
Summary of TGAC (All list)

Organism Oryza sativa
Description "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);
Total Entry Count 5971

Entry Sequences (5971 entries)

LocusGene modelSequenceDescription
AK102309CCTGTCAGTSimilar to Alpha-xylosidase precursor (Fragment).
Os01g0138500AK073435GGTGACGTProtein of unknown function DUF789 family protein.
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein.
Os01g0140100AK068990GTGACGTGPeptidase A1, pepsin family protein.
Os01g0156300AK107993GTGTCACTGACASimilar to Cappuccino protein.
AK066699CACGTCACProtein of unknown function DUF410 family protein.
Os01g0167400AB051107CCTGTCAGTGSimilar to Protein synthesis inhibitor II (EC (Ribosome-inactivating protein II) (rRNA N-glycosidase).
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein.
AK105331CACGTCACCConserved hypothetical protein.
D16499CACGTCACNADP-dependent malic enzyme, chloroplast precursor (EC (NADP-ME).
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein.
AK070272TGTCAGTGThioredoxin domain 2 containing protein.
Os01g0212700AK108311CACGTCACCZinc finger, RING-type domain containing protein.
Os01g0214200AK061229CACTGACALipolytic enzyme, G-D-S-L family protein.
Os01g0218700AK064992TGTCAGTGABC transporter, transmembrane region, type 1 domain containing protein.
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein.
AK101946GAGACGTGACGTGZinc finger, BED-type predicted domain containing protein.
Os01g0224500AK109225CCTGTCAGConserved hypothetical protein.
Os01g0229400AB029508TGTCAGTGSmall GTP-binding protein OsRac1.
Os01g0232400AK101990AGTGACACSimilar to VHS1 protein (Fragment).
Os01g0238700AK121040AGTGACACOligopeptide transporter OPT superfamily protein.
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein.
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
Os01g0255100AK058528CACTGACASimilar to Soluble epoxide hydrolase.
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein.
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein.
AK067786CCACTGACAConserved hypothetical protein.
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC (PK).
AK105130TGTCAGTGGConserved hypothetical protein.
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein.
AK109672GTGACGTGTGGCGTGConserved hypothetical protein.
Os01g0286200AK111156CACTGACAConserved hypothetical protein.
Os01g0293100AK106850CTGTCAGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK106850GTCAGTGGGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os01g0321800AK064712ACGTCACCGas vesicle protein GvpC repeat containing protein.
Os01g0327500AK107756CACTGACAGGTGGGConserved hypothetical protein.
J065199J12AGTGACACConserved hypothetical protein.
AK120842GGTGACGTSimilar to 60S ribosomal protein L23a (L25).
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein.
Os01g0373500AK107175CTGTCAGTConserved hypothetical protein.
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein.
AK068824GGTGACGTSimilar to Cinnamyl alcohol dehydrogenase.
AK105807CCACTGACFF domain containing protein.
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment).
Os01g0579900AK065133CCTGTCAGEsterase/lipase/thioesterase domain containing protein.
AK064970GTGTCACTProtein of unknown function DUF630 domain containing protein.
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel.
Os01g0604100AK099765CCTGTCAGUspA domain containing protein.
AK105136CACGTCACGlutelin family protein.
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein.
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein.
AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein.
Os01g0624700AK111416AGTGACACSimilar to WRKY transcription factor 12.
Os01g0633200AK069077GTGTCACTSimilar to X1 (Fragment).
AK067056GTGACGTGProtein of unknown function DUF1645 family protein.
Os01g0649900AK068077CCACTGACLipolytic enzyme, G-D-S-L family protein.
Os01g0663300AK071667CCACTGACASimilar to (1-4)-beta-mannan endohydrolase-like protein.
AK060072CCACCTGTCAGTGTranscriptional coactivator/pterin dehydratase family protein.
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein.
Os01g0673500AK065017CACTGACASimilar to Katanin p60 ATPase-containing subunit A1 (EC (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
AK099934CCACTGACConserved hypothetical protein.
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein.
Os01g0694500AK108063GTGTCACTConserved hypothetical protein.
Os01g0716200AK062106CTGTCAGTIQ calmodulin-binding region domain containing protein.
AK062106GTGTCACTGACAGIQ calmodulin-binding region domain containing protein.
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein.
Os01g0733200AK066316CACGTCACSimilar to Heat shock transcription factor 29 (Fragment).
Os01g0738400AK110661GTGTCACTSimilar to Zn-finger transcription factor.
AK121118TGTCAGTGConserved hypothetical protein.
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein.
Os01g0752600AK100905GTGTCACTGlycosyl transferase, family 19 protein.
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein.
J065091N13GTGTCACTConserved hypothetical protein.
AK066596TGTCAGTGGlycerophosphoryl diester phosphodiesterase family protein.
