version

Summary of GCCCA (All List)

Organism Arabidopsis thaliana
PPDB Motif GCCCA
Description Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression
Total Entry Count 9717

Entry Sequences (9717 entries)

LocusGene modelSequenceDescription
AT1G01070AT1G01070.2GGGCTTATnodulin MtN21 family protein; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT1G11460.1); Has 1705 Blast hits to 1692 proteins in 315 species: Archae - 18; Bacteria - 780; Metazoa - 4; Fungi - 6; Plants - 641; Viruses - 0; Other Eukaryotes - 256 (source: NCBI BLink).
AT1G01080AT1G01080.1GAATGGGCCAT33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT1G01080.1TTTGGGCCTTTT33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT1G01080.2GAATGGGCCAT33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT1G01080.2TTTGGGCCTTTT33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT1G01100AT1G01100.1AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.1AAGGCCCAATA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.1ATTTGGGCTC60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.1CGGCCCATCA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.2AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.2AAGGCCCAATA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.2ATTTGGGCTC60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.2CGGCCCATCA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.3AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.3AAGGCCCAATA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.3ATTTGGGCTC60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.3CGGCCCATCA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.4AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.4AAGGCCCAATA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.4ATTTGGGCTC60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01100.4CGGCCCATCA60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G01120AT1G01120.1CCCATATAEncodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis.
AT1G01130AT1G01130.1GCCCAATAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47170.1); Has 104 Blast hits to 104 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01160AT1G01160.1ATTGGCCCAAATArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA
AT1G01160.1CCATGGGCCTTAGArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA
AT1G01160.1CTTAGGCCCAAATArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA
AT1G01160.2ATTGGCCCAAATArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA
AT1G01160.2CCATGGGCCTTAGArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA
AT1G01160.2CTTAGGCCCAAATArabidopsis thaliana GRF1-interacting factor 2 (GIF2) mRNA
AT1G01170AT1G01170.1GCCCATTTozone-responsive stress-related protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515); BEST Arabidopsis thaliana protein match is: ATOZI1 (TAIR:AT4G00860.1); Has 61 Blast hits to 61 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01170.2GCCCATTTozone-responsive stress-related protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515); BEST Arabidopsis thaliana protein match is: ATOZI1 (TAIR:AT4G00860.1); Has 61 Blast hits to 61 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01210AT1G01210.1AGTTGGGCCTACDNA-directed RNA polymerase III family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15 kDa subunit (InterPro:IPR001529); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase III family protein (TAIR:AT4G07950.1); Has 790 Blast hits to 790 proteins in 227 species: Archae - 146; Bacteria - 0; Metazoa - 227; Fungi - 178; Plants - 60; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G01210.1TTTAGGCCCAATAADNA-directed RNA polymerase III family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15 kDa subunit (InterPro:IPR001529); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase III family protein (TAIR:AT4G07950.1); Has 790 Blast hits to 790 proteins in 227 species: Archae - 146; Bacteria - 0; Metazoa - 227; Fungi - 178; Plants - 60; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G01320AT1G01320.1AGAGGCCCtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G28080.1); Has 10077 Blast hits to 4062 proteins in 343 species: Archae - 100; Bacteria - 2124; Metazoa - 5307; Fungi - 1095; Plants - 343; Viruses - 76; Other Eukaryotes - 1032 (source: NCBI BLink).
AT1G01320.1CTTAGGCCCATTAAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide TPR2 (InterPro:IPR013105), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT4G28080.1); Has 10077 Blast hits to 4062 proteins in 343 species: Archae - 100; Bacteria - 2124; Metazoa - 5307; Fungi - 1095; Plants - 343; Viruses - 76; Other Eukaryotes - 1032 (source: NCBI BLink).
AT1G01350AT1G01350.1GGGCCCATTATnucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type/C3HC4-type RING finger) family protein (TAIR:AT5G06420.2); Has 684 Blast hits to 680 proteins in 163 species: Archae - 0; Bacteria - 2; Metazoa - 306; Fungi - 148; Plants - 91; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).
AT1G01350.1TGAGCCCATTTAnucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type/C3HC4-type RING finger) family protein (TAIR:AT5G06420.2); Has 684 Blast hits to 680 proteins in 163 species: Archae - 0; Bacteria - 2; Metazoa - 306; Fungi - 148; Plants - 91; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).
AT1G01480AT1G01480.2CCCATGGGa member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library.
AT1G01500AT1G01500.1ATGGCCCAGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01500.1TAAGCCCATTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01510AT1G01510.1TTTTGGGCCCTEncodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction.
AT1G01560AT1G01560.1CCATGGGCmember of MAP Kinase
AT1G01560.2CCATGGGCmember of MAP Kinase
AT1G01620AT1G01620.1CTAGGCCCa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT1G01620.2CTAGGCCCa member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development.
AT1G01630AT1G01630.1ATAAGGCCCAATASEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).
AT1G01630.1CTGACGTGGGCTCASEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).
AT1G01630.1GAGCCCAATAGSEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).
AT1G01650AT1G01650.2TTGGCCCAACaspartic-type endopeptidase/ peptidase; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT1G63690.1); Has 1108 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 119; Metazoa - 534; Fungi - 104; Plants - 174; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).
AT1G01710AT1G01710.1CATGGGCCATacyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).
AT1G01710.1TTAATGGGCCTTGacyl-CoA thioesterase family protein; FUNCTIONS IN: cyclic nucleotide binding, acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT4G00520.2); Has 2588 Blast hits to 2566 proteins in 602 species: Archae - 0; Bacteria - 1102; Metazoa - 404; Fungi - 233; Plants - 38; Viruses - 0; Other Eukaryotes - 811 (source: NCBI BLink).
AT1G01730AT1G01730.1ATATGGGCCCAGAAAGGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01750AT1G01750.1CCCAATAGACTIN DEPOLYMERIZING FACTOR 11 (ADF11); FUNCTIONS IN: actin binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Actin-binding, cofilin/tropomyosin type (InterPro:IPR002108); BEST Arabidopsis thaliana protein match is: ADF8 (ACTIN DEPOLYMERIZING FACTOR 8); actin binding (TAIR:AT4G00680.1); Has 1202 Blast hits to 1183 proteins in 208 species: Archae - 0; Bacteria - 3; Metazoa - 637; Fungi - 111; Plants - 307; Viruses - 0; Other Eukaryotes - 144 (source: NCBI BLink).
AT1G01820AT1G01820.1ACAGGCCCATGmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT1G01840AT1G01840.1TTAAAGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01840.1TTAAAGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01910AT1G01910.1GTGGGCTTTTanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.1TATGGGCTTATanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.2GTGGGCTTTTanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.2TATGGGCTTATanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.3GTGGGCTTTTanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.3TATGGGCTTATanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.4GTGGGCTTTTanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.4TATGGGCTTATanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.5GTGGGCTTTTanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01910.5TATGGGCTTATanion-transporting ATPase, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1732 Blast hits to 1465 proteins in 458 species: Archae - 112; Bacteria - 1101; Metazoa - 115; Fungi - 90; Plants - 59; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).
AT1G01920AT1G01920.1AAAAGCCCACSET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative (TAIR:AT1G14030.1); Has 423 Blast hits to 420 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 142; Plants - 99; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT1G01920.1ATAAGCCCATASET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative (TAIR:AT1G14030.1); Has 423 Blast hits to 420 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 142; Plants - 99; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT1G01920.2AAAAGCCCACSET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative (TAIR:AT1G14030.1); Has 423 Blast hits to 420 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 142; Plants - 99; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT1G01920.2ATAAGCCCATASET domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SET (InterPro:IPR001214); BEST Arabidopsis thaliana protein match is: ribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative (TAIR:AT1G14030.1); Has 423 Blast hits to 420 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 142; Plants - 99; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT1G01970AT1G01970.1AAAAGGCCCATApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR:AT1G19520.1); Has 7256 Blast hits to 3017 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 83; Fungi - 5; Plants - 6997; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink).
AT1G01970.1ATAATGGGCCATApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR:AT1G19520.1); Has 7256 Blast hits to 3017 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 83; Fungi - 5; Plants - 6997; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink).
AT1G01970.1GAGGCCCAATATpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: NFD5 (NUCLEAR FUSION DEFECTIVE 5) (TAIR:AT1G19520.1); Has 7256 Blast hits to 3017 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 83; Fungi - 5; Plants - 6997; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink).
AT1G01990AT1G01990.1ATAATGGGCTTTAAAAGGCCTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01990.1TGAGCCCATTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01990.1TGGGCTTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02060AT1G02060.1AGCCCATTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G37230.1); Has 18912 Blast hits to 5842 proteins in 180 species: Archae - 4; Bacteria - 22; Metazoa - 373; Fungi - 390; Plants - 17444; Viruses - 0; Other Eukaryotes - 679 (source: NCBI BLink).
AT1G02060.1ATTGGGCCTTAGpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G37230.1); Has 18912 Blast hits to 5842 proteins in 180 species: Archae - 4; Bacteria - 22; Metazoa - 373; Fungi - 390; Plants - 17444; Viruses - 0; Other Eukaryotes - 679 (source: NCBI BLink).
AT1G02060.1TAATTGGGCCTAAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G37230.1); Has 18912 Blast hits to 5842 proteins in 180 species: Archae - 4; Bacteria - 22; Metazoa - 373; Fungi - 390; Plants - 17444; Viruses - 0; Other Eukaryotes - 679 (source: NCBI BLink).
AT1G02080AT1G02080.1AAGGCCCAATAAtranscriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink).
AT1G02080.1ATAATGGGCTTATtranscriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink).
AT1G02080.1GCCCAACAtranscriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink).
AT1G02080.1TGTGGGCCTTAAtranscriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink).
AT1G02090AT1G02090.1GTTTGGGCTCAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.1TGAGCCCAATTAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.1TTGGCCCAGAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.2GTTTGGGCTCAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.2TGAGCCCAATTAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.2TTGGCCCAGAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.3GTTTGGGCTCAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.3TGAGCCCAATTAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02090.3TTGGCCCAGAencodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype.
AT1G02100AT1G02100.1TAATTGGGCTCAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.1TCTGGGCCAAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.1TGAGCCCAAACleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.2TAATTGGGCTCAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.2TCTGGGCCAAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.2TGAGCCCAAACleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.3TAATTGGGCTCAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.3TCTGGGCCAAleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02100.3TGAGCCCAAACleucine carboxyl methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine carboxyl methyltransferase, LCTM1 1 (InterPro:IPR016651), Leucine carboxyl methyltransferase (InterPro:IPR007213); Has 455 Blast hits to 446 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 165; Fungi - 191; Plants - 22; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G02130AT1G02130.1CAAGGCCCAAACBelongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation.
AT1G02130.1GGGCCAATBelongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation.
AT1G02130.1TTATTGGGCCTCBelongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation.
AT1G02130.1TTATTGGGCCTTBelongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation.
AT1G02140AT1G02140.1ACTGGGCCTTAAMAGO NASHI (MAGO); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube guidance, sex determination; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mago nashi protein (InterPro:IPR004023); Has 348 Blast hits to 348 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 64; Plants - 47; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G02140.1TAAGCCCATTAMAGO NASHI (MAGO); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube guidance, sex determination; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mago nashi protein (InterPro:IPR004023); Has 348 Blast hits to 348 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 64; Plants - 47; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G02140.1TGGCCCAATATMAGO NASHI (MAGO); FUNCTIONS IN: protein binding; INVOLVED IN: embryonic development ending in seed dormancy, pollen tube guidance, sex determination; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mago nashi protein (InterPro:IPR004023); Has 348 Blast hits to 348 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 64; Plants - 47; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G02145AT1G02145.1ATATTGGGCCAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.1TAATGGGCTTAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.1TTAAGGCCCAGTtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.2ATATTGGGCCAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.2TAATGGGCTTAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.2TTAAGGCCCAGTtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.3ATATTGGGCCAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.3TAATGGGCTTAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.3TTAAGGCCCAGTtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.4ATATTGGGCCAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.4TAATGGGCTTAtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02145.4TTAAGGCCCAGTtransferase, transferring glycosyl groups; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: endomembrane system, intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Alg9-like mannosyltransferase (InterPro:IPR005599); BEST Arabidopsis thaliana protein match is: mannosyltransferase, putative (TAIR:AT5G14850.2); Has 588 Blast hits to 578 proteins in 128 species: Archae - 0; Bacteria - 10; Metazoa - 273; Fungi - 191; Plants - 61; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G02150AT1G02150.1GGCCTTTGGGCTTTGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 5042 Blast hits to 2597 proteins in 108 species: Archae - 0; Bacteria - 2; Metazoa - 25; Fungi - 66; Plants - 4783; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).
AT1G02160AT1G02160.1AAAAGGCCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02160.1TTTTGGGCCGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02160.2AAAAGGCCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02160.2TTTTGGGCCGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MTCP1 (InterPro:IPR009069), CHCH (InterPro:IPR010625); Has 27 Blast hits to 27 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02170AT1G02170.1AATTGGGCTTAMetacaspase AtMCP1b. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam profile PF00656: ICE-like protease (caspase) p20 domain
AT1G02170.1TATATGGGCTMetacaspase AtMCP1b. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam profile PF00656: ICE-like protease (caspase) p20 domain
AT1G02180AT1G02180.1ATTGGCCCAferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02180.1CAAAGCCCAATAAferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02180.1CAATGGGCferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02180.1GAGCCCAACAferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02180.1GCCCATTTAferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02190AT1G02190.1GCCCATTGCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink).
AT1G02190.1TAAATGGGCCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink).
AT1G02190.1TGGGCCAATCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink).
AT1G02190.2GCCCATTGCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink).
AT1G02190.2TAAATGGGCCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink).
AT1G02190.2TGGGCCAATCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink).
AT1G02290AT1G02290.1CATGGGCCTATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G02290.1CCAGGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G02290.1TATAGGCCCATTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45830.1); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 43; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G02330AT1G02330.1ATAATGGGCTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink).
AT1G02330.1ATAATGGGCTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink).
AT1G02330.1GTGGGCCTGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink).
AT1G02330.1TAGGGCCCATATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink).
AT1G02330.1TATGGCCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Hepatocellular carcinoma-associated antigen 59 (InterPro:IPR010756); Has 1111 Blast hits to 862 proteins in 155 species: Archae - 2; Bacteria - 54; Metazoa - 381; Fungi - 93; Plants - 45; Viruses - 5; Other Eukaryotes - 531 (source: NCBI BLink).
AT1G02405AT1G02405.1TAAGCCCATATproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink).
AT1G02405.1TTGGCCCAATAAAGCCCAAATproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to membrane; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G70990.1); Has 43114 Blast hits to 16780 proteins in 897 species: Archae - 84; Bacteria - 5479; Metazoa - 15161; Fungi - 3897; Plants - 10314; Viruses - 1979; Other Eukaryotes - 6200 (source: NCBI BLink).
AT1G02410AT1G02410.1ATATGGGCTTAcytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink).
AT1G02410.1ATTTGGGCTTTATTGGGCCAAcytochrome c oxidase assembly protein CtaG / Cox11 family; FUNCTIONS IN: copper ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein CtaG/Cox11 (InterPro:IPR007533); Has 2371 Blast hits to 2371 proteins in 476 species: Archae - 0; Bacteria - 724; Metazoa - 77; Fungi - 85; Plants - 18; Viruses - 0; Other Eukaryotes - 1467 (source: NCBI BLink).
AT1G02450AT1G02450.1CCCATTTANIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression.
AT1G02475AT1G02475.1CAATGGGCTTTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01883.1); Has 350 Blast hits to 350 proteins in 105 species: Archae - 0; Bacteria - 211; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).
AT1G02500AT1G02500.1CCCAATAGencodes a S-adenosylmethionine synthetase. SAM1 is regulated by protein S-nitrosylation. The covalent binding of nitric oxide (NO) to the Cys114 residue inhibits the enzyme activity.
AT1G02500.2CCCAATAGencodes a S-adenosylmethionine synthetase. SAM1 is regulated by protein S-nitrosylation. The covalent binding of nitric oxide (NO) to the Cys114 residue inhibits the enzyme activity.
AT1G02560AT1G02560.1CAAAGCCCATAAOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G02560.1CAAAGCCCATAAOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G02560.1TTGGCCCATTTOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G02680AT1G02680.1TAAATGGGCCTATTTBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G02680.1TAAGCCCAATTTBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G02680.1TTATGGGCTTBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G02690AT1G02690.1CTAAGCCCAATATPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.
AT1G02690.1GTTGGGCCGATATTGGGCTAAPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.
AT1G02690.2CTAAGCCCAATATPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.
AT1G02690.2GTTGGGCCGATATTGGGCTAAPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype.
AT1G02750AT1G02750.1CAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02750.1CAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02750.1TTGACTTTAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02770AT1G02770.1CAAGGCCCAACAAAAGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19060.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02780AT1G02780.1AAAAGCCCATTTembryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).
AT1G02780.1TAATTGGGembryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).
AT1G02780.1TTAAAGCCCAATATembryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).
