCCACGTCNONE
J080022G21GCCACGTCNONE
J080022P14GCCACGTCNONE
J080023H24GCCACGTCNONE
J080023M08GCCACGTCNONE
J080027E08GCCACGTCNONE
J080027E18GCCACGTCNONE
J080027O16GCCACGTCNONE
J080029M22GCCACGTCNONE
J080034A17GCCACGTCNONE
J080038G04GCCACGTCNONE
J080040F13GCCACGTCNONE
J080040F22GCCACGTCNONE
J080041L15GCCACGTCNONE
J080042L04GCCACGTCNONE
J080042M14GCCACGTCNONE
J080043C22GCCACGTCNONE
J080043O09GCCACGTCNONE
J080045N17GCCACGTCNONE
J080046N08GCCACGTCNONE
J080047K11GCCACGTCNONE
J080047O06GCCACGTCNONE
J080048H10GCCACGTCNONE
J080048N03GCCACGTCNONE
J080050N02GCCACGTCNONE
J080051A05GCCACGTCNONE
J080052I20GCCACGTCNONE
J080053E08GCCACGTCNONE
J080055P05GCCACGTCNONE
J080056F15GCCACGTCNONE
J080056H07GCCACGTCNONE
J080057M20GCCACGTCNONE
J080059K09GCCACGTCNONE
J080059M10GCCACGTCNONE
J080060B12GCCACGTCNONE
J080061N09GCCACGTCNONE
J080062H11GCCACGTCNONE
J080062M13GCCACGTCNONE
J080063D14GCCACGTCNONE
J080063G10GCCACGTCNONE
J080063H18GCCACGTCNONE
J080066J23GCCACGTCNONE
J080067J06GCCACGTCNONE
J080069I11GCCACGTCNONE
J080069O22GCCACGTCNONE
J080070P11GCCACGTCNONE
J080072D06GCCACGTCNONE
J080072J22GCCACGTCNONE
J080075A20GCCACGTCNONE
J080076F11GCCACGTCNONE
J080076J24GCCACGTCNONE
J080076K05GCCACGTCNONE
J080077O10GCCACGTCNONE
J080078L19GCCACGTCNONE
J080080I08GCCACGTCNONE
J080081J23GCCACGTCNONE
J080083A17GCCACGTCNONE
J080085C05GCCACGTCNONE
J080086G24GCCACGTCNONE
J080087H02GCCACGTCNONE
J080089A13GCCACGTCNONE
J080090K08GCCACGTCNONE
J080092M01GCCACGTCNONE
J080095A19GCCACGTCNONE
J080095B20GCCACGTCNONE
J100028F13GCCACGTCNONE
J100040G22GCCACGTCNONE
Os02g0105500AK063929ACACGTGGCNONE
AK102953ACACGTGGCIQ calmodulin-binding region domain containing protein.
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase.
Os02g0115900AF006825CCACGTGTCGNONE
AK065743CCACGTGTCGEndosperm lumenal binding protein.
AK119653CCACGTGTCGNONE
Os02g0118400012-047-C10GCCACGTCNONE
AK064002GCCACGTCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75).
AK101004GCCACGTCNONE
J065022L23GCCACGTCNONE
J065087F24GCCACGTCNONE
Os02g0119400AK060055TTGGCCCACGTGTCCNONE
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52).
J033107H09TTGGCCCACGTGTCCNONE
J075175F09TTGGCCCACGTGTCCNONE
J090011H05TTGGCCCACGTGTCCNONE
J090091O05TTGGCCCACGTGTCCNONE
Os02g0120300006-078-G12GACACGTGNONE
AK066100GACACGTGConserved hypothetical protein.
J013059H10GACACGTGNONE
Os02g0123100011-014-B01CGACACGTNONE
011-014-B01GACGTGGCNONE
012-013-G11CGACACGTNONE
012-013-G11GACGTGGCNONE
016-011-A12CGACACGTNONE
016-011-A12GACGTGGCNONE
AK063438CGACACGTNONE
AK063438GACGTGGCNONE
AK064363CGACACGTNONE
AK064363GACGTGGCNONE
AK101344CGACACGTSimilar to Cell division control protein 28 (EC 2.7.1.37).
AK101344GACGTGGCSimilar to Cell division control protein 28 (EC 2.7.1.37).
X60375CGACACGTNONE
X60375GACGTGGCNONE
Os02g0127900AK102783GGTGACGTGGCHypothetical protein.
J065042F15GGTGACGTGGCNONE
J075005J10GGTGACGTGGCNONE
J075038F02GGTGACGTGGCNONE
J075048K10GGTGACGTGGCNONE
J075064D21GGTGACGTGGCNONE
J075074M07GGTGACGTGGCNONE
J075078D20GGTGACGTGGCNONE
J075109P15GGTGACGTGGCNONE
J075115K24GGTGACGTGGCNONE
J075135G01GGTGACGTGGCNONE
J075156B07GGTGACGTGGCNONE
Os02g0135600AK069843GACACGTGGGGConserved hypothetical protein.
AK069843GACACGTGGGGGConserved hypothetical protein.
J023034H09GACACGTGGGGNONE
J023034H09GACACGTGGGGGNONE
J033090D08GACACGTGGGGNONE
J033090D08GACACGTGGGGGNONE
J100025N07GACACGTGGGGNONE
J100025N07GACACGTGGGGGNONE
J100075G18GACACGTGGGGNONE
J100075G18GACACGTGGGGGNONE
Os02g0135700AK100570CCCCACGTGTCDNA polymerase V family protein.
AK100570CCCCCACGTGTCDNA polymerase V family protein.
Os02g0135800006-039-F03GCCACGTCNONE
AB055156GCCACGTCSimilar to Sec13-like protein (Fragment).
AK111732GCCACGTCNONE
AK112028GCCACGTCNONE
J023038B14GCCACGTCNONE
J023039H16GCCACGTCNONE
J033033L03GCCACGTCNONE
J033082B07GCCACGTCNONE
J065076M03GCCACGTCNONE
J065159C05GCCACGTCNONE
J075052L24GCCACGTCNONE
J075087J09GCCACGTCNONE
J075119I03GCCACGTCNONE
J075124I20GCCACGTCNONE
J100042B01GCCACGTCNONE
J100067M10GCCACGTCNONE
Os02g0139100009-069-E01GCCACGTCNONE
AK065722GCCACGTCConserved hypothetical protein.
J033139D09GCCACGTCNONE
Os02g0148500AK068931GACACGTGSimilar to TIMING OF CAB 1 (Fragment).
Os02g0148600AK059287GACACGTGTGGCConserved hypothetical protein.
Os02g0158900AK108324CGCCACGTCSimilar to SNF4.
Os02g0165500AK060547GACGTGGCGConserved hypothetical protein.
Os02g0169000AK101628GCCACGTCConserved hypothetical protein.
Os02g0169900AK070107CGACACGTInositol monophosphatase family protein.
AK099345CGACACGTNONE
AK103039CGACACGTNONE
AK105887CGACACGTNONE
Os02g0173100AK066680GGACACGTNONE
AK100596GGACACGTSimilar to Cytochrome P450 97B3 (EC 1.14.-.-).
J023106P10GGACACGTNONE
Os02g0176300AK066588GGACACGTGTCConserved hypothetical protein.
J013072N24GGACACGTGTCNONE
Os02g0177700AK119941CGCCACGTProtein of unknown function DUF588 family protein.
Os02g0180100005-013-B11GCCACGTCNONE
AK067359GCCACGTCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein.
AK104700GCCACGTCNONE
J013090O22GCCACGTCNONE
J013099P19GCCACGTCNONE
J090041M21GCCACGTCNONE
J090049C14GCCACGTCNONE
Os02g0186500AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein.
AK099031CGCCACGTGTCCGACCCGCNONE
J013111A12CGCCACGTGTCCGACCCGCNONE
J013127K13CGCCACGTGTCCGACCCGCNONE
J013132O11CGCCACGTGTCCGACCCGCNONE
J023056A11CGCCACGTGTCCGACCCGCNONE
J023078M08CGCCACGTGTCCGACCCGCNONE
J033081F07CGCCACGTGTCCGACCCGCNONE
J090079E24CGCCACGTGTCCGACCCGCNONE
J090097I02CGCCACGTGTCCGACCCGCNONE
Os02g0188000011-003-E06CGCCACGTCNONE
AK105236CGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein.
Os02g0192900AK108910CGACACGTProtein kinase-like domain containing protein.
J065121E05CGACACGTNONE
Os02g0193500009-092-G09GACACGTGNONE
AK101237GACACGTGHypothetical protein.
J033031K13GACACGTGNONE
J033034P12GACACGTGNONE
J080304L19GACACGTGNONE
J100059N21GACACGTGNONE
Os02g0197600003-113-H08GCCACGTGGCNONE
003-129-H06GCCACGTGGCNONE
006-021-H09GCCACGTGGCNONE
006-022-B05GCCACGTGGCNONE
006-022-G12GCCACGTGGCNONE
006-023-A02GCCACGTGGCNONE
006-023-C02GCCACGTGGCNONE
006-023-G09GCCACGTGGCNONE
006-024-D12GCCACGTGGCNONE
006-025-C09GCCACGTGGCNONE
006-025-E01GCCACGTGGCNONE
006-026-A11GCCACGTGGCNONE
006-026-A12GCCACGTGGCNONE
006-028-E11GCCACGTGGCNONE
006-028-G03GCCACGTGGCNONE
006-029-A09GCCACGTGGCNONE
006-029-A12GCCACGTGGCNONE
006-029-D01GCCACGTGGCNONE
006-029-F12GCCACGTGGCNONE
006-029-G12GCCACGTGGCNONE
006-030-A08GCCACGTGGCNONE
006-030-C09GCCACGTGGCNONE
006-030-G06GCCACGTGGCNONE
006-031-D06GCCACGTGGCNONE
006-032-C01GCCACGTGGCNONE
006-034-B07GCCACGTGGCNONE
006-035-G01GCCACGTGGCNONE
006-036-H12GCCACGTGGCNONE
006-040-C01GCCACGTGGCNONE
006-041-G12GCCACGTGGCNONE
006-041-H02GCCACGTGGCNONE
006-041-H11GCCACGTGGCNONE
006-042-B01GCCACGTGGCNONE
006-042-F10GCCACGTGGCNONE
006-043-C04GCCACGTGGCNONE
006-044-D10GCCACGTGGCNONE
006-048-D11GCCACGTGGCNONE
006-049-D07GCCACGTGGCNONE
006-050-H05GCCACGTGGCNONE
006-051-D10GCCACGTGGCNONE
006-051-E05GCCACGTGGCNONE
006-053-C07GCCACGTGGCNONE
006-054-B10GCCACGTGGCNONE
006-054-C12GCCACGTGGCNONE
006-054-G08GCCACGTGGCNONE
006-055-D12GCCACGTGGCNONE
006-056-C04GCCACGTGGCNONE
006-056-H06GCCACGTGGCNONE
006-057-E07GCCACGTGGCNONE
006-058-C12GCCACGTGGCNONE
006-059-B06GCCACGTGGCNONE
006-059-B09GCCACGTGGCNONE
006-059-D05GCCACGTGGCNONE
006-060-D07GCCACGTGGCNONE
006-061-D01GCCACGTGGCNONE
006-061-G09GCCACGTGGCNONE
006-062-A12GCCACGTGGCNONE
006-062-D04GCCACGTGGCNONE
006-062-G01GCCACGTGGCNONE
006-063-C10GCCACGTGGCNONE
006-064-A10GCCACGTGGCNONE
006-067-E04GCCACGTGGCNONE
006-067-H11GCCACGTGGCNONE
006-069-G08GCCACGTGGCNONE
006-071-G06GCCACGTGGCNONE
006-073-E06GCCACGTGGCNONE
006-074-B12GCCACGTGGCNONE
006-074-F06GCCACGTGGCNONE
006-074-H01GCCACGTGGCNONE
006-076-D12GCCACGTGGCNONE
006-077-C08GCCACGTGGCNONE
006-083-H01GCCACGTGGCNONE
006-083-H09GCCACGTGGCNONE
006-084-C02GCCACGTGGCNONE
006-086-D05GCCACGTGGCNONE
006-086-E09GCCACGTGGCNONE
006-087-D04GCCACGTGGCNONE
006-087-E12GCCACGTGGCNONE
006-088-A01GCCACGTGGCNONE
006-088-H09GCCACGTGGCNONE
006-089-G01GCCACGTGGCNONE
006-090-G01GCCACGTGGCNONE
006-092-H10GCCACGTGGCNONE
006-096-G12GCCACGTGGCNONE
006-097-C04GCCACGTGGCNONE
006-098-B06GCCACGTGGCNONE
006-099-A02GCCACGTGGCNONE
006-099-B05GCCACGTGGCNONE
006-100-F02GCCACGTGGCNONE
006-100-F07GCCACGTGGCNONE
006-104-A01GCCACGTGGCNONE
006-107-F06GCCACGTGGCNONE
006-109-A05GCCACGTGGCNONE
006-110-G03GCCACGTGGCNONE
006-111-A06GCCACGTGGCNONE
006-111-C12GCCACGTGGCNONE
006-112-B03GCCACGTGGCNONE
006-113-A02GCCACGTGGCNONE
006-113-H06GCCACGTGGCNONE
006-115-D11GCCACGTGGCNONE
006-116-F11GCCACGTGGCNONE
006-117-A10GCCACGTGGCNONE
006-117-C01GCCACGTGGCNONE
006-117-D08GCCACGTGGCNONE
006-118-B12GCCACGTGGCNONE
006-118-D08GCCACGTGGCNONE
006-118-E11GCCACGTGGCNONE
006-118-H08GCCACGTGGCNONE
006-119-C10GCCACGTGGCNONE
006-120-H11GCCACGTGGCNONE
009-025-G09GCCACGTGGCNONE
009-061-H06GCCACGTGGCNONE
009-070-E02GCCACGTGGCNONE
009-077-A07GCCACGTGGCNONE
009-114-A07GCCACGTGGCNONE
009-115-G02GCCACGTGGCNONE
009-123-C06GCCACGTGGCNONE
009-125-H03GCCACGTGGCNONE
009-127-H11GCCACGTGGCNONE
009-136-G03GCCACGTGGCNONE
009-154-B05GCCACGTGGCNONE
009-162-B02GCCACGTGGCNONE
009-176-D09GCCACGTGGCNONE
009-178-F10GCCACGTGGCNONE
009-190-F05GCCACGTGGCNONE
009-200-C08GCCACGTGGCNONE
011-064-H10GCCACGTGGCNONE
AK060143GCCACGTGGCNONE
AK060970GCCACGTGGCNONE
AK068102GCCACGTGGCSimilar to PSI type III chlorophyll a/b-binding protein.
