version

Summary of TGAC (All list)

Organism Oryza sativa
PLACE Motif TGAC
Description "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);
Total Entry Count 5971

Entry Sequences (5971 entries)

LocusGene modelSequenceDescription
Os01g0130400AK063966CCTGTCAGTNONE
AK102309CCTGTCAGTSimilar to Alpha-xylosidase precursor (Fragment).
Os01g0138500AK073435GGTGACGTProtein of unknown function DUF789 family protein.
J023118K18GGTGACGTNONE
J033039C22GGTGACGTNONE
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein.
Os01g0140100AK068990GTGACGTGPeptidase A1, pepsin family protein.
J065163I12GTGACGTGNONE
J075003M22GTGACGTGNONE
Os01g0145200J100017K24TGTCAGTGGNONE
Os01g0151200AK110801TGTCAGTGNONE
Os01g0156300AK107993GTGTCACTGACASimilar to Cappuccino protein.
Os01g0164700013-037-D07CACGTCACNONE
AK066699CACGTCACProtein of unknown function DUF410 family protein.
J013073F20CACGTCACNONE
J033091F23CACGTCACNONE
J065056C14CACGTCACNONE
Os01g0167400AB051107CCTGTCAGTGSimilar to Protein synthesis inhibitor II (EC 3.2.2.22) (Ribosome-inactivating protein II) (rRNA N-glycosidase).
AK120073CCTGTCAGTGNONE
J065062A04CCTGTCAGTGNONE
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein.
AK102544CACTGACAGCCCGGGCCCACCNONE
J023047L21CACTGACAGCCCGGGCCCACCNONE
J023135I09CACTGACAGCCCGGGCCCACCNONE
J033028G17CACTGACAGCCCGGGCCCACCNONE
J065164L07CACTGACAGCCCGGGCCCACCNONE
J065193F22CACTGACAGCCCGGGCCCACCNONE
J075035I10CACTGACAGCCCGGGCCCACCNONE
J075168H15CACTGACAGCCCGGGCCCACCNONE
Os01g0186900013-032-B12CACGTCACCNONE
013-069-C11CACGTCACCNONE
AK105323CACGTCACCNONE
AK105331CACGTCACCConserved hypothetical protein.
AK106168CACGTCACCNONE
J065023I10CACGTCACCNONE
J065182I03CACGTCACCNONE
J075116O22CACGTCACCNONE
J090082G13CACGTCACCNONE
J100060H12CACGTCACCNONE
Os01g0188400AK072842CACGTCACNONE
AK121770CACGTCACNONE
D16499CACGTCACNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME).
J100053F23CACGTCACNONE
J100060J17CACGTCACNONE
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE
006-024-C04TGTCAGTGNONE
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein.
AK070272TGTCAGTGThioredoxin domain 2 containing protein.
AK104558AGATGGGCCCACCTGTCAGTGGNONE
AK104558TGTCAGTGNONE
J023043M23AGATGGGCCCACCTGTCAGTGGNONE
J023043M23TGTCAGTGNONE
J043001A15AGATGGGCCCACCTGTCAGTGGNONE
J043001A15TGTCAGTGNONE
J065155O20AGATGGGCCCACCTGTCAGTGGNONE
J065155O20TGTCAGTGNONE
J065183G02AGATGGGCCCACCTGTCAGTGGNONE
J065183G02TGTCAGTGNONE
J090007F17AGATGGGCCCACCTGTCAGTGGNONE
J090007F17TGTCAGTGNONE
J090034P12AGATGGGCCCACCTGTCAGTGGNONE
J090034P12TGTCAGTGNONE
Os01g0212700AK108311CACGTCACCZinc finger, RING-type domain containing protein.
Os01g0214200AK061229CACTGACALipolytic enzyme, G-D-S-L family protein.
J065042C12CACTGACANONE
J065045M22CACTGACANONE
J065112H11CACTGACANONE
Os01g0218700AK064992TGTCAGTGABC transporter, transmembrane region, type 1 domain containing protein.
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein.
Os01g0222700012-011-E01GAGACGTGACGTGNONE
AK068883GAGACGTGACGTGNONE
AK101946GAGACGTGACGTGZinc finger, BED-type predicted domain containing protein.
J033075C16GAGACGTGACGTGNONE
J043013D08GAGACGTGACGTGNONE
J065089G19GAGACGTGACGTGNONE
J065197K19GAGACGTGACGTGNONE
J075161L21GAGACGTGACGTGNONE
Os01g0224500AK109225CCTGTCAGConserved hypothetical protein.
Os01g0229400AB029508TGTCAGTGSmall GTP-binding protein OsRac1.
J013111C23TGTCAGTGNONE
J023077H07TGTCAGTGNONE
J100039H15TGTCAGTGNONE
Os01g0232400AK101990AGTGACACSimilar to VHS1 protein (Fragment).
AK106519AGTGACACNONE
Os01g0238700AK121040AGTGACACOligopeptide transporter OPT superfamily protein.
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein.
Os01g0246400009-143-G05CACTGACACGTGGCNONE
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
Os01g0255100AK058528CACTGACASimilar to Soluble epoxide hydrolase.
Os01g0257100J100030B03CGCCACGTCACCNONE
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein.
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein.
Os01g0272600015-046-G06CCACTGACANONE
AK067786CCACTGACAConserved hypothetical protein.
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE
AK103164GGGTGGGCCCCACCTGTCAGTNONE
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).
J023019H09GGGTGGGCCCCACCTGTCAGTNONE
J023084I02GGGTGGGCCCCACCTGTCAGTNONE
J033027F20GGGTGGGCCCCACCTGTCAGTNONE
J033029M06GGGTGGGCCCCACCTGTCAGTNONE
J033039K13GGGTGGGCCCCACCTGTCAGTNONE
J033057C24GGGTGGGCCCCACCTGTCAGTNONE
J033058G20GGGTGGGCCCCACCTGTCAGTNONE
J033060A14GGGTGGGCCCCACCTGTCAGTNONE
J033061M21GGGTGGGCCCCACCTGTCAGTNONE
J033068M10GGGTGGGCCCCACCTGTCAGTNONE
J033074K16GGGTGGGCCCCACCTGTCAGTNONE
J033076C11GGGTGGGCCCCACCTGTCAGTNONE
J033093O13GGGTGGGCCCCACCTGTCAGTNONE
J033119H20GGGTGGGCCCCACCTGTCAGTNONE
J033121D22GGGTGGGCCCCACCTGTCAGTNONE
J033129N11GGGTGGGCCCCACCTGTCAGTNONE
J033131E12GGGTGGGCCCCACCTGTCAGTNONE
J033150L07GGGTGGGCCCCACCTGTCAGTNONE
J053024N17GGGTGGGCCCCACCTGTCAGTNONE
J053034G19GGGTGGGCCCCACCTGTCAGTNONE
J053035E18GGGTGGGCCCCACCTGTCAGTNONE
J053046M01GGGTGGGCCCCACCTGTCAGTNONE
J053047P04GGGTGGGCCCCACCTGTCAGTNONE
J053048B06GGGTGGGCCCCACCTGTCAGTNONE
J053050M22GGGTGGGCCCCACCTGTCAGTNONE
J053053E09GGGTGGGCCCCACCTGTCAGTNONE
J053053I07GGGTGGGCCCCACCTGTCAGTNONE
J053059K03GGGTGGGCCCCACCTGTCAGTNONE
J053059P12GGGTGGGCCCCACCTGTCAGTNONE
J053060C12GGGTGGGCCCCACCTGTCAGTNONE
J053060H24GGGTGGGCCCCACCTGTCAGTNONE
J053064D19GGGTGGGCCCCACCTGTCAGTNONE
J053066L15GGGTGGGCCCCACCTGTCAGTNONE
J053073I02GGGTGGGCCCCACCTGTCAGTNONE
J053083E15GGGTGGGCCCCACCTGTCAGTNONE
J053094D05GGGTGGGCCCCACCTGTCAGTNONE
J053094P18GGGTGGGCCCCACCTGTCAGTNONE
J053095C15GGGTGGGCCCCACCTGTCAGTNONE
J053095C21GGGTGGGCCCCACCTGTCAGTNONE
J053099N16GGGTGGGCCCCACCTGTCAGTNONE
J090025O19GGGTGGGCCCCACCTGTCAGTNONE
J090049N22GGGTGGGCCCCACCTGTCAGTNONE
J090050F17GGGTGGGCCCCACCTGTCAGTNONE
Os01g0276900009-014-B04TGTCAGTGGNONE
AK105130TGTCAGTGGConserved hypothetical protein.
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein.
AK109672GTGACGTGTGGCGTGConserved hypothetical protein.
J065013K07GCGGGCCCACTTGTCAGTGNONE
J065013K07GTGACGTGTGGCGTGNONE
J065040E15GCGGGCCCACTTGTCAGTGNONE
J065040E15GTGACGTGTGGCGTGNONE
J065127F12GCGGGCCCACTTGTCAGTGNONE
J065127F12GTGACGTGTGGCGTGNONE
J075155K23GCGGGCCCACTTGTCAGTGNONE
J075155K23GTGACGTGTGGCGTGNONE
Os01g0286200AK111156CACTGACAConserved hypothetical protein.
Os01g0293100AK106850CTGTCAGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK106850GTCAGTGGGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os01g0321800AK064712ACGTCACCGas vesicle protein GvpC repeat containing protein.
J075175N03ACGTCACCNONE
Os01g0327500AK107756CACTGACAGGTGGGConserved hypothetical protein.
Os01g0342800J065046B02AGTGACACNONE
J065059I08AGTGACACNONE
J065074A14AGTGACACNONE
J065147C02AGTGACACNONE
J065176F09AGTGACACNONE
J065199J12AGTGACACConserved hypothetical protein.
Os01g0348700009-125-H02GGTGACGTNONE
009-156-F08GGTGACGTNONE
009-177-A11GGTGACGTNONE
009-195-D02GGTGACGTNONE
013-040-B06GGTGACGTNONE
013-051-B09GGTGACGTNONE
AK120842GGTGACGTSimilar to 60S ribosomal protein L23a (L25).
J013071O22GGTGACGTNONE
J023022J07GGTGACGTNONE
J033028J08GGTGACGTNONE
J033109M11GGTGACGTNONE
J043022K15GGTGACGTNONE
J043031N11GGTGACGTNONE
J053023I10GGTGACGTNONE
J053045F16GGTGACGTNONE
J053054F22GGTGACGTNONE
J053094P15GGTGACGTNONE
J065048F01GGTGACGTNONE
J075012F16GGTGACGTNONE
J075089C09GGTGACGTNONE
J075179J20GGTGACGTNONE
J080305E19GGTGACGTNONE
J080309B21GGTGACGTNONE
J090017L05GGTGACGTNONE
J090058B11GGTGACGTNONE
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein.
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE
Os01g0373500AK107175CTGTCAGTConserved hypothetical protein.
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein.
Os01g0528800AK059305GGTGACGTNONE
AK068824GGTGACGTSimilar to Cinnamyl alcohol dehydrogenase.
Os01g0532200AK070288CCACTGACNONE
AK105807CCACTGACFF domain containing protein.
J090026N08CCACTGACNONE
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment).
AK104278CTGACAGGTGGGCCCTNONE
Os01g0564400J013160K14GCCACGTCACNONE
J065063D15GCCACGTCACNONE
J065162D09GCCACGTCACNONE
J075006C23GCCACGTCACNONE
J075112F15GCCACGTCACNONE
Os01g0579900AK065133CCTGTCAGEsterase/lipase/thioesterase domain containing protein.
J013001P21CCTGTCAGNONE
J090031F15CCTGTCAGNONE
Os01g0585600AK062064CTGTCAGTNONE
AK064970GTGTCACTProtein of unknown function DUF630 domain containing protein.
J013001B11GTGTCACTNONE
J013022O03GTGTCACTNONE
J013042J20GTGTCACTNONE
J023054F01GTGTCACTNONE
J023123A12GTGTCACTNONE
J023131L21GTGTCACTNONE
J033034D10GTGTCACTNONE
J033066H09GTGTCACTNONE
J033091L15GTGTCACTNONE
J043024B12GTGTCACTNONE
J065064L08GTGTCACTNONE
J065206J15GTGTCACTNONE
J090036E08GTGTCACTNONE
J090053B06GTGTCACTNONE
J090060D05GTGTCACTNONE
J090085L13GTGTCACTNONE
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE
AJ251563TGCGGGCCCCACTGACAGNONE
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel.
AK104055TGCGGGCCCCACTGACAGNONE
AK104419TGCGGGCCCCACTGACAGNONE
J023057A07TGCGGGCCCCACTGACAGNONE
J023068C08TGCGGGCCCCACTGACAGNONE
J023148E24TGCGGGCCCCACTGACAGNONE
J090045O22TGCGGGCCCCACTGACAGNONE
J090045P03TGCGGGCCCCACTGACAGNONE
J090050C18TGCGGGCCCCACTGACAGNONE
J100023F01TGCGGGCCCCACTGACAGNONE
J100051I18TGCGGGCCCCACTGACAGNONE
J100060P17TGCGGGCCCCACTGACAGNONE
Os01g0604100AK099765CCTGTCAGUspA domain containing protein.
J013094O21CCTGTCAGNONE
Os01g0607000009-020-G09CACGTCACNONE
AK105136CACGTCACGlutelin family protein.
Os01g0612600004-008-D07CACGTCACNONE
004-008-D07CACGTCACNONE
004-008-D07TGCGGGCCCCACTGACNONE
009-057-C09CACGTCACNONE
009-057-C09CACGTCACNONE
009-057-C09TGCGGGCCCCACTGACNONE
009-130-C01CACGTCACNONE
009-130-C01CACGTCACNONE
009-130-C01TGCGGGCCCCACTGACNONE
AK062906CACGTCACNONE
AK062906CACGTCACNONE
AK062906TGCGGGCCCCACTGACNONE
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein.
J013065E14CACGTCACNONE
J013065E14CACGTCACNONE
J013065E14TGCGGGCCCCACTGACNONE
J013073D14CACGTCACNONE
J013073D14CACGTCACNONE
J013073D14TGCGGGCCCCACTGACNONE
J023014A21CACGTCACNONE
J023014A21CACGTCACNONE
J023014A21TGCGGGCCCCACTGACNONE
J023073M13CACGTCACNONE
J023073M13CACGTCACNONE
J023073M13TGCGGGCCCCACTGACNONE
J023079F02CACGTCACNONE
J023079F02CACGTCACNONE
J023079F02TGCGGGCCCCACTGACNONE
J023083B16CACGTCACNONE
J023083B16CACGTCACNONE
J023083B16TGCGGGCCCCACTGACNONE
J023090G19CACGTCACNONE
J023090G19CACGTCACNONE
J023090G19TGCGGGCCCCACTGACNONE
J023095F15CACGTCACNONE
J023095F15CACGTCACNONE
J023095F15TGCGGGCCCCACTGACNONE
J023119H11CACGTCACNONE
J023119H11CACGTCACNONE
J023119H11TGCGGGCCCCACTGACNONE
J033040B01CACGTCACNONE
J033040B01CACGTCACNONE
J033040B01TGCGGGCCCCACTGACNONE
J033044F13CACGTCACNONE
J033044F13CACGTCACNONE
J033044F13TGCGGGCCCCACTGACNONE
J033081E23CACGTCACNONE
J033081E23CACGTCACNONE
J033081E23TGCGGGCCCCACTGACNONE
J033121K07CACGTCACNONE
J033121K07CACGTCACNONE
J033121K07TGCGGGCCCCACTGACNONE
J033124D11CACGTCACNONE
J033124D11CACGTCACNONE
J033124D11TGCGGGCCCCACTGACNONE
J033131N22CACGTCACNONE
J033131N22CACGTCACNONE
J033131N22TGCGGGCCCCACTGACNONE
J065179E10CACGTCACNONE
J065179E10CACGTCACNONE
J065179E10TGCGGGCCCCACTGACNONE
J090020A13CACGTCACNONE
J090020A13CACGTCACNONE
J090020A13TGCGGGCCCCACTGACNONE
J090045K17CACGTCACNONE
J090045K17CACGTCACNONE
J090045K17TGCGGGCCCCACTGACNONE
J090047M24CACGTCACNONE
J090047M24CACGTCACNONE
J090047M24TGCGGGCCCCACTGACNONE
J090064G23CACGTCACNONE
J090064G23CACGTCACNONE
J090064G23TGCGGGCCCCACTGACNONE
J090084G08CACGTCACNONE
J090084G08CACGTCACNONE
J090084G08TGCGGGCCCCACTGACNONE
J090086F18CACGTCACNONE
J090086F18CACGTCACNONE
J090086F18TGCGGGCCCCACTGACNONE
J100032D09CACGTCACNONE
J100032D09CACGTCACNONE
J100032D09TGCGGGCCCCACTGACNONE
J100037O18CACGTCACNONE
J100037O18CACGTCACNONE
J100037O18TGCGGGCCCCACTGACNONE
J100042B03CACGTCACNONE
J100042B03CACGTCACNONE
J100042B03TGCGGGCCCCACTGACNONE
J100061D06CACGTCACNONE
J100061D06CACGTCACNONE
J100061D06TGCGGGCCCCACTGACNONE
J100061I03CACGTCACNONE
J100061I03CACGTCACNONE
J100061I03TGCGGGCCCCACTGACNONE
J100063B17CACGTCACNONE
J100063B17CACGTCACNONE
J100063B17TGCGGGCCCCACTGACNONE
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein.
AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein.
Os01g0624700AK111416AGTGACACSimilar to WRKY transcription factor 12.
AY676924AGTGACACNONE
AY870601AGTGACACNONE
Os01g0629900AK062211CTGACAGGNONE
AK073989CTGACAGGNONE
Os01g0631200J023080H07AGTGACACNONE
J023125G17AGTGACACNONE
J033132A13AGTGACACNONE
J065179I22AGTGACACNONE
J090027C06AGTGACACNONE
Os01g0633200AK069077GTGTCACTSimilar to X1 (Fragment).
Os01g0639600005-018-A02GTGACGTGNONE
AK067056GTGACGTGProtein of unknown function DUF1645 family protein.
J013066M03GTGACGTGNONE
J013066O05GTGACGTGNONE
J013088M21GTGACGTGNONE
J065045F04GTGACGTGNONE
J080018F22GTGACGTGNONE
J080037B10GTGACGTGNONE
J080042G23GTGACGTGNONE
J080052B21GTGACGTGNONE
J080060H13GTGACGTGNONE
J100024A05GTGACGTGNONE
J100071A09GTGACGTGNONE
J100080K14GTGACGTGNONE
Os01g0649900AK068077CCACTGACLipolytic enzyme, G-D-S-L family protein.
Os01g0663300AK071667CCACTGACASimilar to (1-4)-beta-mannan endohydrolase-like protein.
J023055F22CCACTGACANONE
J023105N15CCACTGACANONE
J090042C10CCACTGACANONE
Os01g0663500006-024-H09CCACCTGTCAGTGNONE
AK058452CCACCTGTCAGTGNONE
AK060072CCACCTGTCAGTGTranscriptional coactivator/pterin dehydratase family protein.
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein.
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE
Os01g0673500AK065017CACTGACASimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
AK069899CACTGACANONE
Os01g0673800AK072055CCACTGACNONE
AK099934CCACTGACConserved hypothetical protein.
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein.
Os01g0694500AK108063GTGTCACTConserved hypothetical protein.
Os01g0716200AK062106CTGTCAGTIQ calmodulin-binding region domain containing protein.
AK062106GTGTCACTGACAGIQ calmodulin-binding region domain containing protein.
AK098920CTGTCAGTNONE
AK098920GTGTCACTGACAGNONE
J013002N06CTGTCAGTNONE
J013002N06GTGTCACTGACAGNONE
J013050O19CTGTCAGTNONE
J013050O19GTGTCACTGACAGNONE
J013074N19CTGTCAGTNONE
J013074N19GTGTCACTGACAGNONE
J013127F17CTGTCAGTNONE
J013127F17GTGTCACTGACAGNONE
J013155C17CTGTCAGTNONE
J013155C17GTGTCACTGACAGNONE
J013158K07CTGTCAGTNONE
J013158K07GTGTCACTGACAGNONE
J053086D01CTGTCAGTNONE
J053086D01GTGTCACTGACAGNONE
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein.
AK109542GTCAGTGGGCCGTCCNONE
Os01g0733200AK066316CACGTCACSimilar to Heat shock transcription factor 29 (Fragment).
AY344493CACGTCACNONE
J013066G03CACGTCACNONE
J090034J08CACGTCACNONE
Os01g0738400AK110661GTGTCACTSimilar to Zn-finger transcription factor.
Os01g0739500009-085-C03TGTCAGTGNONE
AK121118TGTCAGTGConserved hypothetical protein.
J013110A12TGTCAGTGNONE
J013111F24TGTCAGTGNONE
J013123D24TGTCAGTGNONE
J023043I01TGTCAGTGNONE
J023074B04TGTCAGTGNONE
J023086O13TGTCAGTGNONE
J023100C19TGTCAGTGNONE
J033040N08TGTCAGTGNONE
J033068E10TGTCAGTGNONE
J043010A07TGTCAGTGNONE
J053061P15TGTCAGTGNONE
J053065H08TGTCAGTGNONE
J053096B10TGTCAGTGNONE
J065155H09TGTCAGTGNONE
J075033D14TGTCAGTGNONE
J075035H20TGTCAGTGNONE
J075035L23TGTCAGTGNONE
J075059H22TGTCAGTGNONE
J090097L13TGTCAGTGNONE
J090097P11TGTCAGTGNONE
J100036D16TGTCAGTGNONE
J100049M23TGTCAGTGNONE
J100058P13TGTCAGTGNONE
J100072G10TGTCAGTGNONE
J100072N11TGTCAGTGNONE
J100083D04TGTCAGTGNONE
J100089M03TGTCAGTGNONE
Os01g0749400AK064990GGGGCCCATCTCTGTCAGTGGNONE
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein.
AK103775GGGGCCCATCTCTGTCAGTGGNONE
J023001B06GGGGCCCATCTCTGTCAGTGGNONE
Os01g0752600AK100905GTGTCACTGlycosyl transferase, family 19 protein.
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein.
J033106B06CCACTGACAGTGGGCCTCNONE
J065025B07CCACTGACAGTGGGCCTCNONE
J065025B08CCACTGACAGTGGGCCTCNONE
J065033E12CCACTGACAGTGGGCCTCNONE
J065197B01CCACTGACAGTGGGCCTCNONE
Os01g0761000009-179-C02GTGTCACTNONE
J065021D10GTGTCACTNONE
J065031F21GTGTCACTNONE
J065034O07GTGTCACTNONE
J065052B16GTGTCACTNONE
J065091N13GTGTCACTConserved hypothetical protein.
J065191H14GTGTCACTNONE
J065193H05GTGTCACTNONE
J065201J08GTGTCACTNONE
J075034A10GTGTCACTNONE
J075042C03GTGTCACTNONE
J075066L14GTGTCACTNONE
J075082B03GTGTCACTNONE
J075133C16GTGTCACTNONE
J075164B05GTGTCACTNONE
J090023N23GTGTCACTNONE
Os01g0763600AK061563TGTCAGTGNONE
AK066596TGTCAGTGGlycerophosphoryl diester phosphodiesterase family protein.
J023057P15TGTCAGTGNONE
J065016A16TGTCAGTGNONE
J065039L06TGTCAGTGNONE
J090001E03TGTCAGTGNONE
J090012J18TGTCAGTGNONE
J090085E15TGTCAGTGNONE
Os01g0766400AK073493CTGTCAGTConserved hypothetical protein.
Os01g0770800AK109200GTGTCACTCtr copper transporter family protein.
Os01g0778700AK064933CACTGACAConserved hypothetical protein.
AK064933GTGTCACTConserved hypothetical protein.
Os01g0788800006-075-G02CCTGTCAGNONE
009-007-H04CCTGTCAGNONE
AK059864CCTGTCAGNONE
AK071723CCTGTCAGNONE
J023110O18CCTGTCAGNONE
J023120G04CCTGTCAGNONE
J090040H01CCTGTCAGNONE
J090041P20CCTGTCAGNONE
J090073O13CCTGTCAGNONE
J090080M14CCTGTCAGNONE
J090081K07CCTGTCAGNONE
J090084N10CCTGTCAGNONE
J090085H19CCTGTCAGNONE
J090096B04CCTGTCAGNONE
Os01g0797800013-017-E01CACCTGTCAGNONE
AK122155CACCTGTCAGConserved hypothetical protein.
Os01g0799500AK109346CTGACAGGDNA glycosylase family protein.
Os01g0803200006-057-A07GTGACGTGNONE
009-028-E02GTGACGTGNONE
AF435976GTGACGTGNONE
AK061770GTGACGTGCysteine proteinase inhibitor-I (Oryzacystatin-I).