AT1G02816AT1G02816.1AGCCCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G02816.1ATGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G02816.1TAAGCCCAAAATTAGCCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G02816.1TTAAAGCCCATGGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02370.1); Has 327 Blast hits to 326 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 326; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G02960AT1G02960.1AATTGGGCCTGTTAAAGCCCAATTAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G02960.1TTGGCCCAAAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G02960.2AATTGGGCCTGTTAAAGCCCAATTAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G02960.2TTGGCCCAAAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G02960.3AATTGGGCCTGTTAAAGCCCAATTAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G02960.3TTGGCCCAAAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G02965.1); Has 81 Blast hits to 80 proteins in 39 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 11; Plants - 15; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G02990AT1G02990.1GTTTGGGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).
AT1G02990.2GTTTGGGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G62900.1); Has 5176 Blast hits to 3822 proteins in 317 species: Archae - 10; Bacteria - 289; Metazoa - 2234; Fungi - 277; Plants - 207; Viruses - 11; Other Eukaryotes - 2148 (source: NCBI BLink).
AT1G03000AT1G03000.1GGGCCTTTAEncodes an apparent ATPase similar to yeast and human protein required for peroxisomal biogenesis. May facilitate recycling of PEX5, the peroxisomal matrix protein receptor, and thereby promote peroxisomal matrix protein import.
AT1G03030AT1G03030.1TGGCCCAGTphosphoribulokinase/uridine kinase family protein; FUNCTIONS IN: kinase activity, phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uridine kinase (InterPro:IPR000764); Has 1794 Blast hits to 1794 proteins in 581 species: Archae - 7; Bacteria - 1124; Metazoa - 151; Fungi - 173; Plants - 39; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink).
AT1G03040AT1G03040.1AAAAAGCCCACTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03040.1ATAAAGCCCACTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, acetyl-CoA biosynthetic process from pyruvate; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: UNE12 (unfertilized embryo sac 12); DNA binding / transcription factor (TAIR:AT4G02590.2); Has 1617 Blast hits to 1617 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 0; Plants - 1602; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03080AT1G03080.1TCAGGGGTAAATGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin (InterPro:IPR009053), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 169162 Blast hits to 69460 proteins in 2232 species: Archae - 2114; Bacteria - 24914; Metazoa - 82448; Fungi - 11850; Plants - 6375; Viruses - 760; Other Eukaryotes - 40701 (source: NCBI BLink).
AT1G03090AT1G03090.1ATAAAGCCCATAMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.
AT1G03090.1ATAGGCCCATTAAMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.
AT1G03090.2ATAAAGCCCATAMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.
AT1G03090.2ATAGGCCCATTAAMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion.
AT1G03106AT1G03106.1AGTTGGGCCGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03106.1TTATGGGCCCATTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03110AT1G03110.1CAATGGGCCCATAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / katanin p80 subunit, putative (TAIR:AT1G61210.1); Has 10142 Blast hits to 5991 proteins in 342 species: Archae - 38; Bacteria - 2987; Metazoa - 3498; Fungi - 1909; Plants - 650; Viruses - 0; Other Eukaryotes - 1060 (source: NCBI BLink).
AT1G03110.1CCGGCCCAACTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / katanin p80 subunit, putative (TAIR:AT1G61210.1); Has 10142 Blast hits to 5991 proteins in 342 species: Archae - 38; Bacteria - 2987; Metazoa - 3498; Fungi - 1909; Plants - 650; Viruses - 0; Other Eukaryotes - 1060 (source: NCBI BLink).
AT1G03140AT1G03140.1ATAAAGCCCATTTAsplicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT1G03140.1ATGGCCCAGTsplicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT1G03140.1ATTTGGGCCTATAsplicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT1G03150AT1G03150.1TAAATGGGCTTTATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink).
AT1G03150.1TATAGGCCCAAATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink).
AT1G03200AT1G03200.1CAAAGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03200.1GAAGCCCATTGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03310AT1G03310.1TTATTGGGCCTATGGGCTCGGCCCAGAEncodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex.
AT1G03310.2TTATTGGGCCTATGGGCTCGGCCCAGAEncodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex.
AT1G03350AT1G03350.1TGGCCCATTAABSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT4G13110.1); Has 9675 Blast hits to 5119 proteins in 484 species: Archae - 40; Bacteria - 3294; Metazoa - 2852; Fungi - 1070; Plants - 279; Viruses - 71; Other Eukaryotes - 2069 (source: NCBI BLink).
AT1G03350.1TGGCCCATTTABSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT4G13110.1); Has 9675 Blast hits to 5119 proteins in 484 species: Archae - 40; Bacteria - 3294; Metazoa - 2852; Fungi - 1070; Plants - 279; Viruses - 71; Other Eukaryotes - 2069 (source: NCBI BLink).
AT1G03360AT1G03360.1TAAATGGGCCAARABIDOPSIS THALIANA RIBOSOMAL RNA PROCESSING 4 (ATRRP4); FUNCTIONS IN: RNA binding, exonuclease activity; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), S1, RNA binding (InterPro:IPR003029); Has 443 Blast hits to 443 proteins in 204 species: Archae - 97; Bacteria - 0; Metazoa - 111; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT1G03360.1TTAATGGGCCAARABIDOPSIS THALIANA RIBOSOMAL RNA PROCESSING 4 (ATRRP4); FUNCTIONS IN: RNA binding, exonuclease activity; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), S1, RNA binding (InterPro:IPR003029); Has 443 Blast hits to 443 proteins in 204 species: Archae - 97; Bacteria - 0; Metazoa - 111; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT1G03370AT1G03370.1TAATTGGGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), GRAM (InterPro:IPR004182), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G03000.2); Has 36666 Blast hits to 23729 proteins in 1173 species: Archae - 306; Bacteria - 2687; Metazoa - 20823; Fungi - 2509; Plants - 2020; Viruses - 91; Other Eukaryotes - 8230 (source: NCBI BLink).
AT1G03430AT1G03430.1GGGCCTAAGCCCAATTGGGEncodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6).
AT1G03457AT1G03457.1CCCATTAGRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Ribonucleoprotein, BRUNO-like (InterPro:IPR015903), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Paraneoplastic encephalomyelitis antigen (InterPro:IPR002343); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT4G03110.1); Has 21968 Blast hits to 12589 proteins in 581 species: Archae - 14; Bacteria - 954; Metazoa - 13308; Fungi - 2195; Plants - 3046; Viruses - 0; Other Eukaryotes - 2451 (source: NCBI BLink).
AT1G03457.2CCCATTAGRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Ribonucleoprotein, BRUNO-like (InterPro:IPR015903), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Paraneoplastic encephalomyelitis antigen (InterPro:IPR002343); BEST Arabidopsis thaliana protein match is: RNA-binding protein, putative (TAIR:AT4G03110.1); Has 21968 Blast hits to 12589 proteins in 581 species: Archae - 14; Bacteria - 954; Metazoa - 13308; Fungi - 2195; Plants - 3046; Viruses - 0; Other Eukaryotes - 2451 (source: NCBI BLink).
AT1G03475AT1G03475.1TTTTGGGCCTAATTTGGGCEncodes coproporphyrinogen III oxidase, a key enzyme in the biosynthetic pathway of chlorophyll and heme, a tetrapyrrole pathway. Mutants express cytological and molecular markers associated with the defense responses, usually activated by pathogen infection.
AT1G03600AT1G03600.1ATATGGGCCTTATphotosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).
AT1G03600.1GGGCTTTAphotosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).
AT1G03600.1GTGGGCTTTGphotosystem II family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 218 Blast hits to 218 proteins in 63 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink).
AT1G03630AT1G03630.1TTAAAGCCCATCTCAAGGCCCAATAAEncodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.
AT1G03630.2TTAAAGCCCATCTCAAGGCCCAATAAEncodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.
AT1G03680AT1G03680.1CGGCCCAATAGencodes a chloroplast thioredoxin similar to prokaryotic thioredoxins.
AT1G03680.1CTAAGGCCCAGTencodes a chloroplast thioredoxin similar to prokaryotic thioredoxins.
AT1G03680.1TTAATGGGCTTTAAencodes a chloroplast thioredoxin similar to prokaryotic thioredoxins.
AT1G03687AT1G03687.1ACTGGGCCTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03687.1CTATTGGGCCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03687.1TTAAAGCCCAATAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03687.1TTAAAGCCCATTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03687.2ACTGGGCCTTAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03687.2CTATTGGGCCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03687.2TTAAAGCCCAATAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03687.2TTAAAGCCCATTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: DTW (InterPro:IPR005636); Has 347 Blast hits to 347 proteins in 176 species: Archae - 0; Bacteria - 320; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G03780AT1G03780.1GCCCATCAHomolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.