AK104096GCCACGTGGCNONE
AK104215GCCACGTGGCNONE
AK104348GCCACGTGGCNONE
AK104385GCCACGTGGCNONE
AK104392GCCACGTGGCNONE
AK104446GCCACGTGGCNONE
AK104458GCCACGTGGCNONE
AK104469GCCACGTGGCNONE
AK104522GCCACGTGGCNONE
AK104535GCCACGTGGCNONE
AK104557GCCACGTGGCNONE
AK104636GCCACGTGGCNONE
AK104646GCCACGTGGCNONE
AK104734GCCACGTGGCNONE
AK106085GCCACGTGGCNONE
AK109398GCCACGTGGCNONE
AK119554GCCACGTGGCNONE
J013044I21GCCACGTGGCNONE
J013090N21GCCACGTGGCNONE
J013130I24GCCACGTGGCNONE
J023038D09GCCACGTGGCNONE
J023064C23GCCACGTGGCNONE
J023088A09GCCACGTGGCNONE
J023105K12GCCACGTGGCNONE
J065022M15GCCACGTGGCNONE
J075062L23GCCACGTGGCNONE
J075069B05GCCACGTGGCNONE
J075072D15GCCACGTGGCNONE
J075090E24GCCACGTGGCNONE
J075126D14GCCACGTGGCNONE
J075154L21GCCACGTGGCNONE
J075165F23GCCACGTGGCNONE
J075166D04GCCACGTGGCNONE
J080003O05GCCACGTGGCNONE
J080005L07GCCACGTGGCNONE
J080008K15GCCACGTGGCNONE
J080009A07GCCACGTGGCNONE
J080009F05GCCACGTGGCNONE
J080010M06GCCACGTGGCNONE
J080011E06GCCACGTGGCNONE
J080011H20GCCACGTGGCNONE
J080018I05GCCACGTGGCNONE
J080021N17GCCACGTGGCNONE
J080036E20GCCACGTGGCNONE
J080040E22GCCACGTGGCNONE
J080044D19GCCACGTGGCNONE
J080045C21GCCACGTGGCNONE
J080047B08GCCACGTGGCNONE
J080048E24GCCACGTGGCNONE
J080053D19GCCACGTGGCNONE
J080053N09GCCACGTGGCNONE
J080054A19GCCACGTGGCNONE
J080061O16GCCACGTGGCNONE
J080064P15GCCACGTGGCNONE
J080065M06GCCACGTGGCNONE
J080067G11GCCACGTGGCNONE
J080072M09GCCACGTGGCNONE
J080079I15GCCACGTGGCNONE
J080082I12GCCACGTGGCNONE
J080083K21GCCACGTGGCNONE
J080096H12GCCACGTGGCNONE
J080096J10GCCACGTGGCNONE
J080097O13GCCACGTGGCNONE
J080305P05GCCACGTGGCNONE
J080311C21GCCACGTGGCNONE
J080317C16GCCACGTGGCNONE
Os02g0198200J075078L15GCCCCACGTGTCATCCACCCCCACGNONE
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE
Os02g0199800AK072970GCCACGTGTTGGGCSimilar to No pollen.
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein.
J043024M20GCGGCCCACGTGTCAGTGGNONE
Os02g0245000AK119770GCCACGTCNONE
AK119874GCCACGTCSWAP/Surp domain containing protein.
J065038L11GCCACGTCNONE
J100059I06GCCACGTCNONE
J100076C23GCCACGTCNONE
J100081P08GCCACGTCNONE
J100084C13GCCACGTCNONE
Os02g0250600J075143F23ACGTGTCCLate embryogenesis abundant protein repeat containing protein.
J075143F23CACGTGTCLate embryogenesis abundant protein repeat containing protein.
Os02g0254600014-004-F08GACGTGGCGNONE
AK063627GACGTGGCGConserved hypothetical protein.
J065022D02GACGTGGCGNONE
J065168J03GACGTGGCGNONE
J065170D03GACGTGGCGNONE
J080021G21GACGTGGCGNONE
J080069G24GACGTGGCGNONE
J080071O10GACGTGGCGNONE
J080072L02GACGTGGCGNONE
J080093D22GACGTGGCGNONE
Os02g0265900006-102-B07CGCCACGTGGGCNONE
016-087-A02CGCCACGTGGGCNONE
AK059921CGCCACGTGGGCReticulon family protein.
AK064290CGCCACGTGGGCNONE
AK072628CGCCACGTGGGCNONE
AK104196CGCCACGTGGGCNONE
J023130B01CGCCACGTGGGCNONE
J080010O13CGCCACGTGGGCNONE
J100065C12CGCCACGTGGGCNONE
J100067M20CGCCACGTGGGCNONE
J100070I01CGCCACGTGGGCNONE
Os02g0276200J075059P05ACGTGTCGIsochorismatase hydrolase family protein.
J075172E19ACGTGTCGNONE
J075199I16ACGTGTCGNONE
Os02g0285800AK072177GACGTGGCSimilar to GTP-binding protein typA (Tyrosine phosphorylated protein A).
AK099035GACGTGGCNONE
Os02g0292800AK106941GCCACGTCProtein of unknown function DUF599 family protein.
Os02g0299200AK105486GCCCGGCCACGTCIQ calmodulin-binding region domain containing protein.
Os02g0301800AK067818GACACGTGGNONE
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein.
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit.
Os02g0453300006-099-D03GGCCGTCCACGTGTCCNONE
009-120-D02GGCCGTCCACGTGTCCNONE
AK071220GGCCGTCCACGTGTCCNONE
AK109380GGCCGTCCACGTGTCCConserved hypothetical protein.
J023083M17GGCCGTCCACGTGTCCNONE
Os02g0464700AK107077ACGTGGCGConserved hypothetical protein.
AK107077GACGTGGCGConserved hypothetical protein.
Os02g0493300AK069981ACGTGGCGTetratricopeptide-like helical domain containing protein.
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE
AK100111GCTGGGCCCACGTGTCNONE
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein.
J013074C19GCTGGGCCCACGTGTCNONE
J013153K16GCTGGGCCCACGTGTCNONE
J023078O21GCTGGGCCCACGTGTCNONE
J033127M18GCTGGGCCCACGTGTCNONE
J043038D17GCTGGGCCCACGTGTCNONE
J065090L08GCTGGGCCCACGTGTCNONE
J065110P16GCTGGGCCCACGTGTCNONE
J065163C03GCTGGGCCCACGTGTCNONE
J065213D23GCTGGGCCCACGTGTCNONE
J090010M14GCTGGGCCCACGTGTCNONE
J090016E02GCTGGGCCCACGTGTCNONE
J090044J20GCTGGGCCCACGTGTCNONE
J090091M16GCTGGGCCCACGTGTCNONE
J090099I23GCTGGGCCCACGTGTCNONE
Os02g0506500AK062572CGCCACGTCNONE
AK062572CGCCACGTCNONE
AK062572GACGTGGCNONE
AK063549CGCCACGTCNONE
AK063549CGCCACGTCNONE
AK063549GACGTGGCNONE
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein.
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein.
AK101016GACGTGGCMolybdenum cofactor biosynthesis domain containing protein.
AK109318CGCCACGTCNONE
AK109318CGCCACGTCNONE
AK109318GACGTGGCNONE
J013000C16CGCCACGTCNONE
J013000C16CGCCACGTCNONE
J013000C16GACGTGGCNONE
J013155N06CGCCACGTCNONE
J013155N06CGCCACGTCNONE
J013155N06GACGTGGCNONE
J023067A02CGCCACGTCNONE
J023067A02CGCCACGTCNONE
J023067A02GACGTGGCNONE
J023149E02CGCCACGTCNONE
J023149E02CGCCACGTCNONE
J023149E02GACGTGGCNONE
J033033J18CGCCACGTCNONE
J033033J18CGCCACGTCNONE
J033033J18GACGTGGCNONE
J033051O15CGCCACGTCNONE
J033051O15CGCCACGTCNONE
J033051O15GACGTGGCNONE
J075034C22CGCCACGTCNONE
J075034C22CGCCACGTCNONE
J075034C22GACGTGGCNONE
J075054O10CGCCACGTCNONE
J075054O10CGCCACGTCNONE
J075054O10GACGTGGCNONE
J075108L14CGCCACGTCNONE
J075108L14CGCCACGTCNONE
J075108L14GACGTGGCNONE
J090043O06CGCCACGTCNONE
J090043O06CGCCACGTCNONE
J090043O06GACGTGGCNONE
J100024P03CGCCACGTCNONE
J100024P03CGCCACGTCNONE
J100024P03GACGTGGCNONE
Os02g0509600AK111075CACGTGGCConserved hypothetical protein.
AK111075CACGTGGCGConserved hypothetical protein.
J065033B09CACGTGGCNONE
J065033B09CACGTGGCGNONE
J065069L04CACGTGGCNONE
J065069L04CACGTGGCGNONE
J065089H14CACGTGGCNONE
J065089H14CACGTGGCGNONE
J065119J16CACGTGGCNONE
J065119J16CACGTGGCGNONE
J065142J22CACGTGGCNONE
J065142J22CACGTGGCGNONE
J065168B14CACGTGGCNONE
J065168B14CACGTGGCGNONE
J065203L03CACGTGGCNONE
J065203L03CACGTGGCGNONE
J075044C18CACGTGGCNONE
J075044C18CACGTGGCGNONE
J075068D13CACGTGGCNONE
J075068D13CACGTGGCGNONE
J075152O09CACGTGGCNONE
J075152O09CACGTGGCGNONE
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
AK058487GCCACGTCNONE
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
AK122107GCCACGTCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J033126F06GCCACGTCNONE
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J053077L04GCCACGTCNONE
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J065010C11GCCACGTCNONE
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J075104O14GCCACGTCNONE
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080003G03GCCACGTCNONE
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080014K05GCCACGTCNONE
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080026F03GCCACGTCNONE
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080027O05GCCACGTCNONE
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080037K15GCCACGTCNONE
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080039D24GCCACGTCNONE
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080043G19GCCACGTCNONE
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080047P05GCCACGTCNONE
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080048D22GCCACGTCNONE
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080049F23GCCACGTCNONE
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080062A21GCCACGTCNONE
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080063H20GCCACGTCNONE
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080067P15GCCACGTCNONE
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080068P19GCCACGTCNONE
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080079J15GCCACGTCNONE
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080092K19GCCACGTCNONE
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080096M04GCCACGTCNONE
Os02g0520800AK102815ACACGTGGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP).
J033108M09ACACGTGGCNONE
J100038E09ACACGTGGCNONE
J100076G11ACACGTGGCNONE
Os02g0522700012-086-C03GCCACGTCACCNONE
Os02g0527200009-022-A08ACACGTGGCCCCCCGCGNONE
009-030-A06ACACGTGGCCCCCCGCGNONE
009-034-F08ACACGTGGCCCCCCGCGNONE
009-041-E08ACACGTGGCCCCCCGCGNONE
009-048-H03ACACGTGGCCCCCCGCGNONE
009-067-E04ACACGTGGCCCCCCGCGNONE
009-081-E04ACACGTGGCCCCCCGCGNONE
009-124-C06ACACGTGGCCCCCCGCGNONE
009-154-A07ACACGTGGCCCCCCGCGNONE
009-180-G04ACACGTGGCCCCCCGCGNONE
009-180-H01ACACGTGGCCCCCCGCGNONE
009-183-C03ACACGTGGCCCCCCGCGNONE
009-198-E04ACACGTGGCCCCCCGCGNONE
009-199-A12ACACGTGGCCCCCCGCGNONE
AK058851ACACGTGGCCCCCCGCGConserved hypothetical protein.
J075041O08ACACGTGGCCCCCCGCGNONE
J075112L20ACACGTGGCCCCCCGCGNONE
J075193M15ACACGTGGCCCCCCGCGNONE
Os02g0530100AK058520GACGTGGCGHeavy metal transport/detoxification protein domain containing protein.
Os02g0530600AK102681GGGTGGGCTACGTGTCGBRCT domain containing protein.
Os02g0531450J065097O14GACGTGGCGHypothetical protein.
J075155C16GACGTGGCGNONE
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein.
Os02g0534600GACGTGGCConserved hypothetical protein.
Os02g0538700006-022-A03CGCCACGTNONE
006-023-F01CGCCACGTNONE
006-026-B12CGCCACGTNONE
006-028-B08CGCCACGTNONE
006-028-H01CGCCACGTNONE
006-032-F02CGCCACGTNONE
006-034-E12CGCCACGTNONE
006-045-E02CGCCACGTNONE
006-046-E08CGCCACGTNONE
006-059-B07CGCCACGTNONE
006-060-E05CGCCACGTNONE
006-061-D11CGCCACGTNONE
006-067-G08CGCCACGTNONE
006-068-F12CGCCACGTNONE
006-077-B12CGCCACGTNONE
006-078-E10CGCCACGTNONE
006-079-A06CGCCACGTNONE
006-086-B12CGCCACGTNONE
006-086-E06CGCCACGTNONE
006-087-F01CGCCACGTNONE
006-094-D12CGCCACGTNONE
006-095-A08CGCCACGTNONE
006-097-B01CGCCACGTNONE
006-099-D07CGCCACGTNONE
006-103-A12CGCCACGTNONE
006-108-D05CGCCACGTNONE
006-110-F11CGCCACGTNONE
006-113-E10CGCCACGTNONE
006-120-F07CGCCACGTNONE
009-006-C10CGCCACGTNONE
009-045-F12CGCCACGTNONE
009-045-G05CGCCACGTNONE
009-050-A07CGCCACGTNONE
009-077-D05CGCCACGTNONE
009-080-G04CGCCACGTNONE
009-085-F09CGCCACGTNONE
009-090-A12CGCCACGTNONE
009-127-B07CGCCACGTNONE
009-136-B11CGCCACGTNONE
009-145-C04CGCCACGTNONE
009-164-G04CGCCACGTNONE
009-166-F12CGCCACGTNONE
009-187-D11CGCCACGTNONE
009-193-B07CGCCACGTNONE
009-198-H01CGCCACGTNONE
009-199-C09CGCCACGTNONE
009-199-E04CGCCACGTNONE
013-071-G11CGCCACGTNONE
AK060001CGCCACGTNONE
AK061396CGCCACGTNONE
AK065946CGCCACGTNONE
AK104564CGCCACGTNONE
AK104600CGCCACGTNONE
AK109400CGCCACGTNONE
AK109402CGCCACGTHarpin-induced 1 domain containing protein.
J013049G21CGCCACGTNONE
J065140C21CGCCACGTNONE
J075001F23CGCCACGTNONE
J075197B13CGCCACGTNONE
J100024N04CGCCACGTNONE
Os02g0539200AK108494ACGTGTCGU box domain containing protein.
Os02g0551600009-174-H09GCCACGTCACCNONE
009-174-H09GCCACGTGGCNONE
AK063102GCCACGTCACCConserved hypothetical protein.
AK063102GCCACGTGGCConserved hypothetical protein.
Os02g0556100006-100-D03CACGTGGCNONE
AK059938CACGTGGCNONE
AK103125CACGTGGCNAD-dependent epimerase/dehydratase family protein.
J033107B22CACGTGGCNONE
J033119M03CACGTGGCNONE
J033120L06CACGTGGCNONE
J043007B02CACGTGGCNONE
J043012G03CACGTGGCNONE
J043024A02CACGTGGCNONE
J043027J18CACGTGGCNONE
J100019E06CACGTGGCNONE
J100069C22CACGTGGCNONE
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein.
Os02g0559300AK100088ACGTGTCGNONE
AK121206ACGTGTCGProtein kinase-like domain containing protein.
J023003H24ACGTGTCGNONE
J023088A16ACGTGTCGNONE
J023100K01ACGTGTCGNONE
J023127H24ACGTGTCGNONE
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein.
J065115K07ATTGGGCCACGTGGCGNONE
Os02g0577900J065164K11ACGTGGCGConserved hypothetical protein.
Os02g0578300012-035-D02GCCACGTGGCGNONE
AK105275GCCACGTGGCGSimilar to Glucosyltransferase (Fragment).
Os02g0579000AB028180GCCACGTCTCNONE
AK108080GCCACGTCTCNo apical meristem (NAM) protein domain containing protein.