AK072206GTGACGTGNONE
AK121632GTGACGTGNONE
D29717GTGACGTGNONE
J013088C04GTGACGTGNONE
J023110F17GTGACGTGNONE
J033029J21GTGACGTGNONE
J033050G08GTGACGTGNONE
J033121L08GTGACGTGNONE
J03469GTGACGTGNONE
J043040J18GTGACGTGNONE
J065009B11GTGACGTGNONE
J065037D05GTGACGTGNONE
J065046C08GTGACGTGNONE
J065051M08GTGACGTGNONE
J065059H24GTGACGTGNONE
J065060A10GTGACGTGNONE
J065066O10GTGACGTGNONE
J065075N07GTGACGTGNONE
J065088G17GTGACGTGNONE
J065101N07GTGACGTGNONE
J065111I03GTGACGTGNONE
J065122A02GTGACGTGNONE
J065128L10GTGACGTGNONE
J065134A09GTGACGTGNONE
J065162H09GTGACGTGNONE
J065178F05GTGACGTGNONE
J065209J08GTGACGTGNONE
J065217F08GTGACGTGNONE
J075023A10GTGACGTGNONE
J075023H20GTGACGTGNONE
J075048H09GTGACGTGNONE
J075062K16GTGACGTGNONE
J075074F03GTGACGTGNONE
J075080G02GTGACGTGNONE
J075125J09GTGACGTGNONE
J075125L15GTGACGTGNONE
J075152L15GTGACGTGNONE
J075173B03GTGACGTGNONE
J075177M22GTGACGTGNONE
J080001B16GTGACGTGNONE
J080005K01GTGACGTGNONE
J080005L08GTGACGTGNONE
J080005N22GTGACGTGNONE
J080007B02GTGACGTGNONE
J080008E24GTGACGTGNONE
J080008L18GTGACGTGNONE
J080009H13GTGACGTGNONE
J080010E21GTGACGTGNONE
J080011D21GTGACGTGNONE
J080011P22GTGACGTGNONE
J080013A16GTGACGTGNONE
J080016M01GTGACGTGNONE
J080017A09GTGACGTGNONE
J080020A09GTGACGTGNONE
J080023B21GTGACGTGNONE
J080023L04GTGACGTGNONE
J080023M10GTGACGTGNONE
J080028B02GTGACGTGNONE
J080031E01GTGACGTGNONE
J080036N13GTGACGTGNONE
J080036N17GTGACGTGNONE
J080037M05GTGACGTGNONE
J080043K21GTGACGTGNONE
J080043M11GTGACGTGNONE
J080044I08GTGACGTGNONE
J080044N16GTGACGTGNONE
J080049L02GTGACGTGNONE
J080050H04GTGACGTGNONE
J080054G17GTGACGTGNONE
J080054G21GTGACGTGNONE
J080057A13GTGACGTGNONE
J080057G02GTGACGTGNONE
J080057G23GTGACGTGNONE
J080061A19GTGACGTGNONE
J080062A13GTGACGTGNONE
J080062J22GTGACGTGNONE
J080063G15GTGACGTGNONE
J080066A18GTGACGTGNONE
J080066E03GTGACGTGNONE
J080067E10GTGACGTGNONE
J080069L14GTGACGTGNONE
J080071I09GTGACGTGNONE
J080076E22GTGACGTGNONE
J080078L03GTGACGTGNONE
J080078L15GTGACGTGNONE
J080081G17GTGACGTGNONE
J080083C20GTGACGTGNONE
J080083J03GTGACGTGNONE
J080086C02GTGACGTGNONE
J080088E16GTGACGTGNONE
J080090A03GTGACGTGNONE
J080090C14GTGACGTGNONE
J080090F11GTGACGTGNONE
J080093N06GTGACGTGNONE
J080094B22GTGACGTGNONE
J080094C11GTGACGTGNONE
J080096E22GTGACGTGNONE
J080096F18GTGACGTGNONE
J080301K11GTGACGTGNONE
J080302C22GTGACGTGNONE
J080304K12GTGACGTGNONE
J080317G06GTGACGTGNONE
J080318L23GTGACGTGNONE
J090047A06GTGACGTGNONE
J100025M24GTGACGTGNONE
J100026O09GTGACGTGNONE
J100027D03GTGACGTGNONE
J100028C19GTGACGTGNONE
J100028D07GTGACGTGNONE
J100031H13GTGACGTGNONE
J100053M24GTGACGTGNONE
J100054J03GTGACGTGNONE
J100055D24GTGACGTGNONE
J100059L24GTGACGTGNONE
J100062D23GTGACGTGNONE
J100062F02GTGACGTGNONE
J100063G22GTGACGTGNONE
J100064A04GTGACGTGNONE
J100064P17GTGACGTGNONE
J100065F17GTGACGTGNONE
J100072F05GTGACGTGNONE
J100077D21GTGACGTGNONE
J100081B17GTGACGTGNONE
J100087G09GTGACGTGNONE
J100089C12GTGACGTGNONE
J100090G01GTGACGTGNONE
U54702GTGACGTGNONE
Os01g0818300AK063274GTGACGTGKH domain containing protein.
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment).
Os01g0827500AK111814TGTCAGTGExo70 exocyst complex subunit family protein.
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE
AK061475AGATGGGCCCACACTGACAGNONE
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein.
J065168H17AGATGGGCCCACACTGACAGNONE
J065211O10AGATGGGCCCACACTGACAGNONE
Os01g0843700J065093C02CACGTCACCConserved hypothetical protein.
J065207M23CACGTCACCNONE
Os01g0844800AK099801TGTCAGTGSimilar to Pumilio RBD (Fragment).
AK102882TGTCAGTGNONE
AK103686TGTCAGTGNONE
Os01g0846300AK065949CACGTCACSimilar to Protein phosphatase 2C.
Os01g0846600AK070193CCACTGACAProtein of unknown function DUF248, methyltransferase putative family protein.
J023041I24CCACTGACANONE
J065002B03CCACTGACANONE
J065140C09CCACTGACANONE
J090052A18CCACTGACANONE
J090081O13CCACTGACANONE
J100056L06CCACTGACANONE
Os01g0847100009-045-C07GTGTCACTNONE
009-167-C07GTGTCACTNONE
016-093-C03GTGTCACTNONE
AK063795GTGTCACTConserved hypothetical protein.
AK121513GTGTCACTNONE
J033024P15GTGTCACTNONE
Os01g0847800014-071-E03CACTGACANONE
AK100718CACTGACASimilar to Aldose reductase (EC 1.1.1.21) (AR) (Aldehyde reductase) (20-alpha- hydroxysteroid dehydrogenase) (EC 1.1.1.149) (20-alpha-HSD).
J023049O07CACTGACANONE
J023115O16CACTGACANONE
J033093E24CACTGACANONE
J033094E24CACTGACANONE
J043024M05CACTGACANONE
J065082P08CACTGACANONE
J065106C07CACTGACANONE
J100062I02CACTGACANONE
Os01g0847900006-030-E09TGTCAGTGNONE
AK059798TGTCAGTGPrenylated rab acceptor PRA1 family protein.
AK073643TGTCAGTGNONE
J065091G23TGTCAGTGNONE
Os01g0848550J065073P06GGTGACGTGConserved hypothetical protein.
Os01g0865100016-066-A05GGACACGTCACNONE
AK065779GGACACGTCACNONE
AK071410GGACACGTCACSimilar to Uricase (Fragment).
J013039E23GGACACGTCACNONE
J023024I07GGACACGTCACNONE
J065160J15GGACACGTCACNONE
J090052J17GGACACGTCACNONE
Os01g0866400AB007193CACGTCACCSimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment).
AF378183CACGTCACCNONE
AK070516CACGTCACCNONE
AK119536CACGTCACCNONE
J023057C24CACGTCACCNONE
J023078G07CACGTCACCNONE
J065015D23CACGTCACCNONE
J065050J17CACGTCACCNONE
J065058B03CACGTCACCNONE
J065119C16CACGTCACCNONE
J065134N01CACGTCACCNONE
J065174B10CACGTCACCNONE
J075046D04CACGTCACCNONE
J075172N05CACGTCACCNONE
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein.
Os01g0869000AK067351CTGACAGGNONE
AK121602CTGACAGGProtein of unknown function DUF639 family protein.
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein.
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein.
AK067564GTGTCACTProtein of unknown function DUF1012 family protein.
AK072312CACTGACAGGTGGGGCNONE
AK072312GTGTCACTNONE
AK103428CACTGACAGGTGGGGCNONE
AK103428GTGTCACTNONE
Os01g0881800AK109594CCACTGACATGTGGGCCCCACAConserved hypothetical protein.
J065066N18CCACTGACATGTGGGCCCCACANONE
Os01g0884400AK072566CCTGTCAGTGU box domain containing protein.
Os01g0891700AK105471CTGACAGGLeucine rich repeat, N-terminal domain containing protein.
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE
AK065055GGGCCCCACCTGTCAGTGNONE
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1).
AK105061GGGCCCCACCTGTCAGTGNONE
AK121862GGGCCCCACCTGTCAGTGNONE
J013001J04GGGCCCCACCTGTCAGTGNONE
J033103A19GGGCCCCACCTGTCAGTGNONE
J075005P18GGGCCCCACCTGTCAGTGNONE
J090027D12GGGCCCCACCTGTCAGTGNONE
J090032M01GGGCCCCACCTGTCAGTGNONE
J090079K10GGGCCCCACCTGTCAGTGNONE
J100018O17GGGCCCCACCTGTCAGTGNONE
J100080H14GGGCCCCACCTGTCAGTGNONE
J100088D08GGGCCCCACCTGTCAGTGNONE
Os01g0900800009-086-C08CACGTCACCNONE
AK068254CACGTCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK105713CACGTCACCNONE
J053025O10CACGTCACCNONE
J065063K24CACGTCACCNONE
J065167N21CACGTCACCNONE
J100060A20CACGTCACCNONE
J100079J03CACGTCACCNONE
J100087D11CACGTCACCNONE
J100089K10CACGTCACCNONE
Os01g0904500AK119437TGTCAGTGConserved hypothetical protein.
J065022O22TGTCAGTGNONE
J065102M14TGTCAGTGNONE
J065192C12TGTCAGTGNONE
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein.
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1.
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
Os01g0913300AK100698GTGACGTGTGF-beta receptor, type I/II extracellular region family protein.
J023030J07GTGACGTGNONE
J023102B09GTGACGTGNONE
J023102N03GTGACGTGNONE
J023114K11GTGACGTGNONE
J023140A21GTGACGTGNONE
J043017F23GTGACGTGNONE
J075058O15GTGACGTGNONE
Os01g0914000AK101364ACGTCACCConserved hypothetical protein.
J080302O10ACGTCACCNONE
J080305G04ACGTCACCNONE
J080316B11ACGTCACCNONE
J090049A14ACGTCACCNONE
J090066O10ACGTCACCNONE
Os01g0914300009-174-C06CACGTCACNONE
014-073-B09CACGTCACNONE
AK103489CACGTCACNONE
AK105463CACGTCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
J033076A02CACGTCACNONE
J033130M24CACGTCACNONE
Os01g0921100J100040A04CTGTCAGTNONE
J100058A08CTGTCAGTConserved hypothetical protein.
J100070H06CTGTCAGTNONE
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
J013039J22CACTGACAGGTGGGGCCGGANONE
J013109E03CACTGACAGGTGGGGCCGGANONE
J023081J12CACTGACAGGTGGGGCCGGANONE
J023091E24CACTGACAGGTGGGGCCGGANONE
J033022A01CACTGACAGGTGGGGCCGGANONE
J033074C13CACTGACAGGTGGGGCCGGANONE
J065199E03CACTGACAGGTGGGGCCGGANONE
J075172O04CACTGACAGGTGGGGCCGGANONE
J090007G18CACTGACAGGTGGGGCCGGANONE
J090052B17CACTGACAGGTGGGGCCGGANONE
J090074H01CACTGACAGGTGGGGCCGGANONE
J100043J09CACTGACAGGTGGGGCCGGANONE
J100059J05CACTGACAGGTGGGGCCGGANONE
Os01g0922100AK110737GTGACGTGConserved hypothetical protein.
Os01g0937000AK108620CTGACAGGPeptidase A1, pepsin family protein.
Os01g0954100009-087-G12GTGACGTGNONE
AK062680GTGACGTGConserved hypothetical protein.
Os01g0956200006-108-G08CACGTGTCACTNONE
AK068399CACGTGTCACTProtein of unknown function DUF563 family protein.
AK106051CACGTGTCACTNONE
J013149N20CACGTGTCACTNONE
J023085G19CACGTGTCACTNONE
J033070C20CACGTGTCACTNONE
J065080C11CACGTGTCACTNONE
J090038M06CACGTGTCACTNONE
J100038I20CACGTGTCACTNONE
J100039D17CACGTGTCACTNONE
Os01g0961200011-099-H06CCACTGACAGGNONE
AK105424CCACTGACAGGCBS domain containing protein.
J065169J18CCACTGACAGGNONE
J075109H12CCACTGACAGGNONE
Os01g0962700006-045-H03GTGTCACTNONE
006-047-B04GTGTCACTNONE
006-048-D03GTGTCACTNONE
006-052-G01GTGTCACTNONE
006-057-D10GTGTCACTNONE
006-060-E09GTGTCACTNONE
006-066-H03GTGTCACTNONE
006-080-B11GTGTCACTNONE
006-080-H10GTGTCACTNONE
006-084-C03GTGTCACTNONE
006-088-C11GTGTCACTNONE
006-100-H05GTGTCACTNONE
006-100-H08GTGTCACTNONE
006-118-D03GTGTCACTNONE
006-118-D05GTGTCACTNONE
006-119-A03GTGTCACTNONE
009-165-A12GTGTCACTNONE
009-191-E06GTGTCACTNONE
013-007-G06GTGTCACTNONE
013-039-D01GTGTCACTNONE
014-070-H12GTGTCACTNONE
AK073009GTGTCACTNONE
AK104065GTGTCACTNONE
AK104420GTGTCACTSimilar to Peroxidase 12 precursor (EC 1.11.1.7) (Atperox P12) (PRXR6) (ATP4a).
AK109340GTGTCACTNONE
AK119199GTGTCACTNONE
J023009N24GTGTCACTNONE
J023145L12GTGTCACTNONE
J023147D10GTGTCACTNONE
J065027K02GTGTCACTNONE
J065119C19GTGTCACTNONE
Os01g0971100009-033-D02GTCAGTGGNONE
AK069516GTCAGTGGDrought induced 19 family protein.
J023022E04GTCAGTGGNONE
J023067L15GTCAGTGGNONE
J023110D22GTCAGTGGNONE
J075034M07GTCAGTGGNONE
J075107K18GTCAGTGGNONE
J075172M23GTCAGTGGNONE
J100067J03GTCAGTGGNONE
Os01g0976800J065105P05CCCACTCCCACTGACZinc finger, GATA-type domain containing protein.
J065189M03CCCACTCCCACTGACNONE
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE
J100030O18CCACTGACACATGGGCCCTNONE
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS).
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein.
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
Os02g0127900AK102783GGTGACGTHypothetical protein.
AK102783GGTGACGTGGCHypothetical protein.
J065042F15GGTGACGTNONE
J065042F15GGTGACGTGGCNONE
J075005J10GGTGACGTNONE
J075005J10GGTGACGTGGCNONE
J075038F02GGTGACGTNONE
J075038F02GGTGACGTGGCNONE
J075048K10GGTGACGTNONE
J075048K10GGTGACGTGGCNONE
J075064D21GGTGACGTNONE
J075064D21GGTGACGTGGCNONE
J075074M07GGTGACGTNONE
J075074M07GGTGACGTGGCNONE
J075078D20GGTGACGTNONE
J075078D20GGTGACGTGGCNONE
J075109P15GGTGACGTNONE
J075109P15GGTGACGTGGCNONE
J075115K24GGTGACGTNONE
J075115K24GGTGACGTGGCNONE
J075135G01GGTGACGTNONE
J075135G01GGTGACGTGGCNONE
J075156B07GGTGACGTNONE
J075156B07GGTGACGTGGCNONE
Os02g0130300011-005-D07AGTGACACNONE
011-041-B06AGTGACACNONE
015-099-D11AGTGACACNONE
016-049-D06AGTGACACNONE
AK102708AGTGACACZinc finger, RING-type domain containing protein.
Os02g0133900AK107180CACTGACACTGACAProtein of unknown function DUF829, eukaryotic family protein.
AK107180GTCAGTGGProtein of unknown function DUF829, eukaryotic family protein.
Os02g0138600AK071778CACTGACAProtein of unknown function DUF1677, Oryza sativa family protein.
J023113L07CACTGACANONE
Os02g0148100AF216317CACGTCACNONE
AF241166CACGTCACNONE
AK119650CACGTCACMAP kinase MAPK2 (MAP kinase 3).
Os02g0160000AK062904CACGTCACSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y- 1140 of Kluyveromyces lactis.
Os02g0161800AK105544AGTGACACSimilar to Peroxidase precursor (EC 1.11.1.7).
J065205H23AGTGACACNONE
Os02g0192500AK102694AGTGACACSimilar to Cellulose synthase-like protein (Fragment).
Os02g0194400AK110011TGTCAGTGProtein kinase-like domain containing protein.
Os02g0198600005-012-D12ACTGACAGNONE
AK058299ACTGACAGNONE
Os02g0199300AK064726TGTCAGTGPeptidylprolyl isomerase, FKBP-type domain containing protein.
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein.
AK101434GTGTCACTGACAWD40-like domain containing protein.
J043024M20GCGGCCCACGTGTCAGTGGNONE
J043024M20GTGTCACTGACANONE
Os02g0215100AK110993CACTGACAConserved hypothetical protein.
Os02g0227200009-123-E01GTGACGTGNONE
AB018377GTGACGTGNONE
AK072428GTGACGTGNONE
AK120885GTGACGTGEarly nodulin.
J013022O14GTGACGTGNONE
J043034L12GTGACGTGNONE
J065030L16GTGACGTGNONE
J065056C10GTGACGTGNONE
J065066P11GTGACGTGNONE
J065101I24GTGACGTGNONE
J065102E21GTGACGTGNONE
J065113P17GTGACGTGNONE
J065120I17GTGACGTGNONE
J065122P08GTGACGTGNONE
J065124D04GTGACGTGNONE
J065140K10GTGACGTGNONE
J065140P20GTGACGTGNONE
J065147O15GTGACGTGNONE
J065148L22GTGACGTGNONE
J065159N03GTGACGTGNONE
J065180B09GTGACGTGNONE
J075027C19GTGACGTGNONE
J075120L04GTGACGTGNONE
J075134I10GTGACGTGNONE
J075161B08GTGACGTGNONE
J075172F11GTGACGTGNONE
J090073H01GTGACGTGNONE
J100017B11GTGACGTGNONE
J100030L05GTGACGTGNONE
J100064A03GTGACGTGNONE
Os02g0236200AK073725ACTGACAGSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1).
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein.
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein.
Os02g0307800006-080-C10GGTGACGTGNONE
006-116-A02GGTGACGTGNONE
AK061868GGTGACGTGNONE
AK065304GGTGACGTGConserved hypothetical protein.
Os02g0315600AK102703TGTCAGTGNONE
AK106848TGTCAGTGNONE
AK107002TGTCAGTGHelix-loop-helix DNA-binding domain containing protein.
Os02g0316200AK073932CACTGACAGGCyclin-like F-box domain containing protein.
AK105757CACTGACAGGNONE
J023039G03CACTGACAGGNONE
J033076K03CACTGACAGGNONE
J075157J22CACTGACAGGNONE
J090097K02CACTGACAGGNONE
J100053F10CACTGACAGGNONE
Os02g0320300AK067650AGTGACACHypothetical protein.
Os02g0326700AK064977GGTGACGTGRhomboid-like protein family protein.
Os02g0467200014-053-H06CACGTCACAAAAGCCCATTNONE
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein.
J065197J05CACGTCACAAAAGCCCATTNONE
Os02g0468200AK103767CACGTCACCProtein of unknown function DUF652 family protein.
J033071N12CACGTCACCNONE
J033143I02CACGTCACCNONE
J100019J22CACGTCACCNONE
J100075O13CACGTCACCNONE
Os02g0490000AK106789AGTGACACU box domain containing protein.
Os02g0491300J065205O09CCCACCTGTCAGConserved hypothetical protein.
Os02g0491400AK073233CACTGACASimilar to Peptidylprolyl isomerase.
AK073233CCACTGACSimilar to Peptidylprolyl isomerase.
J090046J15CACTGACANONE
J090046J15CCACTGACNONE
Os02g0504800AK069683CTGACAGGSimilar to Delta-9 stearoyl-acyl carrier protein desaturase (EC 1.14.99.6) (Fragment).
J023030N09CTGACAGGNONE
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
Os02g0510600AK073949GTGTCACTHeavy metal transport/detoxification protein domain containing protein.
AK120359GTGTCACTNONE
J013067J06GTGTCACTNONE
Os02g0522700012-086-C03GCCACGTCACCNONE
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein.
Os02g0533800009-149-F12CACTGACANONE
013-058-H02CACTGACANONE
014-017-G07CACTGACANONE
014-028-F04CACTGACANONE
014-050-G04CACTGACANONE
014-095-F04CACTGACANONE
014-099-C08CACTGACANONE
016-046-F05CACTGACANONE
AK121139CACTGACAConserved hypothetical protein.
J013104A14CACTGACANONE
J023077F13CACTGACANONE
J023145I11CACTGACANONE
J065033D14CACTGACANONE
J065079I15CACTGACANONE
J065104E21CACTGACANONE
J065128E06CACTGACANONE
J065174F07CACTGACANONE
J065195B12CACTGACANONE
J065207B12CACTGACANONE
J080304M24CACTGACANONE
J090040A13CACTGACANONE
J090054B18CACTGACANONE
J100037A06CACTGACANONE
J100042F24CACTGACANONE
J100043N23CACTGACANONE
J100044H14CACTGACANONE
J100056K24CACTGACANONE
J100063O22CACTGACANONE
J100071G05CACTGACANONE
J100078G15CACTGACANONE
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein.
Os02g0551600009-174-H09GCCACGTCACCNONE
AK063102GCCACGTCACCConserved hypothetical protein.
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein.
Os02g0574600AK059246CACCTGTCAGTConserved hypothetical protein.
Os02g0575000AK121198ACGTCACCConserved hypothetical protein.
AK121198ACGTCACCConserved hypothetical protein.
J023087D21ACGTCACCNONE
J023087D21ACGTCACCNONE
J065029M04ACGTCACCNONE
J065029M04ACGTCACCNONE
J065173G10ACGTCACCNONE
J065173G10ACGTCACCNONE
J065188I20ACGTCACCNONE
J065188I20ACGTCACCNONE
J065197H16ACGTCACCNONE
J065197H16ACGTCACCNONE
J100057F16ACGTCACCNONE
J100057F16ACGTCACCNONE
J100077G04ACGTCACCNONE
J100077G04ACGTCACCNONE
Os02g0576400AK107966CACGTCACConserved hypothetical protein.
J075083G06CACGTCACNONE
J075164K09CACGTCACNONE
Os02g0578201J065065K19CACTGACAConserved hypothetical protein.
Os02g0582400006-091-G09GGTGACGTGNONE
AK070989GGTGACGTGConserved hypothetical protein.
J023075I23GGTGACGTGNONE
J080021H07GGTGACGTGNONE
J080068A03GGTGACGTGNONE
J080089B13GGTGACGTGNONE
J080093G22GGTGACGTGNONE
Os02g0600200009-154-A06CACTGACAAGTGGGTCCAGANONE
AK058978CACTGACAAGTGGGTCCAGANONE
AK066974CACTGACAAGTGGGTCCAGAIQ calmodulin-binding region domain containing protein.
Os02g0601800AB060276CACGTCACNONE
AB060276CACTGACAGGTGGNONE
AK099539CACGTCACNONE
AK099539CACTGACAGGTGGNONE
AK101873CACGTCACBromodomain containing protein.
AK101873CACTGACAGGTGGBromodomain containing protein.