Os01g0766400AK073493CTGTCAGTConserved hypothetical protein.
Os01g0770800AK109200GTGTCACTCtr copper transporter family protein.
Os01g0778700AK064933CACTGACAConserved hypothetical protein.
AK064933GTGTCACTConserved hypothetical protein.
AK122155CACCTGTCAGConserved hypothetical protein.
Os01g0799500AK109346CTGACAGGDNA glycosylase family protein.
AK061770GTGACGTGCysteine proteinase inhibitor-I (Oryzacystatin-I).
Os01g0818300AK063274GTGACGTGKH domain containing protein.
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment).
Os01g0827500AK111814TGTCAGTGExo70 exocyst complex subunit family protein.
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein.
Os01g0843700J065093C02CACGTCACCConserved hypothetical protein.
Os01g0844800AK099801TGTCAGTGSimilar to Pumilio RBD (Fragment).
Os01g0846300AK065949CACGTCACSimilar to Protein phosphatase 2C.
Os01g0846600AK070193CCACTGACAProtein of unknown function DUF248, methyltransferase putative family protein.
AK063795GTGTCACTConserved hypothetical protein.
AK100718CACTGACASimilar to Aldose reductase (EC (AR) (Aldehyde reductase) (20-alpha- hydroxysteroid dehydrogenase) (EC (20-alpha-HSD).
AK059798TGTCAGTGPrenylated rab acceptor PRA1 family protein.
Os01g0848550J065073P06GGTGACGTGConserved hypothetical protein.
AK071410GGACACGTCACSimilar to Uricase (Fragment).
Os01g0866400AB007193CACGTCACCSimilar to Fructose-1,6-bisphosphatase (EC (Fragment).
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein.
AK121602CTGACAGGProtein of unknown function DUF639 family protein.
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein.
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein.
AK067564GTGTCACTProtein of unknown function DUF1012 family protein.
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein.
Os01g0884400AK072566CCTGTCAGTGU box domain containing protein.
Os01g0891700AK105471CTGACAGGLeucine rich repeat, N-terminal domain containing protein.
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC
AK068254CACGTCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os01g0904500AK119437TGTCAGTGConserved hypothetical protein.
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein.
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1.
Os01g0913300AK100698GTGACGTGTGF-beta receptor, type I/II extracellular region family protein.
Os01g0914000AK101364ACGTCACCConserved hypothetical protein.
AK105463CACGTCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
J100058A08CTGTCAGTConserved hypothetical protein.
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
Os01g0922100AK110737GTGACGTGConserved hypothetical protein.
Os01g0937000AK108620CTGACAGGPeptidase A1, pepsin family protein.
AK062680GTGACGTGConserved hypothetical protein.
AK068399CACGTGTCACTProtein of unknown function DUF563 family protein.
AK105424CCACTGACAGGCBS domain containing protein.
AK104420GTGTCACTSimilar to Peroxidase 12 precursor (EC (Atperox P12) (PRXR6) (ATP4a).
AK069516GTCAGTGGDrought induced 19 family protein.
Os01g0976800J065105P05CCCACTCCCACTGACZinc finger, GATA-type domain containing protein.
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC (Glutamate--tRNA ligase) (GluRS).
Os02g0127900AK102783GGTGACGTHypothetical protein.
AK102783GGTGACGTGGCHypothetical protein.
AK102708AGTGACACZinc finger, RING-type domain containing protein.
Os02g0133900AK107180CACTGACACTGACAProtein of unknown function DUF829, eukaryotic family protein.
AK107180GTCAGTGGProtein of unknown function DUF829, eukaryotic family protein.
Os02g0138600AK071778CACTGACAProtein of unknown function DUF1677, Oryza sativa family protein.
AK119650CACGTCACMAP kinase MAPK2 (MAP kinase 3).
Os02g0160000AK062904CACGTCACSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y- 1140 of Kluyveromyces lactis.
Os02g0161800AK105544AGTGACACSimilar to Peroxidase precursor (EC
Os02g0192500AK102694AGTGACACSimilar to Cellulose synthase-like protein (Fragment).
Os02g0194400AK110011TGTCAGTGProtein kinase-like domain containing protein.
Os02g0199300AK064726TGTCAGTGPeptidylprolyl isomerase, FKBP-type domain containing protein.
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein.
AK101434GTGTCACTGACAWD40-like domain containing protein.
Os02g0215100AK110993CACTGACAConserved hypothetical protein.
AK120885GTGACGTGEarly nodulin.
Os02g0236200AK073725ACTGACAGSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1).
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein.
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein.
AK065304GGTGACGTGConserved hypothetical protein.
AK107002TGTCAGTGHelix-loop-helix DNA-binding domain containing protein.
Os02g0316200AK073932CACTGACAGGCyclin-like F-box domain containing protein.