AT1G03780.1TAATTGGGHomolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.
AT1G03780.2GCCCATCAHomolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.
AT1G03780.2TAATTGGGHomolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase.
AT1G03860AT1G03860.1AAATGGGCCTCTprohibitin 2
AT1G03860.1ATAATGGGCCTGAprohibitin 2
AT1G03860.1ATAATGGGCTTAGprohibitin 2
AT1G03860.1TAATGGGCCTAAGprohibitin 2
AT1G03860.1TTAGCCCATprohibitin 2
AT1G03860.2AAATGGGCCTCTprohibitin 2
AT1G03860.2ATAATGGGCCTGAprohibitin 2
AT1G03860.2ATAATGGGCTTAGprohibitin 2
AT1G03860.2TAATGGGCCTAAGprohibitin 2
AT1G03860.2TTAGCCCATprohibitin 2
AT1G03860.3AAATGGGCCTCTprohibitin 2
AT1G03860.3ATAATGGGCCTGAprohibitin 2
AT1G03860.3ATAATGGGCTTAGprohibitin 2
AT1G03860.3TAATGGGCCTAAGprohibitin 2
AT1G03860.3TTAGCCCATprohibitin 2
AT1G04010AT1G04010.1CAAAGGCCCAATTAAAAGCCCATTTphosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G04020AT1G04020.1AAATGGGCTTTTAATTGGGCCTTTGEncodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression.
AT1G04020.2AAATGGGCTTTTAATTGGGCCTTTGEncodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression.
AT1G04070AT1G04070.1CTTAATGGGCCTACSubunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.
AT1G04070.1TAAATGGGSubunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.
AT1G04080AT1G04080.1CCCATTTAPRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink).
AT1G04080.1GTAGGCCCATTAAGPRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink).
AT1G04120AT1G04120.1AAAAAGCCCAAAmember of MRP subfamily
AT1G04130AT1G04130.1ATTTGGGCCCATAAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink).
AT1G04170AT1G04170.1TGTTGGGCCAAprotein synthesis initiation factor eIF2 gamma
AT1G04190AT1G04190.1TGAGGCCCATTTAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 15524 Blast hits to 9686 proteins in 698 species: Archae - 779; Bacteria - 4552; Metazoa - 3572; Fungi - 847; Plants - 951; Viruses - 0; Other Eukaryotes - 4823 (source: NCBI BLink).
AT1G04190.1TTATTGGGCTTTTtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 15524 Blast hits to 9686 proteins in 698 species: Archae - 779; Bacteria - 4552; Metazoa - 3572; Fungi - 847; Plants - 951; Viruses - 0; Other Eukaryotes - 4823 (source: NCBI BLink).
AT1G04190.1TTGGGCTTTTtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 15524 Blast hits to 9686 proteins in 698 species: Archae - 779; Bacteria - 4552; Metazoa - 3572; Fungi - 847; Plants - 951; Viruses - 0; Other Eukaryotes - 4823 (source: NCBI BLink).
AT1G04230AT1G04230.1CCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43720.1); Has 1140 Blast hits to 725 proteins in 146 species: Archae - 0; Bacteria - 18; Metazoa - 635; Fungi - 256; Plants - 52; Viruses - 5; Other Eukaryotes - 174 (source: NCBI BLink).
AT1G04230.1GTTGGGCTTTAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43720.1); Has 1140 Blast hits to 725 proteins in 146 species: Archae - 0; Bacteria - 18; Metazoa - 635; Fungi - 256; Plants - 52; Viruses - 5; Other Eukaryotes - 174 (source: NCBI BLink).
AT1G04240AT1G04240.1GCCCATATSHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro.
AT1G04240.1TTAATGGGSHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro.
AT1G04250AT1G04250.1GGGCTTAGTranscription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components.
AT1G04260AT1G04260.1CATGGGCCTTTGEncodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.
AT1G04260.1TTAATGGGCCTTTAAEncodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.
AT1G04270AT1G04270.1AGTTGGGCCGAEncodes cytosolic ribosomal protein S15.
AT1G04270.1ATTTGGGCTTTEncodes cytosolic ribosomal protein S15.
AT1G04270.1TGGGCCCACAEncodes cytosolic ribosomal protein S15.
AT1G04270.1TGGGCTTAEncodes cytosolic ribosomal protein S15.
AT1G04270.1TTATTGGGEncodes cytosolic ribosomal protein S15.
AT1G04270.2AGTTGGGCCGAEncodes cytosolic ribosomal protein S15.
AT1G04270.2ATTTGGGCTTTEncodes cytosolic ribosomal protein S15.
AT1G04270.2TGGGCCCACAEncodes cytosolic ribosomal protein S15.
AT1G04270.2TGGGCTTAEncodes cytosolic ribosomal protein S15.
AT1G04270.2TTATTGGGEncodes cytosolic ribosomal protein S15.
AT1G04290AT1G04290.1AGATGGGCthioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT2G29590.1); Has 654 Blast hits to 653 proteins in 190 species: Archae - 15; Bacteria - 172; Metazoa - 161; Fungi - 107; Plants - 138; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G04400AT1G04400.1TTTAGGCCCACBlue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.
AT1G04400.2TTTAGGCCCACBlue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.
AT1G04410AT1G04410.1AGAGGCCCATTAGmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink).
AT1G04410.1ATTTGGGCCTAATmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink).
AT1G04410.1TGGGCTAAmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink).
AT1G04420AT1G04420.1ATTAGGCCCAAATaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink).
AT1G04420.1CTAATGGGCCTCTaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink).
AT1G04430AT1G04430.1GCCCAAAAdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 569 Blast hits to 556 proteins in 52 species: Archae - 0; Bacteria - 61; Metazoa - 0; Fungi - 0; Plants - 484; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT1G04430.2GCCCAAAAdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 569 Blast hits to 556 proteins in 52 species: Archae - 0; Bacteria - 61; Metazoa - 0; Fungi - 0; Plants - 484; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT1G04510AT1G04510.1AAAAGGCCCATTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink).
AT1G04510.1CTAATGGGCTTCtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink).
AT1G04510.2AAAAGGCCCATTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink).
AT1G04510.2CTAATGGGCTTCtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink).
AT1G04590AT1G04590.1CTTAATGGGCTAFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.1TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.1TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.1TTAATGGGCTAAFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.2CTTAATGGGCTAFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.2TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.2TTAATGGGCCAATFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.2TTAATGGGCTAAFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04630AT1G04630.1AAATGGGCTTAGmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G04630.1CTAATGGGCTTAGmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G04630.1TAGCCCATTTmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G04635AT1G04635.1AAATGGGCTAEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G04635.1CTAAGCCCATTAGEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G04635.1CTAAGCCCATTTEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G04790AT1G04790.1AAAAGGCCCATTATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).
AT1G04790.1AGAGGCCCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).
AT1G04790.1TTAGCCCAATATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: SDIR1 (SALT- AND DROUGHT-INDUCED RING FINGER1); protein binding / ubiquitin-protein ligase/ zinc ion binding (TAIR:AT3G55530.1); Has 6374 Blast hits to 6356 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 2257; Fungi - 483; Plants - 2544; Viruses - 68; Other Eukaryotes - 1022 (source: NCBI BLink).
AT1G04800AT1G04800.1AGTTGGGCglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; Has 100341 Blast hits to 23884 proteins in 1440 species: Archae - 160; Bacteria - 31051; Metazoa - 31586; Fungi - 6910; Plants - 10047; Viruses - 1434; Other Eukaryotes - 19153 (source: NCBI BLink).
AT1G04810AT1G04810.1TGGCCCATCA26S proteasome regulatory subunit, putative; FUNCTIONS IN: enzyme regulator activity, binding; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, base subcomplex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Proteasome/cyclosome, regulatory subunit (InterPro:IPR002015), Armadillo-type fold (InterPro:IPR016024), 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit (InterPro:IPR016642); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (TAIR:AT2G32730.1); Has 813 Blast hits to 749 proteins in 190 species: Archae - 12; Bacteria - 25; Metazoa - 307; Fungi - 211; Plants - 86; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink).
AT1G04810.1TTATGGGCCG26S proteasome regulatory subunit, putative; FUNCTIONS IN: enzyme regulator activity, binding; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, base subcomplex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Proteasome/cyclosome, regulatory subunit (InterPro:IPR002015), Armadillo-type fold (InterPro:IPR016024), 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit (InterPro:IPR016642); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (TAIR:AT2G32730.1); Has 813 Blast hits to 749 proteins in 190 species: Archae - 12; Bacteria - 25; Metazoa - 307; Fungi - 211; Plants - 86; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink).