J065045C05GCCACGTCTCNONE
J065191M18GCCACGTCTCNONE
J065207F02GCCACGTCTCNONE
J065213H24GCCACGTCTCNONE
J075003H02GCCACGTCTCNONE
J075143B14GCCACGTCTCNONE
J100051O03GCCACGTCTCNONE
J100075K22GCCACGTCTCNONE
Os02g0582800AK108180CGACACGTConserved hypothetical protein.
J075127H13CGACACGTNONE
Os02g0586900013-044-D08ACGTGTCGNONE
014-087-D07ACGTGTCGNONE
AK063583ACGTGTCGSimilar to Glycine rich protein (Fragment).
AK105378ACGTGTCGNONE
Os02g0600200009-154-A06ACGTGGCGNONE
009-154-A06CACGCCACGTNONE
AK058978ACGTGGCGNONE
AK058978CACGCCACGTNONE
AK066974ACGTGGCGIQ calmodulin-binding region domain containing protein.
AK066974CACGCCACGTIQ calmodulin-binding region domain containing protein.
Os02g0602300AK065609GGACACGTGNONE
AK066929GGACACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
J013092L08GGACACGTGNONE
J090040I23GGACACGTGNONE
Os02g0611500AK072083CGACACGTSimilar to Eukaryotic initiation factor-like protein.
Os02g0612600009-058-F12CCCACGTGGCNONE
009-058-F12GACGTGGCNONE
009-058-F12GACGTGGCGNONE
AK062519CCCACGTGGCConserved hypothetical protein.
AK062519GACGTGGCConserved hypothetical protein.
AK062519GACGTGGCGConserved hypothetical protein.
Os02g0612650Os02g0612650CCCACGTGGCNONE
Os02g0612650GACGTGGCNONE
Os02g0612650GACGTGGCGNONE
Os02g0613200AK064869GCCCCCACGTGGCNONE
AK065051GCCCCCACGTGGCNONE
AK098853GCCCCCACGTGGCConserved hypothetical protein.
AK098974GCCCCCACGTGGCNONE
J013000H15GCCCCCACGTGGCNONE
J013001I18GCCCCCACGTGGCNONE
J013022I18GCCCCCACGTGGCNONE
J013025D06GCCCCCACGTGGCNONE
J013037H17GCCCCCACGTGGCNONE
J013043F22GCCCCCACGTGGCNONE
J013075E01GCCCCCACGTGGCNONE
J013088D09GCCCCCACGTGGCNONE
J013088E19GCCCCCACGTGGCNONE
J013102O18GCCCCCACGTGGCNONE
J013110C08GCCCCCACGTGGCNONE
J013118C06GCCCCCACGTGGCNONE
J013119F22GCCCCCACGTGGCNONE
J013128K14GCCCCCACGTGGCNONE
J013158C17GCCCCCACGTGGCNONE
J023013P15GCCCCCACGTGGCNONE
J023044L21GCCCCCACGTGGCNONE
J033023I04GCCCCCACGTGGCNONE
J033038I22GCCCCCACGTGGCNONE
J033095M02GCCCCCACGTGGCNONE
J043022F05GCCCCCACGTGGCNONE
J080307N20GCCCCCACGTGGCNONE
J080315C02GCCCCCACGTGGCNONE
J080316A15GCCCCCACGTGGCNONE
J080316G03GCCCCCACGTGGCNONE
J090029E24GCCCCCACGTGGCNONE
J090031H15GCCCCCACGTGGCNONE
J090034F13GCCCCCACGTGGCNONE
J090047G02GCCCCCACGTGGCNONE
J090069M24GCCCCCACGTGGCNONE
J100052E15GCCCCCACGTGGCNONE
Os02g0621600AK071074CGCCACGTNONE
AK108575CGCCACGTConserved hypothetical protein.
J023078O20CGCCACGTNONE
J075025M01CGCCACGTNONE
J090047L11CGCCACGTNONE
Os02g0644500Os02g0644500CGACACGTConserved hypothetical protein.
Os02g0649300014-043-A05CGCCACGTGTNONE
014-043-A05GCCACGTGTCGNONE
AK063685CGCCACGTGTSimilar to Short highly repeated, interspersed DNA (Fragment).
AK063685GCCACGTGTCGSimilar to Short highly repeated, interspersed DNA (Fragment).
Os02g0651300AK061454ACGTGTCCNONE
AK099767ACGTGTCCConserved hypothetical protein.
Os02g0652800AK063448CGCCACGTCMajor facilitator superfamily MFS_1 protein.
Os02g0654100AK101814GCCACGTCSimilar to Enoyl-CoA hydratase.
Os02g0658100AK064728ACGTGGCGNONE
AK064728CGCCACGTCNONE
Os02g0669100012-068-E10CGCCACGTCNONE
016-075-F09CGCCACGTCNONE
AB011367CGCCACGTCNONE
AK070197CGCCACGTCNONE
AY587109CGCCACGTCDehydrin family protein.
AY786415CGCCACGTCNONE
J023042N13CGCCACGTCNONE
J023128F01CGCCACGTCNONE
J065002K05CGCCACGTCNONE
J090057I09CGCCACGTCNONE
J090067J23CGCCACGTCNONE
J090071B04CGCCACGTCNONE
J100018L23CGCCACGTCNONE
J100036A11CGCCACGTCNONE
J100063L18CGCCACGTCNONE
J100071G02CGCCACGTCNONE
J100084P19CGCCACGTCNONE
Os02g0671200J065152N20CGCCACGTCNONE
J075053E22CGCCACGTCConserved hypothetical protein.
Os02g0672600AK070286CGCCACGTSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2.
AK101174CGCCACGTNONE
Os02g0673000AK108650ACGTGTCCProtein of unknown function UPF0005 family protein.
Os02g0677700AK119947CGCCACGTCNONE
Os02g0697600011-021-B01GCCACGTCNONE
AK121757GCCACGTCAAA ATPase domain containing protein.
Os02g0699700AK072471CGCCACGTGSimilar to DNA topoisomerase II.
Os02g0703800AK120025CACGTGTCConserved hypothetical protein.
Os02g0713700J043034B19ACGTGTCGNONE
J065041I10ACGTGTCGNONE
J065121M03ACGTGTCGNONE
J065134C21ACGTGTCGProtein of unknown function DUF296 domain containing protein.
J065186F18ACGTGTCGNONE
J100033H10ACGTGTCGNONE
J100043C12ACGTGTCGNONE
J100048E07ACGTGTCGNONE
J100087G13ACGTGTCGNONE
J100090J08ACGTGTCGNONE
Os02g0717500AK067050GACGTGGCConserved hypothetical protein.
J013092A12GACGTGGCNONE
J013124H24GACGTGGCNONE
J013154C11GACGTGGCNONE
J075098L15GACGTGGCNONE
J090083L24GACGTGGCNONE
J100049G21GACGTGGCNONE
J100073N20GACGTGGCNONE
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein.
J023031J12GGACACGTGGCGNONE
J075195G22GGACACGTGGCGNONE
J100088O11GGACACGTGGCGNONE
Os02g0720200AK105451CGCCACGTCNONE
AK121803CGCCACGTCSimilar to 65kD microtubule associated protein.
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV.
Os02g0726000AK072936CGACACGTNONE
AK099178CGACACGTBeta-Ig-H3/fasciclin domain containing protein.
J090014C14CGACACGTNONE
J090014G22CGACACGTNONE
J090031H04CGACACGTNONE
J090054D18CGACACGTNONE
J090054I05CGACACGTNONE
J090064M02CGACACGTNONE
J090073C19CGACACGTNONE
Os02g0727100AK069154CGACACGTAmino acid/polyamine transporter II family protein.
J023006P21CGACACGTNONE
J023027D19CGACACGTNONE
J023044N10CGACACGTNONE
J023088H15CGACACGTNONE
J023090A13CGACACGTNONE
J023142P16CGACACGTNONE
Os02g0727500009-018-G06CGCCACGTNONE
AK121427CGCCACGTConserved hypothetical protein.
J023136B21CGCCACGTNONE
J033044C13CGCCACGTNONE
J043037O12CGCCACGTNONE
J053072C14CGCCACGTNONE
J065008B15CGCCACGTNONE
J065033I12CGCCACGTNONE
J065077I18CGCCACGTNONE
J065149G03CGCCACGTNONE
J065159H07CGCCACGTNONE
J065162I17CGCCACGTNONE
J065168H02CGCCACGTNONE
J065176N09CGCCACGTNONE
J065178K23CGCCACGTNONE
J065216N03CGCCACGTNONE
J080001G08CGCCACGTNONE
J080002C09CGCCACGTNONE
J080007N17CGCCACGTNONE
J080009B04CGCCACGTNONE
J080009B17CGCCACGTNONE
J080011O15CGCCACGTNONE
J080022B06CGCCACGTNONE
J080022C13CGCCACGTNONE
J080024L04CGCCACGTNONE
J080031G21CGCCACGTNONE
J080035N14CGCCACGTNONE
J080036O14CGCCACGTNONE
J080040P10CGCCACGTNONE
J080042D03CGCCACGTNONE
J080042H05CGCCACGTNONE
J080042I20CGCCACGTNONE
J080043A01CGCCACGTNONE
J080043F17CGCCACGTNONE
J080046I19CGCCACGTNONE
J080053L20CGCCACGTNONE
J080055A20CGCCACGTNONE
J080055F01CGCCACGTNONE
J080056L02CGCCACGTNONE
J080058H02CGCCACGTNONE
J080059F11CGCCACGTNONE
J080062C03CGCCACGTNONE
J080064A07CGCCACGTNONE
J080064K15CGCCACGTNONE
J080067M17CGCCACGTNONE
J080067N17CGCCACGTNONE
J080068G07CGCCACGTNONE
J080069H15CGCCACGTNONE
J080069L08CGCCACGTNONE
J080069L20CGCCACGTNONE
J080069L21CGCCACGTNONE
J080069N20CGCCACGTNONE
J080071N24CGCCACGTNONE
J080074K17CGCCACGTNONE
J080076H08CGCCACGTNONE
J080082F19CGCCACGTNONE
J080086O16CGCCACGTNONE
J090025A19CGCCACGTNONE
J090025M06CGCCACGTNONE
J090070D02CGCCACGTNONE
Os02g0728100AK070290ACGTGGCGPeptidase S49, protease IV family protein.
Os02g0733900AK111335GGACACGTGConserved hypothetical protein.
J065092J17GGACACGTGNONE
J065140P16GGACACGTGNONE
J065191N21GGACACGTGNONE
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1.
AK102767GGCCCCACGTGTCNONE
Os02g0744700AF395537GACACGTGGGCCCCACACNONE
AJ308110GACACGTGGGCCCCACACNONE
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21).
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment).
AK098873GTGACGTGGCNONE
J013001C18GTGACGTGGCNONE
J080003D07GTGACGTGGCNONE
J080003H24GTGACGTGGCNONE
J080010C23GTGACGTGGCNONE
J080011I04GTGACGTGGCNONE
J080011O03GTGACGTGGCNONE
J080012F13GTGACGTGGCNONE
J080020E06GTGACGTGGCNONE
J080025H22GTGACGTGGCNONE
J080026D15GTGACGTGGCNONE
J080028D20GTGACGTGGCNONE
J080029P20GTGACGTGGCNONE
J080031K22GTGACGTGGCNONE
J080034I05GTGACGTGGCNONE
J080036E11GTGACGTGGCNONE
J080036H13GTGACGTGGCNONE
J080037E17GTGACGTGGCNONE
J080043N05GTGACGTGGCNONE
J080044L23GTGACGTGGCNONE
J080047N11GTGACGTGGCNONE
J080048O04GTGACGTGGCNONE
J080049M01GTGACGTGGCNONE
J080050F21GTGACGTGGCNONE
J080054F09GTGACGTGGCNONE
J080055N20GTGACGTGGCNONE
J080058C02GTGACGTGGCNONE
J080058K15GTGACGTGGCNONE
J080062G02GTGACGTGGCNONE
J080066H16GTGACGTGGCNONE
J080066O05GTGACGTGGCNONE
J080067O16GTGACGTGGCNONE
J080068E13GTGACGTGGCNONE
J080069P16GTGACGTGGCNONE
J080072M11GTGACGTGGCNONE
J080076H09GTGACGTGGCNONE
J080081G24GTGACGTGGCNONE
J080082J05GTGACGTGGCNONE
J080084I10GTGACGTGGCNONE
J080087L24GTGACGTGGCNONE
J080089H07GTGACGTGGCNONE
J080089M05GTGACGTGGCNONE
J080092G18GTGACGTGGCNONE
J080095N08GTGACGTGGCNONE
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein.
J023132N16CCCACCACGTGTCACTNONE
J033069F17CCCACCACGTGTCACTNONE
Os02g0753000AK121015CACGTGGCGSimilar to Trehalose-6-phosphate phosphatase.
Os02g0753800AK101787GGACACGTSimilar to Annexin p35.
Os02g0754300009-048-D05CGCCACGTGNONE
AK059012CGCCACGTGNONE
AK068621CGCCACGTGNONE
AK099805CGCCACGTGRibosomal protein L29 family protein.
J065102P04CGCCACGTGNONE
J065161I03CGCCACGTGNONE
Os02g0755600014-024-D06CGACACGTNONE
015-039-F09CGACACGTNONE
AK064105CGACACGTNONE
AK106639CGACACGTSimilar to UDP-glucuronosyltransferase.
Os02g0771500006-096-D12GACGTGGCNONE
006-096-D12GACGTGGCNONE
006-096-D12GACGTGGCGNONE
009-011-G02GACGTGGCNONE
009-011-G02GACGTGGCNONE
009-011-G02GACGTGGCGNONE
AK062335GACGTGGCNONE
AK062335GACGTGGCNONE
AK062335GACGTGGCGNONE
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018GACGTGGCGSimilar to Pap1p; poly A polymerase (Eukaryotic type).
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor.
Os02g0789600AK101046GCCACGTGGCGNONE
AK112100GCCACGTGGCGSimilar to DEM2.
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein.
Os02g0803900AK106930GCCACGTCSimilar to UDP-glycosyltransferase 91D1.
AK106930GCCACGTGGCGCCACGTCSimilar to UDP-glycosyltransferase 91D1.
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE
AK060165TCTCGGCCCATTTCACGTGTCNONE
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein.
J013112C12TCTCGGCCCATTTCACGTGTCNONE
J023098C22TCTCGGCCCATTTCACGTGTCNONE
J033123P06TCTCGGCCCATTTCACGTGTCNONE
J065060N24TCTCGGCCCATTTCACGTGTCNONE
J065069H22TCTCGGCCCATTTCACGTGTCNONE
J065155N20TCTCGGCCCATTTCACGTGTCNONE
J065170K07TCTCGGCCCATTTCACGTGTCNONE
J090033D12TCTCGGCCCATTTCACGTGTCNONE
Os02g0817500AK072707GACACGTGKCNAB voltage-gated K+ channel, beta subunit family protein.
AK104135GACACGTGNONE
U46758GACACGTGNONE
Os02g0824400AK121390CGCCACGTGTCCConserved hypothetical protein.
AK121390GCCACGTGTCCConserved hypothetical protein.