Os02g0320300AK067650AGTGACACHypothetical protein.
Os02g0326700AK064977GGTGACGTGRhomboid-like protein family protein.
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein.
Os02g0468200AK103767CACGTCACCProtein of unknown function DUF652 family protein.
Os02g0490000AK106789AGTGACACU box domain containing protein.
Os02g0491300J065205O09CCCACCTGTCAGConserved hypothetical protein.
Os02g0491400AK073233CACTGACASimilar to Peptidylprolyl isomerase.
AK073233CCACTGACSimilar to Peptidylprolyl isomerase.
Os02g0504800AK069683CTGACAGGSimilar to Delta-9 stearoyl-acyl carrier protein desaturase (EC (Fragment).
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
Os02g0510600AK073949GTGTCACTHeavy metal transport/detoxification protein domain containing protein.
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein.
AK121139CACTGACAConserved hypothetical protein.
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein.
AK063102GCCACGTCACCConserved hypothetical protein.
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein.
Os02g0574600AK059246CACCTGTCAGTConserved hypothetical protein.
Os02g0575000AK121198ACGTCACCConserved hypothetical protein.
AK121198ACGTCACCConserved hypothetical protein.
Os02g0576400AK107966CACGTCACConserved hypothetical protein.
Os02g0578201J065065K19CACTGACAConserved hypothetical protein.
AK070989GGTGACGTGConserved hypothetical protein.
AK066974CACTGACAAGTGGGTCCAGAIQ calmodulin-binding region domain containing protein.
AK101873CACGTCACBromodomain containing protein.
AK101873CACTGACAGGTGGBromodomain containing protein.
AK099756AGTGACACSimilar to Ankyrin-kinase protein (Fragment).
AK099756CCACTGACASimilar to Ankyrin-kinase protein (Fragment).
AK105867ACTGACAGSimilar to Epstein-Barr virus (B95-8 isolate) U2-IR2 domain encoding nuclear protein EBNA2, complete cds.
Os02g0611500AK072083AGTGACACSimilar to Eukaryotic initiation factor-like protein.
AK098853GCCCCCACTGACConserved hypothetical protein.
AK101006TGTCAGTGSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC (Succinyl-CoA synthetase, beta chain) (SCS-beta).
AK101791GTCAGTGGSimilar to Adenosine kinase-like protein (Fragment).
Os02g0658033J090015D03CACGTCACPleckstrin-like domain containing protein.
Os02g0659100AK107559AGTGACACZinc finger, C2H2-type domain containing protein.
AK106401TGTCAGTGProtein prenyltransferase domain containing protein.
Os02g0686300AK066567CGCGCGAGTGACACConserved hypothetical protein.
Os02g0686700AK111294CCACTGACProtein of unknown function DUF581 family protein.
Os02g0690600AK110831CACGTCACU box domain containing protein.
Os02g0697700AK120209CACTGACAConserved hypothetical protein.
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV.
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).
Os02g0732600AK108709TGTCAGTGSimilar to Typical P-type R2R3 Myb protein (Fragment).
AK109397CCACTGACAGlutamine synthetase shoot isozyme (EC (Glutamate--ammonia ligase) (Clone lambda-GS28).
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment).
Os02g0745400AK072229AAAAGCCCCACATGTCAGTGACACGlycosyl transferase, family 8 protein.
Os02g0750500AK101960GTGTCACTGACATGTGGGGCCTGGSAM (and some other nucleotide) binding motif domain containing protein.
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein.
Os02g0754700AK066904GGTGACGTSimilar to Histidyl-tRNA synthetase (EC
AK062900GTGTCACTSimilar to Phi-1 protein.
Os02g0759500AK072404TGTCAGTGGProtein prenyltransferase domain containing protein.
Os02g0761600AK120494CCACTGACAConserved hypothetical protein.
AK120494TGTCAGTGConserved hypothetical protein.
AK110321AGTGACACConserved hypothetical protein.
AK110321CACGTCACConserved hypothetical protein.
AK059779CACGTCACProtein of unknown function DUF1685 family protein.
Os02g0766700AK072062ATCCCCCACACCACTGACASimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2).
AK072062GTGTCACTSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2).
Os02g0773300AK071811CACTGACAPyridoxal phosphate-dependent deaminase family protein.
Os02g0778200AK065948GTGTCACTAminoacyl-tRNA synthetase, class I family protein.
AK061791CACTGACAConserved hypothetical protein.
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein.
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1.
AK105863CTGACAGGZinc finger, CCCH-type domain containing protein.
Os02g0803600AK064750ACGTCACCLongin-like domain containing protein.
Os02g0815200AK067252ACTGACAGGSimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29).
AK100771CACTGACATransferase family protein.
Os02g0824400AK121390CACGTCACConserved hypothetical protein.