AT1G04820AT1G04820.1CCCAATTAEncodes an alpha tubulin isoform that is expressed in roots, leaves and flowers.
AT1G04860AT1G04860.1TATATGGGEncodes a ubiquitin-specific protease.
AT1G04870AT1G04870.1AAATGGGCCGAAEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.1GGGCCTTATEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.1TGGCCCAAGEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.1TTAATGGGEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.1TTGGGCTTGEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.2AAATGGGCCGAAEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.2GGGCCTTATEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.2TGGCCCAAGEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.2TTAATGGGEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04870.2TTGGGCTTGEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT1G04930AT1G04930.1AATACCCTCAGGCCCAGATCGGCCCAAAAhydroxyproline-rich glycoprotein family protein; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT2G32840.1); Has 1563 Blast hits to 1268 proteins in 183 species: Archae - 0; Bacteria - 127; Metazoa - 510; Fungi - 165; Plants - 332; Viruses - 182; Other Eukaryotes - 247 (source: NCBI BLink).
AT1G04930.1CCCAATAAhydroxyproline-rich glycoprotein family protein; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT2G32840.1); Has 1563 Blast hits to 1268 proteins in 183 species: Archae - 0; Bacteria - 127; Metazoa - 510; Fungi - 165; Plants - 332; Viruses - 182; Other Eukaryotes - 247 (source: NCBI BLink).
AT1G04940AT1G04940.1TTTTGGGCCGATCTGGGCCTGAGGGTATTTic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation.
AT1G04950AT1G04950.1AGCCCAAATEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.1CCCGGCCCEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.1CTTATTGGGCCTTGGCCCAAAAEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.2AGCCCAAATEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.2CCCGGCCCEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.2CTTATTGGGCCTTGGCCCAAAAEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.3AGCCCAAATEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.3CCCGGCCCEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04950.3CTTATTGGGCCTTGGCCCAAAAEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant.
AT1G04985AT1G04985.1TGTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G04985.1TTATTGGGCTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 16 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05070AT1G05070.1CAAAGGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32580.1); Has 55 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G05070.1CCGGCCCAACCGGTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32580.1); Has 55 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G05070.1TAAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32580.1); Has 55 Blast hits to 55 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G05140AT1G05140.1AATTGGGCCTAAGmembrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT2G32480.1); Has 6877 Blast hits to 5459 proteins in 1201 species: Archae - 28; Bacteria - 3634; Metazoa - 12; Fungi - 4; Plants - 40; Viruses - 0; Other Eukaryotes - 3159 (source: NCBI BLink).
AT1G05140.1AGCCCATATAmembrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT2G32480.1); Has 6877 Blast hits to 5459 proteins in 1201 species: Archae - 28; Bacteria - 3634; Metazoa - 12; Fungi - 4; Plants - 40; Viruses - 0; Other Eukaryotes - 3159 (source: NCBI BLink).
AT1G05140.1TACTGGGCTTGmembrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT2G32480.1); Has 6877 Blast hits to 5459 proteins in 1201 species: Archae - 28; Bacteria - 3634; Metazoa - 12; Fungi - 4; Plants - 40; Viruses - 0; Other Eukaryotes - 3159 (source: NCBI BLink).
AT1G05150AT1G05150.1ATAAGCCCACcalcium-binding EF hand family protein; FUNCTIONS IN: binding, zinc ion binding, calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), EF hand (InterPro:IPR018248), Tetratricopeptide TPR2 (InterPro:IPR013105), EF-HAND 2 (InterPro:IPR018249), Tetratricopeptide region (InterPro:IPR013026), Zinc finger, ZZ-type (InterPro:IPR000433); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT2G32450.1); Has 27369 Blast hits to 12594 proteins in 993 species: Archae - 1214; Bacteria - 11971; Metazoa - 3725; Fungi - 450; Plants - 518; Viruses - 0; Other Eukaryotes - 9491 (source: NCBI BLink).
AT1G05160AT1G05160.1TGAGGCCCEncodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family.
AT1G05190AT1G05190.1ATAATGGGCCTAGembryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink).
AT1G05190.1CTAATGGGCCGTembryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink).
AT1G05190.1TAAATGGGembryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink).
AT1G05190.1TAATGGGCCGAAembryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink).
AT1G05300AT1G05300.1ACGGGCCTAGmember of Fe(II) transporter isolog family
AT1G05300.2ACGGGCCTAGmember of Fe(II) transporter isolog family
AT1G05340AT1G05340.1ATAAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32210.1); Has 122 Blast hits to 122 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 16; Plants - 106; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05350AT1G05350.1AAGGCCCAGTthiF family protein; FUNCTIONS IN: binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), UBA/THIF-type NAD/FAD binding fold (InterPro:IPR000594), Molybdenum cofactor biosynthesis, MoeB (InterPro:IPR009036), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: SAE2 (SUMO-ACTIVATING ENZYME 2); SUMO activating enzyme (TAIR:AT2G21470.2); Has 7901 Blast hits to 7756 proteins in 1322 species: Archae - 133; Bacteria - 4223; Metazoa - 801; Fungi - 447; Plants - 189; Viruses - 0; Other Eukaryotes - 2108 (source: NCBI BLink).
AT1G05350.1CTAATGGGCTATTthiF family protein; FUNCTIONS IN: binding, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor, catalytic activity, cofactor binding; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), UBA/THIF-type NAD/FAD binding fold (InterPro:IPR000594), Molybdenum cofactor biosynthesis, MoeB (InterPro:IPR009036), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: SAE2 (SUMO-ACTIVATING ENZYME 2); SUMO activating enzyme (TAIR:AT2G21470.2); Has 7901 Blast hits to 7756 proteins in 1322 species: Archae - 133; Bacteria - 4223; Metazoa - 801; Fungi - 447; Plants - 189; Viruses - 0; Other Eukaryotes - 2108 (source: NCBI BLink).
AT1G05360AT1G05360.1CAATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14950.1); Has 269 Blast hits to 262 proteins in 95 species: Archae - 0; Bacteria - 11; Metazoa - 157; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT1G05410AT1G05410.1ATAGGCCCAAGAAGGCCCAATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G05410.1CCGACCCGACCCGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G05410.2ATAGGCCCAAGAAGGCCCAATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G05410.2CCGACCCGACCCGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G05580AT1G05580.1ATAAGCCCATTTmember of Putative Na+/H+ antiporter family
AT1G05580.2ATAAGCCCATTTmember of Putative Na+/H+ antiporter family
AT1G05720AT1G05720.1GAATGGGCselenoprotein family protein; FUNCTIONS IN: selenium binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sep15/SelM redox (InterPro:IPR014912); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G05785AT1G05785.1GCCCAATTAGot1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Got1-like protein (InterPro:IPR007305); BEST Arabidopsis thaliana protein match is: Got1-like family protein (TAIR:AT5G01430.1); Has 318 Blast hits to 318 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 137; Fungi - 75; Plants - 52; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT1G05785.2GCCCAATTAGot1-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Got1-like protein (InterPro:IPR007305); BEST Arabidopsis thaliana protein match is: Got1-like family protein (TAIR:AT5G01430.1); Has 318 Blast hits to 318 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 137; Fungi - 75; Plants - 52; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT1G05805AT1G05805.1CAAAGCCCAAAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT2G43140.1); Has 2445 Blast hits to 1444 proteins in 113 species: Archae - 2; Bacteria - 55; Metazoa - 778; Fungi - 140; Plants - 840; Viruses - 0; Other Eukaryotes - 630 (source: NCBI BLink).
AT1G05805.1CAAGCCCAGCCbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT2G43140.1); Has 2445 Blast hits to 1444 proteins in 113 species: Archae - 2; Bacteria - 55; Metazoa - 778; Fungi - 140; Plants - 840; Viruses - 0; Other Eukaryotes - 630 (source: NCBI BLink).
AT1G05840AT1G05840.1TTAATGGGaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT3G02740.1); Has 2039 Blast hits to 2022 proteins in 216 species: Archae - 0; Bacteria - 0; Metazoa - 414; Fungi - 414; Plants - 1048; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).
AT1G05850AT1G05850.1TAAAAGCCCAATGGGCCATAEncodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants.
AT1G05850.1TAGGGCCCACAEncodes an endo chitinase-like protein AtCTL1. Essential for tolerance to heat, salt and drought stresses. Also involved in root hair development, cell expansion and response to cytokinin. Allelic to erh2. 11 alleles described in Hauser (1995). Mutant is defective in acquired thermotolerance, appears semidwarf throughout its life cycle and has extra lateral branches. There are two EMS alleles. Expression of AtHSP101 is not affected in the mutants.