J023128P21CGCCACGTGTCCNONE
J023128P21GCCACGTGTCCNONE
J053097O16CGCCACGTGTCCNONE
J053097O16GCCACGTGTCCNONE
J065012I02CGCCACGTGTCCNONE
J065012I02GCCACGTGTCCNONE
J065049C06CGCCACGTGTCCNONE
J065049C06GCCACGTGTCCNONE
J065051H02CGCCACGTGTCCNONE
J065051H02GCCACGTGTCCNONE
J065069A13CGCCACGTGTCCNONE
J065069A13GCCACGTGTCCNONE
J065082E04CGCCACGTGTCCNONE
J065082E04GCCACGTGTCCNONE
J065102N09CGCCACGTGTCCNONE
J065102N09GCCACGTGTCCNONE
J065157O10CGCCACGTGTCCNONE
J065157O10GCCACGTGTCCNONE
J065188N23CGCCACGTGTCCNONE
J065188N23GCCACGTGTCCNONE
J065190J11CGCCACGTGTCCNONE
J065190J11GCCACGTGTCCNONE
J065202M09CGCCACGTGTCCNONE
J065202M09GCCACGTGTCCNONE
Os02g0824500AK111296GGACACGTGGCSimilar to Remorin.
AK111296GGACACGTGGCGSimilar to Remorin.
J065048M11GGACACGTGGCNONE
J065048M11GGACACGTGGCGNONE
J065081F01GGACACGTGGCNONE
J065081F01GGACACGTGGCGNONE
Os02g0827900AK099911CGCCACGTCSimilar to Signal peptidase 18 subunit (Fragment).
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa.
AK103235GCGGGCCCCACGTGTCNONE
Os02g0831600AB081951GACGTGGCNONE
AK103279GACGTGGCAGO1 homologous protein.
Os03g0100050Os03g0100050ACGTGGCGHypothetical protein.
Os03g0106000011-049-C02CCACGTGTCNONE
AK063343CCACGTGTCProtein of unknown function UPF0187 family protein.
J065001I04CCACGTGTCNONE
J065021G09CCACGTGTCNONE
J065021I09CCACGTGTCNONE
J100035C20CCACGTGTCNONE
Os03g0108700003-131-E01GTGGGACCCACGTGGCNONE
AK105115GTGGGACCCACGTGGCConserved hypothetical protein.
AY224538GTGGGACCCACGTGGCNONE
J065029A19GTGGGACCCACGTGGCNONE
J065109N11GTGGGACCCACGTGGCNONE
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein.
Os03g0116800012-097-D10GACACGTGGCNONE
012-097-D10GCCACGTGGGNONE
016-024-H10GACACGTGGCNONE
016-024-H10GCCACGTGGGNONE
AK066955GACACGTGGCConserved hypothetical protein.
AK066955GCCACGTGGGConserved hypothetical protein.
AK068678GACACGTGGCNONE
AK068678GCCACGTGGGNONE
AK104839GACACGTGGCNONE
AK104839GCCACGTGGGNONE
J013033G16GACACGTGGCNONE
J013033G16GCCACGTGGGNONE
J013091C10GACACGTGGCNONE
J013091C10GCCACGTGGGNONE
J013158H22GACACGTGGCNONE
J013158H22GCCACGTGGGNONE
J023106K11GACACGTGGCNONE
J023106K11GCCACGTGGGNONE
J065051O15GACACGTGGCNONE
J065051O15GCCACGTGGGNONE
J065129G22GACACGTGGCNONE
J065129G22GCCACGTGGGNONE
J075001K02GACACGTGGCNONE
J075001K02GCCACGTGGGNONE
J075011O03GACACGTGGCNONE
J075011O03GCCACGTGGGNONE
J075024K04GACACGTGGCNONE
J075024K04GCCACGTGGGNONE
J075026E07GACACGTGGCNONE
J075026E07GCCACGTGGGNONE
J075037O14GACACGTGGCNONE
J075037O14GCCACGTGGGNONE
J075071D17GACACGTGGCNONE
J075071D17GCCACGTGGGNONE
J075084M05GACACGTGGCNONE
J075084M05GCCACGTGGGNONE
J075114B06GACACGTGGCNONE
J075114B06GCCACGTGGGNONE
J075128C23GACACGTGGCNONE
J075128C23GCCACGTGGGNONE
J075153A13GACACGTGGCNONE
J075153A13GCCACGTGGGNONE
J075158A15GACACGTGGCNONE
J075158A15GCCACGTGGGNONE
J075165P09GACACGTGGCNONE
J075165P09GCCACGTGGGNONE
J075167M21GACACGTGGCNONE
J075167M21GCCACGTGGGNONE
J075170F11GACACGTGGCNONE
J075170F11GCCACGTGGGNONE
J075186F12GACACGTGGCNONE
J075186F12GCCACGTGGGNONE
J075186L13GACACGTGGCNONE
J075186L13GCCACGTGGGNONE
J075189A01GACACGTGGCNONE
J075189A01GCCACGTGGGNONE
J075192D19GACACGTGGCNONE
J075192D19GCCACGTGGGNONE
Os03g0117900AK108930ACGTGGCGSimilar to Transcription factor.
Os03g0119900AK058741CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)].
AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)].
J065035O07CGCCACGTCNONE
J065035O07CGCCACGTCACCGATCCGNONE
J065165C24CGCCACGTCNONE
J065165C24CGCCACGTCACCGATCCGNONE
J075039M05CGCCACGTCNONE
J075039M05CGCCACGTCACCGATCCGNONE
Os03g0122200009-052-H10CACGTGTCCGGCCCNONE
AB042934CACGTGTCCGGCCCNONE
AK065033CACGTGTCCGGCCCSimilar to 50S ribosomal protein L11.
J013001H03CACGTGTCCGGCCCNONE
J023149C23CACGTGTCCGGCCCNONE
J065025J15CACGTGTCCGGCCCNONE
J065093D22CACGTGTCCGGCCCNONE
Os03g0124900AK070284GCCACGTCVirulence factor, pectin lyase fold family protein.
J013052O13GCCACGTCNONE
J023048L01GCCACGTCNONE
J090085D12GCCACGTCNONE
Os03g0125400AK101342GCCACGTGGCConserved hypothetical protein 147 family protein.
J043012L05GCCACGTGGCNONE
J065013L10GCCACGTGGCNONE
J065046D23GCCACGTGGCNONE
J090074D20GCCACGTGGCNONE
J090087F22GCCACGTGGCNONE
J100047D05GCCACGTGGCNONE
Os03g0133100013-080-E12GCCACGTCNONE
AK063608GCCACGTCHypothetical protein.
AK119680GCCACGTCNONE
J075192B05GCCACGTCNONE
Os03g0134300AK102053ACGTGTCCCACCACSimilar to ATP phosphoribosyl transferase.
Os03g0137400AK072057CGCACCGCGACACGTCACGTCTCNONE
AK101118CGCACCGCGACACGTCACGTCTCProtein of unknown function DUF221 domain containing protein.
J013129L02CGCACCGCGACACGTCACGTCTCNONE
J033025H22CGCACCGCGACACGTCACGTCTCNONE
J033034L15CGCACCGCGACACGTCACGTCTCNONE
J033044F21CGCACCGCGACACGTCACGTCTCNONE
J033046F15CGCACCGCGACACGTCACGTCTCNONE
J033101I17CGCACCGCGACACGTCACGTCTCNONE
J033150K16CGCACCGCGACACGTCACGTCTCNONE
J065042G12CGCACCGCGACACGTCACGTCTCNONE
J065083F17CGCACCGCGACACGTCACGTCTCNONE
J100044G19CGCACCGCGACACGTCACGTCTCNONE
Os03g0138600Os03g0138600ACGTGTCGProtein of unknown function DUF810 family protein.
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2).
AK068968GCCCCACCGCGCGCGACGTGGCSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2).
AK100092CGCCACGTCACCCGCACGCGNONE
AK100092GCCCCACCGCGCGCGACGTGGCNONE
J023003L18CGCCACGTCACCCGCACGCGNONE
J023003L18GCCCCACCGCGCGCGACGTGGCNONE
J023022K18CGCCACGTCACCCGCACGCGNONE
J023022K18GCCCCACCGCGCGCGACGTGGCNONE
J023107H13CGCCACGTCACCCGCACGCGNONE
J023107H13GCCCCACCGCGCGCGACGTGGCNONE
J023107K02CGCCACGTCACCCGCACGCGNONE
J023107K02GCCCCACCGCGCGCGACGTGGCNONE
Os03g0142900011-054-A05GGACACGTNONE
AK067103GGACACGTNONE
AK120438GGACACGTProtein of unknown function DUF946, plant family protein.
J013097D18GGACACGTNONE
J013098E18GGACACGTNONE
J013099I17GGACACGTNONE
J013108C09GGACACGTNONE
J023045J15GGACACGTNONE
J033034E13GGACACGTNONE
J033095F07GGACACGTNONE
J033102N22GGACACGTNONE
J065016C14GGACACGTNONE
J065034E13GGACACGTNONE
J065065F21GGACACGTNONE
J065159M09GGACACGTNONE
J075012C13GGACACGTNONE
J075017P18GGACACGTNONE
J075018M03GGACACGTNONE
J075021H19GGACACGTNONE
J075070K23GGACACGTNONE
J075077B18GGACACGTNONE
J075085E20GGACACGTNONE
J075090N23GGACACGTNONE
J075137M16GGACACGTNONE
J075151E03GGACACGTNONE
J090042L02GGACACGTNONE
J090060C21GGACACGTNONE
J090089I17GGACACGTNONE
J100024L19GGACACGTNONE
J100025A06GGACACGTNONE
J100033C24GGACACGTNONE
J100052J17GGACACGTNONE
J100063H10GGACACGTNONE
J100073P04GGACACGTNONE
J100075D01GGACACGTNONE
J100077J17GGACACGTNONE
J100087F03GGACACGTNONE
J100087F09GGACACGTNONE
Os03g0144800AK103041CGCCACGTCSimilar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein).
J013043M12CGCCACGTCNONE
J013043N11CGCCACGTCNONE
J013093E21CGCCACGTCNONE
J033030E13CGCCACGTCNONE
J033044H20CGCCACGTCNONE
J033084H08CGCCACGTCNONE
J033117F03CGCCACGTCNONE
J043005E24CGCCACGTCNONE
J065218M08CGCCACGTCNONE
Os03g0149400AK111396GCCACGTCProtein prenyltransferase domain containing protein.
Os03g0154300J065112A07CCACGTGTCConserved hypothetical protein.
J065192P15CCACGTGTCNONE
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1).
AK066932GGTGACGTGTCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1).
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE
AK061079GCCCCCACGTGTCAGTGNONE
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
Os03g0177400006-108-A03GCCACGTCNONE
AK062030GCCACGTCNONE
Os03g0178400AK108257CACGTGTCEpoxide hydrolase family protein.
Os03g0183000006-054-A01GACGTGGCNONE
009-133-H05GACGTGGCNONE
AK060527GACGTGGCNONE
AK060929GACGTGGCNONE
AK101949GACGTGGCSimilar to AP2 domain containing protein RAP2.6 (Fragment).
J023007J03GACGTGGCNONE
J033075A14GACGTGGCNONE
J033075D23GACGTGGCNONE
J065170B03GACGTGGCNONE
J075118K09GACGTGGCNONE
J100024E23GACGTGGCNONE
J100025G08GACGTGGCNONE
J100035L20GACGTGGCNONE
J100040B04GACGTGGCNONE
J100059P18GACGTGGCNONE
J100075F05GACGTGGCNONE
Os03g0184100AK067400CCCCCGCGCCACGTHypothetical protein.
AK067400CGCCACGTGHypothetical protein.
J013030J24CCCCCGCGCCACGTNONE
J013030J24CGCCACGTGNONE
J013037M23CCCCCGCGCCACGTNONE
J013037M23CGCCACGTGNONE
J013106B15CCCCCGCGCCACGTNONE
J013106B15CGCCACGTGNONE
J013130H10CCCCCGCGCCACGTNONE
J013130H10CGCCACGTGNONE
J013152B03CCCCCGCGCCACGTNONE
J013152B03CGCCACGTGNONE
J013157J24CCCCCGCGCCACGTNONE
J013157J24CGCCACGTGNONE
J013157K04CCCCCGCGCCACGTNONE
J013157K04CGCCACGTGNONE
J033093A19CCCCCGCGCCACGTNONE
J033093A19CGCCACGTGNONE
J033106E24CCCCCGCGCCACGTNONE
J033106E24CGCCACGTGNONE
J090043G12CCCCCGCGCCACGTNONE
J090043G12CGCCACGTGNONE
Os03g0184300AK119613CGCCACGTGGCNONE
AK120569CGCCACGTGGCGlycosyl transferase, family 8 protein.
Os03g0187700009-155-F05GCCACGTCNONE
J033140E21GCCACGTCNONE
J033142E21GCCACGTCNONE
J065014P17GCCACGTCNONE
J065083L20GCCACGTCNONE
J065092E08GCCACGTCNONE
J065154C08GCCACGTCTarget SNARE coiled-coil region domain containing protein.
J075142H08GCCACGTCNONE
J075175K21GCCACGTCNONE
J090070B20GCCACGTCNONE
J100071M06GCCACGTCNONE
Os03g0196600Os03g0196600CGACACGTSimilar to Chloroplast serine acetyltransferase.
Os03g0197300AK102651GCCACGTCCupin, RmlC-type domain containing protein.
Os03g0201100AK102337GCCACGTCSimilar to Cyclophilin-like protein PPIL3b.
J033091A16GCCACGTCNONE
J075063K10GCCACGTCNONE
J075092L23GCCACGTCNONE
J075093A14GCCACGTCNONE
Os03g0214200AK100623CACGTGTCGProtein of unknown function DUF1675 family protein.
AK100623CGACACGTGTCGCGCGCProtein of unknown function DUF1675 family protein.
J075053B18CACGTGTCGNONE
J075053B18CGACACGTGTCGCGCGCNONE
Os03g0217900AK119980CGACACGTGConserved hypothetical protein.
J053089K18CGACACGTGNONE
J090058B20CGACACGTGNONE
J090081L09CGACACGTGNONE
Os03g0218300015-078-G09CACGTGGCGConserved hypothetical protein.
J090095I10CACGTGGCGNONE
Os03g0218400AK069202GCCACGTGGCSimilar to Hexose transporter.
AK099306GCCACGTGGCNONE
AY342321GCCACGTGGCNONE
J023066K08GCCACGTGGCNONE
J100032N19GCCACGTGGCNONE
Os03g0220700J100064H16CGCCACGTCNONE
J100064H16CGCCACGTCNONE
Os03g0227800016-033-F09CGCCACGTGNONE
AK063571CGCCACGTGNONE
AK103846CGCCACGTGNONE
J013028J20CGCCACGTGNONE
J013091I04CGCCACGTGNONE
J013100P18CGCCACGTGNONE
J013128L15CGCCACGTGNONE
J013153M09CGCCACGTGNONE
J033072J03CGCCACGTGNONE
J033074L07CGCCACGTGNONE
J033106H15CGCCACGTGNONE
J033148J22CGCCACGTGNONE
J065005B02CGCCACGTGNONE
J065009M20CGCCACGTGNONE
J065035E23CGCCACGTGNONE
J065039E24CGCCACGTGNONE
J065057P20CGCCACGTGNONE
J065066E10CGCCACGTGNONE
J065072G21CGCCACGTGNONE
J065076N07CGCCACGTGNONE
J065093G14CGCCACGTGNONE
J065127K10CGCCACGTGNONE
J065142O20CGCCACGTGNONE
J065165O18CGCCACGTGNONE
J065179O07CGCCACGTGNONE
J065203E15CGCCACGTGNONE
J080305J16CGCCACGTGNONE
J090008C14CGCCACGTGNONE
J090083E01CGCCACGTGNONE
J090092B02CGCCACGTGNONE
J090098O14CGCCACGTGNONE
J100042A12CGCCACGTGNONE
J100090K14CGCCACGTGNONE
Os03g0232101J075061A11GACACGTGHypothetical protein.