Os02g0824500AK111296GTGACGTGSimilar to Remorin.
Os02g0826200AK070787CTGACAGGdTDP-4-dehydrorhamnose reductase family protein.
AK101841GTGACGTGACGTGProtein prenyltransferase domain containing protein.
Os02g0832700AK099439ACTGACAGSimilar to Metal tolerance protein C2 (AtMTPc2).
AK058286ACGTCACCProtein kinase-like domain containing protein.
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein.
Os03g0119900AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)].
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein.
AK101458CACTGACAProtein kinase-like domain containing protein.
Os03g0124100AK107007CCACTGACFringe-like family protein.
Os03g0124200AK102524GTCAGTGGSimilar to Pto-like protein kinase F.
AK071745AGCCCATCTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC
AK071745CTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC
AK101118CGCACCGCGACACGTCACGTCTCProtein of unknown function DUF221 domain containing protein.
AK072119TGTCAGTGTGF-beta receptor, type I/II extracellular region family protein.
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC
AK121641CACTGACASimilar to Cell division control protein 48 homolog A (AtCDC48a).
AK121527CACTGACASimilar to Small GTP-binding protein.
Os03g0152000AK102357ACTGACAGGHeavy metal transport/detoxification protein domain containing protein.
Os03g0158800AK108516AGTGACACACTGACASimilar to P69C protein.
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein.
Os03g0160200AK064836GTGACGTGGACCGGACGCGTCCConserved hypothetical protein.
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1).
AK066932GGTGACGTGTCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1).
Os03g0169500Os03g0169500CTGACAGGSimilar to Cellulose synthase-like A4.
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
AK111195CCCACCTGTCAGConserved hypothetical protein.
AK103762TGTCAGTGConserved hypothetical protein.
Os03g0181600AK067807ACTGACAGSimilar to GATA transcription factor 25 (ZIM-like 2 protein).
Os03g0187350J065013L15GTGACGTGHypothetical protein.
AK058535GTGACGTGSimilar to Cyanelle 30S ribosomal protein S10.
J065152P14CCCACCTGTCAGTGConserved hypothetical protein.
Os03g0200400AK107086TGTCAGTGConserved hypothetical protein.
Os03g0206400AK066494CCACTGACAConserved hypothetical protein.
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein.
Os03g0212300AK070861GTGTCACTTranscriptional factor B3 family protein.
Os03g0215800AK071308CACGTCACCPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein.
Os03g0232600AK068218TGTCAGTGU box domain containing protein.
Os03g0238800AY224467CCACTGACAConserved hypothetical protein.
Os03g0239300AK066038CACTGACAZinc finger, C2H2-type domain containing protein.
Os03g0245500AK064707ATCCCCCACTGACACurculin-like (mannose-binding) lectin domain containing protein.
AK119298CACTGACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment).
Os03g0251800AK067333CGCCACGTCACSimilar to Possible OmpA family member precursor.
AK109239CACGTCACConserved hypothetical protein.
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein.
Os03g0281600AK070260CACTGACASimilar to Ca2+-ATPase.
AK065887CCACTGACSimilar to In2-1 protein.
AK121300GTGGCCCACATGTCAGTGHAD-superfamily subfamily IIA hydrolase, CECR5 protein.
Os03g0284600AK110712CACTGACATGTGGGCCACThioredoxin fold domain containing protein.
Os03g0285900AK073348GTGTCACTSimilar to Splicing factor RSZ33.
Os03g0288700AK110718GGACACGTCACCAcid phosphatase/vanadium-dependent haloperoxidase family protein.
Os03g0298300AK061180CTGTCAGTGProtein of unknown function DUF588 family protein.
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein.
AK068534CCCACCTGTCAGProtein prenyltransferase domain containing protein.
AK068241CACGTCACEnoyl-CoA hydratase/isomerase domain containing protein.
Os03g0310600AK109731GTGTCACTProtein of unknown function DUF247, plant family protein.
AK062978CCACTGACAConserved hypothetical protein.
AK108821CCACTGACSimilar to Phospholipid-transporting ATPase 1 (EC (Aminophospholipid flippase 1).
Os03g0328100AK107122CACGTCACSimilar to Axi 1 (Auxin-independent growth promoter)-like protein.
Os03g0333000AK109811CACGTCACConserved hypothetical protein.
Os03g0333100AK101050GTGACGTGProtein of unknown function DUF663 domain containing protein.
Os03g0338000AK121399GTGACGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
AK102158CCACTGACASimilar to Sucrose synthase (EC
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC
Os03g0370000AK100033CCCACCTGTCAGSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein.
AK068223ACTGACAGPlant lipid transfer protein/Par allergen family protein.
AK058567GTGTCACTProteasome subunit alpha type 2 (EC (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
Os03g0416300AK103650ACTGACAGSimilar to Phytochelatin synthetase (Fragment).