AT1G05860AT1G05860.1TATGGCCCATTGGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 51 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G05860.1TGTGGGCCCTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31600.1); Has 51 Blast hits to 50 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G05900AT1G05900.1ATGGCCCAGTendonuclease-related; FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, sequence-specific DNA binding, DNA binding, catalytic activity, endonuclease activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Endonuclease III-like, iron-sulphur cluster loop (InterPro:IPR003651), Endonuclease III, conserved site-2 (InterPro:IPR004036), Helix-hairpin-helix motif (InterPro:IPR000445), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: endonuclease-related (TAIR:AT2G31450.1); Has 9734 Blast hits to 9731 proteins in 1448 species: Archae - 228; Bacteria - 5250; Metazoa - 197; Fungi - 131; Plants - 86; Viruses - 0; Other Eukaryotes - 3842 (source: NCBI BLink).
AT1G05900.2ATGGCCCAGTendonuclease-related; FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, sequence-specific DNA binding, DNA binding, catalytic activity, endonuclease activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Endonuclease III-like, iron-sulphur cluster loop (InterPro:IPR003651), Endonuclease III, conserved site-2 (InterPro:IPR004036), Helix-hairpin-helix motif (InterPro:IPR000445), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: endonuclease-related (TAIR:AT2G31450.1); Has 9734 Blast hits to 9731 proteins in 1448 species: Archae - 228; Bacteria - 5250; Metazoa - 197; Fungi - 131; Plants - 86; Viruses - 0; Other Eukaryotes - 3842 (source: NCBI BLink).
AT1G05940AT1G05940.1TAAAGGCCCAAAEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.
AT1G05940.1TGTTGGGCCCAATGEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.
AT1G05940.1TTATTGGGEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.
AT1G05940.1TTGGCCCAATATEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters.
AT1G06000AT1G06000.1GAATGGGCCGGencodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols
AT1G06060AT1G06060.1TTTTGGGCTTTRanBPM-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61150.6); Has 659 Blast hits to 568 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 95; Plants - 120; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT1G06120AT1G06120.1CCCATATAfatty acid desaturase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1, core (InterPro:IPR015876), Fatty acid desaturase, type 1 (InterPro:IPR005804); BEST Arabidopsis thaliana protein match is: fatty acid desaturase family protein (TAIR:AT1G06090.1); Has 2696 Blast hits to 2696 proteins in 596 species: Archae - 0; Bacteria - 1082; Metazoa - 689; Fungi - 152; Plants - 71; Viruses - 3; Other Eukaryotes - 699 (source: NCBI BLink).
AT1G06120.1GCCCAAAAfatty acid desaturase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1, core (InterPro:IPR015876), Fatty acid desaturase, type 1 (InterPro:IPR005804); BEST Arabidopsis thaliana protein match is: fatty acid desaturase family protein (TAIR:AT1G06090.1); Has 2696 Blast hits to 2696 proteins in 596 species: Archae - 0; Bacteria - 1082; Metazoa - 689; Fungi - 152; Plants - 71; Viruses - 3; Other Eukaryotes - 699 (source: NCBI BLink).
AT1G06190AT1G06190.1CAAAGCCCATAAAGCCCAATAATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).
AT1G06190.2CAAAGCCCATAAAGCCCAATAATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism, ATP binding; INVOLVED IN: ATP biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase, coupled to transmembrane movement of ions, phosphorylative mechanism (TAIR:AT2G31150.1); Has 1742 Blast hits to 1480 proteins in 252 species: Archae - 4; Bacteria - 198; Metazoa - 552; Fungi - 215; Plants - 95; Viruses - 50; Other Eukaryotes - 628 (source: NCBI BLink).
AT1G06220AT1G06220.1AATTGGGCCGATEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.
AT1G06220.2AATTGGGCCGATEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.
AT1G06530AT1G06530.1GCCCAAAAmyosin heavy chain-related; LOCATED IN: mitochondrion, plasma membrane, plastid; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58840.2); Has 115779 Blast hits to 52346 proteins in 2082 species: Archae - 1688; Bacteria - 13782; Metazoa - 57957; Fungi - 9395; Plants - 4647; Viruses - 508; Other Eukaryotes - 27802 (source: NCBI BLink).
AT1G06560AT1G06560.1AGATGGGCTTATNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1ATATGGGCTTATNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1ATATGGGCTTATNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1ATATGGGCTTATNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1ATGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1CAAGGCCCATANOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1CAAGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1CAAGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06560.1CAAGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink).
AT1G06670AT1G06670.1TGGCCCAAAAGGCCCAAAAAGCCCAAAAnuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins
AT1G06690AT1G06690.1AAAAGGCCCAACTaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink).
AT1G06690.1CAAAGGCCCAACCAAGCCCAAaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink).
AT1G06690.1GCCCAAACaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity, ATPase activity, ATP binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT5G53580.1); Has 18029 Blast hits to 18016 proteins in 1454 species: Archae - 258; Bacteria - 9842; Metazoa - 1647; Fungi - 1390; Plants - 743; Viruses - 0; Other Eukaryotes - 4149 (source: NCBI BLink).
AT1G06700AT1G06700.1GCCCATAAserine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).
AT1G06700.2GCCCATAAserine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).
AT1G06790AT1G06790.1TTGGCCCARNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT1G06790.1TTGGCCCAATTRNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT1G06790.2TTGGCCCARNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT1G06790.2TTGGCCCAATTRNA polymerase Rpb7 N-terminal domain-containing protein; FUNCTIONS IN: DNA-directed RNA polymerase activity; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase Rpb7, N-terminal (InterPro:IPR005576), RNA polymerase III, subunit Rpc25 (InterPro:IPR013238); Has 625 Blast hits to 625 proteins in 198 species: Archae - 107; Bacteria - 0; Metazoa - 231; Fungi - 170; Plants - 43; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT1G06960AT1G06960.1GGGCCTAACsmall nuclear ribonucleoprotein U2B, putative / spliceosomal protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U2B'' (U2 small nuclear ribonucleoprotein B); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT2G30260.1); Has 1187 Blast hits to 1180 proteins in 179 species: Archae - 0; Bacteria - 2; Metazoa - 655; Fungi - 246; Plants - 133; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).
AT1G06960.2GGGCCTAACsmall nuclear ribonucleoprotein U2B, putative / spliceosomal protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U2B'' (U2 small nuclear ribonucleoprotein B); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT2G30260.1); Has 1187 Blast hits to 1180 proteins in 179 species: Archae - 0; Bacteria - 2; Metazoa - 655; Fungi - 246; Plants - 133; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).
AT1G06960.3GGGCCTAACsmall nuclear ribonucleoprotein U2B, putative / spliceosomal protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U2B'' (U2 small nuclear ribonucleoprotein B); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT2G30260.1); Has 1187 Blast hits to 1180 proteins in 179 species: Archae - 0; Bacteria - 2; Metazoa - 655; Fungi - 246; Plants - 133; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).
AT1G07000AT1G07000.1ATCGGCCCATAAA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT1G07010AT1G07010.1AGAGGCCCAATTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.1ATGGCCCAATGcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.1TTGGGCTTTAcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.2AGAGGCCCAATTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.2ATGGCCCAATGcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.2TTGGGCTTTAcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.3AGAGGCCCAATTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.3ATGGCCCAATGcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07010.3TTGGGCTTTAcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G18480.1).
AT1G07020AT1G07020.1ATATGGGCTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 22 Blast hits to 22 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G07020.1GTTTGGGCCTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 22 Blast hits to 22 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G07020.1TAGTGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; Has 22 Blast hits to 22 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 3; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G07070AT1G07070.1GGGCCGAT60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G07070.1TATAGGCCCATTAA60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G07070.1TTCGGCCCATAT60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G07110AT1G07110.1ATAGGCCCAATAAEncodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase.
AT1G07110.1CAAGCCCAGCCCAAAAEncodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase.
AT1G07140AT1G07140.1ATCGGCCCATAEncodes a putative Ran-binding protein (siRanBP).
AT1G07140.1TATATGGGCCATAEncodes a putative Ran-binding protein (siRanBP).
AT1G07170AT1G07170.1AAAAAGCCCATCALOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT1G07170.1TAGCCCATATTAAGTCGGLOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT1G07170.2AAAAAGCCCATCALOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT1G07170.2TAGCCCATATTAAGTCGGLOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT1G07210AT1G07210.1TAAATGGGCCTGG30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink).
AT1G07210.1TCAGCCCATTAT30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink).
AT1G07210.1TGAGCCCATTAT30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink).