AK106801CACGTCACNONE
AK106801CACTGACAGGTGGNONE
AK121758CACGTCACNONE
AK121758CACTGACAGGTGGNONE
AK121891CACGTCACNONE
AK121891CACTGACAGGTGGNONE
J013059H01CACGTCACNONE
J013059H01CACTGACAGGTGGNONE
J013092F08CACGTCACNONE
J013092F08CACTGACAGGTGGNONE
J013146J04CACGTCACNONE
J013146J04CACTGACAGGTGGNONE
J023001K12CACGTCACNONE
J023001K12CACTGACAGGTGGNONE
J023002H16CACGTCACNONE
J023002H16CACTGACAGGTGGNONE
J023013B10CACGTCACNONE
J023013B10CACTGACAGGTGGNONE
J023081I22CACGTCACNONE
J023081I22CACTGACAGGTGGNONE
J023084K19CACGTCACNONE
J023084K19CACTGACAGGTGGNONE
J023150E24CACGTCACNONE
J023150E24CACTGACAGGTGGNONE
J033023B18CACGTCACNONE
J033023B18CACTGACAGGTGGNONE
J033025F18CACGTCACNONE
J033025F18CACTGACAGGTGGNONE
J033048P08CACGTCACNONE
J033048P08CACTGACAGGTGGNONE
J033060M24CACGTCACNONE
J033060M24CACTGACAGGTGGNONE
J033070G06CACGTCACNONE
J033070G06CACTGACAGGTGGNONE
J033088P12CACGTCACNONE
J033088P12CACTGACAGGTGGNONE
J033105C13CACGTCACNONE
J033105C13CACTGACAGGTGGNONE
J043009N18CACGTCACNONE
J043009N18CACTGACAGGTGGNONE
J065103G21CACGTCACNONE
J065103G21CACTGACAGGTGGNONE
J075039H15CACGTCACNONE
J075039H15CACTGACAGGTGGNONE
J090014K10CACGTCACNONE
J090014K10CACTGACAGGTGGNONE
J090022N02CACGTCACNONE
J090022N02CACTGACAGGTGGNONE
J090033F18CACGTCACNONE
J090033F18CACTGACAGGTGGNONE
J090033I04CACGTCACNONE
J090033I04CACTGACAGGTGGNONE
J090041F11CACGTCACNONE
J090041F11CACTGACAGGTGGNONE
J090045P20CACGTCACNONE
J090045P20CACTGACAGGTGGNONE
J090054B01CACGTCACNONE
J090054B01CACTGACAGGTGGNONE
J090055M12CACGTCACNONE
J090055M12CACTGACAGGTGGNONE
J090071K09CACGTCACNONE
J090071K09CACTGACAGGTGGNONE
J090098O16CACGTCACNONE
J090098O16CACTGACAGGTGGNONE
J090099P15CACGTCACNONE
J090099P15CACTGACAGGTGGNONE
J100050I16CACGTCACNONE
J100050I16CACTGACAGGTGGNONE
Os02g0602400AK059178CCTGTCAGNONE
Os02g0608500AK071922AGTGACACNONE
AK071922CCACTGACANONE
AK099756AGTGACACSimilar to Ankyrin-kinase protein (Fragment).
AK099756CCACTGACASimilar to Ankyrin-kinase protein (Fragment).
Os02g0608900AK068690ACTGACAGNONE
AK105867ACTGACAGSimilar to Epstein-Barr virus (B95-8 isolate) U2-IR2 domain encoding nuclear protein EBNA2, complete cds.
J065017D16ACTGACAGNONE
J065042D05ACTGACAGNONE
J065117J15ACTGACAGNONE
J075020G04ACTGACAGNONE
J075052B14ACTGACAGNONE
J075170K13ACTGACAGNONE
J075178D19ACTGACAGNONE
J075182F02ACTGACAGNONE
J075199I18ACTGACAGNONE
J090057A11ACTGACAGNONE
J100048A21ACTGACAGNONE
Os02g0611500AK072083AGTGACACSimilar to Eukaryotic initiation factor-like protein.
Os02g0613200AK064869GCCCCCACTGACNONE
AK065051GCCCCCACTGACNONE
AK098853GCCCCCACTGACConserved hypothetical protein.
AK098974GCCCCCACTGACNONE
J013000H15GCCCCCACTGACNONE
J013001I18GCCCCCACTGACNONE
J013022I18GCCCCCACTGACNONE
J013025D06GCCCCCACTGACNONE
J013037H17GCCCCCACTGACNONE
J013043F22GCCCCCACTGACNONE
J013075E01GCCCCCACTGACNONE
J013088D09GCCCCCACTGACNONE
J013088E19GCCCCCACTGACNONE
J013102O18GCCCCCACTGACNONE
J013110C08GCCCCCACTGACNONE
J013118C06GCCCCCACTGACNONE
J013119F22GCCCCCACTGACNONE
J013128K14GCCCCCACTGACNONE
J013158C17GCCCCCACTGACNONE
J023013P15GCCCCCACTGACNONE
J023044L21GCCCCCACTGACNONE
J033023I04GCCCCCACTGACNONE
J033038I22GCCCCCACTGACNONE
J033095M02GCCCCCACTGACNONE
J043022F05GCCCCCACTGACNONE
J080307N20GCCCCCACTGACNONE
J080315C02GCCCCCACTGACNONE
J080316A15GCCCCCACTGACNONE
J080316G03GCCCCCACTGACNONE
J090029E24GCCCCCACTGACNONE
J090031H15GCCCCCACTGACNONE
J090034F13GCCCCCACTGACNONE
J090047G02GCCCCCACTGACNONE
J090069M24GCCCCCACTGACNONE
J100052E15GCCCCCACTGACNONE
Os02g0621700011-079-F10TGTCAGTGNONE
AK101006TGTCAGTGSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta).
AK103525TGTCAGTGNONE
J013026C02TGTCAGTGNONE
J013104M10TGTCAGTGNONE
J023003D01TGTCAGTGNONE
J023007H13TGTCAGTGNONE
J023019G09TGTCAGTGNONE
J023020L19TGTCAGTGNONE
J023022L12TGTCAGTGNONE
J023022O14TGTCAGTGNONE
J023036F16TGTCAGTGNONE
J023047D16TGTCAGTGNONE
J023052P08TGTCAGTGNONE
J023077C01TGTCAGTGNONE
J023083M06TGTCAGTGNONE
J023105A11TGTCAGTGNONE
J023117F21TGTCAGTGNONE
J023119D20TGTCAGTGNONE
J023148E03TGTCAGTGNONE
J023149B13TGTCAGTGNONE
J033029A10TGTCAGTGNONE
J033046L17TGTCAGTGNONE
J033052M04TGTCAGTGNONE
J033057M14TGTCAGTGNONE
J033066K24TGTCAGTGNONE
J033069K02TGTCAGTGNONE
J033079G14TGTCAGTGNONE
J033101E06TGTCAGTGNONE
J033116E06TGTCAGTGNONE
J033118L18TGTCAGTGNONE
J033135B13TGTCAGTGNONE
J033136C10TGTCAGTGNONE
J033136P08TGTCAGTGNONE
J043027B13TGTCAGTGNONE
J065039I03TGTCAGTGNONE
J065185N21TGTCAGTGNONE
J090008D14TGTCAGTGNONE
J090029K17TGTCAGTGNONE
J090047H20TGTCAGTGNONE
J090048N17TGTCAGTGNONE
J090085G08TGTCAGTGNONE
J090089F07TGTCAGTGNONE
Os02g0625500011-025-C06GTCAGTGGNONE
AB050624GTCAGTGGNONE
AK059188GTCAGTGGNONE
AK059771GTCAGTGGNONE
AK101791GTCAGTGGSimilar to Adenosine kinase-like protein (Fragment).
AY224510GTCAGTGGNONE
J013152H02GTCAGTGGNONE
J023012P09GTCAGTGGNONE
J023127D16GTCAGTGGNONE
J033024G01GTCAGTGGNONE
J033025L19GTCAGTGGNONE
J033080M04GTCAGTGGNONE
J033101A08GTCAGTGGNONE
J033121L12GTCAGTGGNONE
J043017N15GTCAGTGGNONE
J065207J01GTCAGTGGNONE
J090049G12GTCAGTGGNONE
J100036A07GTCAGTGGNONE
J100076C04GTCAGTGGNONE
J100080N22GTCAGTGGNONE
Os02g0658033J090015D03CACGTCACPleckstrin-like domain containing protein.
Os02g0658500AK120166ACCGGGCCCGCATGTCAGTGNONE
Os02g0659100AK107559AGTGACACZinc finger, C2H2-type domain containing protein.
Os02g0680500015-074-F11TGTCAGTGNONE
AK106401TGTCAGTGProtein prenyltransferase domain containing protein.
Os02g0686300AK066567CGCGCGAGTGACACConserved hypothetical protein.
Os02g0686700AK111294CCACTGACProtein of unknown function DUF581 family protein.
Os02g0690600AK110831CACGTCACU box domain containing protein.
Os02g0697700AK120209CACTGACAConserved hypothetical protein.
J013038N05CACTGACANONE
J013170I01CACTGACANONE
J033144L08CACTGACANONE
J033145L08CACTGACANONE
J043004E24CACTGACANONE
J065032A08CACTGACANONE
J065166F03CACTGACANONE
J075174D13CACTGACANONE
J100019I19CACTGACANONE
J100073F13CACTGACANONE
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV.
Os02g0725100AK071759ACTGACAGNONE
AK071759ACTGACAGGTGTGGCCCACTNONE
AK071759CACTGACAAGTGGGACCCNONE
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).
J065121P04CTGACAGGTGGGCCTANONE
Os02g0732600AK108709TGTCAGTGSimilar to Typical P-type R2R3 Myb protein (Fragment).
Os02g0735200015-035-A06CCACTGACANONE
015-048-A05CCACTGACANONE
015-091-A06CCACTGACANONE
016-082-G07CCACTGACANONE
016-086-G04CCACTGACANONE
AB037595CCACTGACANONE
AK061157CCACTGACANONE
AK071969CCACTGACANONE
AK104987CCACTGACANONE
AK109397CCACTGACAGlutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS28).
X14245CCACTGACANONE
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment).
AK098873GTGACGTGGCNONE
J013001C18GTGACGTGGCNONE
J080003D07GTGACGTGGCNONE
J080003H24GTGACGTGGCNONE
J080010C23GTGACGTGGCNONE
J080011I04GTGACGTGGCNONE
J080011O03GTGACGTGGCNONE
J080012F13GTGACGTGGCNONE
J080020E06GTGACGTGGCNONE
J080025H22GTGACGTGGCNONE
J080026D15GTGACGTGGCNONE
J080028D20GTGACGTGGCNONE
J080029P20GTGACGTGGCNONE
J080031K22GTGACGTGGCNONE
J080034I05GTGACGTGGCNONE
J080036E11GTGACGTGGCNONE
J080036H13GTGACGTGGCNONE
J080037E17GTGACGTGGCNONE
J080043N05GTGACGTGGCNONE
J080044L23GTGACGTGGCNONE
J080047N11GTGACGTGGCNONE
J080048O04GTGACGTGGCNONE
J080049M01GTGACGTGGCNONE
J080050F21GTGACGTGGCNONE
J080054F09GTGACGTGGCNONE
J080055N20GTGACGTGGCNONE
J080058C02GTGACGTGGCNONE
J080058K15GTGACGTGGCNONE
J080062G02GTGACGTGGCNONE
J080066H16GTGACGTGGCNONE
J080066O05GTGACGTGGCNONE
J080067O16GTGACGTGGCNONE
J080068E13GTGACGTGGCNONE
J080069P16GTGACGTGGCNONE
J080072M11GTGACGTGGCNONE
J080076H09GTGACGTGGCNONE
J080081G24GTGACGTGGCNONE
J080082J05GTGACGTGGCNONE
J080084I10GTGACGTGGCNONE
J080087L24GTGACGTGGCNONE
J080089H07GTGACGTGGCNONE
J080089M05GTGACGTGGCNONE
J080092G18GTGACGTGGCNONE
J080095N08GTGACGTGGCNONE
Os02g0745400AK072229AAAAGCCCCACATGTCAGTGACACGlycosyl transferase, family 8 protein.
AK108072AAAAGCCCCACATGTCAGTGACACNONE
Os02g0750500AK101960GTGTCACTGACATGTGGGGCCTGGSAM (and some other nucleotide) binding motif domain containing protein.
J033075P05GTGTCACTGACATGTGGGGCCTGGNONE
J065054F02GTGTCACTGACATGTGGGGCCTGGNONE
J065124N03GTGTCACTGACATGTGGGGCCTGGNONE
J090001H12GTGTCACTGACATGTGGGGCCTGGNONE
J100057J01GTGTCACTGACATGTGGGGCCTGGNONE
J100062F12GTGTCACTGACATGTGGGGCCTGGNONE
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein.
J023132N16CCCACCACGTGTCACTNONE
J033069F17CCCACCACGTGTCACTNONE
Os02g0754700AK066904GGTGACGTSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21).
AK099136GGTGACGTNONE
Os02g0756600009-128-A01GTGTCACTNONE
AK062900GTGTCACTSimilar to Phi-1 protein.
J065039J24GTGTCACTNONE
Os02g0759500AK072404TGTCAGTGGProtein prenyltransferase domain containing protein.
AK110954TGTCAGTGGNONE
J023077D13TGTCAGTGGNONE
J065053L15TGTCAGTGGNONE
J065087D20TGTCAGTGGNONE
Os02g0761600AK120494CCACTGACAConserved hypothetical protein.
AK120494TGTCAGTGConserved hypothetical protein.
Os02g0762600AK103657AGTGACACNONE
AK103657CACGTCACNONE
AK110321AGTGACACConserved hypothetical protein.
AK110321CACGTCACConserved hypothetical protein.
J033135G19AGTGACACNONE
J033135G19CACGTCACNONE
J090004E21AGTGACACNONE
J090004E21CACGTCACNONE
J100067M04AGTGACACNONE
J100067M04CACGTCACNONE
Os02g0766600006-039-E02CACGTCACNONE
009-087-E05CACGTCACNONE
013-049-E02CACGTCACNONE
AK059779CACGTCACProtein of unknown function DUF1685 family protein.
AK099386CACGTCACNONE
J033072H02CACGTCACNONE
J065045F21CACGTCACNONE
J065079P05CACGTCACNONE
J065121M12CACGTCACNONE
J065134C23CACGTCACNONE
J065140G23CACGTCACNONE
J065180P12CACGTCACNONE
J065212O07CACGTCACNONE
J100028B03CACGTCACNONE
J100030E05CACGTCACNONE
J100037O12CACGTCACNONE
J100050P11CACGTCACNONE
J100058I07CACGTCACNONE
J100059G05CACGTCACNONE
J100062H11CACGTCACNONE
J100064L18CACGTCACNONE
J100068G08CACGTCACNONE
Os02g0766700AK072062ATCCCCCACACCACTGACASimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2).
AK072062GTGTCACTSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2).
J100073F09ATCCCCCACACCACTGACANONE
J100073F09GTGTCACTNONE
Os02g0773300AK071811CACTGACAPyridoxal phosphate-dependent deaminase family protein.
J013056D10CACTGACANONE
J013096G18CACTGACANONE
Os02g0778200AK065948GTGTCACTAminoacyl-tRNA synthetase, class I family protein.
Os02g0781700006-066-G01CACTGACANONE
006-066-G01GGCCCCACCTGTCAGTGGNONE
009-034-D03CACTGACANONE
009-034-D03GGCCCCACCTGTCAGTGGNONE
009-194-D04CACTGACANONE
009-194-D04GGCCCCACCTGTCAGTGGNONE
AK061791CACTGACAConserved hypothetical protein.
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein.
AK063223CACTGACANONE
AK063223GGCCCCACCTGTCAGTGGNONE
AY224477CACTGACANONE
AY224477GGCCCCACCTGTCAGTGGNONE
J013045H09CACTGACANONE
J013045H09GGCCCCACCTGTCAGTGGNONE
J013061I22CACTGACANONE
J013061I22GGCCCCACCTGTCAGTGGNONE
J013071F11CACTGACANONE
J013071F11GGCCCCACCTGTCAGTGGNONE
J023130H07CACTGACANONE
J023130H07GGCCCCACCTGTCAGTGGNONE
J043036K23CACTGACANONE
J043036K23GGCCCCACCTGTCAGTGGNONE
J065010N07CACTGACANONE
J065010N07GGCCCCACCTGTCAGTGGNONE
J065219I01CACTGACANONE
J065219I01GGCCCCACCTGTCAGTGGNONE
J090073I15CACTGACANONE
J090073I15GGCCCCACCTGTCAGTGGNONE
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE
006-065-C12CTGACAGGTGGGCCCCACCACNONE
011-016-A10CTGACAGGTGGGCCCCACCACNONE
011-027-G10CTGACAGGTGGGCCCCACCACNONE
011-078-C10CTGACAGGTGGGCCCCACCACNONE
012-039-F02CTGACAGGTGGGCCCCACCACNONE
012-059-F07CTGACAGGTGGGCCCCACCACNONE
012-088-B06CTGACAGGTGGGCCCCACCACNONE
012-088-C06CTGACAGGTGGGCCCCACCACNONE
012-090-F01CTGACAGGTGGGCCCCACCACNONE
015-002-C09CTGACAGGTGGGCCCCACCACNONE
015-004-C04CTGACAGGTGGGCCCCACCACNONE
015-024-F11CTGACAGGTGGGCCCCACCACNONE
015-038-C01CTGACAGGTGGGCCCCACCACNONE
015-053-H02CTGACAGGTGGGCCCCACCACNONE
015-057-G04CTGACAGGTGGGCCCCACCACNONE
016-010-H02CTGACAGGTGGGCCCCACCACNONE
016-018-C07CTGACAGGTGGGCCCCACCACNONE
016-048-B11CTGACAGGTGGGCCCCACCACNONE
016-062-D03CTGACAGGTGGGCCCCACCACNONE
016-077-H03CTGACAGGTGGGCCCCACCACNONE
AF193803CTGACAGGTGGGCCCCACCACNONE
AK064027CTGACAGGTGGGCCCCACCACNONE
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1.
AK119643CTGACAGGTGGGCCCCACCACNONE
AK119885CTGACAGGTGGGCCCCACCACNONE
J013021I16CTGACAGGTGGGCCCCACCACNONE
J013049O14CTGACAGGTGGGCCCCACCACNONE
J013063K17CTGACAGGTGGGCCCCACCACNONE
J013072M15CTGACAGGTGGGCCCCACCACNONE
J023027O06CTGACAGGTGGGCCCCACCACNONE
J023065O13CTGACAGGTGGGCCCCACCACNONE
J033061L05CTGACAGGTGGGCCCCACCACNONE
J033071D23CTGACAGGTGGGCCCCACCACNONE
J033091P12CTGACAGGTGGGCCCCACCACNONE
J033124J07CTGACAGGTGGGCCCCACCACNONE
J033144H23CTGACAGGTGGGCCCCACCACNONE
J033145H23CTGACAGGTGGGCCCCACCACNONE
J065063N13CTGACAGGTGGGCCCCACCACNONE
J065186B09CTGACAGGTGGGCCCCACCACNONE
J075055I18CTGACAGGTGGGCCCCACCACNONE
J075177O06CTGACAGGTGGGCCCCACCACNONE
J090008G10CTGACAGGTGGGCCCCACCACNONE
J090050I24CTGACAGGTGGGCCCCACCACNONE
J090062F21CTGACAGGTGGGCCCCACCACNONE
J090071M09CTGACAGGTGGGCCCCACCACNONE
J090078M03CTGACAGGTGGGCCCCACCACNONE
J100018N15CTGACAGGTGGGCCCCACCACNONE
J100035P04CTGACAGGTGGGCCCCACCACNONE
J100037E03CTGACAGGTGGGCCCCACCACNONE
J100045D04CTGACAGGTGGGCCCCACCACNONE
J100062C01CTGACAGGTGGGCCCCACCACNONE
J100065C13CTGACAGGTGGGCCCCACCACNONE
J100068N10CTGACAGGTGGGCCCCACCACNONE
J100074A11CTGACAGGTGGGCCCCACCACNONE
J100077G20CTGACAGGTGGGCCCCACCACNONE
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE
Os02g0793000AK070242CTGACAGGNONE
AK099173CTGACAGGNONE
AK105863CTGACAGGZinc finger, CCCH-type domain containing protein.
Os02g0803600AK064750ACGTCACCLongin-like domain containing protein.
Os02g0804300006-046-D12CCACTGACNONE
AK060165CCACTGACNONE
Os02g0815200AK067252ACTGACAGGSimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29).
AK104489ACTGACAGGNONE
Os02g0820400AK060511CACTGACANONE
AK100771CACTGACATransferase family protein.
J023120A02CACTGACANONE
Os02g0824400AK121390CACGTCACConserved hypothetical protein.
J023128P21CACGTCACNONE
J053097O16CACGTCACNONE
J065012I02CACGTCACNONE
J065049C06CACGTCACNONE
J065051H02CACGTCACNONE
J065069A13CACGTCACNONE
J065082E04CACGTCACNONE
J065102N09CACGTCACNONE
J065157O10CACGTCACNONE
J065188N23CACGTCACNONE
J065190J11CACGTCACNONE
J065202M09CACGTCACNONE
Os02g0824500AK111296GTGACGTGSimilar to Remorin.
J065048M11GTGACGTGNONE
J065081F01GTGACGTGNONE
Os02g0826200AK070787CTGACAGGdTDP-4-dehydrorhamnose reductase family protein.
J075022D14CTGACAGGNONE
Os02g0830000011-075-D11GTGACGTGACGTGNONE
AK101841GTGACGTGACGTGProtein prenyltransferase domain containing protein.
J033069G13GTGACGTGACGTGNONE
Os02g0832700AK099439ACTGACAGSimilar to Metal tolerance protein C2 (AtMTPc2).
Os03g0100500013-056-B11TGTCAGTGNONE
Os03g0113000009-007-C03ACGTCACCNONE
AK058286ACGTCACCProtein kinase-like domain containing protein.
AK071309ACGTCACCNONE
AK104314ACGTCACCNONE
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein.
Os03g0119900AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)].
J065035O07CGCCACGTCACCGATCCGNONE
J065165C24CGCCACGTCACCGATCCGNONE
J075039M05CGCCACGTCACCGATCCGNONE
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein.
AK101458CACTGACAProtein kinase-like domain containing protein.
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE
J013035K10CACTGACANONE
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE
J013050E10CACTGACANONE
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE
J033040C13CACTGACANONE
Os03g0124100AK107007CCACTGACFringe-like family protein.
Os03g0124200AK102524GTCAGTGGSimilar to Pto-like protein kinase F.
AK105735GTCAGTGGNONE
J033096A14GTCAGTGGNONE
J090082I09GTCAGTGGNONE
Os03g0135300004-017-A10AGCCCATCTGTCAGTGNONE
004-017-A10CTGTCAGTGNONE
006-046-A11AGCCCATCTGTCAGTGNONE
006-046-A11CTGTCAGTGNONE
006-110-B05AGCCCATCTGTCAGTGNONE
006-110-B05CTGTCAGTGNONE
AF309384AGCCCATCTGTCAGTGNONE
AF309384CTGTCAGTGNONE
AK071745AGCCCATCTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18).
AK071745CTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18).
AK104680AGCCCATCTGTCAGTGNONE
AK104680CTGTCAGTGNONE
J013100M12AGCCCATCTGTCAGTGNONE
J013100M12CTGTCAGTGNONE
J023107J18AGCCCATCTGTCAGTGNONE
J023107J18CTGTCAGTGNONE
J033081B13AGCCCATCTGTCAGTGNONE
J033081B13CTGTCAGTGNONE
J033087L03AGCCCATCTGTCAGTGNONE
J033087L03CTGTCAGTGNONE
J065120N18AGCCCATCTGTCAGTGNONE
J065120N18CTGTCAGTGNONE
J075032C15AGCCCATCTGTCAGTGNONE
J075032C15CTGTCAGTGNONE
J075172P14AGCCCATCTGTCAGTGNONE
J075172P14CTGTCAGTGNONE
J090049B05AGCCCATCTGTCAGTGNONE
J090049B05CTGTCAGTGNONE
Os03g0137400AK072057CGCACCGCGACACGTCACGTCTCNONE
AK101118CGCACCGCGACACGTCACGTCTCProtein of unknown function DUF221 domain containing protein.
J013129L02CGCACCGCGACACGTCACGTCTCNONE
J033025H22CGCACCGCGACACGTCACGTCTCNONE
J033034L15CGCACCGCGACACGTCACGTCTCNONE
J033044F21CGCACCGCGACACGTCACGTCTCNONE
J033046F15CGCACCGCGACACGTCACGTCTCNONE
J033101I17CGCACCGCGACACGTCACGTCTCNONE
J033150K16CGCACCGCGACACGTCACGTCTCNONE
J065042G12CGCACCGCGACACGTCACGTCTCNONE
J065083F17CGCACCGCGACACGTCACGTCTCNONE
J100044G19CGCACCGCGACACGTCACGTCTCNONE
Os03g0138700009-045-H03TGTCAGTGNONE
AK072119TGTCAGTGTGF-beta receptor, type I/II extracellular region family protein.
J013025I16TGTCAGTGNONE
J013123D02TGTCAGTGNONE
J023048B09TGTCAGTGNONE
J023048C09TGTCAGTGNONE
J065027O03TGTCAGTGNONE
J065028C03TGTCAGTGNONE
J065080H22TGTCAGTGNONE
J065102H03TGTCAGTGNONE
J065137P14TGTCAGTGNONE
J065143C23TGTCAGTGNONE
J065168G06TGTCAGTGNONE
J065192N07TGTCAGTGNONE
J065205I11TGTCAGTGNONE
J075040F03TGTCAGTGNONE
J075052H20TGTCAGTGNONE
J075118L18TGTCAGTGNONE
J075126C19TGTCAGTGNONE
J075173L07TGTCAGTGNONE
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2).
AK100092CGCCACGTCACCCGCACGCGNONE
J023003L18CGCCACGTCACCCGCACGCGNONE
J023022K18CGCCACGTCACCCGCACGCGNONE
J023107H13CGCCACGTCACCCGCACGCGNONE
J023107K02CGCCACGTCACCCGCACGCGNONE
Os03g0151800AK064955CACTGACANONE
AK098874CACTGACANONE
AK098980CACTGACANONE
AK099712CACTGACANONE
AK099889CACTGACANONE
AK121641CACTGACASimilar to Cell division control protein 48 homolog A (AtCDC48a).