AK101797CTGACAGGConserved hypothetical protein.
Os03g0421800AK099491CCTGTCAGVirulence factor, pectin lyase fold family protein.
AK099491CCTGTCAGTVirulence factor, pectin lyase fold family protein.
AK063543TGTCAGTGConserved hypothetical protein.
Os03g0425900AK105583CCTGTCAGTZinc finger, C2H2-type domain containing protein.
AK100305GTGACGTGProtein of unknown function DUF563 family protein.
AK105133CTGTCAGTProtein of unknown function UPF0136, Transmembrane family protein.
Os03g0596800AK073603CCCACGTGTCAGTGConserved hypothetical protein.
AK063673CACGTCACCSimilar to THA4.
Os03g0666200AK102364CACTGACAGPleckstrin homology-type domain containing protein.
AK065363ACGTCACCBTB domain containing protein.
AK065363GTGACGTGBTB domain containing protein.
AK065253GTCAGTGGConserved hypothetical protein.
Os03g0687800AK106820CACCTGTCAGConserved hypothetical protein.
AK066652CTGACAGGPescadillo, N-terminal domain containing protein.
Os03g0709100AK061596CACTGACASimilar to Basic blue protein (Cusacyanin) (Plantacyanin) (CBP).
Os03g0712800AK063913CCACTGACSimilar to Glutamine synthetase root isozyme 2 (EC (Glutamate--ammonia ligase).
Os03g0722500AK099926AGTGACACGlycoside hydrolase, family 17 protein.
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin).
Os03g0735000AK069296CCACTGACSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment).
AK062272CTGTCAGTUncharacterized protein UPF0114 family protein.
Os03g0744800AK059983GCCACGTCACemp24/gp25L/p24 family protein.
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein.
AK068199CACTGACAConserved hypothetical protein.
Os03g0757200AK071136CACGTCACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK072833CTGACAGGCTTTCCCSimilar to ER33 protein (Fragment).
AK073162CCACTGACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6).
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6).
Os03g0781000AK065910GTGTCACTSimilar to GTP-dependent nucleic acid-binding protein engD.
Os03g0786800AK059186GTGTCACTSimilar to Cullin-4A (CUL-4A).
Os03g0798300AK108034CACTGACASimilar to Cytosine-5 DNA methyltransferase MET1 (Fragment).
AK070731ACGTCACCAAA ATPase domain containing protein.
AK060010GGTGACGTGGCSimilar to Short-chain alcohol dehydrogenase.
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein.
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H.
AK067585ACGTCACCZinc finger, RING-type domain containing protein.
Os03g0817200AK121940GTGTCACTAmino acid/polyamine transporter II family protein.
AK121701GGTGACGTGTCACTHistidine acid phosphatase family protein.
Os03g0818200AK058641CTGTCAGTNAD-dependent epimerase/dehydratase family protein.
Os03g0821900AK070847CACGTCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-).
Os03g0822300AK060050GCCACGTCACRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein.
AK070075CCACTGACAAGTGGGTCCCConserved hypothetical protein.
Os03g0823500AK058972CCACTGACTGF-beta receptor, type I/II extracellular region family protein.
Os03g0825700AK067902CACGTCACCSimilar to Defective in exine formation.
Os03g0825900AK109694CACGTCACConserved hypothetical protein.
AK119707GGTGACGTConserved hypothetical protein.
Os03g0832200AK070712TGTCAGTGSimilar to Calcium-binding protein precursor (Calreticulin).
Os03g0832600AK120137CCACTGACSimilar to Galactokinase (EC (Galactose kinase).
Os03g0835600AK101677CACGTCACAcyl-coA-binding protein, ACBP family protein.
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein.
AK068346TGTCAGTGStreptomyces cyclase/dehydrase family protein.
AK119894GTGTCACTCurculin-like (mannose-binding) lectin domain containing protein.
Os03g0839900AK067347CTGTCAGTGACACUspA domain containing protein.
Os03g0844800AK071813CTGTCAGTConserved hypothetical protein.
AK069447CACGTGTCACTBacterial transketolase family protein.
Os04g0271700AK059031CACGTCACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os04g0283700AK063831CTGACAGGChromo domain containing protein.
AK062974GCCACGTCACCHypothetical protein.
Os04g0291000Os04g0291000AGTGACACGlucose/ribitol dehydrogenase family protein.
AK061121AGGGCCCACCTGTCAGReticulon family protein.
Os04g0389800AK109628CACTGACASimilar to Acetohydroxyacid synthase.
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component.
AK098921CCTGTCAGSimilar to 2-oxoglutarate dehydrogenase, E1 component.
Os04g0390700AK107261GTGACGTGTCGGlucose/ribitol dehydrogenase family protein.
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit.