AT1G07250AT1G07250.1AGTTGGGCTCUDP-GLUCOSYL TRANSFERASE 71C4 (UGT71C4); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71C3 (UDP-GLUCOSYL TRANSFERASE 71C3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G07260.1); Has 4707 Blast hits to 4690 proteins in 296 species: Archae - 0; Bacteria - 123; Metazoa - 1851; Fungi - 11; Plants - 2658; Viruses - 37; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G07250.1CAATGGGCCGTUDP-GLUCOSYL TRANSFERASE 71C4 (UGT71C4); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71C3 (UDP-GLUCOSYL TRANSFERASE 71C3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G07260.1); Has 4707 Blast hits to 4690 proteins in 296 species: Archae - 0; Bacteria - 123; Metazoa - 1851; Fungi - 11; Plants - 2658; Viruses - 37; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G07250.1TTGGCCCACAUDP-GLUCOSYL TRANSFERASE 71C4 (UGT71C4); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71C3 (UDP-GLUCOSYL TRANSFERASE 71C3); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT1G07260.1); Has 4707 Blast hits to 4690 proteins in 296 species: Archae - 0; Bacteria - 123; Metazoa - 1851; Fungi - 11; Plants - 2658; Viruses - 37; Other Eukaryotes - 27 (source: NCBI BLink).
AT1G07350AT1G07350.2CAATTGGGCCTTTTtransformer serine/arginine-rich ribonucleoprotein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT4G35785.2); Has 25544 Blast hits to 16897 proteins in 693 species: Archae - 12; Bacteria - 1110; Metazoa - 16477; Fungi - 2700; Plants - 2768; Viruses - 163; Other Eukaryotes - 2314 (source: NCBI BLink).
AT1G07350.2TGGGCCGGtransformer serine/arginine-rich ribonucleoprotein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT4G35785.2); Has 25544 Blast hits to 16897 proteins in 693 species: Archae - 12; Bacteria - 1110; Metazoa - 16477; Fungi - 2700; Plants - 2768; Viruses - 163; Other Eukaryotes - 2314 (source: NCBI BLink).
AT1G07400AT1G07400.1AGCCCATTATAGCCCATAAAACGC17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink).
AT1G07400.1ATTTGGGCCTCA17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink).
AT1G07420AT1G07420.1AAAAGGCCCArabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA
AT1G07420.1GGCTTTAATGGGArabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA
AT1G07430AT1G07430.1CATTGGGCCACGTAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G29380.1); Has 4401 Blast hits to 4389 proteins in 274 species: Archae - 0; Bacteria - 82; Metazoa - 1419; Fungi - 539; Plants - 1372; Viruses - 7; Other Eukaryotes - 982 (source: NCBI BLink).
AT1G07440AT1G07440.1CCCGGCCCATCAtropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G29340.2); Has 82964 Blast hits to 82757 proteins in 2203 species: Archae - 469; Bacteria - 45784; Metazoa - 4525; Fungi - 4011; Plants - 1547; Viruses - 5; Other Eukaryotes - 26623 (source: NCBI BLink).
AT1G07440.2CCCGGCCCATCAtropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G29340.2); Has 82964 Blast hits to 82757 proteins in 2203 species: Archae - 469; Bacteria - 45784; Metazoa - 4525; Fungi - 4011; Plants - 1547; Viruses - 5; Other Eukaryotes - 26623 (source: NCBI BLink).
AT1G07510AT1G07510.1GAAGCCCATTAAGencodes an FtsH protease that is localized to the mitochondrion
AT1G07590AT1G07590.1GGGCCTATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 6623 Blast hits to 3122 proteins in 84 species: Archae - 0; Bacteria - 4; Metazoa - 30; Fungi - 22; Plants - 6377; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).
AT1G07590.1TGATGGGCpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 6623 Blast hits to 3122 proteins in 84 species: Archae - 0; Bacteria - 4; Metazoa - 30; Fungi - 22; Plants - 6377; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).
AT1G07600AT1G07600.1TGATGGGCmetallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage.
AT1G07645AT1G07645.1GTAGGCCCAAATDESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G07645.1TAAAGGCCCATATDESSICATION-INDUCED 1VOC SUPERFAMILY PROTEIN (ATDSI-1VOC); FUNCTIONS IN: catalytic activity; INVOLVED IN: response to abiotic stimulus; LOCATED IN: endomembrane system; EXPRESSED IN: seed; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); Has 442 Blast hits to 442 proteins in 189 species: Archae - 0; Bacteria - 413; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G07650AT1G07650.1GAATGGGCTGAleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / protein kinase family protein (TAIR:AT1G53430.1); Has 130529 Blast hits to 99787 proteins in 3434 species: Archae - 76; Bacteria - 9490; Metazoa - 46107; Fungi - 7763; Plants - 48132; Viruses - 454; Other Eukaryotes - 18507 (source: NCBI BLink).
AT1G07660AT1G07660.1ATATGGGCCTTTAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07660.2ATATGGGCCTTTAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07700AT1G07700.1CATGGGCCCATCTthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).
AT1G07700.2CATGGGCCCATCTthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).
AT1G07700.3CATGGGCCCATCTthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).
AT1G07745AT1G07745.1AAATGGGCTAAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination.
AT1G07745.1TCTGGGCCTGAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination.
AT1G07745.2AAATGGGCTAAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination.
AT1G07745.2TCTGGGCCTGAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination.
AT1G07810AT1G07810.1CATTGGGCTTAEncodes an ER-type Ca2+-pumping ATPase.
AT1G07810.1TATAGGCCCAAAEncodes an ER-type Ca2+-pumping ATPase.
AT1G07820AT1G07820.1GGGCCCAATAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07820.1TTATTGGGCCAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07820.2GGGCCCAATAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07820.2TTATTGGGCCAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink).
AT1G07830AT1G07830.1TATTGGGCCCTAribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).
AT1G07830.1TGGCCCAATAAribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).
AT1G07840AT1G07840.1CTTATTGGGCCCTAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G07840.1TAAATGGGGCCTGAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G07840.2CTTATTGGGCCCTAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G07840.2TAAATGGGGCCTGAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G07840.3CTTATTGGGCCCTAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G07840.3TAAATGGGGCCTGAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G07890AT1G07890.1TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07890.2TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07890.3TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07890.4TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07890.5TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07890.6TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07890.7TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07890.8TAGTGGGCCCTEncodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. At least part of the induction of heat shock proteins during light stress in Arabidopsis is mediated by H2O2 that is scavenged by APX1. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT1G07910AT1G07910.1AATAGCCCEncodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.
AT1G07910.1AATTGGGCTEncodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.
AT1G07910.2AATAGCCCEncodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.
AT1G07910.2AATTGGGCTEncodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains — an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component— that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.
AT1G07940AT1G07940.1CAAGGCCCAAAelongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).
AT1G07940.2CAAGGCCCAAAelongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).
AT1G07950AT1G07950.1TAAGCCCATTAsurfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G16430.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 139; Fungi - 8; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G07950.1TTTAGGCCCAATAsurfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G16430.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 139; Fungi - 8; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G07960AT1G07960.1TAATGGGCTTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07960.1TATTGGGCCTAAAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07960.2TAATGGGCTTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07960.2TATTGGGCCTAAAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07960.3TAATGGGCTTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07960.3TATTGGGCCTAAAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily.
AT1G07980AT1G07980.1ATAAGCCCATNUCLEAR FACTOR Y, SUBUNIT C10 (NF-YC10); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); Has 837 Blast hits to 835 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 200; Plants - 185; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).
AT1G07980.1TAAATGGGCCTAAANUCLEAR FACTOR Y, SUBUNIT C10 (NF-YC10); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); Has 837 Blast hits to 835 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 200; Plants - 185; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).
AT1G08040AT1G08040.1AGCCCAATAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G08040.1GTTGGGCTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G08040.2AGCCCAATAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G08040.2GTTGGGCTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G28310.3); Has 193 Blast hits to 192 proteins in 15 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G08125AT1G08125.1ATTTGGGCCGAAExpressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73320.1); Has 986 Blast hits to 984 proteins in 169 species: Archae - 0; Bacteria - 58; Metazoa - 387; Fungi - 270; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G08125.1GTGGGCCTAAACCGTExpressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73320.1); Has 986 Blast hits to 984 proteins in 169 species: Archae - 0; Bacteria - 58; Metazoa - 387; Fungi - 270; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G08130AT1G08130.1TTGGCCCAACAEncodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. Indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus.