J013001A05CACTGACANONE
J013001D04CACTGACANONE
J013121O12CACTGACANONE
Os03g0151900009-084-F09CACTGACANONE
AB032761CACTGACANONE
AK105389CACTGACANONE
AK121527CACTGACASimilar to Small GTP-binding protein.
J075028M03CACTGACANONE
J075031H15CACTGACANONE
J075045L24CACTGACANONE
J075055K14CACTGACANONE
J075100O08CACTGACANONE
J075112B20CACTGACANONE
J075188D21CACTGACANONE
Os03g0152000AK102357ACTGACAGGHeavy metal transport/detoxification protein domain containing protein.
J023072F16ACTGACAGGNONE
J033091H19ACTGACAGGNONE
J065037B07ACTGACAGGNONE
J065087E11ACTGACAGGNONE
J065098H09ACTGACAGGNONE
J065105L15ACTGACAGGNONE
J065165N20ACTGACAGGNONE
J065166C14ACTGACAGGNONE
J065183M01ACTGACAGGNONE
J065187C11ACTGACAGGNONE
J075001H11ACTGACAGGNONE
J075044D12ACTGACAGGNONE
J075088L19ACTGACAGGNONE
J075124A10ACTGACAGGNONE
J075155D14ACTGACAGGNONE
J075173I10ACTGACAGGNONE
J090009D11ACTGACAGGNONE
J090056G24ACTGACAGGNONE
J100028I24ACTGACAGGNONE
J100029D09ACTGACAGGNONE
Os03g0158800AK108516AGTGACACACTGACASimilar to P69C protein.
J065013G11AGTGACACACTGACANONE
Os03g0159700012-100-B09GTGACGTGTGGCCCATACNONE
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein.
J065197I24GTGACGTGTGGCCCATACNONE
J090089G20GTGACGTGTGGCCCATACNONE
Os03g0160200AK064836GTGACGTGGACCGGACGCGTCCConserved hypothetical protein.
AK071081GTGACGTGGACCGGACGCGTCCNONE
AK100712GTGACGTGGACCGGACGCGTCCNONE
AK104859GTGACGTGGACCGGACGCGTCCNONE
J013000F21GTGACGTGGACCGGACGCGTCCNONE
J013024G05GTGACGTGGACCGGACGCGTCCNONE
J013035E12GTGACGTGGACCGGACGCGTCCNONE
J013041A17GTGACGTGGACCGGACGCGTCCNONE
J013045D10GTGACGTGGACCGGACGCGTCCNONE
J013045F04GTGACGTGGACCGGACGCGTCCNONE
J013046F04GTGACGTGGACCGGACGCGTCCNONE
J013047F10GTGACGTGGACCGGACGCGTCCNONE
J013051E10GTGACGTGGACCGGACGCGTCCNONE
J013059J07GTGACGTGGACCGGACGCGTCCNONE
J013059O17GTGACGTGGACCGGACGCGTCCNONE
J013060A20GTGACGTGGACCGGACGCGTCCNONE
J013063J23GTGACGTGGACCGGACGCGTCCNONE
J013066D19GTGACGTGGACCGGACGCGTCCNONE
J013069O08GTGACGTGGACCGGACGCGTCCNONE
J013088K24GTGACGTGGACCGGACGCGTCCNONE
J013098G04GTGACGTGGACCGGACGCGTCCNONE
J013100I15GTGACGTGGACCGGACGCGTCCNONE
J013102E18GTGACGTGGACCGGACGCGTCCNONE
J013102O09GTGACGTGGACCGGACGCGTCCNONE
J013119M18GTGACGTGGACCGGACGCGTCCNONE
J013123I19GTGACGTGGACCGGACGCGTCCNONE
J013146H15GTGACGTGGACCGGACGCGTCCNONE
J013149A14GTGACGTGGACCGGACGCGTCCNONE
J023003A05GTGACGTGGACCGGACGCGTCCNONE
J023013O19GTGACGTGGACCGGACGCGTCCNONE
J023044M05GTGACGTGGACCGGACGCGTCCNONE
J023048O03GTGACGTGGACCGGACGCGTCCNONE
J023049L17GTGACGTGGACCGGACGCGTCCNONE
J023060D22GTGACGTGGACCGGACGCGTCCNONE
J023060F20GTGACGTGGACCGGACGCGTCCNONE
J023069G09GTGACGTGGACCGGACGCGTCCNONE
J023086E11GTGACGTGGACCGGACGCGTCCNONE
J023091I09GTGACGTGGACCGGACGCGTCCNONE
J023091M19GTGACGTGGACCGGACGCGTCCNONE
J023101D06GTGACGTGGACCGGACGCGTCCNONE
J023109B03GTGACGTGGACCGGACGCGTCCNONE
J023113B14GTGACGTGGACCGGACGCGTCCNONE
J023114B19GTGACGTGGACCGGACGCGTCCNONE
J023115H16GTGACGTGGACCGGACGCGTCCNONE
J023134F22GTGACGTGGACCGGACGCGTCCNONE
J023139I06GTGACGTGGACCGGACGCGTCCNONE
J023150C02GTGACGTGGACCGGACGCGTCCNONE
J033033A14GTGACGTGGACCGGACGCGTCCNONE
J033058O11GTGACGTGGACCGGACGCGTCCNONE
J033060H13GTGACGTGGACCGGACGCGTCCNONE
J033075P14GTGACGTGGACCGGACGCGTCCNONE
J033084O05GTGACGTGGACCGGACGCGTCCNONE
J033087G04GTGACGTGGACCGGACGCGTCCNONE
J033092E18GTGACGTGGACCGGACGCGTCCNONE
J033101G23GTGACGTGGACCGGACGCGTCCNONE
J033112I05GTGACGTGGACCGGACGCGTCCNONE
J033118E14GTGACGTGGACCGGACGCGTCCNONE
J033118P04GTGACGTGGACCGGACGCGTCCNONE
J033123C07GTGACGTGGACCGGACGCGTCCNONE
J043003C01GTGACGTGGACCGGACGCGTCCNONE
J043024B21GTGACGTGGACCGGACGCGTCCNONE
J043030N04GTGACGTGGACCGGACGCGTCCNONE
J043039J02GTGACGTGGACCGGACGCGTCCNONE
J043039N08GTGACGTGGACCGGACGCGTCCNONE
J075006N21GTGACGTGGACCGGACGCGTCCNONE
J075008A16GTGACGTGGACCGGACGCGTCCNONE
J075018J16GTGACGTGGACCGGACGCGTCCNONE
J075023G04GTGACGTGGACCGGACGCGTCCNONE
J075134F18GTGACGTGGACCGGACGCGTCCNONE
J075181B05GTGACGTGGACCGGACGCGTCCNONE
J090014O14GTGACGTGGACCGGACGCGTCCNONE
J090020H22GTGACGTGGACCGGACGCGTCCNONE
J090022G17GTGACGTGGACCGGACGCGTCCNONE
J090023J24GTGACGTGGACCGGACGCGTCCNONE
J090033H01GTGACGTGGACCGGACGCGTCCNONE
J090038A03GTGACGTGGACCGGACGCGTCCNONE
J090041O22GTGACGTGGACCGGACGCGTCCNONE
J090049E10GTGACGTGGACCGGACGCGTCCNONE
J090063E24GTGACGTGGACCGGACGCGTCCNONE
J090080N12GTGACGTGGACCGGACGCGTCCNONE
J100021G23GTGACGTGGACCGGACGCGTCCNONE
J100028P06GTGACGTGGACCGGACGCGTCCNONE
J100060L21GTGACGTGGACCGGACGCGTCCNONE
J100077D16GTGACGTGGACCGGACGCGTCCNONE
J100088I09GTGACGTGGACCGGACGCGTCCNONE
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE
AK121425CTGACAGGTGGGNONE
AK121425CTGACAGGTGGGGCNONE
AK121425CTGACAGGTGGGGCNONE
AK121425CTGACAGGTGGGGCNONE
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE
J023135K12CTGACAGGTGGGNONE
J023135K12CTGACAGGTGGGGCNONE
J023135K12CTGACAGGTGGGGCNONE
J023135K12CTGACAGGTGGGGCNONE
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1).
AK066932GGTGACGTGTCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1).
Os03g0169500Os03g0169500CTGACAGGSimilar to Cellulose synthase-like A4.
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE
AK061079GCCCCCACGTGTCAGTGNONE
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
Os03g0173700AK101161CCCACCTGTCAGNONE
AK111195CCCACCTGTCAGConserved hypothetical protein.
J090042G17CCCACCTGTCAGNONE
Os03g0174200AK060616TGTCAGTGNONE
AK103762TGTCAGTGConserved hypothetical protein.
J033143G15TGTCAGTGNONE
J090025L02TGTCAGTGNONE
Os03g0181600AK067807ACTGACAGSimilar to GATA transcription factor 25 (ZIM-like 2 protein).
AK101197ACTGACAGNONE
Os03g0187350J065013L15GTGACGTGHypothetical protein.
J065049N06GTGACGTGNONE
J065090E15GTGACGTGNONE
J065112I11GTGACGTGNONE
J065114I10GTGACGTGNONE
Os03g0196800006-059-H10GTGACGTGNONE
009-016-G04GTGACGTGNONE
AK058535GTGACGTGSimilar to Cyanelle 30S ribosomal protein S10.
AK104108GTGACGTGNONE
J013147G20GTGACGTGNONE
J100026M18GTGACGTGNONE
J100043F14GTGACGTGNONE
J100062D03GTGACGTGNONE
Os03g0199500J065099N05CCCACCTGTCAGTGNONE
J065152P14CCCACCTGTCAGTGConserved hypothetical protein.
J080009C14CCCACCTGTCAGTGNONE
J080011K01CCCACCTGTCAGTGNONE
J080015H12CCCACCTGTCAGTGNONE
J080022K05CCCACCTGTCAGTGNONE
J080034G01CCCACCTGTCAGTGNONE
J080038I04CCCACCTGTCAGTGNONE
J080039F20CCCACCTGTCAGTGNONE
J080042J22CCCACCTGTCAGTGNONE
J080042N23CCCACCTGTCAGTGNONE
J080043E07CCCACCTGTCAGTGNONE
J080050A12CCCACCTGTCAGTGNONE
J080050C11CCCACCTGTCAGTGNONE
J080052B01CCCACCTGTCAGTGNONE
J080052H22CCCACCTGTCAGTGNONE
J080060E02CCCACCTGTCAGTGNONE
J080063K24CCCACCTGTCAGTGNONE
J080067I07CCCACCTGTCAGTGNONE
J080081H22CCCACCTGTCAGTGNONE
J080085J10CCCACCTGTCAGTGNONE
J080089E20CCCACCTGTCAGTGNONE
J080092N04CCCACCTGTCAGTGNONE
J080093B01CCCACCTGTCAGTGNONE
J080093N04CCCACCTGTCAGTGNONE
J080097B03CCCACCTGTCAGTGNONE
Os03g0200400AK107086TGTCAGTGConserved hypothetical protein.
Os03g0206400AK066494CCACTGACAConserved hypothetical protein.
AK107011CCACTGACANONE
J065162G04CCACTGACANONE
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein.
Os03g0212300AK070861GTGTCACTTranscriptional factor B3 family protein.
Os03g0215800AK071308CACGTCACCPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein.
Os03g0232600AK068218TGTCAGTGU box domain containing protein.
J013114N10TGTCAGTGNONE
J013146E12TGTCAGTGNONE
J023034C23TGTCAGTGNONE
J033030J03TGTCAGTGNONE
J033050L03TGTCAGTGNONE
J033122E16TGTCAGTGNONE
J090018C20TGTCAGTGNONE
J090053P15TGTCAGTGNONE
J090096C17TGTCAGTGNONE
Os03g0238800AY224467CCACTGACAConserved hypothetical protein.
J013042E23CCACTGACANONE
Os03g0239300AK066038CACTGACAZinc finger, C2H2-type domain containing protein.
AK068149CACTGACANONE
AK071768CACTGACANONE
J053027G22CACTGACANONE
J075048G23CACTGACANONE
J100060G19CACTGACANONE
Os03g0245500AK064707ATCCCCCACTGACACurculin-like (mannose-binding) lectin domain containing protein.
J100045N08ATCCCCCACTGACANONE
Os03g0251500AK101151CACTGACANONE
AK119298CACTGACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment).
Os03g0251800AK067333CGCCACGTCACSimilar to Possible OmpA family member precursor.
AK073337CGCCACGTCACNONE
Os03g0254700AK112052CCACTGACNONE
Os03g0271500AK068546CACGTCACNONE
AK109239CACGTCACConserved hypothetical protein.
J013157P04CACGTCACNONE
J075041K23CACGTCACNONE
Os03g0274000AK119251GTGTCACTNONE
J080046E19GTGTCACTNONE
J080050M05GTGTCACTNONE
J080057N03GTGTCACTNONE
J080061A16GTGTCACTNONE
J080094M24GTGTCACTNONE
J090013O05GTGTCACTNONE
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein.
Os03g0281600AK070260CACTGACASimilar to Ca2+-ATPase.
Os03g0283100006-097-E01CCACTGACNONE
AK061849CCACTGACNONE
AK065887CCACTGACSimilar to In2-1 protein.
J013044J05CCACTGACNONE
J013130I02CCACTGACNONE
J013162M18CCACTGACNONE
J023014O17CCACTGACNONE
J023139N17CCACTGACNONE
Os03g0284500012-066-D02GTGGCCCACATGTCAGTGNONE
AK105295GTGGCCCACATGTCAGTGNONE
AK121300GTGGCCCACATGTCAGTGHAD-superfamily subfamily IIA hydrolase, CECR5 protein.
Os03g0284600AK110712CACTGACATGTGGGCCACThioredoxin fold domain containing protein.
Os03g0285900AK073348GTGTCACTSimilar to Splicing factor RSZ33.
J033025D08GTGTCACTNONE
J033087M12GTGTCACTNONE
J065008F11GTGTCACTNONE
J065059C09GTGTCACTNONE
J065070J11GTGTCACTNONE
J065076L20GTGTCACTNONE
J065083M19GTGTCACTNONE
J065111I06GTGTCACTNONE
J065112H18GTGTCACTNONE
J065112J18GTGTCACTNONE
J065140C08GTGTCACTNONE
J065180P06GTGTCACTNONE
J065187G12GTGTCACTNONE
J065189B14GTGTCACTNONE
J090042N02GTGTCACTNONE
J090087M04GTGTCACTNONE
Os03g0286200AK105065CTGACAGGNONE
Os03g0288300006-086-D07CTGACAGGNONE
AK061155CTGACAGGNONE
J065141G11CTGACAGGNONE
J065162C12CTGACAGGNONE
J100054H19CTGACAGGNONE
Os03g0288700AK110718GGACACGTCACCAcid phosphatase/vanadium-dependent haloperoxidase family protein.
Os03g0298300AK061180CTGTCAGTGProtein of unknown function DUF588 family protein.
AK099089CTGTCAGTGNONE
Os03g0299600009-037-H11TCTCGGCCCAGACTGACAGNONE
011-072-E02TCTCGGCCCAGACTGACAGNONE
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein.
J013132L05TCTCGGCCCAGACTGACAGNONE
J023012P15TCTCGGCCCAGACTGACAGNONE
J023022H03TCTCGGCCCAGACTGACAGNONE
J023026N15TCTCGGCCCAGACTGACAGNONE
J023056A21TCTCGGCCCAGACTGACAGNONE
J023093P10TCTCGGCCCAGACTGACAGNONE
J075143J10TCTCGGCCCAGACTGACAGNONE
J075166I19TCTCGGCCCAGACTGACAGNONE
J090010G13TCTCGGCCCAGACTGACAGNONE
J090033D23TCTCGGCCCAGACTGACAGNONE
J090090L22TCTCGGCCCAGACTGACAGNONE
Os03g0308800AK066789CCCACCTGTCAGNONE
AK068534CCCACCTGTCAGProtein prenyltransferase domain containing protein.
Os03g0310400009-143-E11CACGTCACNONE
AK068241CACGTCACEnoyl-CoA hydratase/isomerase domain containing protein.
J065176F24CACGTCACNONE
Os03g0310600AK109731GTGTCACTProtein of unknown function DUF247, plant family protein.
Os03g0320800AK103265TGTCAGTGNONE
Os03g0322200009-102-F01CCACTGACANONE
009-144-G06CCACTGACANONE
016-048-D06CCACTGACANONE
AK062978CCACTGACAConserved hypothetical protein.
Os03g0326200AK099837CCACTGACNONE
AK108821CCACTGACSimilar to Phospholipid-transporting ATPase 1 (EC 3.6.3.1) (Aminophospholipid flippase 1).
J065001D06CCACTGACNONE
J065037M19CCACTGACNONE
Os03g0328100AK107122CACGTCACSimilar to Axi 1 (Auxin-independent growth promoter)-like protein.
Os03g0333000AK109811CACGTCACConserved hypothetical protein.
J065152D04CACGTCACNONE
J090011B05CACGTCACNONE
Os03g0333100AK101050GTGACGTGProtein of unknown function DUF663 domain containing protein.
Os03g0338000AK121399GTGACGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment).
Os03g0340500012-007-F10CCACTGACANONE
012-007-F10GGCCCCACGTGTCAGTGNONE
012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE
AK099406CCACTGACANONE
AK099406GGCCCCACGTGTCAGTGNONE
AK099406TGTGGGGCCCACGGGTCAGTGGNONE
AK102158CCACTGACASimilar to Sucrose synthase (EC 2.4.1.13).
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13).
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13).
J013030N13CCACTGACANONE
J013030N13GGCCCCACGTGTCAGTGNONE
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE
J013063E02CCACTGACANONE
J013063E02GGCCCCACGTGTCAGTGNONE
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE
J013063I02CCACTGACANONE
J013063I02GGCCCCACGTGTCAGTGNONE
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE
J013157O07CCACTGACANONE
J013157O07GGCCCCACGTGTCAGTGNONE
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE
J023131N05CCACTGACANONE
J023131N05GGCCCCACGTGTCAGTGNONE
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE
J033033P05CCACTGACANONE
J033033P05GGCCCCACGTGTCAGTGNONE
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE
J033040N16CCACTGACANONE
J033040N16GGCCCCACGTGTCAGTGNONE
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE
J033044M19CCACTGACANONE
J033044M19GGCCCCACGTGTCAGTGNONE
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE
J033086F24CCACTGACANONE
J033086F24GGCCCCACGTGTCAGTGNONE
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE
J033097H01CCACTGACANONE
J033097H01GGCCCCACGTGTCAGTGNONE
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE
J033106C22CCACTGACANONE
J033106C22GGCCCCACGTGTCAGTGNONE
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE
J033128M13CCACTGACANONE
J033128M13GGCCCCACGTGTCAGTGNONE
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE
J033133I15CCACTGACANONE
J033133I15GGCCCCACGTGTCAGTGNONE
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE
J043027A21CCACTGACANONE
J043027A21GGCCCCACGTGTCAGTGNONE
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE
J090028A09CCACTGACANONE
J090028A09GGCCCCACGTGTCAGTGNONE
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE
J090053D06CCACTGACANONE
J090053D06GGCCCCACGTGTCAGTGNONE
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE
J090083O17CCACTGACANONE
J090083O17GGCCCCACGTGTCAGTGNONE
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE
J090099H10CCACTGACANONE
J090099H10GGCCCCACGTGTCAGTGNONE
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE
J100036M05CCACTGACANONE
J100036M05GGCCCCACGTGTCAGTGNONE
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE
Os03g0370000AK100033CCCACCTGTCAGSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99).
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein.
J023010L17CAACGGCCCCACATGTCAGTGGNONE
Os03g0383800009-149-G01CCCACCTGTCAGNONE
AK062998CCCACCTGTCAGNONE
AK065904CCCACCTGTCAGNONE
Os03g0385400009-011-B08ACTGACAGNONE
009-073-E04ACTGACAGNONE
009-181-D10ACTGACAGNONE
014-027-G11ACTGACAGNONE
AK068223ACTGACAGPlant lipid transfer protein/Par allergen family protein.
AK070241ACTGACAGNONE
J065193L18ACTGACAGNONE
J075086H20ACTGACAGNONE
J075178G03ACTGACAGNONE
J075199N02ACTGACAGNONE
J080014D24ACTGACAGNONE
Os03g0387100AB026559GTGTCACTNONE
AF022735GTGTCACTNONE
AK058567GTGTCACTProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
AK101195GTGTCACTNONE
J033030J15GTGTCACTNONE
J033102N16GTGTCACTNONE
J065056E08GTGTCACTNONE
J065112M11GTGTCACTNONE
J065170H07GTGTCACTNONE
J075003P17GTGTCACTNONE
J075074D06GTGTCACTNONE
J075127F20GTGTCACTNONE
J075129I01GTGTCACTNONE
J075178A10GTGTCACTNONE
J090071P12GTGTCACTNONE
J100090D18GTGTCACTNONE
Os03g0416300AK103650ACTGACAGSimilar to Phytochelatin synthetase (Fragment).
Os03g0418700AK099879CTGACAGGNONE
AK101797CTGACAGGConserved hypothetical protein.
Os03g0421800AK099491CCTGTCAGVirulence factor, pectin lyase fold family protein.
AK099491CCTGTCAGTVirulence factor, pectin lyase fold family protein.
J065198F08CCTGTCAGNONE
J065198F08CCTGTCAGTNONE
Os03g0422300012-087-G12TGTCAGTGNONE
AK063543TGTCAGTGConserved hypothetical protein.
J090010I02TGTCAGTGNONE
J090079A01TGTCAGTGNONE
Os03g0425900AK105583CCTGTCAGTZinc finger, C2H2-type domain containing protein.
Os03g0442400Os03g0442400CACGTCACNONE
Os03g0567600AK065135GTGACGTGNONE
AK098896GTGACGTGNONE
AK100305GTGACGTGProtein of unknown function DUF563 family protein.
Os03g0584300009-018-H09CTGTCAGTNONE
AK105133CTGTCAGTProtein of unknown function UPF0136, Transmembrane family protein.
J065053M11CTGTCAGTNONE
Os03g0596800AK073603CCCACGTGTCAGTGConserved hypothetical protein.
J033052N01CCCACGTGTCAGTGNONE
Os03g0634000014-034-A03CACGTCACCNONE
AK063673CACGTCACCSimilar to THA4.
Os03g0666200AK102364CACTGACAGPleckstrin homology-type domain containing protein.
J033097E16CACTGACAGNONE
Os03g0667100012-045-B01ACGTCACCNONE
012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE
012-045-B01GTGACGTGNONE
AK065363ACGTCACCBTB domain containing protein.
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein.
AK065363GTGACGTGBTB domain containing protein.
AK065952ACGTCACCNONE
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE
AK065952GTGACGTGNONE
J013045I05ACGTCACCNONE
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE
J013045I05GTGACGTGNONE
J013129F20ACGTCACCNONE
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE
J013129F20GTGACGTGNONE
Os03g0687000004-020-F11GTCAGTGGNONE
AK065253GTCAGTGGConserved hypothetical protein.
AK099321GTCAGTGGNONE
AK099910GTCAGTGGNONE
AK104378GTCAGTGGNONE
J013002J10GTCAGTGGNONE
J013096H20GTCAGTGGNONE
J023012P19GTCAGTGGNONE
J043027G24GTCAGTGGNONE
Os03g0687800AK106820CACCTGTCAGConserved hypothetical protein.
Os03g0699200005-016-G07CTGACAGGNONE
AK066652CTGACAGGPescadillo, N-terminal domain containing protein.
AK099383CTGACAGGNONE
J013069A12CTGACAGGNONE
J033085M11CTGACAGGNONE
J033111P09CTGACAGGNONE
J033128H17CTGACAGGNONE
Os03g0699700AB099850CACTGACA9-lipoxigenase.
AK103565CACTGACANONE
J033041M05CACTGACANONE
J033074I05CACTGACANONE
J033105I23CACTGACANONE
J033126I24CACTGACANONE
J033132L12CACTGACANONE
Os03g0700700J023073A19CACTGACANONE
J023079P11CACTGACANONE
J023143H13CACTGACANONE
J023143O17CACTGACANONE
J033028E14CACTGACANONE
J033050I07CACTGACANONE
J033121L11CACTGACANONE
J090086O16CACTGACANONE
Os03g0701000J075172J23GTGACGTGNONE
Os03g0709100AK061596CACTGACASimilar to Basic blue protein (Cusacyanin) (Plantacyanin) (CBP).
J065217M09CACTGACANONE
J080302M03CACTGACANONE
J080306M12CACTGACANONE
J080311O17CACTGACANONE
J080313D12CACTGACANONE
J080318C19CACTGACANONE
J080319E08CACTGACANONE
J090085H23CACTGACANONE
Os03g0712800AK063913CCACTGACSimilar to Glutamine synthetase root isozyme 2 (EC 6.3.1.2) (Glutamate--ammonia ligase).
AK099290CCACTGACNONE
J023127P21CCACTGACNONE
Os03g0722500AK099926AGTGACACGlycoside hydrolase, family 17 protein.