Os04g0432000AB125308GTGTCACTSerine/threonine-protein kinase SAPK7 (EC (Osmotic stress/abscisic acid-activated protein kinase 7).
AK101115CACGTCACProtein prenyltransferase domain containing protein.
Os04g0447400AK070858CACGTCACCSimilar to Glutamate decarboxylase 2 (EC (GAD 2).
Os04g0447500AK064090GGTGACGTGSimilar to NADPH-dependent codeinone reductase (EC
AK061024AGTGACACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK065178GTGTCACTSimilar to TMV induced protein 1-2.
AK062816ACTGACAGHeavy metal transport/detoxification protein domain containing protein.
AK065793CCACTGACSimilar to Cyanogenic beta-glucosidase precursor (EC (Linamarase) (Fragment).
AK121520CACTGACA2OG-Fe(II) oxygenase domain containing protein.
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment).
AK070908CCACTGACSimilar to TA5 protein (Fragment).
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein.
Os04g0492600AK072226GTGTCACTAnticodon-binding domain containing protein.
Os04g0503500AK099404CCACTGACALeucine-rich repeat, cysteine-containing subtype containing protein.
AK099404TGTCAGTGLeucine-rich repeat, cysteine-containing subtype containing protein.
Os04g0504700AK068596CCTGTCAGTGConserved hypothetical protein.
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein.
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein.
Os04g0537800AK103654CCACTGACProtein of unknown function DUF26 domain containing protein.
Os04g0549300AK063296CCACTGACASimilar to GA protein (Fragment).
Os04g0552400AK069623CACGTGTCACTSimilar to ZPT2-13.
Os04g0558400AK061440ACTGACAGGAcyl-CoA thioesterase family protein.
AK061440GGTCCCACCTGACAGGAcyl-CoA thioesterase family protein.
Os04g0564700AK111806CACGTCACCQuinonprotein alcohol dehydrogenase-like domain containing protein.
AK058888ACGTCACCAmino acid/polyamine transporter II family protein.
Os04g0577700AK108703CACGTCACProtein of unknown function DUF623, plant domain containing protein.
AK058642CACGTCACSimilar to Secretory carrier membrane protein.
Os04g0599000AK111508CCTGTCAGEGF-like, type 3 domain containing protein.
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein.
AK072824GTCAGTGGConserved hypothetical protein.
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein.
AK066289CCACTGACPeptidase M24A, methionine aminopeptidase, subfamily 1 protein.
AK067276GCCACGTCACBromodomain containing protein.
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase).
AK067760GTCAGTGGATGGGGlycosyl transferase, family 8 protein.
AK067501ACGTCACCSimilar to Vacuolar ATP synthase subunit D (EC (V-ATPase D subunit) (Vacuolar proton pump D subunit).
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein.
Os04g0662400AK108652CACTGACAAuxin responsive SAUR protein family protein.
AK105958CCTGTCAGZinc finger, CCCH-type domain containing protein.
AK105958GTGTCACTZinc finger, CCCH-type domain containing protein.
AK068004CTGACAGGTLDc domain containing protein.
Os04g0667000AK069874ACTGACAGGTafazzin family protein.
AK121152CACCGCACGTCACSimilar to Ripening-associated protein (Fragment).
Os04g0679800AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein.
AK121739CACGTCACPeptidase T2, asparaginase 2 family protein.
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC
Os04g0686700AK105746CACTGACAGTGGGTCCKelch repeat containing protein.
AK098928CCACTGACACGTGGGSimilar to T24D18.17 protein (Tubby-like protein TULP8).
AK121142TGTCAGTGConserved hypothetical protein.
Os05g0115200AK106709CACTGACAAGGTGGGCCCTConserved hypothetical protein.
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein.
Os05g0116500AK102231GTCAGTGGConserved hypothetical protein.
Os05g0119200AK067943CACGTCACConserved hypothetical protein.
AK099495AGTGACACXYPPX repeat containing protein.
J100053B03TGTCAGTGHaem peroxidase family protein.
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor.
Os05g0145100AK107957CACGTCACCConserved hypothetical protein.
AK104336CCACTGACAGGSimilar to Na+/H+ antiporter.
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein.
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
AK071561CCACCTGTCAGTGGSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
AK069814GGTGACGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein.
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein.
Os05g0186900AK111403TGTCAGTGConserved hypothetical protein.
009-114-F04AGTGACACGTGGCConserved hypothetical protein.
AK065594AGTGACACSimilar to Transcription factor MYBS2.
AK103861CACTGACASimilar to Serine/threonine-protein kinase PBS1 (EC (AvrPphB susceptible protein 1).
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator.
Os05g0222200AK068591AGTGACACABC transporter related domain containing protein.
Os05g0297900AK071238TAAGCCCAGTGACGTGSimilar to Signal peptidase 18 subunit (Fragment).