J075166F13GACACGTGNONE
Os03g0251500AK101151ACGTGTCCNONE
AK101151CGCCACGTCNONE
AK119298ACGTGTCCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment).
AK119298CGCCACGTCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment).
Os03g0251800AK067333CGCCACGTCACSimilar to Possible OmpA family member precursor.
AK073337CGCCACGTCACNONE
Os03g0272300AK060183GCCACGTGTCNONE
AK071865GCCACGTGTCZinc finger, RING-type domain containing protein.
Os03g0281600AK070260CGCCACGTSimilar to Ca2+-ATPase.
Os03g0282900006-088-H05GCCACGTGNONE
AK061166GCCACGTGNONE
AK102161GCCACGTGConserved hypothetical protein.
AK104514GCCACGTGNONE
Os03g0288700AK110718GGACACGTCACCAcid phosphatase/vanadium-dependent haloperoxidase family protein.
Os03g0295800006-107-F02ACACGTGGCNONE
AK106050ACACGTGGCNONE
Os03g0297100006-113-D12GCCACGTCNONE
AK061276GCCACGTCSimilar to 40S ribosomal protein S7.
J033119B03GCCACGTCNONE
J065205G10GCCACGTCNONE
J080069C17GCCACGTCNONE
J100069E15GCCACGTCNONE
J100081D07GCCACGTCNONE
Os03g0297400AK060653GCCACGTCGCGTCGCNONE
AK061403GCCACGTCGCGTCGCNONE
AK101597GCCACGTCGCGTCGCMalonyl CoA-acyl carrier protein transacylase family protein.
Os03g0297800AK107121ACGTGTCGProtein kinase-like domain containing protein.
Os03g0298300AK061180CCACGTGTCCProtein of unknown function DUF588 family protein.
AK061180CGCACCGCGCCACGTProtein of unknown function DUF588 family protein.
AK099089CCACGTGTCCNONE
AK099089CGCACCGCGCCACGTNONE
Os03g0298900006-028-C11GACGTGGCNONE
AK060996GACGTGGCHypothetical protein.
Os03g0300400AF395880ACGTGTCCNONE
AK121376ACGTGTCCPathogen-related protein (JIOsPR10).
J013036K14ACGTGTCCNONE
J023019C05ACGTGTCCNONE
J023068B20ACGTGTCCNONE
J023074O20ACGTGTCCNONE
J023093P15ACGTGTCCNONE
J023119D19ACGTGTCCNONE
J023127E15ACGTGTCCNONE
J023143G09ACGTGTCCNONE
J033087E12ACGTGTCCNONE
J075191C11ACGTGTCCNONE
J100023P07ACGTGTCCNONE
J100032G15ACGTGTCCNONE
J100074L17ACGTGTCCNONE
Os03g0300900014-046-H03CACGCCACGTGNONE
AK064068CACGCCACGTGNONE
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein.
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
Os03g0303100015-002-B09GACGTGGCGNONE
015-005-B02GACGTGGCGNONE
015-017-E10GACGTGGCGNONE
AK071041GACGTGGCGProtein of unknown function DUF1645 family protein.
J065140F05GACGTGGCGNONE
Os03g0305400009-198-D04CGCCACGTGGCNONE
013-012-C06CGCCACGTGGCNONE
014-034-D01CGCCACGTGGCNONE
AK071397CGCCACGTGGCUniversal stress protein (Usp) family protein.
J023012O22CGCCACGTGGCNONE
J023097A13CGCCACGTGGCNONE
J023107P16CGCCACGTGGCNONE
J023113C14CGCCACGTGGCNONE
Os03g0305600014-071-F12ACGTGTCCGGCCCNONE
AK063714ACGTGTCCGGCCCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J065005E12ACGTGTCCGGCCCNONE
J075099I09ACGTGTCCGGCCCNONE
J075152H24ACGTGTCCGGCCCNONE
J075177J04ACGTGTCCGGCCCNONE
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein.
J023013H05CGACACGTGGGCCCAACANONE
J023043K04CGACACGTGGGCCCAACANONE
J023083I20CGACACGTGGGCCCAACANONE
J033068F22CGACACGTGGGCCCAACANONE
J033125P21CGACACGTGGGCCCAACANONE
J065207A22CGACACGTGGGCCCAACANONE
J100018D20CGACACGTGGGCCCAACANONE
J100026L17CGACACGTGGGCCCAACANONE
J100055D14CGACACGTGGGCCCAACANONE
J100060P03CGACACGTGGGCCCAACANONE
J100078A20CGACACGTGGGCCCAACANONE
Os03g0308800AK066789GACGTGGCGNONE
AK068534GACGTGGCGProtein prenyltransferase domain containing protein.
Os03g0312500AK106657GCCACGTCSimilar to Inhibitor of apoptosis-like protein.
AK109328GCCACGTCNONE
Os03g0322500009-014-F03GCCACGTGGCNONE
009-014-F03GGACACGTGGCNONE
009-076-G10GCCACGTGGCNONE
009-076-G10GGACACGTGGCNONE
009-100-C01GCCACGTGGCNONE
009-100-C01GGACACGTGGCNONE
009-106-F02GCCACGTGGCNONE
009-106-F02GGACACGTGGCNONE
009-123-H11GCCACGTGGCNONE
009-123-H11GGACACGTGGCNONE
009-158-C09GCCACGTGGCNONE
009-158-C09GGACACGTGGCNONE
009-172-D04GCCACGTGGCNONE
009-172-D04GGACACGTGGCNONE
009-179-C11GCCACGTGGCNONE
009-179-C11GGACACGTGGCNONE
009-188-B12GCCACGTGGCNONE
009-188-B12GGACACGTGGCNONE
009-194-D07GCCACGTGGCNONE
009-194-D07GGACACGTGGCNONE
AK103503GCCACGTGGCNONE
AK103503GGACACGTGGCNONE
AK121029GCCACGTGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI).
AK121029GGACACGTGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI).
J013066O21GCCACGTGGCNONE
J013066O21GGACACGTGGCNONE
J023050G22GCCACGTGGCNONE
J023050G22GGACACGTGGCNONE
J023103H15GCCACGTGGCNONE
J023103H15GGACACGTGGCNONE
J033075B11GCCACGTGGCNONE
J033075B11GGACACGTGGCNONE
J033091E24GCCACGTGGCNONE
J033091E24GGACACGTGGCNONE
J033098N14GCCACGTGGCNONE
J033098N14GGACACGTGGCNONE
J053089B02GCCACGTGGCNONE
J053089B02GGACACGTGGCNONE
J065039M05GCCACGTGGCNONE
J065039M05GGACACGTGGCNONE
J065210G05GCCACGTGGCNONE
J065210G05GGACACGTGGCNONE
J090036P06GCCACGTGGCNONE
J090036P06GGACACGTGGCNONE
J090040M04GCCACGTGGCNONE
J090040M04GGACACGTGGCNONE
Os03g0323100009-108-G02CGACACGTNONE
AK062803CGACACGTHypothetical protein.
AK070776CGACACGTNONE
Os03g0323200AK067323ACGTGTCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor.
Os03g0324800AK059868CGCCACGTCNONE
AK071431CGCCACGTCHypothetical protein.
Os03g0331600009-025-C11GCCACGTGGCNONE
AK063782GCCACGTGGCConserved hypothetical protein.
Os03g0333000AK109811GCCACGTGTConserved hypothetical protein.
J065152D04GCCACGTGTNONE
J090011B05GCCACGTGTNONE
Os03g0333100AK101050ACACGTGGCProtein of unknown function DUF663 domain containing protein.
Os03g0335300AK098846CGACACGTNONE
AK098891CGACACGTNONE
AK111509CGACACGTSimilar to Vacuolar sorting receptor homolog (Fragment).
AK111847CGACACGTNONE
AK121413CGACACGTNONE
Os03g0338600AK066604CGCCACGTCtRNA pseudouridine synthase family protein.
Os03g0340500012-007-F10GGACACGTNONE
012-007-F10GGCCCCACGTGTCAGTGNONE
AK099406GGACACGTNONE
AK099406GGCCCCACGTGTCAGTGNONE
AK102158GGACACGTSimilar to Sucrose synthase (EC 2.4.1.13).
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13).
J013030N13GGACACGTNONE
J013030N13GGCCCCACGTGTCAGTGNONE
J013063E02GGACACGTNONE
J013063E02GGCCCCACGTGTCAGTGNONE
J013063I02GGACACGTNONE
J013063I02GGCCCCACGTGTCAGTGNONE
J013157O07GGACACGTNONE
J013157O07GGCCCCACGTGTCAGTGNONE
J023131N05GGACACGTNONE
J023131N05GGCCCCACGTGTCAGTGNONE
J033033P05GGACACGTNONE
J033033P05GGCCCCACGTGTCAGTGNONE
J033040N16GGACACGTNONE
J033040N16GGCCCCACGTGTCAGTGNONE
J033044M19GGACACGTNONE
J033044M19GGCCCCACGTGTCAGTGNONE
J033086F24GGACACGTNONE
J033086F24GGCCCCACGTGTCAGTGNONE
J033097H01GGACACGTNONE
J033097H01GGCCCCACGTGTCAGTGNONE
J033106C22GGACACGTNONE
J033106C22GGCCCCACGTGTCAGTGNONE
J033128M13GGACACGTNONE
J033128M13GGCCCCACGTGTCAGTGNONE
J033133I15GGACACGTNONE
J033133I15GGCCCCACGTGTCAGTGNONE
J043027A21GGACACGTNONE
J043027A21GGCCCCACGTGTCAGTGNONE
J090028A09GGACACGTNONE
J090028A09GGCCCCACGTGTCAGTGNONE
J090053D06GGACACGTNONE
J090053D06GGCCCCACGTGTCAGTGNONE
J090083O17GGACACGTNONE
J090083O17GGCCCCACGTGTCAGTGNONE
J090099H10GGACACGTNONE
J090099H10GGCCCCACGTGTCAGTGNONE
J100036M05GGACACGTNONE
J100036M05GGCCCCACGTGTCAGTGNONE
Os03g0341600AK067497GCCACGTCConserved hypothetical protein.
Os03g0343900009-077-C03TCCACGCCACGTGGCNONE
AK105813TCCACGCCACGTGGCPhotosystem II protein PsbX family protein.
J100059N03TCCACGCCACGTGGCNONE
J100079C20TCCACGCCACGTGGCNONE
Os03g0370000AK100033CGCCACGTCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99).
Os03g0379300006-039-F11CACGTGGCNONE
AK061515CACGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK068704CACGTGGCNONE
J013159M16CACGTGGCNONE
J090067F01CACGTGGCNONE
J090083F21CACGTGGCNONE
J100040M08CACGTGGCNONE
J100048C03CACGTGGCNONE
J100056M07CACGTGGCNONE
J100062N22CACGTGGCNONE
J100086L07CACGTGGCNONE
Os03g0381500AK108125ACGTGGCGConserved hypothetical protein.
AK108125ACGTGTCCConserved hypothetical protein.
AK108125CGCCACGTGTConserved hypothetical protein.
Os03g0383800009-149-G01ACGTGTCCNONE
AK062998ACGTGTCCNONE
AK065904ACGTGTCCNONE
Os03g0388100AK059680GACGTGGCHeavy metal transport/detoxification protein domain containing protein.
AK099133GACGTGGCNONE
Os03g0411500AK058696GCCACGTCNONE
AK071057GCCACGTCPeptidase S14, ClpP family protein.
Os03g0412300AK071008ACACGTGGCHeavy metal transport/detoxification protein domain containing protein.
J075120J12ACACGTGGCNONE
J100068E17ACACGTGGCNONE
Os03g0413000009-180-E02ACGTGGCGNONE
009-180-E02CCCACGTGGCNONE
009-180-E02TCCGTCCGACGTGGCGNONE
009-188-B06ACGTGGCGNONE
009-188-B06CCCACGTGGCNONE
009-188-B06TCCGTCCGACGTGGCGNONE
AK060225ACGTGGCGNONE
AK060225CCCACGTGGCNONE
AK060225TCCGTCCGACGTGGCGNONE
AY062181ACGTGGCGSimilar to Potential histone-like transcription factor.
AY062181CCCACGTGGCSimilar to Potential histone-like transcription factor.
AY062181TCCGTCCGACGTGGCGSimilar to Potential histone-like transcription factor.
Os03g0419100AK073482GGACACGTNONE
AK119969GGACACGTProtein of unknown function DUF1675 family protein.
Os03g0429000AK102768CGCCACGTCProteinase inhibitor I25, cystatin domain containing protein.
J033107F20CGCCACGTCNONE
J065042C20CGCCACGTCNONE
J065106L01CGCCACGTCNONE
J065142N05CGCCACGTCNONE
J075112D23CGCCACGTCNONE
J080001J15CGCCACGTCNONE
J080005I06CGCCACGTCNONE
J080011L11CGCCACGTCNONE
J080011P21CGCCACGTCNONE
J080024E07CGCCACGTCNONE
J080029G10CGCCACGTCNONE
J080039C16CGCCACGTCNONE
J080039E19CGCCACGTCNONE
J080045E04CGCCACGTCNONE
J080063D02CGCCACGTCNONE
J080063L14CGCCACGTCNONE
J080077L02CGCCACGTCNONE
J080077O08CGCCACGTCNONE
J080078D15CGCCACGTCNONE
J080079M10CGCCACGTCNONE
J080085D01CGCCACGTCNONE
J080089E07CGCCACGTCNONE
J080089E22CGCCACGTCNONE
J080097B13CGCCACGTCNONE
J080302C24CGCCACGTCNONE
Os03g0439700AK065720CGCCACGTProtein of unknown function DUF1230 family protein.
J013041G12CGCCACGTNONE
J065030N09CGCCACGTNONE
J065084A03CGCCACGTNONE
J065167B14CGCCACGTNONE
J100025F06CGCCACGTNONE
J100032J16CGCCACGTNONE
J100040L01CGCCACGTNONE
J100074M13CGCCACGTNONE
Os03g0453800014-002-A05GCCACGTGGCNONE
AK063623GCCACGTGGCConserved hypothetical protein.
Os03g0561249J065016H04ACGTGTCGConserved hypothetical protein.
Os03g0576900AK064861CACGTGTCCNONE
J013000I01CACGTGTCCNONE
J013169P21CACGTGTCCNONE
J023001P03CACGTGTCCNONE
J023009M10CACGTGTCCNONE
J023025G11CACGTGTCCNONE
J033046B19CACGTGTCCNONE
J033149I10CACGTGTCCNONE
J090081C04CACGTGTCCNONE
Os03g0581600J065037H09CGCCACGTCNONE
J065183O12CGCCACGTCNONE
Os03g0581800009-177-G11CGCCACGTNONE
AK059201CGCCACGTNONE
AK121839CGCCACGTHypothetical protein.
J023022K06CGCCACGTNONE
J023110K21CGCCACGTNONE
J033100N18CGCCACGTNONE
J033120D11CGCCACGTNONE
J065044P15CGCCACGTNONE
J065102G22CGCCACGTNONE
J065149N14CGCCACGTNONE
J065201L18CGCCACGTNONE
J065205K10CGCCACGTNONE
J075035D19CGCCACGTNONE
J075073E06CGCCACGTNONE
J075134M11CGCCACGTNONE
J090004P12CGCCACGTNONE
J090070H20CGCCACGTNONE
J090087B04CGCCACGTNONE
J100028F10CGCCACGTNONE
J100036M18CGCCACGTNONE
J100065C24CGCCACGTNONE
J100080O13CGCCACGTNONE
Os03g0584300009-018-H09CGCCACGTNONE
AK105133CGCCACGTProtein of unknown function UPF0136, Transmembrane family protein.