AK100108AGTGACACNONE
J023004N24AGTGACACNONE
J100018K24AGTGACACNONE
J100032B22AGTGACACNONE
J100036K14AGTGACACNONE
J100043B05AGTGACACNONE
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE
006-023-C08TCTGGACCCACCTGTCAGTGNONE
006-029-H02TCTGGACCCACCTGTCAGTGNONE
006-032-B03TCTGGACCCACCTGTCAGTGNONE
006-035-C10TCTGGACCCACCTGTCAGTGNONE
006-040-H05TCTGGACCCACCTGTCAGTGNONE
006-043-C02TCTGGACCCACCTGTCAGTGNONE
006-046-B11TCTGGACCCACCTGTCAGTGNONE
006-046-E05TCTGGACCCACCTGTCAGTGNONE
006-046-H04TCTGGACCCACCTGTCAGTGNONE
006-048-A09TCTGGACCCACCTGTCAGTGNONE
006-050-A02TCTGGACCCACCTGTCAGTGNONE
006-063-A02TCTGGACCCACCTGTCAGTGNONE
006-064-A09TCTGGACCCACCTGTCAGTGNONE
006-070-G11TCTGGACCCACCTGTCAGTGNONE
006-072-G04TCTGGACCCACCTGTCAGTGNONE
006-077-G12TCTGGACCCACCTGTCAGTGNONE
006-080-F04TCTGGACCCACCTGTCAGTGNONE
006-080-H01TCTGGACCCACCTGTCAGTGNONE
006-084-D10TCTGGACCCACCTGTCAGTGNONE
006-084-G06TCTGGACCCACCTGTCAGTGNONE
006-085-H10TCTGGACCCACCTGTCAGTGNONE
006-086-C05TCTGGACCCACCTGTCAGTGNONE
006-087-D10TCTGGACCCACCTGTCAGTGNONE
006-096-C09TCTGGACCCACCTGTCAGTGNONE
006-100-F10TCTGGACCCACCTGTCAGTGNONE
006-108-D12TCTGGACCCACCTGTCAGTGNONE
006-115-G10TCTGGACCCACCTGTCAGTGNONE
006-119-C09TCTGGACCCACCTGTCAGTGNONE
006-120-E05TCTGGACCCACCTGTCAGTGNONE
011-042-H01TCTGGACCCACCTGTCAGTGNONE
011-075-B11TCTGGACCCACCTGTCAGTGNONE
013-003-D03TCTGGACCCACCTGTCAGTGNONE
013-028-B11TCTGGACCCACCTGTCAGTGNONE
013-031-A01TCTGGACCCACCTGTCAGTGNONE
013-035-F03TCTGGACCCACCTGTCAGTGNONE
013-051-D02TCTGGACCCACCTGTCAGTGNONE
013-055-D06TCTGGACCCACCTGTCAGTGNONE
013-059-H03TCTGGACCCACCTGTCAGTGNONE
013-076-A09TCTGGACCCACCTGTCAGTGNONE
013-076-B01TCTGGACCCACCTGTCAGTGNONE
013-090-F09TCTGGACCCACCTGTCAGTGNONE
013-100-A05TCTGGACCCACCTGTCAGTGNONE
013-100-F05TCTGGACCCACCTGTCAGTGNONE
013-100-G12TCTGGACCCACCTGTCAGTGNONE
014-006-G08TCTGGACCCACCTGTCAGTGNONE
015-003-B07TCTGGACCCACCTGTCAGTGNONE
016-093-C06TCTGGACCCACCTGTCAGTGNONE
AF030548TCTGGACCCACCTGTCAGTGNONE
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin).
AK119247TCTGGACCCACCTGTCAGTGNONE
AK119362TCTGGACCCACCTGTCAGTGNONE
AK119638TCTGGACCCACCTGTCAGTGNONE
J013066P16TCTGGACCCACCTGTCAGTGNONE
J023022H18TCTGGACCCACCTGTCAGTGNONE
J023087O13TCTGGACCCACCTGTCAGTGNONE
J023121I16TCTGGACCCACCTGTCAGTGNONE
J023123M09TCTGGACCCACCTGTCAGTGNONE
J033022M05TCTGGACCCACCTGTCAGTGNONE
J033087C05TCTGGACCCACCTGTCAGTGNONE
J065022K07TCTGGACCCACCTGTCAGTGNONE
J065024E22TCTGGACCCACCTGTCAGTGNONE
J065041G05TCTGGACCCACCTGTCAGTGNONE
J065045M11TCTGGACCCACCTGTCAGTGNONE
J065082K10TCTGGACCCACCTGTCAGTGNONE
J065121K18TCTGGACCCACCTGTCAGTGNONE
J065137O07TCTGGACCCACCTGTCAGTGNONE
J065144B12TCTGGACCCACCTGTCAGTGNONE
J065152E04TCTGGACCCACCTGTCAGTGNONE
J065159D24TCTGGACCCACCTGTCAGTGNONE
J065217E02TCTGGACCCACCTGTCAGTGNONE
J075014N22TCTGGACCCACCTGTCAGTGNONE
J075064O17TCTGGACCCACCTGTCAGTGNONE
J080316L10TCTGGACCCACCTGTCAGTGNONE
J080318L20TCTGGACCCACCTGTCAGTGNONE
J090034D01TCTGGACCCACCTGTCAGTGNONE
J090034P05TCTGGACCCACCTGTCAGTGNONE
J090041H08TCTGGACCCACCTGTCAGTGNONE
J090042F20TCTGGACCCACCTGTCAGTGNONE
J090042I15TCTGGACCCACCTGTCAGTGNONE
J090050O17TCTGGACCCACCTGTCAGTGNONE
J090054L13TCTGGACCCACCTGTCAGTGNONE
J090062A12TCTGGACCCACCTGTCAGTGNONE
J090068I22TCTGGACCCACCTGTCAGTGNONE
J090070J23TCTGGACCCACCTGTCAGTGNONE
J090070M18TCTGGACCCACCTGTCAGTGNONE
J090084L07TCTGGACCCACCTGTCAGTGNONE
J090087H13TCTGGACCCACCTGTCAGTGNONE
J090095H10TCTGGACCCACCTGTCAGTGNONE
J090099M17TCTGGACCCACCTGTCAGTGNONE
J100022O10TCTGGACCCACCTGTCAGTGNONE
J100048A05TCTGGACCCACCTGTCAGTGNONE
J100057O06TCTGGACCCACCTGTCAGTGNONE
X91806TCTGGACCCACCTGTCAGTGNONE
Os03g0735000AK069296CCACTGACSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC 2.7.7.27) (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment).
Os03g0739700003-104-A04CTGTCAGTNONE
AK062272CTGTCAGTUncharacterized protein UPF0114 family protein.
Os03g0744800AK059983GCCACGTCACemp24/gp25L/p24 family protein.
J065067D01GCCACGTCACNONE
J065122L19GCCACGTCACNONE
J090041I03GCCACGTCACNONE
J100039H03GCCACGTCACNONE
Os03g0745000AK109590CGCCACGTCACCGCACNONE
AY332465CGCCACGTCACCGCACNONE
AY344486CGCCACGTCACCGCACNONE
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein.
Os03g0746700015-015-E02CACTGACANONE
015-059-G01CACTGACANONE
015-073-C05CACTGACANONE
AK068199CACTGACAConserved hypothetical protein.
J075066J09CACTGACANONE
J100025E14CACTGACANONE
Os03g0757200AK071136CACGTCACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
J023078E19CACGTCACNONE
Os03g0759700011-078-B02CTGACAGGCTTTCCCNONE
AK072833CTGACAGGCTTTCCCSimilar to ER33 protein (Fragment).
J100036M24CTGACAGGCTTTCCCNONE
J100047B02CTGACAGGCTTTCCCNONE
J100062F21CTGACAGGCTTTCCCNONE
J100066O16CTGACAGGCTTTCCCNONE
J100082M12CTGACAGGCTTTCCCNONE
Os03g0780400011-100-D09CCACTGACANONE
011-100-D09CCCACCTGTCAGTGACACNONE
AK061347CCACTGACANONE
AK061347CCCACCTGTCAGTGACACNONE
AK073162CCACTGACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6).
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6).
J065043E22CCACTGACANONE
J065043E22CCCACCTGTCAGTGACACNONE
J065045I07CCACTGACANONE
J065045I07CCCACCTGTCAGTGACACNONE
J090036F17CCACTGACANONE
J090036F17CCCACCTGTCAGTGACACNONE
J090077M14CCACTGACANONE
J090077M14CCCACCTGTCAGTGACACNONE
J100055G20CCACTGACANONE
J100055G20CCCACCTGTCAGTGACACNONE
Os03g0781000AK065910GTGTCACTSimilar to GTP-dependent nucleic acid-binding protein engD.
Os03g0786800AK059186GTGTCACTSimilar to Cullin-4A (CUL-4A).
Os03g0798300AK108034CACTGACASimilar to Cytosine-5 DNA methyltransferase MET1 (Fragment).
Os03g0802500005-009-E09ACGTCACCNONE
016-058-E03ACGTCACCNONE
AK070731ACGTCACCAAA ATPase domain containing protein.
AK099212ACGTCACCNONE
AK104696ACGTCACCNONE
J013050J10ACGTCACCNONE
J023061A01ACGTCACCNONE
J023088E08ACGTCACCNONE
J033084A02ACGTCACCNONE
J090015G11ACGTCACCNONE
J090075G22ACGTCACCNONE
J100067G24ACGTCACCNONE
Os03g0810800006-060-G12GGTGACGTGGCNONE
006-063-F08GGTGACGTGGCNONE
006-102-H09GGTGACGTGGCNONE
AK060010GGTGACGTGGCSimilar to Short-chain alcohol dehydrogenase.
AK070201GGTGACGTGGCNONE
AK105938GGTGACGTGGCNONE
J023042C15GGTGACGTGGCNONE
J053075K10GGTGACGTGGCNONE
J065061E08GGTGACGTGGCNONE
J065079B21GGTGACGTGGCNONE
J065082F07GGTGACGTGGCNONE
J065128H02GGTGACGTGGCNONE
J065195C03GGTGACGTGGCNONE
J090038F07GGTGACGTGGCNONE
J090048P14GGTGACGTGGCNONE
J090052C07GGTGACGTGGCNONE
J090089M12GGTGACGTGGCNONE
J090097F20GGTGACGTGGCNONE
J100037H03GGTGACGTGGCNONE
J100038K01GGTGACGTGGCNONE
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein.
Os03g0811600009-134-B07TGTGGGCCCCACATGTCAGTGNONE
AK071076TGTGGGCCCCACATGTCAGTGSimilar to Peptidyl prolyl isomerase H.
J023078H22TGTGGGCCCCACATGTCAGTGNONE
Os03g0812200011-060-G11ACGTCACCNONE
012-035-D04ACGTCACCNONE
AK060419ACGTCACCNONE
AK067585ACGTCACCZinc finger, RING-type domain containing protein.
J013111A16ACGTCACCNONE
J013169G17ACGTCACCNONE
J023088G08ACGTCACCNONE
J023106G03ACGTCACCNONE
J033038K23ACGTCACCNONE
J033118H11ACGTCACCNONE
J090003M07ACGTCACCNONE
J090031L06ACGTCACCNONE
J090045B19ACGTCACCNONE
J090058P14ACGTCACCNONE
J100028C22ACGTCACCNONE
J100041B04ACGTCACCNONE
J100042B08ACGTCACCNONE
J100061F10ACGTCACCNONE
Os03g0817200AK121940GTGTCACTAmino acid/polyamine transporter II family protein.
J033107D18GTGTCACTNONE
J065141D04GTGTCACTNONE
Os03g0818100015-098-A09GGTGACGTGTCACTNONE
AK064366GGTGACGTGTCACTNONE
AK121701GGTGACGTGTCACTHistidine acid phosphatase family protein.
Os03g0818200AK058641CTGTCAGTNAD-dependent epimerase/dehydratase family protein.
J080067J02CTGTCAGTNONE
J080085K02CTGTCAGTNONE
J090088H02CTGTCAGTNONE
Os03g0821900AK070847CACGTCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-).
Os03g0822300AK060050GCCACGTCACRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein.
J065198I20GCCACGTCACNONE
Os03g0822400013-072-A06CCACTGACAAGTGGGTCCCNONE
014-009-H06CCACTGACAAGTGGGTCCCNONE
014-025-G05CCACTGACAAGTGGGTCCCNONE
014-033-G02CCACTGACAAGTGGGTCCCNONE
014-038-G06CCACTGACAAGTGGGTCCCNONE
014-047-H10CCACTGACAAGTGGGTCCCNONE
014-054-H04CCACTGACAAGTGGGTCCCNONE
014-055-F05CCACTGACAAGTGGGTCCCNONE
014-075-E04CCACTGACAAGTGGGTCCCNONE
014-084-B02CCACTGACAAGTGGGTCCCNONE
014-087-F10CCACTGACAAGTGGGTCCCNONE
014-098-D02CCACTGACAAGTGGGTCCCNONE
014-099-B04CCACTGACAAGTGGGTCCCNONE
014-100-H10CCACTGACAAGTGGGTCCCNONE
AK070075CCACTGACAAGTGGGTCCCConserved hypothetical protein.
AK102425CCACTGACAAGTGGGTCCCNONE
J065134M15CCACTGACAAGTGGGTCCCNONE
J090053B16CCACTGACAAGTGGGTCCCNONE
Os03g0823500AK058972CCACTGACTGF-beta receptor, type I/II extracellular region family protein.
AK099193CCACTGACNONE
J023109G05CCACTGACNONE
J023114H09CCACTGACNONE
J065017L13CCACTGACNONE
J065093G04CCACTGACNONE
J065218D16CCACTGACNONE
J090036G14CCACTGACNONE
Os03g0825700AK067902CACGTCACCSimilar to Defective in exine formation.
Os03g0825900AK109694CACGTCACConserved hypothetical protein.
Os03g0829600AK071298GGTGACGTNONE
AK119707GGTGACGTConserved hypothetical protein.
J023084A07GGTGACGTNONE
Os03g0832200AK070712TGTCAGTGSimilar to Calcium-binding protein precursor (Calreticulin).
Os03g0832600AK120137CCACTGACSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase).
Os03g0835600AK101677CACGTCACAcyl-coA-binding protein, ACBP family protein.
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein.
AK068346TGTCAGTGStreptomyces cyclase/dehydrase family protein.
Os03g0838100011-054-D06GTGTCACTNONE
011-077-A11GTGTCACTNONE
015-079-D06GTGTCACTNONE
AK066616GTGTCACTNONE
AK119863GTGTCACTNONE
AK119881GTGTCACTNONE
AK119894GTGTCACTCurculin-like (mannose-binding) lectin domain containing protein.
J013074M03GTGTCACTNONE
J033051E08GTGTCACTNONE
J100060E05GTGTCACTNONE
Os03g0839900AK067347CTGTCAGTGACACUspA domain containing protein.
Os03g0844800AK071813CTGTCAGTConserved hypothetical protein.
J023114B14CTGTCAGTNONE
Os03g0854800J090007D13CGCCACGTCACNONE
J090085N22CGCCACGTCACNONE
Os04g0177400012-039-C04GTGACGTGNONE
Os04g0266900011-064-A07CACGTGTCACTNONE
AK069447CACGTGTCACTBacterial transketolase family protein.
J023019B19CACGTGTCACTNONE
Os04g0271700AK059031CACGTCACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK070110CACGTCACNONE
AK099145CACGTCACNONE
J065045A03CACGTCACNONE
Os04g0283700AK063831CTGACAGGChromo domain containing protein.
Os04g0286400009-144-C10GCCACGTCACCNONE
AK062974GCCACGTCACCHypothetical protein.
Os04g0291000Os04g0291000AGTGACACGlucose/ribitol dehydrogenase family protein.
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE
AK061121AGGGCCCACCTGTCAGReticulon family protein.
AK100139AGGGCCCACCTGTCAGNONE
J065009F13AGGGCCCACCTGTCAGNONE
J065032N11AGGGCCCACCTGTCAGNONE
J065039P10AGGGCCCACCTGTCAGNONE
J065124I05AGGGCCCACCTGTCAGNONE
J065197E16AGGGCCCACCTGTCAGNONE
Os04g0384000009-095-E04GTCAGTGGNONE
AK062717GTCAGTGGNONE
Os04g0389800AK109628CACTGACASimilar to Acetohydroxyacid synthase.
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE
AK067777CCTGTCAGNONE
AK068713CACGCCACTGACATCTGGGCCCCACCNONE
AK068713CCTGTCAGNONE
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component.
AK098921CCTGTCAGSimilar to 2-oxoglutarate dehydrogenase, E1 component.
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE
AK066575CTGACAGGTGGGTCCNONE
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE
AK099908CTGACAGGTGGGTCCNONE
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE
AK100148CTGACAGGTGGGTCCNONE
Os04g0390700AK107261GTGACGTGTCGGlucose/ribitol dehydrogenase family protein.
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit.
AK104832CACTGACAGGTGGGCCCACCANONE
AK121002CACTGACAGGTGGGCCCACCANONE
J033092H19CACTGACAGGTGGGCCCACCANONE
Os04g0416900J080302P15TGTCAGTGNONE
J080312A22TGTCAGTGNONE
Os04g0432000AB125308GTGTCACTSerine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7).
AK122087GTGTCACTNONE
J065206O17GTGTCACTNONE
Os04g0436800015-053-A06CACGTCACNONE
AK101115CACGTCACProtein prenyltransferase domain containing protein.
J033025G14CACGTCACNONE
J033073N23CACGTCACNONE
J033097L19CACGTCACNONE
Os04g0447400AK070858CACGTCACCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2).
J023002M09CACGTCACCNONE
J023003G16CACGTCACCNONE
J023006F16CACGTCACCNONE
J023008D10CACGTCACCNONE
J023010A01CACGTCACCNONE
J023012M16CACGTCACCNONE
J023023H17CACGTCACCNONE
J023029B12CACGTCACCNONE
J023030F09CACGTCACCNONE
J023034K03CACGTCACCNONE
J023045A16CACGTCACCNONE
J023048I04CACGTCACCNONE
J023056C09CACGTCACCNONE
J023056F05CACGTCACCNONE
J023058B21CACGTCACCNONE
J023058N06CACGTCACCNONE
J023059F03CACGTCACCNONE
J023059M19CACGTCACCNONE
J023060P05CACGTCACCNONE
J023062D07CACGTCACCNONE
J023063F16CACGTCACCNONE
J023068K15CACGTCACCNONE
J023069L04CACGTCACCNONE
J023075I24CACGTCACCNONE
J023086H01CACGTCACCNONE
J023086I24CACGTCACCNONE
J023091M08CACGTCACCNONE
J023095A07CACGTCACCNONE
J023110K06CACGTCACCNONE
J023113D07CACGTCACCNONE
J023126J05CACGTCACCNONE
J023140F04CACGTCACCNONE
J023141N19CACGTCACCNONE
Os04g0447500AK064090GGTGACGTGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247).
Os04g0451200006-041-H09AGTGACACNONE
AK061024AGTGACACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK068176AGTGACACNONE
J065045M24AGTGACACNONE
Os04g0456700009-080-F10GTGTCACTNONE
009-143-C10GTGTCACTNONE
AK065178GTGTCACTSimilar to TMV induced protein 1-2.
J013002D12GTGTCACTNONE
J065027N14GTGTCACTNONE
J065139E16GTGTCACTNONE
J065165D09GTGTCACTNONE
J065179D14GTGTCACTNONE
J065198C03GTGTCACTNONE
J065198L22GTGTCACTNONE
J075139M08GTGTCACTNONE
J075150D14GTGTCACTNONE
J075172F01GTGTCACTNONE
J075197F03GTGTCACTNONE
J090059E16GTGTCACTNONE
J100063J01GTGTCACTNONE
J100085F13GTGTCACTNONE
J100088O10GTGTCACTNONE
Os04g0469000009-089-B06ACTGACAGNONE
009-111-A10ACTGACAGNONE
AK062816ACTGACAGHeavy metal transport/detoxification protein domain containing protein.
J080004F04ACTGACAGNONE
J080021H03ACTGACAGNONE
J080038F20ACTGACAGNONE
J080066G20ACTGACAGNONE
J080084E17ACTGACAGNONE
Os04g0474500AK062029CCACTGACNONE
AK065793CCACTGACSimilar to Cyanogenic beta-glucosidase precursor (EC 3.2.1.21) (Linamarase) (Fragment).
J013068M03CCACTGACNONE
J013089M14CCACTGACNONE
J065131H24CCACTGACNONE
Os04g0475600AK105400CACTGACANONE
AK121520CACTGACA2OG-Fe(II) oxygenase domain containing protein.
J065167F22CACTGACANONE
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment).
AK070908CCACTGACSimilar to TA5 protein (Fragment).
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein.
J065141K24CCACTGACAGGTGGGCCCGCNONE
J065144O22CCACTGACAGGTGGGCCCGCNONE
J065162F11CCACTGACAGGTGGGCCCGCNONE
Os04g0492600AK072226GTGTCACTAnticodon-binding domain containing protein.
Os04g0503500AK099404CCACTGACALeucine-rich repeat, cysteine-containing subtype containing protein.
AK099404TGTCAGTGLeucine-rich repeat, cysteine-containing subtype containing protein.
AK101695CCACTGACANONE
AK101695TGTCAGTGNONE
Os04g0504700AK068596CCTGTCAGTGConserved hypothetical protein.
Os04g0514500AK073502AGTGACACNONE
J090058N12AGTGACACNONE
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein.
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein.
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein.
Os04g0537800AK103654CCACTGACProtein of unknown function DUF26 domain containing protein.
J023003K20CCACTGACNONE
J023007K15CCACTGACNONE
J023041L14CCACTGACNONE
J033135E09CCACTGACNONE
Os04g0541700AK109177GGACACGTCACNONE
AY554030GGACACGTCACNONE
J065055P13GGACACGTCACNONE
J065057N20GGACACGTCACNONE
J065136D07GGACACGTCACNONE
Os04g0549300AK063296CCACTGACASimilar to GA protein (Fragment).
J065073I11CCACTGACANONE
J065172C13CCACTGACANONE
J090004B10CCACTGACANONE
J090039N18CCACTGACANONE
J090088F09CCACTGACANONE
Os04g0552400AK069623CACGTGTCACTSimilar to ZPT2-13.
J023023M18CACGTGTCACTNONE
J023063H11CACGTGTCACTNONE
Os04g0558400AK061440ACTGACAGGAcyl-CoA thioesterase family protein.
AK061440GGTCCCACCTGACAGGAcyl-CoA thioesterase family protein.
AK102197ACTGACAGGNONE
AK102197GGTCCCACCTGACAGGNONE
J013046K23ACTGACAGGNONE
J013046K23GGTCCCACCTGACAGGNONE
J013090O17ACTGACAGGNONE
J013090O17GGTCCCACCTGACAGGNONE
J033087D05ACTGACAGGNONE
J033087D05GGTCCCACCTGACAGGNONE
J065029A16ACTGACAGGNONE
J065029A16GGTCCCACCTGACAGGNONE
J065121A13ACTGACAGGNONE
J065121A13GGTCCCACCTGACAGGNONE
J090063H18ACTGACAGGNONE
J090063H18GGTCCCACCTGACAGGNONE
J100048C18ACTGACAGGNONE
J100048C18GGTCCCACCTGACAGGNONE
Os04g0564700AK111806CACGTCACCQuinonprotein alcohol dehydrogenase-like domain containing protein.
Os04g0565500006-022-C06ACGTCACCNONE
AK058888ACGTCACCAmino acid/polyamine transporter II family protein.
AK071118ACGTCACCNONE
AK105902ACGTCACCNONE
J023052I22ACGTCACCNONE
J023082L01ACGTCACCNONE
J023112P14ACGTCACCNONE
J065043O12ACGTCACCNONE
J065045B08ACGTCACCNONE
J065059N01ACGTCACCNONE
J065073A04ACGTCACCNONE
J065078K06ACGTCACCNONE
J065124J08ACGTCACCNONE
J065140G16ACGTCACCNONE
J065185E13ACGTCACCNONE
J065197N09ACGTCACCNONE
J100024A03ACGTCACCNONE
J100042E11ACGTCACCNONE
J100069L15ACGTCACCNONE
J100078K13ACGTCACCNONE
Os04g0577700AK108703CACGTCACProtein of unknown function DUF623, plant domain containing protein.
Os04g0585200AK073062AGTGACACNONE
Os04g0595800016-024-H02CACGTCACNONE
AK058642CACGTCACSimilar to Secretory carrier membrane protein.
AK120076CACGTCACNONE
J075124H24CACGTCACNONE
Os04g0599000AK111508CCTGTCAGEGF-like, type 3 domain containing protein.
Os04g0606800009-159-H11AGATGGGCCCACATGTCAGTGNONE
009-159-H11GTCAGTGGNONE
009-159-H11GTGGGGCCCACAAGTCAGTGGNONE
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein.
AK072824GTCAGTGGConserved hypothetical protein.
AK072824GTGGGGCCCACAAGTCAGTGGConserved hypothetical protein.