AK067846TAGGCCCACTGACConserved hypothetical protein.
Os05g0319800AK100483TGTCAGTGGSimilar to Plasma membrane H+ ATPase (EC
Os05g0323100AK109472CACTGACARhodanese-like domain containing protein.
AK060058CACGTCACCConserved hypothetical protein.
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7.
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7.
AK102727GCCACGTCACProtein of unknown function DUF538 family protein.
AK102727GCCACGTCACProtein of unknown function DUF538 family protein.
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein.
AK072064CCACTGACACGTGGACCMitochondrial substrate carrier family protein.
AK100184GTCAGTGGSimilar to EREBP-2 protein (Fragment).
AK100184GTGTCACTSimilar to EREBP-2 protein (Fragment).
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein.
Os05g0367900Os05g0367900CACGTCACHarpin-induced 1 domain containing protein.
Os05g0368700AK064686ACGTCACCSimilar to Subtilisin-like protease (Fragment).
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2).
AK073634GGTGACGTReticulon family protein.
Os05g0389800AK108808CACTGACASimilar to ATP-dependent helicase DHX8 (RNA helicase HRH1) (DEAH-box protein 8).
Os05g0391000AK109555ACGTCACCConserved hypothetical protein.
AK100039GTCAGTGGSimilar to PAC (Fragment).
Os05g0404700Os05g0404700GTGACGTGZinc finger, CW-type domain containing protein.
Os05g0406100AK069515GTGTCACTInosine/uridine-preferring nucleoside hydrolase domain containing protein.
AK099640GTCAGTGGLeucine rich repeat, N-terminal domain containing protein.
Os05g0408200AK100057CACTGACASBP domain containing protein.
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor.
AK103559CCACTGACGGCTCGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein.
Os05g0430300AK121670CTGTCAGTProtein of unknown function DUF668 family protein.
AK060776ACTGACAGPeptidase A22, presenilin signal peptide family protein.
AK106328AGTGACACConserved hypothetical protein.
Os05g0445000AK111423AGTGACACConserved hypothetical protein.
Os05g0446000AK070640GTGTCACTSimilar to Transcriptional activator DEMETER (DNA glycosylase-related protein DME).
Os05g0451300AK108341GGGCCCCACCTGTCAGConserved hypothetical protein.
AK068616GTGTCACTSimilar to Aldose reductase.
AK061873CCACTGACASelT/selW/selH selenoprotein family protein.
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein.
Os05g0477100AK108641ACTGACAGGConserved hypothetical protein.
Os05g0490900AK111382CACTGACAConserved hypothetical protein.
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment).
AK106936TGTCAGTGConserved hypothetical protein.
AK122090CACGTCACCSimilar to MS5-like protein (Fragment).
AK106758CACGTCACCSimilar to Thioredoxin H.
Os05g0510100Os05g0510100CCACTGACProtein of unknown function DUF567 family protein.
Os05g0529300AK102648CGCCACGTCACCSimilar to ER lumen protein retaining receptor (HDEL receptor).
AK063846GGTGACGTCACCConserved hypothetical protein.
AK063846GGTGACGTGGCGConserved hypothetical protein.
Os05g0533600AK067577CACTGACATGTGGGCCGCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like).
Os05g0535100AK063362CCACCTGTCAGSimilar to Beta-1,3-glucanase-like protein.
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein.
AK101555CAAGGCCCCACACGTCACIQ calmodulin-binding region domain containing protein.
AK101555TGTCAGTGIQ calmodulin-binding region domain containing protein.
Os05g0539400AK068572CGCCACGTCACTCCACGCCGlycoside hydrolase, family 35 protein.
AK103819CACGTCACCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a).
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC (Stt7 homolog).
AK068460AGGGCCCACTGTCAGTGSimilar to 50S ribosomal protein L21, mitochondrial precursor.
AK100389GCCACGTCACCSimilar to Blast and wounding induced mitogen-activated protein kinase.
AK121133AGTGACACDNA glycosylase family protein.
Os05g0586600AB096011CCACGTGTCACTPlastid sigma factor SIG5.
AK120464ACGTCACCConserved hypothetical protein.
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein.
AK105360TGTCAGTGSimilar to Cyclophilin-like protein PPIL3b.
Os06g0136000AK060303CACTGACASimilar to Hypersensitive-induced reaction protein 4.
Os06g0136600AK069316CACTGACATGTGGGCCCTSimilar to Enolase 1 (EC (2-phosphoglycerate dehydratase 1) (2-phospho- D-glycerate hydro-lyase 1).
Os06g0136900AK107405GTGACGTGGCCGTGGProtein of unknown function DUF296 domain containing protein.
Os06g0140900AK058823CACGTCACSigma factor, regions 3 and 4 domain containing protein.