J065053M11CGCCACGTNONE
Os03g0587250J065002M05GCCACGTGConserved hypothetical protein.
Os03g0592500003-125-D02GACGTGGCGNONE
006-021-F01GACGTGGCGNONE
006-025-C12GACGTGGCGNONE
006-027-A06GACGTGGCGNONE
006-031-D08GACGTGGCGNONE
006-031-H05GACGTGGCGNONE
006-034-A10GACGTGGCGNONE
006-034-H11GACGTGGCGNONE
006-035-D10GACGTGGCGNONE
006-037-H08GACGTGGCGNONE
006-044-B09GACGTGGCGNONE
006-044-F02GACGTGGCGNONE
006-045-B11GACGTGGCGNONE
006-045-E09GACGTGGCGNONE
006-046-H12GACGTGGCGNONE
006-047-D04GACGTGGCGNONE
006-047-F02GACGTGGCGNONE
006-050-C12GACGTGGCGNONE
006-052-B07GACGTGGCGNONE
006-053-A09GACGTGGCGNONE
006-057-H02GACGTGGCGNONE
006-061-G12GACGTGGCGNONE
006-064-A04GACGTGGCGNONE
006-067-G10GACGTGGCGNONE
006-069-F06GACGTGGCGNONE
006-070-D02GACGTGGCGNONE
006-076-D11GACGTGGCGNONE
006-078-B12GACGTGGCGNONE
006-080-A10GACGTGGCGNONE
006-082-B04GACGTGGCGNONE
006-082-C05GACGTGGCGNONE
006-082-C08GACGTGGCGNONE
006-085-G08GACGTGGCGNONE
006-086-E03GACGTGGCGNONE
006-087-E03GACGTGGCGNONE
006-088-A07GACGTGGCGNONE
006-088-H06GACGTGGCGNONE
006-089-G09GACGTGGCGNONE
006-092-C03GACGTGGCGNONE
006-092-C06GACGTGGCGNONE
006-093-D09GACGTGGCGNONE
006-097-B08GACGTGGCGNONE
006-098-B09GACGTGGCGNONE
006-102-D11GACGTGGCGNONE
006-103-G02GACGTGGCGNONE
006-104-A12GACGTGGCGNONE
006-106-D10GACGTGGCGNONE
006-108-A08GACGTGGCGNONE
006-108-A12GACGTGGCGNONE
006-108-B08GACGTGGCGNONE
006-110-D07GACGTGGCGNONE
006-110-D09GACGTGGCGNONE
006-111-B04GACGTGGCGNONE
006-111-G11GACGTGGCGNONE
006-117-A08GACGTGGCGNONE
006-119-A08GACGTGGCGNONE
009-005-H11GACGTGGCGNONE
009-013-A12GACGTGGCGNONE
009-023-H09GACGTGGCGNONE
009-056-D04GACGTGGCGNONE
009-073-F11GACGTGGCGNONE
009-127-B01GACGTGGCGNONE
009-175-E01GACGTGGCGNONE
AF022739GACGTGGCGNONE
AF061577GACGTGGCGNONE
AK058315GACGTGGCGNONE
AK066762GACGTGGCGSimilar to Photosystem II type II chlorophyll a/b binding protein (Fragment).
D00642GACGTGGCGNONE
J013075I09GACGTGGCGNONE
J023115C07GACGTGGCGNONE
J065024G17GACGTGGCGNONE
J065051K08GACGTGGCGNONE
J065137D16GACGTGGCGNONE
J075057E17GACGTGGCGNONE
J075096E24GACGTGGCGNONE
J075105K04GACGTGGCGNONE
J075125F06GACGTGGCGNONE
J075132E10GACGTGGCGNONE
J075149I20GACGTGGCGNONE
J075151M21GACGTGGCGNONE
J075160K21GACGTGGCGNONE
J075187C08GACGTGGCGNONE
J075187E15GACGTGGCGNONE
J075194K02GACGTGGCGNONE
J075194L07GACGTGGCGNONE
J090008E24GACGTGGCGNONE
Os03g0594900AK069017GGACACGTCytochrome P450 family protein.
Os03g0596800AK073603ACGTGGCGConserved hypothetical protein.
AK073603CCCACGTGTCAGTGConserved hypothetical protein.
AK073603GCCACGTCConserved hypothetical protein.
J033052N01ACGTGGCGNONE
J033052N01CCCACGTGTCAGTGNONE
J033052N01GCCACGTCNONE
Os03g0598200AK068322CACGTGTCNop14-like protein family protein.
Os03g0606200009-030-E09GACACGTGGNONE
009-076-H10GACACGTGGNONE
009-122-H12GACACGTGGNONE
009-153-F09GACACGTGGNONE
AB055076GACACGTGGMitochondrial ATP synthase 6 KD subunit.
AK072384GACACGTGGNONE
AK107928GACACGTGGNONE
J023078E13GACACGTGGNONE
J053031N01GACACGTGGNONE
J053046K19GACACGTGGNONE
J053062P07GACACGTGGNONE
J053091C23GACACGTGGNONE
J053099N19GACACGTGGNONE
J065005E06GACACGTGGNONE
J065030N03GACACGTGGNONE
J065138O21GACACGTGGNONE
J065159K03GACACGTGGNONE
J075030M08GACACGTGGNONE
J080006E23GACACGTGGNONE
J080010D10GACACGTGGNONE
J080016N17GACACGTGGNONE
J080024N09GACACGTGGNONE
J080028E23GACACGTGGNONE
J080035I11GACACGTGGNONE
J080038D15GACACGTGGNONE
J080040H08GACACGTGGNONE
J080043L04GACACGTGGNONE
J080047C06GACACGTGGNONE
J080061G04GACACGTGGNONE
J080066E10GACACGTGGNONE
J080067P03GACACGTGGNONE
J080082D07GACACGTGGNONE
J080089M13GACACGTGGNONE
J080094O09GACACGTGGNONE
J080095C24GACACGTGGNONE
J080309E21GACACGTGGNONE
J090016G15GACACGTGGNONE
J090031C20GACACGTGGNONE
J090033A15GACACGTGGNONE
J090037L07GACACGTGGNONE
J090038I10GACACGTGGNONE
J090072P19GACACGTGGNONE
J100040J02GACACGTGGNONE
J100047N05GACACGTGGNONE
J100048M10GACACGTGGNONE
J100076C02GACACGTGGNONE
J100077G23GACACGTGGNONE
J100080O08GACACGTGGNONE
J100085C06GACACGTGGNONE
J100085F16GACACGTGGNONE
Os03g0607200013-002-F05CGACACGTNONE
013-021-H08CGACACGTNONE
013-038-E10CGACACGTNONE
014-009-E05CGACACGTNONE
014-034-H01CGACACGTNONE
014-038-A08CGACACGTNONE
014-072-G08CGACACGTNONE
014-083-B06CGACACGTNONE
014-088-G10CGACACGTNONE
AK070268CGACACGTGibberellin regulated protein family protein.
J023044E14CGACACGTNONE
J065199F02CGACACGTNONE
J075001C09CGACACGTNONE
J075019F02CGACACGTNONE
J075061J21CGACACGTNONE
J075068G03CGACACGTNONE
J075126F10CGACACGTNONE
J075153F19CGACACGTNONE
J080305I04CGACACGTNONE
J080307F24CGACACGTNONE
J080312E23CGACACGTNONE
J080315M20CGACACGTNONE
J080317E18CGACACGTNONE
J090043I11CGACACGTNONE
Os03g0622200AK108660CGACACGTTranscriptional factor B3 family protein.
Os03g0623100014-072-D06ACGTGTCGNONE
014-072-D06GACACGTGNONE
014-072-G11ACGTGTCGNONE
014-072-G11GACACGTGNONE
AK063716ACGTGTCGConserved hypothetical protein.
AK063716GACACGTGConserved hypothetical protein.
J065136O20ACGTGTCGNONE
J065136O20GACACGTGNONE
J075030G11ACGTGTCGNONE
J075030G11GACACGTGNONE
J075034O21ACGTGTCGNONE
J075034O21GACACGTGNONE
J075051D07ACGTGTCGNONE
J075051D07GACACGTGNONE
J075066M05ACGTGTCGNONE
J075066M05GACACGTGNONE
J075095G15ACGTGTCGNONE
J075095G15GACACGTGNONE
Os03g0637600006-046-H01ACGTGGCGNONE
AK061561ACGTGGCGNONE
Os03g0647500015-025-E10GCCACGTCNONE
AK064308GCCACGTCConserved hypothetical protein.
AK103649GCCACGTCNONE
J033135D01GCCACGTCNONE
Os03g0648300AK067192GGACACGTGIQ calmodulin-binding region domain containing protein.
J013098A04GGACACGTGNONE
J075149P13GGACACGTGNONE
J100044P16GGACACGTGNONE
J100053G19GGACACGTGNONE
Os03g0656500AK121052CGCCACGTSimilar to K-exchanger-like protein.
J065195N11CGCCACGTNONE
J065197F16CGCCACGTNONE
J075022O03CGCCACGTNONE
J075056N16CGCCACGTNONE
J075139P11CGCCACGTNONE
Os03g0663800011-023-B06CGCCACGTNONE
011-023-B06GAGACGTGGCGNONE
011-033-C06CGCCACGTNONE
011-033-C06GAGACGTGGCGNONE
012-011-E03CGCCACGTNONE
012-011-E03GAGACGTGGCGNONE
012-014-F04CGCCACGTNONE
012-014-F04GAGACGTGGCGNONE
012-027-C01CGCCACGTNONE
012-027-C01GAGACGTGGCGNONE
012-027-H07CGCCACGTNONE
012-027-H07GAGACGTGGCGNONE
012-031-A02CGCCACGTNONE
012-031-A02GAGACGTGGCGNONE
012-044-E05CGCCACGTNONE
012-044-E05GAGACGTGGCGNONE
012-045-G10CGCCACGTNONE
012-045-G10GAGACGTGGCGNONE
012-049-H02CGCCACGTNONE
012-049-H02GAGACGTGGCGNONE
012-053-G08CGCCACGTNONE
012-053-G08GAGACGTGGCGNONE
012-058-D07CGCCACGTNONE
012-058-D07GAGACGTGGCGNONE
012-061-H02CGCCACGTNONE
012-061-H02GAGACGTGGCGNONE
012-066-A02CGCCACGTNONE
012-066-A02GAGACGTGGCGNONE
012-074-F12CGCCACGTNONE
012-074-F12GAGACGTGGCGNONE
012-079-D08CGCCACGTNONE
012-079-D08GAGACGTGGCGNONE
012-081-E05CGCCACGTNONE
012-081-E05GAGACGTGGCGNONE
012-083-F04CGCCACGTNONE
012-083-F04GAGACGTGGCGNONE
012-084-F08CGCCACGTNONE
012-084-F08GAGACGTGGCGNONE
012-086-E08CGCCACGTNONE
012-086-E08GAGACGTGGCGNONE
012-086-F01CGCCACGTNONE
012-086-F01GAGACGTGGCGNONE
012-087-F03CGCCACGTNONE
012-087-F03GAGACGTGGCGNONE
012-087-H02CGCCACGTNONE
012-087-H02GAGACGTGGCGNONE
012-088-E05CGCCACGTNONE
012-088-E05GAGACGTGGCGNONE
012-089-B02CGCCACGTNONE
012-089-B02GAGACGTGGCGNONE
014-016-A04CGCCACGTNONE
014-016-A04GAGACGTGGCGNONE
AK105347CGCCACGTNONE
AK105347GAGACGTGGCGNONE
J075032I06CGCCACGTNONE
J075032I06GAGACGTGGCGNONE
J075041O22CGCCACGTNONE
J075041O22GAGACGTGGCGNONE
J075093E24CGCCACGTNONE
J075093E24GAGACGTGGCGNONE
J075094E06CGCCACGTNONE
J075094E06GAGACGTGGCGNONE
U45322CGCCACGTCupin region domain containing protein.
U45322GAGACGTGGCGCupin region domain containing protein.
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein.
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE
Os03g0668900AK108369GCCACGTCConserved hypothetical protein.
Os03g0670200011-069-G05CCCCCACGTGGCNONE
AK069553CCCCCACGTGGCSimilar to YJR013Wp (Fragment).
J023020O11CCCCCACGTGGCNONE
J023114J22CCCCCACGTGGCNONE
J100084F17CCCCCACGTGGCNONE
J100087A11CCCCCACGTGGCNONE
Os03g0683700AK065067CGCCACGTCProtein of unknown function DUF810 family protein.
Os03g0694000006-079-C12CACGTGTCCNONE
AK059872CACGTGTCCSimilar to Oxalate oxidase 1 (EC 1.2.3.4) (Germin).
J043027B01CACGTGTCCNONE
J065071N13CACGTGTCCNONE
J065159E22CACGTGTCCNONE
Os03g0698900013-074-A08TCGTGGGCCACGTCNONE
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein.
AK103953TCGTGGGCCACGTCNONE
J033024P22TCGTGGGCCACGTCNONE
J065194N16TCGTGGGCCACGTCNONE
J065195O11TCGTGGGCCACGTCNONE
J075020F03TCGTGGGCCACGTCNONE
J075032P18TCGTGGGCCACGTCNONE
J075037H13TCGTGGGCCACGTCNONE
J075147I01TCGTGGGCCACGTCNONE
J075187B13TCGTGGGCCACGTCNONE
J100043G08TCGTGGGCCACGTCNONE
J100060L06TCGTGGGCCACGTCNONE
J100063O21TCGTGGGCCACGTCNONE
J100066O13TCGTGGGCCACGTCNONE
J100072K20TCGTGGGCCACGTCNONE
J100083G21TCGTGGGCCACGTCNONE
J100085D07TCGTGGGCCACGTCNONE
Os03g0701600AK071171CGCCACGTGConserved hypothetical protein.
J013036F14CGCCACGTGNONE
J075052I22CGCCACGTGNONE
J100029D11CGCCACGTGNONE
J100062B19CGCCACGTGNONE
J100063H01CGCCACGTGNONE
Os03g0704200AK071176GACACGTGGGZinc finger, MYND-type domain containing protein.
AK071176GCCACGTGGGTCCCACCZinc finger, MYND-type domain containing protein.
J023083O08GACACGTGGGNONE
J023083O08GCCACGTGGGTCCCACCNONE
Os03g0712400AK111063ACGTGTCGNONE
Os03g0712600015-008-G03ACACGTGGCNONE
AK103705ACACGTGGCHypothetical protein.
J033136N14ACACGTGGCNONE
Os03g0723000011-021-G07CACGTGGCNONE
012-075-F08CACGTGGCNONE
012-077-F05CACGTGGCNONE
AK064022CACGTGGCNONE
AK101603CACGTGGCGRAS transcription factor domain containing protein.
AK102857CACGTGGCNONE
J100032K06CACGTGGCNONE
J100075D20CACGTGGCNONE
Os03g0723400AK107276ACGTGTCCConserved hypothetical protein.
AK107276CACGTGGCConserved hypothetical protein.
J065104F19ACGTGTCCNONE
J065104F19CACGTGGCNONE
J075026E22ACGTGTCCNONE
J075026E22CACGTGGCNONE
J075047K21ACGTGTCCNONE
J075047K21CACGTGGCNONE
J075071K20ACGTGTCCNONE
J075071K20CACGTGGCNONE
J075071K21ACGTGTCCNONE
J075071K21CACGTGGCNONE
J075140F21ACGTGTCCNONE
J075140F21CACGTGGCNONE
J075177C18ACGTGTCCNONE
J075177C18CACGTGGCNONE
Os03g0723800AK110710GGACACGTConserved hypothetical protein.