J033070J06AGATGGGCCCACATGTCAGTGNONE
J033070J06GTCAGTGGNONE
J033070J06GTGGGGCCCACAAGTCAGTGGNONE
J033119D03AGATGGGCCCACATGTCAGTGNONE
J033119D03GTCAGTGGNONE
J033119D03GTGGGGCCCACAAGTCAGTGGNONE
J100043F05AGATGGGCCCACATGTCAGTGNONE
J100043F05GTCAGTGGNONE
J100043F05GTGGGGCCCACAAGTCAGTGGNONE
J100050A01AGATGGGCCCACATGTCAGTGNONE
J100050A01GTCAGTGGNONE
J100050A01GTGGGGCCCACAAGTCAGTGGNONE
Os04g0610500006-115-C07CCACTGACNONE
AK066289CCACTGACPeptidase M24A, methionine aminopeptidase, subfamily 1 protein.
AK104817CCACTGACNONE
J013096N09CCACTGACNONE
J023054I11CCACTGACNONE
J023121P20CCACTGACNONE
J053039O20CCACTGACNONE
J053071L20CCACTGACNONE
J053088H23CCACTGACNONE
J053096J03CCACTGACNONE
Os04g0623100006-042-D10GCCACGTCACNONE
AK067276GCCACGTCACBromodomain containing protein.
J013097L22GCCACGTCACNONE
J013099L18GCCACGTCACNONE
J023009D13GCCACGTCACNONE
J023041M21GCCACGTCACNONE
J090088H12GCCACGTCACNONE
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase).
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE
Os04g0636100003-115-H08GTCAGTGGATGGGNONE
AK067760GTCAGTGGATGGGGlycosyl transferase, family 8 protein.
J013119I03GTCAGTGGATGGGNONE
J075092K10GTCAGTGGATGGGNONE
Os04g0643100014-026-F09ACGTCACCNONE
AK067501ACGTCACCSimilar to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit).
AK106989ACGTCACCNONE
J013110H12ACGTCACCNONE
J090089E23ACGTCACCNONE
J100033G14ACGTCACCNONE
J100033L15ACGTCACCNONE
J100041J24ACGTCACCNONE
J100041M14ACGTCACCNONE
J100057A03ACGTCACCNONE
J100059C11ACGTCACCNONE
J100072B15ACGTCACCNONE
J100073N24ACGTCACCNONE
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein.
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE
Os04g0662400AK108652CACTGACAAuxin responsive SAUR protein family protein.
Os04g0663200006-074-D02CCTGTCAGNONE
006-074-D02GTGTCACTNONE
AK105958CCTGTCAGZinc finger, CCCH-type domain containing protein.
AK105958GTGTCACTZinc finger, CCCH-type domain containing protein.
AK111925CCTGTCAGNONE
AK111925GTGTCACTNONE
Os04g0663700012-059-B10CTGACAGGNONE
AK068004CTGACAGGTLDc domain containing protein.
J013129G21CTGACAGGNONE
J100045N22CTGACAGGNONE
J100048A18CTGACAGGNONE
Os04g0667000AK069874ACTGACAGGTafazzin family protein.
J100055P09ACTGACAGGNONE
J100057O12ACTGACAGGNONE
J100067H07ACTGACAGGNONE
J100070D06ACTGACAGGNONE
J100071J16ACTGACAGGNONE
J100072C15ACTGACAGGNONE
Os04g0675300AK111982CACTGACANONE
Os04g0679400004-018-E07CACCGCACGTCACNONE
006-039-G08CACCGCACGTCACNONE
006-045-D06CACCGCACGTCACNONE
006-048-B12CACCGCACGTCACNONE
006-061-C05CACCGCACGTCACNONE
006-062-A03CACCGCACGTCACNONE
006-063-A06CACCGCACGTCACNONE
006-066-B04CACCGCACGTCACNONE
006-068-H12CACCGCACGTCACNONE
006-075-C08CACCGCACGTCACNONE
006-076-A02CACCGCACGTCACNONE
006-083-B04CACCGCACGTCACNONE
006-090-F04CACCGCACGTCACNONE
006-099-H12CACCGCACGTCACNONE
006-105-F10CACCGCACGTCACNONE
006-106-G03CACCGCACGTCACNONE
006-107-B05CACCGCACGTCACNONE
006-108-F06CACCGCACGTCACNONE
006-109-E09CACCGCACGTCACNONE
006-111-B02CACCGCACGTCACNONE
006-113-C10CACCGCACGTCACNONE
009-128-G11CACCGCACGTCACNONE
009-150-B02CACCGCACGTCACNONE
009-156-E08CACCGCACGTCACNONE
012-015-E07CACCGCACGTCACNONE
012-027-B04CACCGCACGTCACNONE
012-030-A03CACCGCACGTCACNONE
012-066-E06CACCGCACGTCACNONE
012-083-A09CACCGCACGTCACNONE
012-088-E07CACCGCACGTCACNONE
012-097-F08CACCGCACGTCACNONE
013-010-D04CACCGCACGTCACNONE
013-012-A01CACCGCACGTCACNONE
013-016-D04CACCGCACGTCACNONE
013-041-B01CACCGCACGTCACNONE
013-043-F10CACCGCACGTCACNONE
013-047-C12CACCGCACGTCACNONE
013-058-E10CACCGCACGTCACNONE
013-063-B07CACCGCACGTCACNONE
013-076-A01CACCGCACGTCACNONE
013-081-D04CACCGCACGTCACNONE
013-090-D05CACCGCACGTCACNONE
013-091-B07CACCGCACGTCACNONE
014-030-A04CACCGCACGTCACNONE
014-055-A04CACCGCACGTCACNONE
014-070-A04CACCGCACGTCACNONE
015-033-C10CACCGCACGTCACNONE
015-040-H10CACCGCACGTCACNONE
016-006-F03CACCGCACGTCACNONE
016-090-B03CACCGCACGTCACNONE
AK065314CACCGCACGTCACNONE
AK068608CACCGCACGTCACNONE
AK099009CACCGCACGTCACNONE
AK099087CACCGCACGTCACNONE
AK099368CACCGCACGTCACNONE
AK099653CACCGCACGTCACNONE
AK099975CACCGCACGTCACNONE
AK104249CACCGCACGTCACNONE
AK104376CACCGCACGTCACNONE
AK106133CACCGCACGTCACNONE
AK119666CACCGCACGTCACNONE
AK120508CACCGCACGTCACNONE
AK121152CACCGCACGTCACSimilar to Ripening-associated protein (Fragment).
J013002O24CACCGCACGTCACNONE
J013023H15CACCGCACGTCACNONE
J013036E15CACCGCACGTCACNONE
J013042D22CACCGCACGTCACNONE
J013045A07CACCGCACGTCACNONE
J013056D24CACCGCACGTCACNONE
J013057D10CACCGCACGTCACNONE
J013059B08CACCGCACGTCACNONE
J013059D01CACCGCACGTCACNONE
J013060C02CACCGCACGTCACNONE
J013070N22CACCGCACGTCACNONE
J013071K02CACCGCACGTCACNONE
J013073G04CACCGCACGTCACNONE
J013096J17CACCGCACGTCACNONE
J013098G08CACCGCACGTCACNONE
J013123H02CACCGCACGTCACNONE
J013135I23CACCGCACGTCACNONE
J013149G08CACCGCACGTCACNONE
J013155N04CACCGCACGTCACNONE
J013156C23CACCGCACGTCACNONE
J013157C07CACCGCACGTCACNONE
J013157D23CACCGCACGTCACNONE
J023001K19CACCGCACGTCACNONE
J023002H21CACCGCACGTCACNONE
J023003H14CACCGCACGTCACNONE
J023006D09CACCGCACGTCACNONE
J023010E07CACCGCACGTCACNONE
J023014E18CACCGCACGTCACNONE
J023024G16CACCGCACGTCACNONE
J023034F13CACCGCACGTCACNONE
J023034F17CACCGCACGTCACNONE
J023045C18CACCGCACGTCACNONE
J023058P17CACCGCACGTCACNONE
J023061H18CACCGCACGTCACNONE
J023064H05CACCGCACGTCACNONE
J023078J16CACCGCACGTCACNONE
J023079L03CACCGCACGTCACNONE
J023085N10CACCGCACGTCACNONE
J023087G10CACCGCACGTCACNONE
J023088I02CACCGCACGTCACNONE
J023093K24CACCGCACGTCACNONE
J023095H05CACCGCACGTCACNONE
J023097C02CACCGCACGTCACNONE
J023101P15CACCGCACGTCACNONE
J023106C22CACCGCACGTCACNONE
J023121B08CACCGCACGTCACNONE
J023121N13CACCGCACGTCACNONE
J023123F01CACCGCACGTCACNONE
J023128E14CACCGCACGTCACNONE
J023128M11CACCGCACGTCACNONE
J023135L14CACCGCACGTCACNONE
J023141H20CACCGCACGTCACNONE
J023150A12CACCGCACGTCACNONE
J033035G16CACCGCACGTCACNONE
J033037N04CACCGCACGTCACNONE
J033041D20CACCGCACGTCACNONE
J033052O07CACCGCACGTCACNONE
J033061D19CACCGCACGTCACNONE
J033068M01CACCGCACGTCACNONE
J033090I15CACCGCACGTCACNONE
J033103G06CACCGCACGTCACNONE
J033117F16CACCGCACGTCACNONE
J033120H02CACCGCACGTCACNONE
J033126N05CACCGCACGTCACNONE
J033136C13CACCGCACGTCACNONE
J033139H08CACCGCACGTCACNONE
J043024N03CACCGCACGTCACNONE
J043027G07CACCGCACGTCACNONE
J065103L02CACCGCACGTCACNONE
J065108G02CACCGCACGTCACNONE
J065175N11CACCGCACGTCACNONE
J080003B03CACCGCACGTCACNONE
J080007J02CACCGCACGTCACNONE
J080008D02CACCGCACGTCACNONE
J080008E04CACCGCACGTCACNONE
J080015H20CACCGCACGTCACNONE
J080017J09CACCGCACGTCACNONE
J080020O09CACCGCACGTCACNONE
J080021F06CACCGCACGTCACNONE
J080027L11CACCGCACGTCACNONE
J080028J11CACCGCACGTCACNONE
J080030G17CACCGCACGTCACNONE
J080035E09CACCGCACGTCACNONE
J080035F20CACCGCACGTCACNONE
J080036H18CACCGCACGTCACNONE
J080039M19CACCGCACGTCACNONE
J080042A21CACCGCACGTCACNONE
J080043A07CACCGCACGTCACNONE
J080052A16CACCGCACGTCACNONE
J080055G22CACCGCACGTCACNONE
J080061O12CACCGCACGTCACNONE
J080062I05CACCGCACGTCACNONE
J080068K18CACCGCACGTCACNONE
J080070G01CACCGCACGTCACNONE
J080077F11CACCGCACGTCACNONE
J080079N14CACCGCACGTCACNONE
J080084G11CACCGCACGTCACNONE
J080093C04CACCGCACGTCACNONE
J090056G10CACCGCACGTCACNONE
J090091H01CACCGCACGTCACNONE
J100025J03CACCGCACGTCACNONE
J100027L16CACCGCACGTCACNONE
J100030B22CACCGCACGTCACNONE
J100048H23CACCGCACGTCACNONE
J100050C24CACCGCACGTCACNONE
J100055F22CACCGCACGTCACNONE
J100057L08CACCGCACGTCACNONE
J100065E17CACCGCACGTCACNONE
J100072C03CACCGCACGTCACNONE
Os04g0679800AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein.
AK099987CTTGGGCCCCACCTGTCAGTNONE
J013130B11CTTGGGCCCCACCTGTCAGTNONE
J065049C17CTTGGGCCCCACCTGTCAGTNONE
J075191N12CTTGGGCCCCACCTGTCAGTNONE
J075191P12CTTGGGCCCCACCTGTCAGTNONE
J100031C07CTTGGGCCCCACCTGTCAGTNONE
Os04g0682500015-003-H03CACGTCACNONE
AK064978CACGTCACNONE
AK121739CACGTCACPeptidase T2, asparaginase 2 family protein.
J013001C03CACGTCACNONE
J023028M11CACGTCACNONE
J033085H01CACGTCACNONE
Os04g0682800AK068406CACTGACANONE
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17).
AK071345CGGGCCCACCTGTCAGNONE
J023069G19CGGGCCCACCTGTCAGNONE
J023097E09CGGGCCCACCTGTCAGNONE
J065071A01CGGGCCCACCTGTCAGNONE
J065186F08CGGGCCCACCTGTCAGNONE
J075044B21CGGGCCCACCTGTCAGNONE
J075120N18CGGGCCCACCTGTCAGNONE
J075131B22CGGGCCCACCTGTCAGNONE
J100041H18CGGGCCCACCTGTCAGNONE
J100042P13CGGGCCCACCTGTCAGNONE
Os04g0686700AK105746CACTGACAGTGGGTCCKelch repeat containing protein.
J065021K04CACTGACAGTGGGTCCNONE
J065097E18CACTGACAGTGGGTCCNONE
J075004C12CACTGACAGTGGGTCCNONE
J080301H10CACTGACAGTGGGTCCNONE
J090087N02CACTGACAGTGGGTCCNONE
J100060E19CACTGACAGTGGGTCCNONE
Os04g0687900009-068-D03CCACTGACACGTGGGNONE
015-097-H12CCACTGACACGTGGGNONE
AK062547CCACTGACACGTGGGNONE
AK066910CCACTGACACGTGGGNONE
AK098928CCACTGACACGTGGGSimilar to T24D18.17 protein (Tubby-like protein TULP8).
AK104333CCACTGACACGTGGGNONE
J013023N16CCACTGACACGTGGGNONE
J013031I07CCACTGACACGTGGGNONE
J013063L06CCACTGACACGTGGGNONE
J013091C11CCACTGACACGTGGGNONE
J013123M06CCACTGACACGTGGGNONE
J013126D14CCACTGACACGTGGGNONE
J023023E09CCACTGACACGTGGGNONE
J023039C19CCACTGACACGTGGGNONE
J023068D23CCACTGACACGTGGGNONE
J023080C21CCACTGACACGTGGGNONE
J033092J17CCACTGACACGTGGGNONE
J033112P12CCACTGACACGTGGGNONE
J033135O08CCACTGACACGTGGGNONE
J053023C13CCACTGACACGTGGGNONE
J065030O05CCACTGACACGTGGGNONE
J065065P07CCACTGACACGTGGGNONE
J065190O06CCACTGACACGTGGGNONE
J090011M19CCACTGACACGTGGGNONE
J090061F08CCACTGACACGTGGGNONE
J090064H09CCACTGACACGTGGGNONE
J090064P11CCACTGACACGTGGGNONE
Os05g0110100009-015-D08TGTCAGTGNONE
009-023-C09TGTCAGTGNONE
009-031-B11TGTCAGTGNONE
009-034-C02TGTCAGTGNONE
009-050-B08TGTCAGTGNONE
009-065-D12TGTCAGTGNONE
009-090-G08TGTCAGTGNONE
009-111-H07TGTCAGTGNONE
009-136-F12TGTCAGTGNONE
009-138-E06TGTCAGTGNONE
009-138-G12TGTCAGTGNONE
009-141-D08TGTCAGTGNONE
009-143-D01TGTCAGTGNONE
009-179-D09TGTCAGTGNONE
009-179-E03TGTCAGTGNONE
009-196-A09TGTCAGTGNONE
009-199-F04TGTCAGTGNONE
013-021-E05TGTCAGTGNONE
013-076-C04TGTCAGTGNONE
013-096-F06TGTCAGTGNONE
014-071-A05TGTCAGTGNONE
014-077-F09TGTCAGTGNONE
AK099779TGTCAGTGNONE
AK121142TGTCAGTGConserved hypothetical protein.
J013095A16TGTCAGTGNONE
J013111A17TGTCAGTGNONE
J013132G04TGTCAGTGNONE
J023077M04TGTCAGTGNONE
J065001B11TGTCAGTGNONE
J065001E11TGTCAGTGNONE
J065057G10TGTCAGTGNONE
J065057L08TGTCAGTGNONE
J065080E07TGTCAGTGNONE
J065087K10TGTCAGTGNONE
J065091M15TGTCAGTGNONE
J065167A15TGTCAGTGNONE
J075018F02TGTCAGTGNONE
J075063F20TGTCAGTGNONE
J075064F18TGTCAGTGNONE
J075066N19TGTCAGTGNONE
J075073I02TGTCAGTGNONE
J075080P17TGTCAGTGNONE
J075081F11TGTCAGTGNONE
J075085E03TGTCAGTGNONE
J075101G18TGTCAGTGNONE
J075149N08TGTCAGTGNONE
J075158I21TGTCAGTGNONE
J075161M20TGTCAGTGNONE
J075190F12TGTCAGTGNONE
J075194K16TGTCAGTGNONE
J080001E08TGTCAGTGNONE
J080001F21TGTCAGTGNONE
J080001H19TGTCAGTGNONE
J080001O15TGTCAGTGNONE
J080005I22TGTCAGTGNONE
J080006K23TGTCAGTGNONE
J080014D20TGTCAGTGNONE
J080014I05TGTCAGTGNONE
J080014K21TGTCAGTGNONE
J080017I24TGTCAGTGNONE
J080017K11TGTCAGTGNONE
J080018F11TGTCAGTGNONE
J080022L18TGTCAGTGNONE
J080024N23TGTCAGTGNONE
J080027J23TGTCAGTGNONE
J080029B14TGTCAGTGNONE
J080032F14TGTCAGTGNONE
J080032K19TGTCAGTGNONE
J080032O21TGTCAGTGNONE
J080033P17TGTCAGTGNONE
J080034I06TGTCAGTGNONE
J080039F24TGTCAGTGNONE
J080040O13TGTCAGTGNONE
J080042B02TGTCAGTGNONE
J080043E12TGTCAGTGNONE
J080043J15TGTCAGTGNONE
J080043N09TGTCAGTGNONE
J080052J08TGTCAGTGNONE
J080053K01TGTCAGTGNONE
J080053K19TGTCAGTGNONE
J080055J09TGTCAGTGNONE
J080058D07TGTCAGTGNONE
J080062F11TGTCAGTGNONE
J080063J24TGTCAGTGNONE
J080066H04TGTCAGTGNONE
J080066I09TGTCAGTGNONE
J080067B02TGTCAGTGNONE
J080067N09TGTCAGTGNONE
J080068D22TGTCAGTGNONE
J080068K13TGTCAGTGNONE
J080069N19TGTCAGTGNONE
J080070D07TGTCAGTGNONE
J080070E05TGTCAGTGNONE
J080071G04TGTCAGTGNONE
J080077G05TGTCAGTGNONE
J080077O06TGTCAGTGNONE
J080085F05TGTCAGTGNONE
J080086E07TGTCAGTGNONE
J080089G16TGTCAGTGNONE
J080092K15TGTCAGTGNONE
J080094A08TGTCAGTGNONE
J080097A09TGTCAGTGNONE
J080097J07TGTCAGTGNONE
J090027N01TGTCAGTGNONE
J090081J05TGTCAGTGNONE
Os05g0115200AK106709CACTGACAAGGTGGGCCCTConserved hypothetical protein.
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein.
J023003L12CCACTGACATGCGGGCCCCACNONE
J023025C18CCACTGACATGCGGGCCCCACNONE
J023074E20CCACTGACATGCGGGCCCCACNONE
J023128H09CCACTGACATGCGGGCCCCACNONE
J033092N18CCACTGACATGCGGGCCCCACNONE
J065009J09CCACTGACATGCGGGCCCCACNONE
J090073L21CCACTGACATGCGGGCCCCACNONE
Os05g0116500AK102231GTCAGTGGConserved hypothetical protein.
J033088A05GTCAGTGGNONE
Os05g0119200AK067943CACGTCACConserved hypothetical protein.
J013122C02CACGTCACNONE
J065077M14CACGTCACNONE
J065108P21CACGTCACNONE
J065138G20CACGTCACNONE
J065148H07CACGTCACNONE
J065205P09CACGTCACNONE
J075061H16CACGTCACNONE
J075140H13CACGTCACNONE
J075153H02CACGTCACNONE
J075170B14CACGTCACNONE
Os05g0119300004-011-B09AGTGACACNONE
004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-063-A03AGTGACACNONE
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-077-E12AGTGACACNONE
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-079-E12AGTGACACNONE
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-100-B11AGTGACACNONE
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-109-A12AGTGACACNONE
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-123-C07AGTGACACNONE
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-163-D09AGTGACACNONE
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-170-D11AGTGACACNONE
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-173-C01AGTGACACNONE
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-192-E01AGTGACACNONE
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
011-048-G01AGTGACACNONE
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK060883AGTGACACNONE
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK068289AGTGACACNONE
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK071554AGTGACACNONE
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK099495AGTGACACXYPPX repeat containing protein.
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein.
AY348312AGTGACACNONE
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013037L16AGTGACACNONE
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013088P04AGTGACACNONE
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013099D14AGTGACACNONE
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013146E19AGTGACACNONE
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013147E18AGTGACACNONE
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023104E19AGTGACACNONE
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023128O20AGTGACACNONE
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023132D16AGTGACACNONE
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023143E13AGTGACACNONE
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J033028F15AGTGACACNONE
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J033133D24AGTGACACNONE
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J053091M07AGTGACACNONE
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075029L15AGTGACACNONE
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075097M12AGTGACACNONE
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075103J11AGTGACACNONE
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075138J10AGTGACACNONE
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075172K18AGTGACACNONE
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080001C15AGTGACACNONE
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080002M13AGTGACACNONE
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080009K01AGTGACACNONE
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080010N01AGTGACACNONE
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080011D23AGTGACACNONE
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080013C13AGTGACACNONE
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080013M16AGTGACACNONE
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080018J02AGTGACACNONE
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080020F03AGTGACACNONE
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080020G05AGTGACACNONE
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080021D05AGTGACACNONE
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080030A19AGTGACACNONE
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080031A16AGTGACACNONE
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080033J23AGTGACACNONE
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080035H07AGTGACACNONE
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080039M24AGTGACACNONE
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080042B16AGTGACACNONE
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080043B03AGTGACACNONE
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080045G01AGTGACACNONE
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080045K17AGTGACACNONE
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080047A09AGTGACACNONE
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080047I22AGTGACACNONE
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080048M14AGTGACACNONE
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080049J02AGTGACACNONE
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052C15AGTGACACNONE
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052E11AGTGACACNONE
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052M22AGTGACACNONE
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080056O21AGTGACACNONE
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080059J04AGTGACACNONE
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080059O17AGTGACACNONE
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080064N04AGTGACACNONE
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080066A03AGTGACACNONE
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080066I22AGTGACACNONE
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069C13AGTGACACNONE
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069J03AGTGACACNONE
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069N04AGTGACACNONE
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071A01AGTGACACNONE
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071C03AGTGACACNONE
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071J02AGTGACACNONE
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080080D17AGTGACACNONE
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080084O06AGTGACACNONE
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080085O20AGTGACACNONE
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080086H15AGTGACACNONE
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080094K06AGTGACACNONE
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080095C05AGTGACACNONE
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080095G04AGTGACACNONE
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080096F03AGTGACACNONE
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080096F20AGTGACACNONE
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090004H05AGTGACACNONE
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090012P10AGTGACACNONE
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090021B09AGTGACACNONE
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090034M08AGTGACACNONE
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090046G21AGTGACACNONE
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090055K24AGTGACACNONE
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090055L05AGTGACACNONE
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090057H17AGTGACACNONE
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090082K21AGTGACACNONE
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100022A07AGTGACACNONE
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100022M02AGTGACACNONE
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100069K11AGTGACACNONE
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100086C24AGTGACACNONE
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
Os05g0135200J100023D22TGTCAGTGNONE
J100049H03TGTCAGTGNONE
J100050K11TGTCAGTGNONE
J100053B03TGTCAGTGHaem peroxidase family protein.
J100072E18TGTCAGTGNONE
Os05g0137200006-023-A08CACTGACANONE
006-026-D10CACTGACANONE
AK059748CACTGACANONE
Os05g0137400AK065206CCACTGACATGTGGGCCCCACCTGSimilar to Aspartic protease precursor.
D12777CCACTGACATGTGGGCCCCACCTGNONE
J013002F13CCACTGACATGTGGGCCCCACCTGNONE
J013029I15CCACTGACATGTGGGCCCCACCTGNONE
J013033A10CCACTGACATGTGGGCCCCACCTGNONE
J013035H24CCACTGACATGTGGGCCCCACCTGNONE
J013051H21CCACTGACATGTGGGCCCCACCTGNONE
J013098H05CCACTGACATGTGGGCCCCACCTGNONE
J023060B04CCACTGACATGTGGGCCCCACCTGNONE
J023130D23CCACTGACATGTGGGCCCCACCTGNONE
J033140N08CCACTGACATGTGGGCCCCACCTGNONE
J053039L22CCACTGACATGTGGGCCCCACCTGNONE
J080007K21CCACTGACATGTGGGCCCCACCTGNONE
Os05g0145100AK107957CACGTCACCConserved hypothetical protein.