AK106249GTGACGTGTransferase family protein.
Os06g0156700AK107226GGTGACGTLipolytic enzyme, G-D-S-L family protein.
Os06g0161800AK064664CCTGTCAGProtein of unknown function DUF569 family protein.
AK103637CACTGACAGSimilar to Prolin rich protein.
Os06g0171700AK103771GTGACGTGGCGTGCdk-activating kinase assembly factor (MAT1) family protein.
AK100878GTCAGTGGSimilar to Plasma membrane H+-ATPase (EC
Os06g0194400AK102980CACTGACAAGTGGGCCCACTTranscriptional factor B3 family protein.
Os06g0199100AK120323CCTGTCAGProtein prenyltransferase domain containing protein.
Os06g0224900AK065678TGTCAGTGGMitochodrial transcription termination factor-related family protein.
Os06g0225400AK109268AGTGACACConserved hypothetical protein.
AK102752CACTGACATB2/DP1 and HVA22 related protein family protein.
AF419099ACGTCACCSimilar to Starch synthase IIA.
AK063118CACTGACAConserved hypothetical protein.
AK063118CACTGACAConserved hypothetical protein.
Os06g0233200AK108060CCTGTCAGSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8).
Os06g0239500AK064959GTCAGTGGTGF-beta receptor, type I/II extracellular region family protein.
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein.
AK067794AGTGACACKetose-bisphosphate aldolase, class-II family protein.
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein.
AK061872CACGTCACGTCACPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein.
AK101229GTCAGTGGBZR1, transcriptional repressor family protein.
Os06g0587300AK069419CACTGACATGTGGGCCCCACAConserved hypothetical protein.
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein.
Os06g0589600AK111758GTGTCACTProtein kinase-like domain containing protein.
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter.
AK101377GGTGACGTGSimilar to Fatty acid elongase 1-like protein.
AK104955CACTGACASimilar to Heme oxygenase 1 (Fragment).
AK066422CCACTGACAGSimilar to Ethylene response factor 1.
Os06g0611500AK072708GTCAGTGGSimilar to Polygalacturonase (Fragment).
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein.
AK110866CCACTGACAConserved hypothetical protein.
AK058459GCCACGTCACSimilar to Thioredoxin peroxidase.
Os06g0633900Os06g0633900TGTCAGTGGEsterase/lipase/thioesterase domain containing protein.
Os06g0636700AK058562CACGTCACLipolytic enzyme, G-D-S-L family protein.
AK058562CACGTCACCLipolytic enzyme, G-D-S-L family protein.
Os06g0643800AK071732CTGTCAGTSimilar to Sucrose-phosphate synthase 7 (EC (Fragment).
Os06g0646600AB061818AGTGACACKNOX family class 2 homeodomain protein.
AK062354CACGTCACSimilar to Polyubiquitin gene (Fragment).
AK070705CTGACAGGTGGSimilar to Phosphoglycerate kinase, cytosolic (EC
Os06g0681200AK107980AGTGACACCupredoxin domain containing protein.
AK103599AGTGACACConserved hypothetical protein.
Os06g0683800AK110639CACGTCACGTCACCConserved hypothetical protein.
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein.
J023143A16CTGTCAGTGGZinc finger, RING-type domain containing protein.
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein.
Os06g0698785AJ578494AGTGACACSimilar to Choline monooxygenase, chloroplast precursor (EC
Os06g0706400AK064899AGTGACACSimilar to Peptide transporter PTR2-B (Histidine transporting protein).
AK072490AGGGCCCACCTGTCAGSimilar to Cyclophilin.
AK072490CACTGACASimilar to Cyclophilin.
Os06g0712800AK121236CGCCACGTCACCSimilar to Ankyrin-like protein.
Os06g0714000AK069538CCCACCTGTCAGTProtein of unknown function UPF0183 family protein.
AK069538CCCACCTGTCAGTGProtein of unknown function UPF0183 family protein.
AK100782CTGTCAGTGGSimilar to Translocon-associated protein alpha subunit precursor (TRAP-alpha) (Signal sequence receptor alpha subunit) (SSR-alpha).
Os06g0715700AK121440ACTGACAGGProtein of unknown function DUF803 family protein.
AK065019CACGTCACCSimilar to Cell division protein ftsH homolog, chloroplast precursor (EC 3.4.24.-) (DS9).
AK119436ACTGACAGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I).
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-).
Os06g0728700AK111637GTGACGTGHomeodomain-like containing protein.
AK061511CACGTCACCSimilar to Peroxidase2 precursor (EC
Os07g0121100AK102706CACGTCACProtein of unknown function DUF1719, Oryza sativa family protein.
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein.
AK065558ACGTCACCUDP-glucose 4-epimerase family protein.
AK065248GTGACGTGSimilar to 23 kDa polypeptide of photosystem II.