Os03g0725000AK059294GCCACGTCNONE
J043026H11GCCACGTCNONE
J065187O06GCCACGTCNONE
J090066M23GCCACGTCNONE
Os03g0729600009-092-C12CGACACGTCCACGCCTCNONE
009-156-H03CGACACGTCCACGCCTCNONE
AK062697CGACACGTCCACGCCTCNONE
AK063169CGACACGTCCACGCCTCConserved hypothetical protein.
Os03g0738600AK073529CGCCACGTCSimilar to Lipoxygenase L-2 (EC 1.13.11.12).
X64396CGCCACGTCNONE
Os03g0744800AK059983CGCCACGTemp24/gp25L/p24 family protein.
AK059983GCCACGTCACemp24/gp25L/p24 family protein.
J065067D01CGCCACGTNONE
J065067D01GCCACGTCACNONE
J065122L19CGCCACGTNONE
J065122L19GCCACGTCACNONE
J090041I03CGCCACGTNONE
J090041I03GCCACGTCACNONE
J100039H03CGCCACGTNONE
J100039H03GCCACGTCACNONE
Os03g0745000AK109590CGCCACGTCACCGCACNONE
AY332465CGCCACGTCACCGCACNONE
AY344486CGCCACGTCACCGCACNONE
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein.
Os03g0745600014-030-E09CGCCACGTCGGATCNONE
J053057E07CGCCACGTCGGATCNONE
J075044L08CGCCACGTCGGATCNONE
J075069C24CGCCACGTCGGATCNONE
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein.
J075180G21CGCCACGTCGGATCNONE
J075189M22CGCCACGTCGGATCNONE
J075192P11CGCCACGTCGGATCNONE
Os03g0747500AK108009CCACGTGTCCSeed maturation protein domain containing protein.
AK108009GACACGTGSeed maturation protein domain containing protein.
Os03g0750000AK071321ACGTGTCGUniversal stress protein (Usp) family protein.
J023088M23ACGTGTCGNONE
J065163N07ACGTGTCGNONE
J075006P15ACGTGTCGNONE
J075007N13ACGTGTCGNONE
J075018H04ACGTGTCGNONE
J075025E04ACGTGTCGNONE
J075036K02ACGTGTCGNONE
J075049I06ACGTGTCGNONE
J075050F19ACGTGTCGNONE
J075055M07ACGTGTCGNONE
J075070D11ACGTGTCGNONE
J075072A01ACGTGTCGNONE
J075081I23ACGTGTCGNONE
J075083G08ACGTGTCGNONE
J075095B03ACGTGTCGNONE
J075099I22ACGTGTCGNONE
J075122G06ACGTGTCGNONE
J075130C13ACGTGTCGNONE
J075143H06ACGTGTCGNONE
J075154E20ACGTGTCGNONE
J075174D01ACGTGTCGNONE
J075175E01ACGTGTCGNONE
J075185H11ACGTGTCGNONE
J080005K09ACGTGTCGNONE
J080006M06ACGTGTCGNONE
J080009M15ACGTGTCGNONE
J080013J23ACGTGTCGNONE
J080014L22ACGTGTCGNONE
J080018B22ACGTGTCGNONE
J080023C20ACGTGTCGNONE
J080025B08ACGTGTCGNONE
J080025C17ACGTGTCGNONE
J080025D21ACGTGTCGNONE
J080027A19ACGTGTCGNONE
J080030K08ACGTGTCGNONE
J080034I08ACGTGTCGNONE
J080034P08ACGTGTCGNONE
J080039E04ACGTGTCGNONE
J080041J05ACGTGTCGNONE
J080043G01ACGTGTCGNONE
J080044M21ACGTGTCGNONE
J080045J24ACGTGTCGNONE
J080045M10ACGTGTCGNONE
J080047E17ACGTGTCGNONE
J080047I12ACGTGTCGNONE
J080052I15ACGTGTCGNONE
J080060L19ACGTGTCGNONE
J080062M06ACGTGTCGNONE
J080064F23ACGTGTCGNONE
J080068L14ACGTGTCGNONE
J080070H15ACGTGTCGNONE
J080071P16ACGTGTCGNONE
J080076H11ACGTGTCGNONE
J080076L20ACGTGTCGNONE
J080077H05ACGTGTCGNONE
J080079E17ACGTGTCGNONE
J080089N23ACGTGTCGNONE
J080095J09ACGTGTCGNONE
J080096M12ACGTGTCGNONE
J080097E11ACGTGTCGNONE
Os03g0757200AK071136GCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein.
J023078E19GCCACGTGNONE
Os03g0764800AK104299GACGTGGCNONE
Os03g0766000AK070596CACGTGGCNONE
AK104743CACGTGGCNONE
AK106079CACGTGGCNONE
J013063M09CACGTGGCNONE
J023056A03CACGTGGCNONE
J043038L07CACGTGGCNONE
J053067N16CACGTGGCNONE
J053073G09CACGTGGCNONE
J053075I19CACGTGGCNONE
Os03g0767800004-017-A08CCACGTGTCCNONE
006-025-G11CCACGTGTCCNONE
006-088-G04CCACGTGTCCNONE
009-055-C02CCACGTGTCCNONE
AF283006CCACGTGTCCNONE
AK060000CCACGTGTCCNONE
AK060906CCACGTGTCCNONE
AK066036CCACGTGTCCCold acclimation WCOR413 family protein.
J023026I12CCACGTGTCCNONE
J023049J16CCACGTGTCCNONE
J033037M10CCACGTGTCCNONE
J033057D13CCACGTGTCCNONE
J033105H16CCACGTGTCCNONE
J033119G10CCACGTGTCCNONE
J065023C15CCACGTGTCCNONE
J065080D13CCACGTGTCCNONE
J080003C23CCACGTGTCCNONE
J080003P09CCACGTGTCCNONE
J080004K04CCACGTGTCCNONE
J080010M14CCACGTGTCCNONE
J080011J21CCACGTGTCCNONE
J080013J01CCACGTGTCCNONE
J080015A16CCACGTGTCCNONE
J080021F07CCACGTGTCCNONE
J080023F18CCACGTGTCCNONE
J080034D18CCACGTGTCCNONE
J080034O19CCACGTGTCCNONE
J080038J08CCACGTGTCCNONE
J080039N10CCACGTGTCCNONE
J080042P09CCACGTGTCCNONE
J080043E10CCACGTGTCCNONE
J080051M02CCACGTGTCCNONE
J080051O17CCACGTGTCCNONE
J080053B01CCACGTGTCCNONE
J080056N01CCACGTGTCCNONE
J080058J20CCACGTGTCCNONE
J080061B11CCACGTGTCCNONE
J080064B15CCACGTGTCCNONE
J080064O18CCACGTGTCCNONE
J080071A15CCACGTGTCCNONE
J080071C13CCACGTGTCCNONE
J080071F14CCACGTGTCCNONE
J080071M21CCACGTGTCCNONE
J080072A10CCACGTGTCCNONE
J080075J05CCACGTGTCCNONE
J080076A05CCACGTGTCCNONE
J080078F05CCACGTGTCCNONE
J080078K01CCACGTGTCCNONE
J080081F11CCACGTGTCCNONE
J080081K15CCACGTGTCCNONE
J080084K03CCACGTGTCCNONE
J080089F18CCACGTGTCCNONE
J080095A21CCACGTGTCCNONE
J100022L11CCACGTGTCCNONE
J100029I01CCACGTGTCCNONE
J100032I15CCACGTGTCCNONE
J100062N24CCACGTGTCCNONE
J100067E13CCACGTGTCCNONE
J100075G02CCACGTGTCCNONE
J100080L14CCACGTGTCCNONE
Os03g0770100AK108776ACGTGGCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
Os03g0784000AK067337CGCCACGTCNONE
AK100003CGCCACGTCFAD dependent oxidoreductase family protein.
J013102O14CGCCACGTCNONE
J013135F18CGCCACGTCNONE
Os03g0784500AK109744GCCACGTCNONE
Os03g0784900006-053-H11CGACACGTNONE
009-165-F11CGACACGTNONE
AK060949CGACACGTConserved hypothetical protein.
AK099097CGACACGTNONE
J023019M19CGACACGTNONE
J065024O11CGACACGTNONE
J065106D20CGACACGTNONE
J065201L15CGACACGTNONE
J075031B04CGACACGTNONE
J075033C19CGACACGTNONE
J075035F11CGACACGTNONE
J075074K14CGACACGTNONE
J075083A22CGACACGTNONE
J075120O10CGACACGTNONE
J075153L20CGACACGTNONE
J075159G02CGACACGTNONE
J080001J18CGACACGTNONE
J080015I03CGACACGTNONE
J080027E23CGACACGTNONE
J080046D24CGACACGTNONE
J080053B17CGACACGTNONE
J080070P07CGACACGTNONE
J080076D18CGACACGTNONE
J080078E13CGACACGTNONE
J080090H03CGACACGTNONE
J100024F19CGACACGTNONE
J100052D15CGACACGTNONE
J100079B14CGACACGTNONE
Os03g0785200003-116-B06GCCACGTCNONE
J013098I23GCCACGTCNONE
J023002I24GCCACGTCMitochodrial transcription termination factor-related family protein.
J075150G04GCCACGTCNONE
Os03g0788500AK072204GCCACGTCSimilar to Calcium-dependent protein kinase 2.
Os03g0793100AK067897ACGTGGCGGlycosyl transferase, family 43 protein.
J033125G24ACGTGGCGNONE
J065132N21ACGTGGCGNONE
Os03g0793700AK121667CGCCACGTCupin 1 domain containing protein.
AY098743CGCCACGTNONE
Os03g0795900012-092-G05CGACACGTNONE
015-043-D09CGACACGTNONE
016-078-G11CGACACGTNONE
AK068660CGACACGTSimilar to Heat shock transcription factor 31 (Fragment).
J013162K14CGACACGTNONE
J023001L04CGACACGTNONE
J053032K11CGACACGTNONE
J065059E10CGACACGTNONE
J065095H19CGACACGTNONE
J065181M06CGACACGTNONE
J100047D11CGACACGTNONE
J100068G04CGACACGTNONE
Os03g0796000AK064912GACACGTGGSimilar to Ripening-associated protein (Fragment).
AK106661GACACGTGGNONE
J013000M11GACACGTGGNONE
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE
003-113-D10CGCCACGTNONE
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE
011-076-B12CGCCACGTNONE
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein.
AK105257CGCCACGTProtein of unknown function DUF506, plant family protein.
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE
J075105C03CGCCACGTNONE
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE
J080036O17CGCCACGTNONE
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE
J080064E16CGCCACGTNONE
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE
J080069E03CGCCACGTNONE
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE
J080079E23CGCCACGTNONE
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE
J090036H20CGCCACGTNONE
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE
J100029L10CGCCACGTNONE
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE
J100055G09CGCCACGTNONE
Os03g0796800J065024O22CGACACGTConserved hypothetical protein.
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein.
Os03g0799300AK108023GACACGTGConserved hypothetical protein.
J065161F04GACACGTGNONE
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein.
AK070287GACACGTGGGGCCCGGCNONE
J023049O16GACACGTGGGGCCCGGCNONE
J100025I21GACACGTGGGGCCCGGCNONE
J100035K21GACACGTGGGGCCCGGCNONE
Os03g0808900AK065100GCCACGTGGCSimilar to Seed imbibition protein (Fragment).
Os03g0810800006-060-G12GGTGACGTGGCNONE
006-063-F08GGTGACGTGGCNONE
006-102-H09GGTGACGTGGCNONE
AK060010GGTGACGTGGCSimilar to Short-chain alcohol dehydrogenase.
AK070201GGTGACGTGGCNONE
AK105938GGTGACGTGGCNONE
J023042C15GGTGACGTGGCNONE
J053075K10GGTGACGTGGCNONE
J065061E08GGTGACGTGGCNONE
J065079B21GGTGACGTGGCNONE
J065082F07GGTGACGTGGCNONE
J065128H02GGTGACGTGGCNONE
J065195C03GGTGACGTGGCNONE
J090038F07GGTGACGTGGCNONE
J090048P14GGTGACGTGGCNONE
J090052C07GGTGACGTGGCNONE
J090089M12GGTGACGTGGCNONE
J090097F20GGTGACGTGGCNONE
J100037H03GGTGACGTGGCNONE
J100038K01GGTGACGTGGCNONE
Os03g0815900013-097-G08CGACACGTGGCGNONE
AK065258CGACACGTGGCGNONE
AK119756CGACACGTGGCGSimilar to DNA-directed RNA polymerase.
J013002J17CGACACGTGGCGNONE
J013074A12CGACACGTGGCGNONE
J023045C17CGACACGTGGCGNONE
J033050E21CGACACGTGGCGNONE
J053094P05CGACACGTGGCGNONE
J090038F11CGACACGTGGCGNONE
J090072J01CGACACGTGGCGNONE
J100026H07CGACACGTGGCGNONE
J100040O06CGACACGTGGCGNONE
J100083D07CGACACGTGGCGNONE
Os03g0818100015-098-A09CACGTGGCGNONE
AK064366CACGTGGCGNONE
AK121701CACGTGGCGHistidine acid phosphatase family protein.
Os03g0820500J065073D04GCCACGTCSimilar to WCOR719.
Os03g0820600013-030-F01ACGTGTCCNONE
AK058941ACGTGTCCSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3).
J065038I10ACGTGTCCNONE
J065043C23ACGTGTCCNONE
J065060H20ACGTGTCCNONE
J065065E06ACGTGTCCNONE
J065078K18ACGTGTCCNONE
J065116J24ACGTGTCCNONE
J065118G22ACGTGTCCNONE
J065129D16ACGTGTCCNONE
J065153G20ACGTGTCCNONE
J065159I03ACGTGTCCNONE
J065176E14ACGTGTCCNONE
J065187B11ACGTGTCCNONE
J065203D14ACGTGTCCNONE
J065217P15ACGTGTCCNONE
J075105D14ACGTGTCCNONE
J100036F11ACGTGTCCNONE
J100044M07ACGTGTCCNONE
Os03g0822300AK060050GCCACGTCACRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein.
J065198I20GCCACGTCACNONE
Os03g0832200AK070712CACGTGGCSimilar to Calcium-binding protein precursor (Calreticulin).
Os03g0835600AK101677CGACACGTGGAcyl-coA-binding protein, ACBP family protein.
Os03g0837300AK111243GCCACGTGTCGNONE
AK121140GCCACGTGTCGNicotinate phosphoribosyltransferase and related family protein.
AY214337GCCACGTGTCGNONE
J023077G12GCCACGTGTCGNONE
J023078M10GCCACGTGTCGNONE
J033031B10GCCACGTGTCGNONE
J033067L18GCCACGTGTCGNONE
J043005P09GCCACGTGTCGNONE
J090013J15GCCACGTGTCGNONE
J090042E10GCCACGTGTCGNONE
J090045A20GCCACGTGTCGNONE
J100022H02GCCACGTGTCGNONE
Os03g0837900AK068346GCCACGTCGGCCCAGAStreptomyces cyclase/dehydrase family protein.
Os03g0842700AK065755GACACGTGTTGGTGGNONE
AK067436GACACGTGTTGGTGGNONE
AK070821GACACGTGTTGGTGGVacuolar sorting protein 9 domain containing protein.