Os05g0148600003-016-C11CCACTGACAGGNONE
AK066168CCACTGACAGGNONE
AK104336CCACTGACAGGSimilar to Na+/H+ antiporter.
AY360145CCACTGACAGGNONE
J013055J22CCACTGACAGGNONE
J013057M24CCACTGACAGGNONE
J013074N03CCACTGACAGGNONE
J013158A22CCACTGACAGGNONE
J075118H09CCACTGACAGGNONE
Os05g0150600011-043-D06CCACTGACAGCGTGGGCCCACANONE
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein.
AY180331CCACTGACAGCGTGGGCCCACANONE
J090053A16CCACTGACAGCGTGGGCCCACANONE
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
AK071561CCACCTGTCAGTGGSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
Os05g0171900012-005-F08GGTGACGTGNONE
012-048-G09GGTGACGTGNONE
013-046-A07GGTGACGTGNONE
013-050-D10GGTGACGTGNONE
014-003-G04GGTGACGTGNONE
014-008-G10GGTGACGTGNONE
014-011-E07GGTGACGTGNONE
014-011-F11GGTGACGTGNONE
014-019-C02GGTGACGTGNONE
014-037-G03GGTGACGTGNONE
014-043-G06GGTGACGTGNONE
014-045-A05GGTGACGTGNONE
014-047-C07GGTGACGTGNONE
014-052-F03GGTGACGTGNONE
014-088-G07GGTGACGTGNONE
014-090-B11GGTGACGTGNONE
015-010-A06GGTGACGTGNONE
015-013-B11GGTGACGTGNONE
015-026-A04GGTGACGTGNONE
015-041-G01GGTGACGTGNONE
015-046-D06GGTGACGTGNONE
015-050-B07GGTGACGTGNONE
015-053-C03GGTGACGTGNONE
015-056-C04GGTGACGTGNONE
015-057-B04GGTGACGTGNONE
015-075-C12GGTGACGTGNONE
015-079-F04GGTGACGTGNONE
016-025-F02GGTGACGTGNONE
016-030-B10GGTGACGTGNONE
016-034-B03GGTGACGTGNONE
016-034-E04GGTGACGTGNONE
016-035-B07GGTGACGTGNONE
016-035-D10GGTGACGTGNONE
016-039-C06GGTGACGTGNONE
016-042-D01GGTGACGTGNONE
016-043-C02GGTGACGTGNONE
016-044-B01GGTGACGTGNONE
016-045-G06GGTGACGTGNONE
016-049-G07GGTGACGTGNONE
016-052-C10GGTGACGTGNONE
016-070-D03GGTGACGTGNONE
016-077-H10GGTGACGTGNONE
016-082-F02GGTGACGTGNONE
016-087-D04GGTGACGTGNONE
016-093-B05GGTGACGTGNONE
016-093-F06GGTGACGTGNONE
AK069814GGTGACGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein.
AK106348GGTGACGTGNONE
AK119584GGTGACGTGNONE
AK119669GGTGACGTGNONE
J013074J12GGTGACGTGNONE
J023031G07GGTGACGTGNONE
J023072P16GGTGACGTGNONE
J023105N07GGTGACGTGNONE
J053023E11GGTGACGTGNONE
J053025H06GGTGACGTGNONE
J053029G08GGTGACGTGNONE
J053051L10GGTGACGTGNONE
J065011P09GGTGACGTGNONE
J065022O05GGTGACGTGNONE
J065071D04GGTGACGTGNONE
J065100B07GGTGACGTGNONE
J065104O10GGTGACGTGNONE
J065154H19GGTGACGTGNONE
J065183D19GGTGACGTGNONE
J065185I07GGTGACGTGNONE
J065205O17GGTGACGTGNONE
J075022N11GGTGACGTGNONE
J100033M17GGTGACGTGNONE
Os05g0182700003-102-E07CCACTGACATGTGGGCCCAACTNONE
011-019-D04CCACTGACATGTGGGCCCAACTNONE
013-068-D09CCACTGACATGTGGGCCCAACTNONE
014-032-G03CCACTGACATGTGGGCCCAACTNONE
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein.
AK104343CCACTGACATGTGGGCCCAACTNONE
J013045E01CCACTGACATGTGGGCCCAACTNONE
J013156L15CCACTGACATGTGGGCCCAACTNONE
J023029P17CCACTGACATGTGGGCCCAACTNONE
J023134I24CCACTGACATGTGGGCCCAACTNONE
J033099A10CCACTGACATGTGGGCCCAACTNONE
J033115L16CCACTGACATGTGGGCCCAACTNONE
J090007M24CCACTGACATGTGGGCCCAACTNONE
J090019F02CCACTGACATGTGGGCCCAACTNONE
Os05g0186900AK111403TGTCAGTGConserved hypothetical protein.
Os05g0188100009-011-G07AGTGACACGTGGCNONE
009-015-G06AGTGACACGTGGCNONE
009-021-B03AGTGACACGTGGCNONE
009-024-A09AGTGACACGTGGCNONE
009-025-A03AGTGACACGTGGCNONE
009-028-G03AGTGACACGTGGCNONE
009-029-G10AGTGACACGTGGCNONE
009-034-G12AGTGACACGTGGCNONE
009-039-D05AGTGACACGTGGCNONE
009-055-F08AGTGACACGTGGCNONE
009-064-B05AGTGACACGTGGCNONE
009-066-H12AGTGACACGTGGCNONE
009-077-B10AGTGACACGTGGCNONE
009-102-B06AGTGACACGTGGCNONE
009-113-F04AGTGACACGTGGCNONE
009-114-F04AGTGACACGTGGCConserved hypothetical protein.
009-131-G06AGTGACACGTGGCNONE
009-137-H11AGTGACACGTGGCNONE
009-172-H10AGTGACACGTGGCNONE
009-176-D08AGTGACACGTGGCNONE
009-182-A01AGTGACACGTGGCNONE
009-183-A04AGTGACACGTGGCNONE
009-183-G03AGTGACACGTGGCNONE
009-185-B10AGTGACACGTGGCNONE
009-192-F10AGTGACACGTGGCNONE
009-196-G01AGTGACACGTGGCNONE
011-005-A09AGTGACACGTGGCNONE
013-031-B12AGTGACACGTGGCNONE
013-031-F12AGTGACACGTGGCNONE
013-032-A08AGTGACACGTGGCNONE
013-069-H06AGTGACACGTGGCNONE
013-089-C10AGTGACACGTGGCNONE
J065123I11AGTGACACGTGGCNONE
J065124F15AGTGACACGTGGCNONE
J065155D05AGTGACACGTGGCNONE
J065181J22AGTGACACGTGGCNONE
J065185B07AGTGACACGTGGCNONE
J065186J11AGTGACACGTGGCNONE
J075183H21AGTGACACGTGGCNONE
J080003P06AGTGACACGTGGCNONE
J080068G17AGTGACACGTGGCNONE
J080069J05AGTGACACGTGGCNONE
J080080D03AGTGACACGTGGCNONE
J080080K22AGTGACACGTGGCNONE
J080090D12AGTGACACGTGGCNONE
J080092I03AGTGACACGTGGCNONE
J100039B06AGTGACACGTGGCNONE
J100047N15AGTGACACGTGGCNONE
Os05g0195700006-027-E05AGTGACACNONE
AK061427AGTGACACNONE
AK065594AGTGACACSimilar to Transcription factor MYBS2.
J013029P13AGTGACACNONE
J065048A06AGTGACACNONE
J065080L03AGTGACACNONE
J065103D11AGTGACACNONE
J065106I19AGTGACACNONE
J065198K16AGTGACACNONE
Os05g0207700AK102665CACTGACANONE
AK103861CACTGACASimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1).
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE
AK063666CCCACGGGCCCACCTGTCAGTNONE
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator.
Os05g0222200AK068591AGTGACACABC transporter related domain containing protein.
AK070374AGTGACACNONE
Os05g0297900AK071238TAAGCCCAGTGACGTGSimilar to Signal peptidase 18 subunit (Fragment).
J013159C03TAAGCCCAGTGACGTGNONE
J023041J06TAAGCCCAGTGACGTGNONE
J023085B09TAAGCCCAGTGACGTGNONE
J033031J11TAAGCCCAGTGACGTGNONE
J065010C22TAAGCCCAGTGACGTGNONE
J065032E10TAAGCCCAGTGACGTGNONE
J065141O18TAAGCCCAGTGACGTGNONE
J065155K04TAAGCCCAGTGACGTGNONE
Os05g0300700014-079-G07TAGGCCCACTGACNONE
AK063728TAGGCCCACTGACNONE
AK067846TAGGCCCACTGACConserved hypothetical protein.
Os05g0319800AK100483TGTCAGTGGSimilar to Plasma membrane H+ ATPase (EC 3.6.3.6).
Os05g0323100AK109472CACTGACARhodanese-like domain containing protein.
Os05g0344200006-022-E04CACGTCACCNONE
006-080-D01CACGTCACCNONE
009-021-D03CACGTCACCNONE
009-026-A10CACGTCACCNONE
009-054-B12CACGTCACCNONE
009-059-H03CACGTCACCNONE
009-077-C02CACGTCACCNONE
009-095-H12CACGTCACCNONE
009-106-B08CACGTCACCNONE
009-138-D10CACGTCACCNONE
009-140-G06CACGTCACCNONE
009-146-E09CACGTCACCNONE
009-161-F04CACGTCACCNONE
009-176-F05CACGTCACCNONE
013-047-C03CACGTCACCNONE
013-052-E07CACGTCACCNONE
013-054-G04CACGTCACCNONE
013-095-D10CACGTCACCNONE
014-003-D06CACGTCACCNONE
014-020-C09CACGTCACCNONE
014-043-E01CACGTCACCNONE
014-080-G09CACGTCACCNONE
014-081-H05CACGTCACCNONE
AK060058CACGTCACCConserved hypothetical protein.
AK098850CACGTCACCNONE
AK104716CACGTCACCNONE
AK119727CACGTCACCNONE
J013000G04CACGTCACCNONE
J013155L11CACGTCACCNONE
J033138J22CACGTCACCNONE
J065112E22CACGTCACCNONE
J065124M06CACGTCACCNONE
J065130M01CACGTCACCNONE
J065137I03CACGTCACCNONE
J065157O12CACGTCACCNONE
J065171B12CACGTCACCNONE
J075003O16CACGTCACCNONE
J075026G12CACGTCACCNONE
J075032K07CACGTCACCNONE
J075070I11CACGTCACCNONE
J075093K06CACGTCACCNONE
J075148C12CACGTCACCNONE
J075148L08CACGTCACCNONE
J075152G13CACGTCACCNONE
J075177G07CACGTCACCNONE
J100026I09CACGTCACCNONE
J100083L11CACGTCACCNONE
J100086F04CACGTCACCNONE
Os05g0346300009-033-C06GTGACGTGGCNONE
009-033-C06GTGACGTGGCNONE
AF529175GTGACGTGGCNONE
AF529175GTGACGTGGCNONE
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7.
AK061627GTGACGTGGCSimilar to 40S ribosomal protein S7.
AK103081GTGACGTGGCNONE
AK103081GTGACGTGGCNONE
AK104191GTGACGTGGCNONE
AK104191GTGACGTGGCNONE
J013049B09GTGACGTGGCNONE
J013049B09GTGACGTGGCNONE
J023142E24GTGACGTGGCNONE
J023142E24GTGACGTGGCNONE
J033052M14GTGACGTGGCNONE
J033052M14GTGACGTGGCNONE
J033089N04GTGACGTGGCNONE
J033089N04GTGACGTGGCNONE
J033118F01GTGACGTGGCNONE
J033118F01GTGACGTGGCNONE
J065054E07GTGACGTGGCNONE
J065054E07GTGACGTGGCNONE
J065066L18GTGACGTGGCNONE
J065066L18GTGACGTGGCNONE
J065078C21GTGACGTGGCNONE
J065078C21GTGACGTGGCNONE
J065127G23GTGACGTGGCNONE
J065127G23GTGACGTGGCNONE
J065128N24GTGACGTGGCNONE
J065128N24GTGACGTGGCNONE
J065144P17GTGACGTGGCNONE
J065144P17GTGACGTGGCNONE
J065147P14GTGACGTGGCNONE
J065147P14GTGACGTGGCNONE
J065170E16GTGACGTGGCNONE
J065170E16GTGACGTGGCNONE
J065175D17GTGACGTGGCNONE
J065175D17GTGACGTGGCNONE
J065176M05GTGACGTGGCNONE
J065176M05GTGACGTGGCNONE
J065218G20GTGACGTGGCNONE
J065218G20GTGACGTGGCNONE
J090074J12GTGACGTGGCNONE
J090074J12GTGACGTGGCNONE
J100019H16GTGACGTGGCNONE
J100019H16GTGACGTGGCNONE
J100031N24GTGACGTGGCNONE
J100031N24GTGACGTGGCNONE
J100072G08GTGACGTGGCNONE
J100072G08GTGACGTGGCNONE
J100086I23GTGACGTGGCNONE
J100086I23GTGACGTGGCNONE
Os05g0346400AK058872GCCACGTCACNONE
AK058872GCCACGTCACNONE
AK102727GCCACGTCACProtein of unknown function DUF538 family protein.
AK102727GCCACGTCACProtein of unknown function DUF538 family protein.
J033105N07GCCACGTCACNONE
J033105N07GCCACGTCACNONE
J100077I17GCCACGTCACNONE
J100077I17GCCACGTCACNONE
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE
AF020787GGACCCACCTGTCAGTGNONE
AK061712GGACCCACCTGTCAGTGNONE
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein.
J033060G23GGACCCACCTGTCAGTGNONE
J033112P14GGACCCACCTGTCAGTGNONE
J033127J04GGACCCACCTGTCAGTGNONE
J090015L18GGACCCACCTGTCAGTGNONE
J090047K03GGACCCACCTGTCAGTGNONE
J090097J17GGACCCACCTGTCAGTGNONE
Os05g0357200014-046-H09CCACTGACACGTGGACCNONE
AK064069CCACTGACACGTGGACCNONE
AK072064CCACTGACACGTGGACCMitochondrial substrate carrier family protein.
J065038M01CCACTGACACGTGGACCNONE
J065121C16CCACTGACACGTGGACCNONE
J075173E09CCACTGACACGTGGACCNONE
J080307A20CCACTGACACGTGGACCNONE
J090046B19CCACTGACACGTGGACCNONE
J100033N12CCACTGACACGTGGACCNONE
J100036G01CCACTGACACGTGGACCNONE
J100057B19CCACTGACACGTGGACCNONE
Os05g0361700AJ575218GTCAGTGGNONE
AJ575218GTGTCACTNONE
AK100184GTCAGTGGSimilar to EREBP-2 protein (Fragment).
AK100184GTGTCACTSimilar to EREBP-2 protein (Fragment).
AK111676GTCAGTGGNONE
AK111676GTGTCACTNONE
J013155B14GTCAGTGGNONE
J013155B14GTGTCACTNONE
J065073N01GTCAGTGGNONE
J065073N01GTGTCACTNONE
J065161J12GTCAGTGGNONE
J065161J12GTGTCACTNONE
J075074A07GTCAGTGGNONE
J075074A07GTGTCACTNONE
J100029H13GTCAGTGGNONE
J100029H13GTGTCACTNONE
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein.
AK104602ACTGACAGGTGGGCCCAGCCCNONE
AK104747ACTGACAGGTGGGCCCAGCCCNONE
J033133L03ACTGACAGGTGGGCCCAGCCCNONE
J080001O06ACTGACAGGTGGGCCCAGCCCNONE
J080004F05ACTGACAGGTGGGCCCAGCCCNONE
J080005D12ACTGACAGGTGGGCCCAGCCCNONE
J080008G19ACTGACAGGTGGGCCCAGCCCNONE
J080015D10ACTGACAGGTGGGCCCAGCCCNONE
J080015H22ACTGACAGGTGGGCCCAGCCCNONE
J080016K15ACTGACAGGTGGGCCCAGCCCNONE
J080018D12ACTGACAGGTGGGCCCAGCCCNONE
J080020A01ACTGACAGGTGGGCCCAGCCCNONE
J080027A09ACTGACAGGTGGGCCCAGCCCNONE
J080032F05ACTGACAGGTGGGCCCAGCCCNONE
J080039D09ACTGACAGGTGGGCCCAGCCCNONE
J080043J19ACTGACAGGTGGGCCCAGCCCNONE
J080052G22ACTGACAGGTGGGCCCAGCCCNONE
J080052M15ACTGACAGGTGGGCCCAGCCCNONE
J080053D22ACTGACAGGTGGGCCCAGCCCNONE
J080061I18ACTGACAGGTGGGCCCAGCCCNONE
J080064O14ACTGACAGGTGGGCCCAGCCCNONE
J080075K01ACTGACAGGTGGGCCCAGCCCNONE
J080082I02ACTGACAGGTGGGCCCAGCCCNONE
J080095C14ACTGACAGGTGGGCCCAGCCCNONE
J100028N14ACTGACAGGTGGGCCCAGCCCNONE
Os05g0367900Os05g0367900CACGTCACHarpin-induced 1 domain containing protein.
Os05g0368700AK064686ACGTCACCSimilar to Subtilisin-like protease (Fragment).
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2).
AK099962CAGGTGGGCCCCACCTGTCAGNONE
J065083M07CAGGTGGGCCCCACCTGTCAGNONE
Os05g0386900AK071425GGTGACGTNONE
AK073634GGTGACGTReticulon family protein.
Os05g0389800AK108808CACTGACASimilar to ATP-dependent helicase DHX8 (RNA helicase HRH1) (DEAH-box protein 8).
Os05g0391000AK109555ACGTCACCConserved hypothetical protein.
Os05g0393400AK059594GTCAGTGGNONE
AK099875GTCAGTGGNONE
AK100039GTCAGTGGSimilar to PAC (Fragment).
Os05g0404700Os05g0404700GTGACGTGZinc finger, CW-type domain containing protein.
Os05g0406100AK069515GTGTCACTInosine/uridine-preferring nucleoside hydrolase domain containing protein.
J023019G14GTGTCACTNONE
Os05g0406800AK062566GTCAGTGGNONE
AK099640GTCAGTGGLeucine rich repeat, N-terminal domain containing protein.
J013060B14GTCAGTGGNONE
J090013F14GTCAGTGGNONE
J090062E13GTCAGTGGNONE
J090063D09GTCAGTGGNONE
J090075H10GTCAGTGGNONE
J090096E22GTCAGTGGNONE
Os05g0408200AK100057CACTGACASBP domain containing protein.
J065182F20CACTGACANONE
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor.
Os05g0429700AK069203CCACTGACGGCTCGGCCCCACCNONE
AK103559CCACTGACGGCTCGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein.
Os05g0430300AK121670CTGTCAGTProtein of unknown function DUF668 family protein.
Os05g0436400003-014-B09ACTGACAGNONE
AK060776ACTGACAGPeptidase A22, presenilin signal peptide family protein.
Os05g0437800015-045-B10AGTGACACNONE
AK106328AGTGACACConserved hypothetical protein.
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE
Os05g0445000AK111423AGTGACACConserved hypothetical protein.
Os05g0446000AK070640GTGTCACTSimilar to Transcriptional activator DEMETER (DNA glycosylase-related protein DME).
Os05g0451300AK108341GGGCCCCACCTGTCAGConserved hypothetical protein.
Os05g0456300006-096-G05GTGTCACTNONE
006-108-F09GTGTCACTNONE
AK061843GTGTCACTNONE
AK068616GTGTCACTSimilar to Aldose reductase.
J013156J23GTGTCACTNONE
J023080O21GTGTCACTNONE
J043031L21GTGTCACTNONE
Os05g0467300006-113-H02CCACTGACANONE
006-113-H02GCGGCCCACCTGTCAGTGNONE
AK061873CCACTGACASelT/selW/selH selenoprotein family protein.
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein.
AK098945CCACTGACANONE
AK098945GCGGCCCACCTGTCAGTGNONE
J013050H09CCACTGACANONE
J013050H09GCGGCCCACCTGTCAGTGNONE
J023108B17CCACTGACANONE
J023108B17GCGGCCCACCTGTCAGTGNONE
J065189J01CCACTGACANONE
J065189J01GCGGCCCACCTGTCAGTGNONE
J075011H05CCACTGACANONE
J075011H05GCGGCCCACCTGTCAGTGNONE
J075019G20CCACTGACANONE
J075019G20GCGGCCCACCTGTCAGTGNONE
Os05g0477100AK108641ACTGACAGGConserved hypothetical protein.
Os05g0490900AK111382CACTGACAConserved hypothetical protein.
Os05g0494700Os05g0494700GTGACGTGNONE
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment).
AK100773GTGTCACTGACAGTGGGACCCACCACNONE
AK103289GTGTCACTGACAGTGGGACCCACCACNONE
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE
Os05g0505900AK105820TGTCAGTGNONE
AK106936TGTCAGTGConserved hypothetical protein.
Os05g0506000AF031609CACGTCACCNONE
AK062012CACGTCACCNONE
AK098900CACGTCACCNONE
AK122090CACGTCACCSimilar to MS5-like protein (Fragment).
J013002B13CACGTCACCNONE
J023149G13CACGTCACCNONE
J033123O20CACGTCACCNONE
J080315O17CACGTCACCNONE
Os05g0508500009-110-H08CACGTCACCNONE
009-135-B09CACGTCACCNONE
009-165-D10CACGTCACCNONE
AB053294CACGTCACCNONE
AK059385CACGTCACCNONE
AK106758CACGTCACCSimilar to Thioredoxin H.
J013121L08CACGTCACCNONE
J023069L24CACGTCACCNONE
J023146O17CACGTCACCNONE
J043030D01CACGTCACCNONE
J065084D15CACGTCACCNONE
J090046E10CACGTCACCNONE
J090078J10CACGTCACCNONE
Os05g0510100Os05g0510100CCACTGACProtein of unknown function DUF567 family protein.
Os05g0519900AK101078TGTCAGTGGNONE
Os05g0529300AK102648CGCCACGTCACCSimilar to ER lumen protein retaining receptor (HDEL receptor).
Os05g0529400009-126-H06GGTGACGTCACCNONE
009-126-H06GGTGACGTGGCGNONE
AK063846GGTGACGTCACCConserved hypothetical protein.
AK063846GGTGACGTGGCGConserved hypothetical protein.
AK122038GGTGACGTCACCNONE
AK122038GGTGACGTGGCGNONE
J033113C01GGTGACGTCACCNONE
J033113C01GGTGACGTGGCGNONE
Os05g0533600AK067577CACTGACATGTGGGCCGCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like).
AY224560CACTGACATGTGGGCCGCNONE
AY373258CACTGACATGTGGGCCGCNONE
Os05g0535100AK063362CCACCTGTCAGSimilar to Beta-1,3-glucanase-like protein.
Os05g0535700009-067-F01CCACTGACATATGGGCCCGNONE
AK061590CCACTGACATATGGGCCCGNONE
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein.
Os05g0535900AK101539CAAGGCCCCACACGTCACNONE
AK101539TGTCAGTGNONE
AK101555CAAGGCCCCACACGTCACIQ calmodulin-binding region domain containing protein.
AK101555TGTCAGTGIQ calmodulin-binding region domain containing protein.
J013047J05CAAGGCCCCACACGTCACNONE
J013047J05TGTCAGTGNONE
Os05g0539400AK068572CGCCACGTCACTCCACGCCGlycoside hydrolase, family 35 protein.
J013063P08CGCCACGTCACTCCACGCCNONE
J013110N24CGCCACGTCACTCCACGCCNONE
J013156K22CGCCACGTCACTCCACGCCNONE
J043038A08CGCCACGTCACTCCACGCCNONE
J090004K18CGCCACGTCACTCCACGCCNONE
J090085F03CGCCACGTCACTCCACGCCNONE
Os05g0540100AB021666CACGTCACCNONE
AK060623CACGTCACCNONE
AK103819CACGTCACCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a).
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog).
Os05g0557800009-156-G05AGGGCCCACTGTCAGTGNONE
013-049-C12AGGGCCCACTGTCAGTGNONE
AK068460AGGGCCCACTGTCAGTGSimilar to 50S ribosomal protein L21, mitochondrial precursor.
AK105327AGGGCCCACTGTCAGTGNONE
J013153H24AGGGCCCACTGTCAGTGNONE
J023003F16AGGGCCCACTGTCAGTGNONE
J065216G02AGGGCCCACTGTCAGTGNONE
J075037C20AGGGCCCACTGTCAGTGNONE
J100032H16AGGGCCCACTGTCAGTGNONE
Os05g0566400AK061645GCCACGTCACCNONE
AK099472GCCACGTCACCNONE
AK100389GCCACGTCACCSimilar to Blast and wounding induced mitogen-activated protein kinase.
Os05g0567100AK100749TGTCAGTGNONE
J023118K01TGTCAGTGNONE
Os05g0567500AK073046AGTGACACNONE
AK121133AGTGACACDNA glycosylase family protein.
J023075P20AGTGACACNONE
Os05g0581800006-040-C10AGTGACACNONE
AK106199AGTGACACNONE
Os05g0586600AB096011CCACGTGTCACTPlastid sigma factor SIG5.