J013036A18GACACGTGTTGGTGGNONE
J013059F17GACACGTGTTGGTGGNONE
J023043H05GACACGTGTTGGTGGNONE
J023063L20GACACGTGTTGGTGGNONE
J043020E01GACACGTGTTGGTGGNONE
J065007C01GACACGTGTTGGTGGNONE
J065023K08GACACGTGTTGGTGGNONE
J065046H23GACACGTGTTGGTGGNONE
J065080F24GACACGTGTTGGTGGNONE
J065091L10GACACGTGTTGGTGGNONE
J065102K05GACACGTGTTGGTGGNONE
J065106E22GACACGTGTTGGTGGNONE
J065128C20GACACGTGTTGGTGGNONE
J065189O17GACACGTGTTGGTGGNONE
J065219D10GACACGTGTTGGTGGNONE
J075064C10GACACGTGTTGGTGGNONE
J075098I17GACACGTGTTGGTGGNONE
J075101I04GACACGTGTTGGTGGNONE
J075153O11GACACGTGTTGGTGGNONE
J075197E10GACACGTGTTGGTGGNONE
J090011C21GACACGTGTTGGTGGNONE
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein.
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE
Os03g0852400006-021-C11GACGTGGCNONE
006-048-D09GACGTGGCNONE
006-059-C05GACGTGGCNONE
006-078-E01GACGTGGCNONE
006-082-H09GACGTGGCNONE
AK060985GACGTGGCNONE
AK109338GACGTGGCConserved hypothetical protein.
Os03g0854800J090007D13CGCCACGTCACNONE
J090085N22CGCCACGTCACNONE
Os04g0173800AK103206CGCCACGTLectin precursor (Agglutinin).
J033122E14CGCCACGTNONE
J075001E08CGCCACGTNONE
J075005H05CGCCACGTNONE
J075006A12CGCCACGTNONE
J075026O21CGCCACGTNONE
J075040I24CGCCACGTNONE
J075060N11CGCCACGTNONE
J075069A22CGCCACGTNONE
J075070A15CGCCACGTNONE
J075074K06CGCCACGTNONE
J075078E13CGCCACGTNONE
J075085O15CGCCACGTNONE
J075088A22CGCCACGTNONE
J075094E22CGCCACGTNONE
J075095E06CGCCACGTNONE
J075120L07CGCCACGTNONE
J075138I15CGCCACGTNONE
J075140I20CGCCACGTNONE
J075140N11CGCCACGTNONE
J075142I18CGCCACGTNONE
J075147F23CGCCACGTNONE
J075147J18CGCCACGTNONE
J075155H18CGCCACGTNONE
J075156J22CGCCACGTNONE
J075157J02CGCCACGTNONE
J075167L04CGCCACGTNONE
J075170H22CGCCACGTNONE
J075172G01CGCCACGTNONE
J075180L07CGCCACGTNONE
J075182B03CGCCACGTNONE
J075194C19CGCCACGTNONE
J100063D16CGCCACGTNONE
M24504CGCCACGTNONE
Os04g0175400AK107892CGACACGTConserved hypothetical protein.
J065212M08CGACACGTNONE
Os04g0231800AK068417ACGTGTCGNONE
J013153L19ACGTGTCGNONE
J065020J04ACGTGTCGNONE
J065201K08ACGTGTCGNONE
J065214C10ACGTGTCGNONE
Os04g0244800009-066-G06CCCACGTGGCNONE
009-066-G06GCCCACGTGTCNONE
011-024-D02CCCACGTGGCNONE
011-024-D02GCCCACGTGTCNONE
AK121488CCCACGTGGCHeavy metal transport/detoxification protein domain containing protein.
AK121488GCCCACGTGTCHeavy metal transport/detoxification protein domain containing protein.
J023095P14CCCACGTGGCNONE
J023095P14GCCCACGTGTCNONE
J023150J09CCCACGTGGCNONE
J023150J09GCCCACGTGTCNONE
J053097G24CCCACGTGGCNONE
J053097G24GCCCACGTGTCNONE
J065001K24CCCACGTGGCNONE
J065001K24GCCCACGTGTCNONE
J065009O13CCCACGTGGCNONE
J065009O13GCCCACGTGTCNONE
J065076M12CCCACGTGGCNONE
J065076M12GCCCACGTGTCNONE
J065081I15CCCACGTGGCNONE
J065081I15GCCCACGTGTCNONE
J065105E10CCCACGTGGCNONE
J065105E10GCCCACGTGTCNONE
J065106G04CCCACGTGGCNONE
J065106G04GCCCACGTGTCNONE
J065123I12CCCACGTGGCNONE
J065123I12GCCCACGTGTCNONE
J065137H16CCCACGTGGCNONE
J065137H16GCCCACGTGTCNONE
J065151I11CCCACGTGGCNONE
J065151I11GCCCACGTGTCNONE
J065164H06CCCACGTGGCNONE
J065164H06GCCCACGTGTCNONE
J065173J07CCCACGTGGCNONE
J065173J07GCCCACGTGTCNONE
J065196F02CCCACGTGGCNONE
J065196F02GCCCACGTGTCNONE
J065198I17CCCACGTGGCNONE
J065198I17GCCCACGTGTCNONE
J065206I11CCCACGTGGCNONE
J065206I11GCCCACGTGTCNONE
J065216J02CCCACGTGGCNONE
J065216J02GCCCACGTGTCNONE
J075076D10CCCACGTGGCNONE
J075076D10GCCCACGTGTCNONE
J075098F06CCCACGTGGCNONE
J075098F06GCCCACGTGTCNONE
J075115A20CCCACGTGGCNONE
J075115A20GCCCACGTGTCNONE
J075184H05CCCACGTGGCNONE
J075184H05GCCCACGTGTCNONE
J075193E17CCCACGTGGCNONE
J075193E17GCCCACGTGTCNONE
J090014L09CCCACGTGGCNONE
J090014L09GCCCACGTGTCNONE
J090015H16CCCACGTGGCNONE
J090015H16GCCCACGTGTCNONE
J090024M04CCCACGTGGCNONE
J090024M04GCCCACGTGTCNONE
J090062K08CCCACGTGGCNONE
J090062K08GCCCACGTGTCNONE
J090082I08CCCACGTGGCNONE
J090082I08GCCCACGTGTCNONE
Os04g0259800AK111548GACGTGGCConserved hypothetical protein.
Os04g0266900011-064-A07ACGTGTCGNONE
011-064-A07CACGTGTCACTNONE
AK069447ACGTGTCGBacterial transketolase family protein.
AK069447CACGTGTCACTBacterial transketolase family protein.
J023019B19ACGTGTCGNONE
J023019B19CACGTGTCACTNONE
Os04g0269900J065139P11ACGTGTCCNONE
J065139P11CGCCACGTNONE
J100034P12ACGTGTCCNONE
J100034P12CGCCACGTNONE
J100045D21ACGTGTCCNONE
J100045D21CGCCACGTNONE
Os04g0274700J043039I02GCCACGTGConserved hypothetical protein.
Os04g0275966J065015F20GACGTGGCConserved hypothetical protein.
J065118M18GACGTGGCNONE
Os04g0286400009-144-C10GCCACGTCACCNONE
AK062974GCCACGTCACCHypothetical protein.
Os04g0313300AK121730GACGTGGCConserved hypothetical protein.
J033082F07GACGTGGCNONE
Os04g0321700003-103-G02GACACGTGNONE
AK068732GACACGTGSimilar to Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C).
AK099397GACACGTGNONE
Os04g0367400006-079-G12GACGTGGCNONE
006-079-G12GACGTGGCNONE
AK061121GACGTGGCReticulon family protein.
AK061121GACGTGGCReticulon family protein.
AK100139GACGTGGCNONE
AK100139GACGTGGCNONE
J065009F13GACGTGGCNONE
J065009F13GACGTGGCNONE
J065032N11GACGTGGCNONE
J065032N11GACGTGGCNONE
J065039P10GACGTGGCNONE
J065039P10GACGTGGCNONE
J065124I05GACGTGGCNONE
J065124I05GACGTGGCNONE
J065197E16GACGTGGCNONE
J065197E16GACGTGGCNONE
Os04g0380800J075004H10GGACACGTConserved hypothetical protein.
Os04g0382300AK071912CGCCACGTCNONE
AK101795CGCCACGTCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1).
Os04g0389800AK109628GCCACGTCSimilar to Acetohydroxyacid synthase.
Os04g0390700AK107261CGCCACGTGTCCGlucose/ribitol dehydrogenase family protein.
AK107261GGACACGTGGGlucose/ribitol dehydrogenase family protein.
AK107261GTGACGTGTCGGlucose/ribitol dehydrogenase family protein.
Os04g0407900AK064758GACGTGGCSimilar to Cytochrom P450-like protein.
Os04g0408900009-183-E05GCCACGTCNONE
AK058627GCCACGTCSimilar to DNA-binding protein S1FA.
J023014N01GCCACGTCNONE
J023088K23GCCACGTCNONE
J065086B17GCCACGTCNONE
J065095F08GCCACGTCNONE
J065119N11GCCACGTCNONE
J100032H17GCCACGTCNONE
Os04g0412100AK108223ACGTGTCCConserved hypothetical protein.
Os04g0414700009-068-G12CGCCACGTCNONE
009-070-D05CGCCACGTCNONE
009-141-A08CGCCACGTCNONE
009-144-A07CGCCACGTCNONE
009-164-F03CGCCACGTCNONE
AK058848CGCCACGTCConserved hypothetical protein.
J013131F19CGCCACGTCNONE
J013158N18CGCCACGTCNONE
J023028J24CGCCACGTCNONE
J023039K24CGCCACGTCNONE
J065077F17CGCCACGTCNONE
J065080G08CGCCACGTCNONE
J065182N04CGCCACGTCNONE
J065184G24CGCCACGTCNONE
J065208A07CGCCACGTCNONE
J065215H12CGCCACGTCNONE
J075039D21CGCCACGTCNONE
J075049C05CGCCACGTCNONE
J075055E15CGCCACGTCNONE
J075057O12CGCCACGTCNONE
J075073K23CGCCACGTCNONE
J075073N15CGCCACGTCNONE
J075076A15CGCCACGTCNONE
J075077D02CGCCACGTCNONE
J075096M18CGCCACGTCNONE
J075098M24CGCCACGTCNONE
J075101G13CGCCACGTCNONE
J075101O07CGCCACGTCNONE
J075114F04CGCCACGTCNONE
J075119K17CGCCACGTCNONE
J075132E19CGCCACGTCNONE
J075136P20CGCCACGTCNONE
J075140E11CGCCACGTCNONE
J075145D03CGCCACGTCNONE
J075146B08CGCCACGTCNONE
J075169B13CGCCACGTCNONE
J075181A18CGCCACGTCNONE
J075189H21CGCCACGTCNONE
J075197F20CGCCACGTCNONE
J075199J08CGCCACGTCNONE
J080307B22CGCCACGTCNONE
J090076J18CGCCACGTCNONE
Os04g0423600AK065331CGCCACGTNuclear protein SET domain containing protein.
J013000M22CGCCACGTNONE
J013069D18CGCCACGTNONE
J023099G24CGCCACGTNONE
J033041P19CGCCACGTNONE
Os04g0434400014-079-B10GCCACGTCNONE
AK063725GCCACGTCConserved hypothetical protein.
Os04g0435700AK100857GCCACGTGGGACCSimilar to UVB-resistance protein UVR8.
Os04g0457000006-027-A09CACGTGGCGNONE
006-027-D01CACGTGGCGNONE
006-030-G04CACGTGGCGNONE
006-038-H12CACGTGGCGNONE
006-042-E09CACGTGGCGNONE
006-049-C02CACGTGGCGNONE
006-049-C09CACGTGGCGNONE
006-052-C03CACGTGGCGNONE
006-053-C01CACGTGGCGNONE
006-054-B08CACGTGGCGNONE
006-054-G05CACGTGGCGNONE
006-058-A06CACGTGGCGNONE
006-059-G07CACGTGGCGNONE
006-088-F04CACGTGGCGNONE
006-091-G07CACGTGGCGNONE
006-093-C04CACGTGGCGNONE
006-093-H03CACGTGGCGNONE
006-094-B05CACGTGGCGNONE
006-097-B05CACGTGGCGNONE
006-097-E02CACGTGGCGNONE
006-098-G09CACGTGGCGNONE
006-099-A11CACGTGGCGNONE
006-099-B09CACGTGGCGNONE
006-099-E10CACGTGGCGNONE
006-111-A07CACGTGGCGNONE
006-111-H12CACGTGGCGNONE
006-114-B12CACGTGGCGNONE
006-115-H03CACGTGGCGNONE
009-042-G09CACGTGGCGNONE
009-117-G09CACGTGGCGNONE
009-121-E02CACGTGGCGNONE
009-162-H07CACGTGGCGNONE
011-063-C05CACGTGGCGNONE
AK066070CACGTGGCGSimilar to Chlorophyll a/b-binding protein CP24, photosystem II (Fragment).
AK104811CACGTGGCGNONE
J013055K10CACGTGGCGNONE
J013072C14CACGTGGCGNONE
J013091A08CACGTGGCGNONE
J013123L18CACGTGGCGNONE
J013129M15CACGTGGCGNONE
J013135J21CACGTGGCGNONE
J013170D09CACGTGGCGNONE
J023107N10CACGTGGCGNONE
J065142G08CACGTGGCGNONE
J075023K20CACGTGGCGNONE
J075119K14CACGTGGCGNONE
J075134I20CACGTGGCGNONE
J075161H06CACGTGGCGNONE
J080014L13CACGTGGCGNONE
J080026H08CACGTGGCGNONE
J080070F02CACGTGGCGNONE
J080070G22CACGTGGCGNONE
J080093H23CACGTGGCGNONE
J080305C11CACGTGGCGNONE
J080305H15CACGTGGCGNONE
J080317P21CACGTGGCGNONE
J090023F10CACGTGGCGNONE
J100061O10CACGTGGCGNONE
Os04g0462500006-073-E08GCCACGTGNONE
AK062065GCCACGTGNONE
AK071311GCCACGTGSimilar to 14-3-3-like protein GF14-6.
AK071822GCCACGTGNONE
AK099243GCCACGTGNONE
AK101938GCCACGTGNONE
J013056F02GCCACGTGNONE
J023020E08GCCACGTGNONE
J023085B16GCCACGTGNONE
J023117D08GCCACGTGNONE
J023133K12GCCACGTGNONE
J033025G04GCCACGTGNONE
J033052A15GCCACGTGNONE
J033074G16GCCACGTGNONE
J033090A16GCCACGTGNONE
J033122A07GCCACGTGNONE
J033133G09GCCACGTGNONE
J065002F16GCCACGTGNONE
J065030M09GCCACGTGNONE
J065056B11GCCACGTGNONE
J065115I10GCCACGTGNONE
J065120O09GCCACGTGNONE
J065124G21GCCACGTGNONE
J075031C14GCCACGTGNONE
J075040H07GCCACGTGNONE
J075047F04GCCACGTGNONE
J075065F14GCCACGTGNONE
J075066G20GCCACGTGNONE
J075105D01GCCACGTGNONE
J075147B04GCCACGTGNONE
J075149A12GCCACGTGNONE
J075172D07GCCACGTGNONE
J075190J11GCCACGTGNONE
J090038H18GCCACGTGNONE
J090087G05GCCACGTGNONE
J100025A10GCCACGTGNONE
J100025O10GCCACGTGNONE
J100027D02GCCACGTGNONE
J100027P06GCCACGTGNONE
J100032K04GCCACGTGNONE
J100056D21GCCACGTGNONE