AB096071CCACGTGTCACTNONE
AK105697CCACGTGTCACTNONE
Os06g0108100Os06g0108100TGTCAGTGNONE
Os06g0113900AK067430ACGTCACCNONE
AK102259ACGTCACCNONE
AK120464ACGTCACCConserved hypothetical protein.
J065144I06ACGTCACCNONE
Os06g0114000006-033-H09ACTGACAGNONE
AK060117ACTGACAGNONE
Os06g0115200J100029D05CCACTGACATGTGGGCCCCACGNONE
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein.
Os06g0130500014-030-B02TGTCAGTGNONE
AK105360TGTCAGTGSimilar to Cyclophilin-like protein PPIL3b.
J065114L20TGTCAGTGNONE
J075009J22TGTCAGTGNONE
J100030K17TGTCAGTGNONE
J100040E03TGTCAGTGNONE
J100041F14TGTCAGTGNONE
Os06g0136000AK060303CACTGACASimilar to Hypersensitive-induced reaction protein 4.
AK102678CACTGACANONE
J075185K19CACTGACANONE
J090028C16CACTGACANONE
J090099N12CACTGACANONE
J100070O10CACTGACANONE
Os06g0136600AK069316CACTGACATGTGGGCCCTSimilar to Enolase 1 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 1) (2-phospho- D-glycerate hydro-lyase 1).
J075010L23CACTGACATGTGGGCCCTNONE
Os06g0136900AK107405GTGACGTGGCCGTGGProtein of unknown function DUF296 domain containing protein.
Os06g0140900AK058823CACGTCACSigma factor, regions 3 and 4 domain containing protein.
J065159C22CACGTCACNONE
J090061D18CACGTCACNONE
J100066L20CACGTCACNONE
J100085F19CACGTCACNONE
J100088E11CACGTCACNONE
Os06g0145600015-013-D11GTGACGTGNONE
AK106249GTGACGTGTransferase family protein.
Os06g0156700AK107226GGTGACGTLipolytic enzyme, G-D-S-L family protein.
J075021O05GGTGACGTNONE
J075023M12GGTGACGTNONE
J075041C14GGTGACGTNONE
J075041C19GGTGACGTNONE
J075064F08GGTGACGTNONE
J075116I03GGTGACGTNONE
J075123I02GGTGACGTNONE
Os06g0161800AK064664CCTGTCAGProtein of unknown function DUF569 family protein.
Os06g0168700011-054-F04CACTGACAGNONE
012-001-G03CACTGACAGNONE
AK101305CACTGACAGNONE
AK103637CACTGACAGSimilar to Prolin rich protein.
J075082N06CACTGACAGNONE
J100086I19CACTGACAGNONE
Os06g0171700AK103771GTGACGTGGCGTGCdk-activating kinase assembly factor (MAT1) family protein.
J033143J20GTGACGTGGCGTGNONE
Os06g0181500AK068950GTCAGTGGNONE
AK100878GTCAGTGGSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3).
J023001P16GTCAGTGGNONE
Os06g0194400AK102980CACTGACAAGTGGGCCCACTTranscriptional factor B3 family protein.
Os06g0199100AK120323CCTGTCAGProtein prenyltransferase domain containing protein.
Os06g0199300J065045H01CACTGACATGTGGGCCCTNONE
J075177C22CACTGACATGTGGGCCCTNONE
J080068H06CACTGACATGTGGGCCCTNONE
J090048F01CACTGACATGTGGGCCCTNONE
J100066F17CACTGACATGTGGGCCCTNONE
Os06g0209300AK066363TGTCAGTGNONE
Os06g0224900AK065678TGTCAGTGGMitochodrial transcription termination factor-related family protein.
AK105790TGTCAGTGGNONE
Os06g0225400AK109268AGTGACACConserved hypothetical protein.
Os06g0226600006-083-D04CACTGACANONE
AK061806CACTGACANONE
AK102752CACTGACATB2/DP1 and HVA22 related protein family protein.
J013089J11CACTGACANONE
J033106M05CACTGACANONE
J100044M21CACTGACANONE
J100056E06CACTGACANONE
J100059F06CACTGACANONE
Os06g0229800AB115915ACGTCACCNONE
AB115916ACGTCACCNONE
AB115917ACGTCACCNONE
AB115918ACGTCACCNONE
AF419099ACGTCACCSimilar to Starch synthase IIA.
AK101978ACGTCACCNONE
Os06g0233000009-177-C07CACTGACANONE
009-177-C07CACTGACANONE
AK063118CACTGACAConserved hypothetical protein.
AK063118CACTGACAConserved hypothetical protein.
Os06g0233200AK108060CCTGTCAGSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8).
Os06g0239500AK064959GTCAGTGGTGF-beta receptor, type I/II extracellular region family protein.
Os06g0241200AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein.
Os06g0258900AK060181CTGACAGGNONE
AK067794AGTGACACKetose-bisphosphate aldolase, class-II family protein.
AK099384AGTGACACNONE
Os06g0337100006-100-G05CTGGCCCACGGGTCAGTGGNONE
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein.
Os06g0340600006-114-G04CACGTCACGTCACNONE
AK061872CACGTCACGTCACPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein.
AK065176CACGTCACGTCACNONE
AK100224CACGTCACGTCACNONE
J013002D10CACGTCACGTCACNONE
Os06g0552300011-011-G12GTCAGTGGNONE
AK101229GTCAGTGGBZR1, transcriptional repressor family protein.
J023061O03GTCAGTGGNONE
J033031H19GTCAGTGGNONE
J075103K14GTCAGTGGNONE
J075108I16GTCAGTGGNONE
J075194I23GTCAGTGGNONE
J090008K01GTCAGTGGNONE
J100062P15GTCAGTGGNONE
Os06g0587300AK069419CACTGACATGTGGGCCCCACAConserved hypothetical protein.
AK121885CACTGACATGTGGGCCCCACANONE
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein.
J033030G15CACTGACACGTGGGCCCACGGNONE
J033148N18CACTGACACGTGGGCCCACGGNONE
Os06g0589600AK111758GTGTCACTProtein kinase-like domain containing protein.
J100032C08GTGTCACTNONE
J100067P18GTGTCACTNONE
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter.
AK071175CACGCCACGTCACCNONE
Os06g0598800011-079-A05GGTGACGTGNONE
014-040-G10GGTGACGTGNONE
AK101377GGTGACGTGSimilar to Fatty acid elongase 1-like protein.
J013022A17GGTGACGTGNONE
J023011B05GGTGACGTGNONE
J023104L12GGTGACGTGNONE
J033033O20GGTGACGTGNONE
J033036C04GGTGACGTGNONE
J065060C17GGTGACGTGNONE
J075009D16GGTGACGTGNONE
J075123K20GGTGACGTGNONE
J075191A14GGTGACGTGNONE
J090038I01GGTGACGTGNONE
Os06g0603000AK068856CACTGACANONE
AK104955CACTGACASimilar to Heme oxygenase 1 (Fragment).
Os06g0604000006-085-H11CCACTGACAGNONE
AK061163CCACTGACAGNONE
AK066422CCACTGACAGSimilar to Ethylene response factor 1.
J065063N22CCACTGACAGNONE
J065099J09CCACTGACAGNONE
J090023J05CCACTGACAGNONE
Os06g0611500AK072708GTCAGTGGSimilar to Polygalacturonase (Fragment).
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein.
AK110866CCACTGACAConserved hypothetical protein.
Os06g0625500006-034-A05GCCACGTCACNONE
AK058459GCCACGTCACSimilar to Thioredoxin peroxidase.
AK068955GCCACGTCACNONE
AK104130GCCACGTCACNONE
J023003C09GCCACGTCACNONE
J033043I02GCCACGTCACNONE
J065063E05GCCACGTCACNONE
J065190D24GCCACGTCACNONE
J065198I01GCCACGTCACNONE
J075107A02GCCACGTCACNONE
Os06g0633900Os06g0633900TGTCAGTGGEsterase/lipase/thioesterase domain containing protein.
Os06g0636700AK058562CACGTCACLipolytic enzyme, G-D-S-L family protein.
AK058562CACGTCACCLipolytic enzyme, G-D-S-L family protein.
Os06g0643800AK071732CTGTCAGTSimilar to Sucrose-phosphate synthase 7 (EC 2.4.1.14) (Fragment).
J023111F20CTGTCAGTNONE
Os06g0646600AB061818AGTGACACKNOX family class 2 homeodomain protein.
J023088C09AGTGACACNONE
J065162G03AGTGACACNONE
Os06g0649000AK119644CACTGACANONE
Os06g0650100009-016-C02CACGTCACNONE
AK062354CACGTCACSimilar to Polyubiquitin gene (Fragment).
Os06g0668200011-004-A12CTGACAGGTGGNONE
AK070705CTGACAGGTGGSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3).
AK101622CTGACAGGTGGNONE
D10408CTGACAGGTGGNONE
J033044L05CTGACAGGTGGNONE
J033052L01CTGACAGGTGGNONE
J033086F09CTGACAGGTGGNONE
J033096I19CTGACAGGTGGNONE
J053072J20CTGACAGGTGGNONE
J065074N09CTGACAGGTGGNONE
J065075K09CTGACAGGTGGNONE
J065130L15CTGACAGGTGGNONE
J065136P12CTGACAGGTGGNONE
J065137M09CTGACAGGTGGNONE
J065139O15CTGACAGGTGGNONE
J075003J03CTGACAGGTGGNONE
J075021J20CTGACAGGTGGNONE
Os06g0681200AK107980AGTGACACCupredoxin domain containing protein.
Os06g0683600009-130-D10AGTGACACNONE
009-162-E11AGTGACACNONE
AK103599AGTGACACConserved hypothetical protein.
J033133F14AGTGACACNONE
J065041F11AGTGACACNONE
J065179G17AGTGACACNONE
Os06g0683800AK110639CACGTCACGTCACCConserved hypothetical protein.
Os06g0694100011-036-G03ATATGGGCCACTGACGTGTGGGCCCCACCNONE
AK063936ATATGGGCCACTGACGTGTGGGCCCCACCConserved hypothetical protein.
AK073594ATATGGGCCACTGACGTGTGGGCCCCACCNONE
J033051C12ATATGGGCCACTGACGTGTGGGCCCCACCNONE
J065102I24ATATGGGCCACTGACGTGTGGGCCCCACCNONE
Os06g0695900011-023-F07CTGTCAGTGGNONE
J023143A16CTGTCAGTGGZinc finger, RING-type domain containing protein.
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein.
Os06g0698785AJ578494AGTGACACSimilar to Choline monooxygenase, chloroplast precursor (EC 1.14.15.7).
Os06g0706400AK064899AGTGACACSimilar to Peptide transporter PTR2-B (Histidine transporting protein).
J013000L13AGTGACACNONE
J013043C22AGTGACACNONE
J013073L22AGTGACACNONE
J033022L23AGTGACACNONE
J065098I07AGTGACACNONE
J075074K18AGTGACACNONE
J090090M23AGTGACACNONE
J100021C24AGTGACACNONE
J100042I21AGTGACACNONE
J100074M14AGTGACACNONE
Os06g0708200J013149K22CTGACAGGTGGGCCACNONE
J053032C24CTGACAGGTGGGCCACNONE
J053037F13CTGACAGGTGGGCCACNONE
J053037L10CTGACAGGTGGGCCACNONE
J053043J18CTGACAGGTGGGCCACNONE
J053098E09CTGACAGGTGGGCCACNONE
J075036L07CTGACAGGTGGGCCACNONE
J075057O05CTGACAGGTGGGCCACNONE
J090092L13CTGACAGGTGGGCCACNONE
Os06g0708500AK060865AGGGCCCACCTGTCAGNONE
AK060865CACTGACANONE
AK072490AGGGCCCACCTGTCAGSimilar to Cyclophilin.
AK072490CACTGACASimilar to Cyclophilin.
J013052B11AGGGCCCACCTGTCAGNONE
J013052B11CACTGACANONE
J013052B13AGGGCCCACCTGTCAGNONE
J013052B13CACTGACANONE
J065214H07AGGGCCCACCTGTCAGNONE
J065214H07CACTGACANONE
J075192D20AGGGCCCACCTGTCAGNONE
J075192D20CACTGACANONE
J090090C15AGGGCCCACCTGTCAGNONE
J090090C15CACTGACANONE
J100051J18AGGGCCCACCTGTCAGNONE
J100051J18CACTGACANONE
J100055A07AGGGCCCACCTGTCAGNONE
J100055A07CACTGACANONE
J100060B10AGGGCCCACCTGTCAGNONE
J100060B10CACTGACANONE
J100061D02AGGGCCCACCTGTCAGNONE
J100061D02CACTGACANONE
Os06g0712800AK121236CGCCACGTCACCSimilar to Ankyrin-like protein.
Os06g0714000AK069538CCCACCTGTCAGTProtein of unknown function UPF0183 family protein.
AK069538CCCACCTGTCAGTGProtein of unknown function UPF0183 family protein.
J023020A02CCCACCTGTCAGTNONE
J023020A02CCCACCTGTCAGTGNONE
J023039H03CCCACCTGTCAGTNONE
J023039H03CCCACCTGTCAGTGNONE
J100042E23CCCACCTGTCAGTNONE
J100042E23CCCACCTGTCAGTGNONE
J100069N01CCCACCTGTCAGTNONE
J100069N01CCCACCTGTCAGTGNONE
J100089L13CCCACCTGTCAGTNONE
J100089L13CCCACCTGTCAGTGNONE
Os06g0715500AK059749CTGTCAGTGGNONE
AK060137CTGTCAGTGGNONE
AK100782CTGTCAGTGGSimilar to Translocon-associated protein alpha subunit precursor (TRAP-alpha) (Signal sequence receptor alpha subunit) (SSR-alpha).
Os06g0715700AK121440ACTGACAGGProtein of unknown function DUF803 family protein.
Os06g0725900AK061771CACGTCACCNONE
AK065019CACGTCACCSimilar to Cell division protein ftsH homolog, chloroplast precursor (EC 3.4.24.-) (DS9).
Os06g0726400AF136268ACTGACAGNONE
AK065121ACTGACAGNONE
AK119436ACTGACAGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I).
AK120332ACTGACAGNONE
AY302112ACTGACAGNONE
D10752ACTGACAGNONE
D11082ACTGACAGNONE
J013031L12ACTGACAGNONE
J013042M09ACTGACAGNONE
J013058E01ACTGACAGNONE
J013058O09ACTGACAGNONE
J013063J17ACTGACAGNONE
J013066I24ACTGACAGNONE
J013069F17ACTGACAGNONE
J013106E01ACTGACAGNONE
J013118D19ACTGACAGNONE
J013162M11ACTGACAGNONE
J023028B19ACTGACAGNONE
J023031A13ACTGACAGNONE
J023047H18ACTGACAGNONE
J023059N10ACTGACAGNONE
J023104N22ACTGACAGNONE
J033025J03ACTGACAGNONE
J033045B05ACTGACAGNONE
J033067M08ACTGACAGNONE
J033113D04ACTGACAGNONE
J043003D11ACTGACAGNONE
J043009O20ACTGACAGNONE
J043016P06ACTGACAGNONE
J043017C21ACTGACAGNONE
J043017J20ACTGACAGNONE
J043021P15ACTGACAGNONE
J043026I22ACTGACAGNONE
J043032L15ACTGACAGNONE
J043034G14ACTGACAGNONE
J043039L16ACTGACAGNONE
J075003D02ACTGACAGNONE
J075003O22ACTGACAGNONE
J075005I24ACTGACAGNONE
J075006N09ACTGACAGNONE
J075011A22ACTGACAGNONE
J075012K24ACTGACAGNONE
J075017D01ACTGACAGNONE
J075017I23ACTGACAGNONE
J075023D17ACTGACAGNONE
J075024B03ACTGACAGNONE
J075025H05ACTGACAGNONE
J075031D19ACTGACAGNONE
J075034B02ACTGACAGNONE
J075035C02ACTGACAGNONE
J075037J12ACTGACAGNONE
J075038M11ACTGACAGNONE
J075039J17ACTGACAGNONE
J075042P10ACTGACAGNONE
J075046J20ACTGACAGNONE
J075047F21ACTGACAGNONE
J075053E05ACTGACAGNONE
J075054D11ACTGACAGNONE
J075054K06ACTGACAGNONE
J075059E15ACTGACAGNONE
J075061O04ACTGACAGNONE
J075062I20ACTGACAGNONE
J075066I12ACTGACAGNONE
J075066L06ACTGACAGNONE
J075071H12ACTGACAGNONE
J075071N19ACTGACAGNONE
J075074K01ACTGACAGNONE
J075077H22ACTGACAGNONE
J075083H18ACTGACAGNONE
J075085F04ACTGACAGNONE
J075085K09ACTGACAGNONE
J075086C06ACTGACAGNONE
J075086E06ACTGACAGNONE
J075087A15ACTGACAGNONE
J075090N02ACTGACAGNONE
J075090N22ACTGACAGNONE
J075091C04ACTGACAGNONE
J075091G16ACTGACAGNONE
J075097E04ACTGACAGNONE
J075099E04ACTGACAGNONE
J075102P22ACTGACAGNONE
J075109B08ACTGACAGNONE
J075109J02ACTGACAGNONE
J075115I12ACTGACAGNONE
J075117E17ACTGACAGNONE
J075123C07ACTGACAGNONE
J075124N05ACTGACAGNONE
J075125E12ACTGACAGNONE
J075126B11ACTGACAGNONE
J075129E14ACTGACAGNONE
J075130N15ACTGACAGNONE
J075131I07ACTGACAGNONE
J075141B13ACTGACAGNONE
J075141B20ACTGACAGNONE
J075144D23ACTGACAGNONE
J075144N01ACTGACAGNONE
J075147M24ACTGACAGNONE
J075148L16ACTGACAGNONE
J075151A22ACTGACAGNONE
J075151D03ACTGACAGNONE
J075151D04ACTGACAGNONE
J075153E23ACTGACAGNONE
J075156D02ACTGACAGNONE
J075156P05ACTGACAGNONE
J075162E23ACTGACAGNONE
J075165J22ACTGACAGNONE
J075166A06ACTGACAGNONE
J075168H13ACTGACAGNONE
J075170D04ACTGACAGNONE
J075171C19ACTGACAGNONE
J075173B12ACTGACAGNONE
J075173M23ACTGACAGNONE
J075174C03ACTGACAGNONE
J075185O11ACTGACAGNONE
J075186G21ACTGACAGNONE
J075187D06ACTGACAGNONE
J075195G21ACTGACAGNONE
J090003D18ACTGACAGNONE
J090005I12ACTGACAGNONE
J090007D15ACTGACAGNONE
J090007G20ACTGACAGNONE
J090014G13ACTGACAGNONE
J090014L08ACTGACAGNONE
J090016J03ACTGACAGNONE
J090023P22ACTGACAGNONE
J090025C19ACTGACAGNONE
J090028F11ACTGACAGNONE
J090028G01ACTGACAGNONE
J090028H02ACTGACAGNONE
J090037I11ACTGACAGNONE
J090040F21ACTGACAGNONE
J090040N24ACTGACAGNONE
J090044M12ACTGACAGNONE
J090045B13ACTGACAGNONE
J090045M22ACTGACAGNONE
J090048C10ACTGACAGNONE
J090051J02ACTGACAGNONE
J090058O15ACTGACAGNONE
J090062F11ACTGACAGNONE
J090067D23ACTGACAGNONE
J090069G15ACTGACAGNONE
J090072I06ACTGACAGNONE
J090073H18ACTGACAGNONE
J090073L01ACTGACAGNONE
J090075O21ACTGACAGNONE
J090084K24ACTGACAGNONE
J090087P11ACTGACAGNONE
J090092B17ACTGACAGNONE
J100042H08ACTGACAGNONE
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-).
Os06g0728700AK111637GTGACGTGHomeodomain-like containing protein.
AK119632GTGACGTGNONE
J075015J02GTGACGTGNONE
J075016L14GTGACGTGNONE
J075078O03GTGACGTGNONE
J075098O14GTGACGTGNONE
J075171L20GTGACGTGNONE
Os07g0106700009-004-C02GTCAGTGGGGGAGNONE
009-037-F10GTCAGTGGGGGAGNONE
AK060004GTCAGTGGGGGAGNONE
AK100221GTCAGTGGGGGAGNONE
J065041B01GTCAGTGGGGGAGNONE
J065183O15GTCAGTGGGGGAGNONE
J075030L24GTCAGTGGGGGAGNONE
J075097O21GTCAGTGGGGGAGNONE
J075109P03GTCAGTGGGGGAGNONE
J075114J05GTCAGTGGGGGAGNONE
J075185N04GTCAGTGGGGGAGNONE
Os07g0115300006-039-C05CACGTCACCNONE
AK061511CACGTCACCSimilar to Peroxidase2 precursor (EC 1.11.1.7).
Os07g0121100AK102706CACGTCACProtein of unknown function DUF1719, Oryza sativa family protein.
Os07g0133500015-010-H05CCACTGACAGGTGGGNONE
AB110179CCACTGACAGGTGGGNONE
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein.
J090075I21CCACTGACAGGTGGGNONE
Os07g0139400AB096864ACGTCACCNONE
AK065558ACGTCACCUDP-glucose 4-epimerase family protein.
AK099140ACGTCACCNONE
AK099183ACGTCACCNONE
J013033B01ACGTCACCNONE
J013157B14ACGTCACCNONE
J023052E04ACGTCACCNONE
J023086K05ACGTCACCNONE
J023099C15ACGTCACCNONE
J033025C08ACGTCACCNONE
J033072I24ACGTCACCNONE
J043020I04ACGTCACCNONE
J090039I21ACGTCACCNONE
J090078P20ACGTCACCNONE
J090084C18ACGTCACCNONE
J100024F07ACGTCACCNONE
J100054D22ACGTCACCNONE
J100062O08ACGTCACCNONE
Os07g0141400003-129-D08GTGACGTGNONE
006-021-E02GTGACGTGNONE
006-025-C06GTGACGTGNONE
006-027-H11GTGACGTGNONE
006-036-C05GTGACGTGNONE
006-046-D07GTGACGTGNONE
006-047-A02GTGACGTGNONE
006-050-F02GTGACGTGNONE
006-053-D07GTGACGTGNONE
006-054-E06GTGACGTGNONE
006-055-E01GTGACGTGNONE
006-055-F01GTGACGTGNONE
006-056-H12GTGACGTGNONE
006-057-D07GTGACGTGNONE
006-074-G10GTGACGTGNONE
006-077-C02GTGACGTGNONE
006-081-E01GTGACGTGNONE
006-089-B08GTGACGTGNONE
006-089-C10GTGACGTGNONE
006-092-E07GTGACGTGNONE
006-096-C11GTGACGTGNONE
006-096-H06GTGACGTGNONE
006-097-E07GTGACGTGNONE
006-098-D03GTGACGTGNONE
006-102-C05GTGACGTGNONE
006-107-E09GTGACGTGNONE
006-110-C09GTGACGTGNONE
006-113-C01GTGACGTGNONE
006-114-D09GTGACGTGNONE
006-115-H06GTGACGTGNONE
009-016-G06GTGACGTGNONE
009-031-C05GTGACGTGNONE
009-060-B05GTGACGTGNONE
009-123-H12GTGACGTGNONE
009-154-B09GTGACGTGNONE
009-172-F07GTGACGTGNONE
009-193-A04GTGACGTGNONE
AF022732GTGACGTGNONE
AF052203GTGACGTGNONE
AK065248GTGACGTGSimilar to 23 kDa polypeptide of photosystem II.
AK104722GTGACGTGNONE
D49713GTGACGTGNONE
J013002J02GTGACGTGNONE
J065051O13GTGACGTGNONE
J065066J18GTGACGTGNONE
J065077G23GTGACGTGNONE
J065162C22GTGACGTGNONE
J065162G22GTGACGTGNONE
J075091B13GTGACGTGNONE
J075099J22GTGACGTGNONE
J100056O22GTGACGTGNONE
J100059E01GTGACGTGNONE
J100079F20GTGACGTGNONE
Os07g0147600AK099551CACTGACAGNONE
AK102834CACTGACAGProtein kinase-like domain containing protein.
J090004P22CACTGACAGNONE
J090040K07CACTGACAGNONE
J090044I03CACTGACAGNONE
J090060I04CACTGACAGNONE
J090063O16CACTGACAGNONE
J090072C03CACTGACAGNONE
J090072E05CACTGACAGNONE
J090091P08CACTGACAGNONE
J090099P14CACTGACAGNONE
Os07g0166800006-038-C11TGTCAGTGNONE
012-080-F02TGTCAGTGNONE
AK070524TGTCAGTGRad6 (Ubiquitin carrier protein).
AK121382TGTCAGTGNONE
J023022D19TGTCAGTGNONE
J023055G02TGTCAGTGNONE
J023073E02TGTCAGTGNONE
J023125B08TGTCAGTGNONE
J023127H21TGTCAGTGNONE
J033052G01TGTCAGTGNONE
J033067F13TGTCAGTGNONE
J065046L14TGTCAGTGNONE
J065178D11TGTCAGTGNONE
J065205N17TGTCAGTGNONE