AT1G08220AT1G08220.1GAAGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: mitochondrial proton-transporting ATP synthase complex assembly; LOCATED IN: mitochondrial inner membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: ATPase assembly factor ATP10, mitochondria (InterPro:IPR007849); Has 100 Blast hits to 100 proteins in 48 species: Archae - 6; Bacteria - 0; Metazoa - 2; Fungi - 63; Plants - 15; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G08220.2GAAGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: mitochondrial proton-transporting ATP synthase complex assembly; LOCATED IN: mitochondrial inner membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: ATPase assembly factor ATP10, mitochondria (InterPro:IPR007849); Has 100 Blast hits to 100 proteins in 48 species: Archae - 6; Bacteria - 0; Metazoa - 2; Fungi - 63; Plants - 15; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G08280AT1G08280.1TTAATGGGCTTAglycosyl transferase family 29 protein / sialyltransferase family protein; FUNCTIONS IN: sialyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, integral to Golgi membrane, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Sialyltransferase (InterPro:IPR012163), Glycosyl transferase, family 29 (InterPro:IPR001675); Has 1982 Blast hits to 1970 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 1819; Fungi - 0; Plants - 92; Viruses - 14; Other Eukaryotes - 57 (source: NCBI BLink).
AT1G08350AT1G08350.1AAAAGCCCAAACendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink).
AT1G08350.1AAATGGGCendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink).
AT1G08350.1AATTGGGCCTTTAendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink).
AT1G08350.2AAAAGCCCAAACendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink).
AT1G08350.2AAATGGGCendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink).
AT1G08350.2AATTGGGCCTTTAendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink).
AT1G08360AT1G08360.1GCCCATTT60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink).
AT1G08360.1GTTTGGGCTTTT60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink).
AT1G08360.1TAAAGGCCCAATT60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink).
AT1G08430AT1G08430.1GCCCAACTTACTGGGCEncodes a Al-activated malate efflux transporter. Is essential for aluminum tolerance but does not represent the major Al tolerance QTL. Staurosporine and calyculin A both block all changes in AtALMT1 gene expression (as a result malate release is totally inhibited).
AT1G08460AT1G08460.1CCAGGCCCAATAAGHDA08; FUNCTIONS IN: histone deacetylase activity; INVOLVED IN: histone deacetylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone deacetylase superfamily (InterPro:IPR000286); BEST Arabidopsis thaliana protein match is: HDA15; histone deacetylase (TAIR:AT3G18520.2); Has 6845 Blast hits to 6725 proteins in 846 species: Archae - 124; Bacteria - 2006; Metazoa - 1106; Fungi - 418; Plants - 273; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink).
AT1G08490AT1G08490.1AAAAGGCCTAATTCGGCCCATATChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation.
AT1G08490.1AGGGCCCATTTAChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation.
AT1G08540AT1G08540.1AATAGGCCCAAAAEnodes a subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme. SIG1 is induced by red and blue light.
AT1G08540.1ATTGGGCCAAEnodes a subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme. SIG1 is induced by red and blue light.
AT1G08580AT1G08580.1AAAAGGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G08580.1AAAAGGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 25 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G08610AT1G08610.1AAAAAGCCCAATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 19965 Blast hits to 5457 proteins in 167 species: Archae - 5; Bacteria - 16; Metazoa - 328; Fungi - 289; Plants - 18418; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink).
AT1G08610.1ATTGGCCCAAAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 19965 Blast hits to 5457 proteins in 167 species: Archae - 5; Bacteria - 16; Metazoa - 328; Fungi - 289; Plants - 18418; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink).
AT1G08640AT1G08640.1AGTTGGGCTGAunknown protein; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G08640.1ATTGGGCCGATunknown protein; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G08640.1CATTGGGCCACunknown protein; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G08680AT1G08680.1TCAGCCCAAAAGCCCACA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15.
AT1G08680.2TCAGCCCAAAAGCCCACA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15.
AT1G08680.3TCAGCCCAAAAGCCCACA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15.
AT1G08695AT1G08695.1GGGCTTTGEncodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT1G08695.1TGGGCCACEncodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT1G08700AT1G08700.1TTATTGGGCCTAATGGGCTEncodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation.
AT1G08700.1TTTTGGGCTTTAAEncodes a protein similar to animal presenilin whose expression is increased in response to potassium (K+) deprivation.
AT1G08710AT1G08710.1AGCCCATTAGGCCCAATAAF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G08710.1TTAAAGCCCAAAAF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G08710.2AGCCCATTAGGCCCAATAAF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G08710.2TTAAAGCCCAAAAF-box family protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; Has 80 Blast hits to 80 proteins in 27 species: Archae - 0; Bacteria - 2; Metazoa - 47; Fungi - 2; Plants - 17; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G08800AT1G08800.1TAAATGGGunknown protein; INVOLVED IN: response to salt stress, N-terminal protein myristoylation; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30690.1); Has 5590 Blast hits to 4318 proteins in 373 species: Archae - 40; Bacteria - 467; Metazoa - 2654; Fungi - 401; Plants - 432; Viruses - 11; Other Eukaryotes - 1585 (source: NCBI BLink).
AT1G08800.2TAAATGGGunknown protein; INVOLVED IN: response to salt stress, N-terminal protein myristoylation; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF593 (InterPro:IPR007656); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30690.1); Has 5590 Blast hits to 4318 proteins in 373 species: Archae - 40; Bacteria - 467; Metazoa - 2654; Fungi - 401; Plants - 432; Viruses - 11; Other Eukaryotes - 1585 (source: NCBI BLink).
AT1G08970AT1G08970.1ATAAGCCCAATGheme activated protein (HAP5c)
AT1G08970.2ATAAGCCCAATGheme activated protein (HAP5c)
AT1G08970.3ATAAGCCCAATGheme activated protein (HAP5c)
AT1G08970.4ATAAGCCCAATGheme activated protein (HAP5c)
AT1G08980AT1G08980.1GGGCCTGTEncodes an enzyme with similarity to bacterial acylamidohydrolases and exhibits indole-3-acetamide amidohydrolase activity in vitro. This enzyme may be involved in the in vivo biosynthesis of indole-acetic acid from indole-3-acetamide, a native metabolite of A. thaliana. It appears to exist as a monomer.
AT1G09090AT1G09090.1ATATGGGCrespiratory burst oxidase homolog B (ATRBOHB); FUNCTIONS IN: in 7 functions; INVOLVED IN: response to heat, defense response; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Cytochrome b245, heavy chain (InterPro:IPR000778), EF-Hand type (InterPro:IPR011992), Ferric reductase-like transmembrane component, N-terminal (InterPro:IPR013130), Ferric reductase, NAD binding (InterPro:IPR013121), NADPH oxidase Respiratory burst (InterPro:IPR013623), EF-HAND 2 (InterPro:IPR018249), FAD-binding 8 (InterPro:IPR013112), Riboflavin synthase-like beta-barrel (InterPro:IPR017938); BEST Arabidopsis thaliana protein match is: RBOHD (RESPIRATORY BURST OXIDASE HOMOLOGUE D); NAD(P)H oxidase (TAIR:AT5G47910.1); Has 1565 Blast hits to 1460 proteins in 219 species: Archae - 2; Bacteria - 104; Metazoa - 602; Fungi - 472; Plants - 265; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G09090.2ATATGGGCrespiratory burst oxidase homolog B (ATRBOHB); FUNCTIONS IN: in 7 functions; INVOLVED IN: response to heat, defense response; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Ferredoxin reductase-type FAD-binding domain (InterPro:IPR017927), Cytochrome b245, heavy chain (InterPro:IPR000778), EF-Hand type (InterPro:IPR011992), Ferric reductase-like transmembrane component, N-terminal (InterPro:IPR013130), Ferric reductase, NAD binding (InterPro:IPR013121), NADPH oxidase Respiratory burst (InterPro:IPR013623), EF-HAND 2 (InterPro:IPR018249), FAD-binding 8 (InterPro:IPR013112), Riboflavin synthase-like beta-barrel (InterPro:IPR017938); BEST Arabidopsis thaliana protein match is: RBOHD (RESPIRATORY BURST OXIDASE HOMOLOGUE D); NAD(P)H oxidase (TAIR:AT5G47910.1); Has 1565 Blast hits to 1460 proteins in 219 species: Archae - 2; Bacteria - 104; Metazoa - 602; Fungi - 472; Plants - 265; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G09100AT1G09100.1GCCCAAAAEncodes RPT5b (Regulatory Particle 5b), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype.
AT1G09130AT1G09130.1ACTGGGCCTGTATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).
AT1G09130.1ATGGCCCAGAATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).
AT1G09130.1ATTTGGGCTATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).
AT1G09130.2ACTGGGCCTGTATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).
AT1G09130.2ATGGCCCAGAATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).
AT1G09130.2ATTTGGGCTATP-dependent Clp protease proteolytic subunit, putative; FUNCTIONS IN: serine-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: in 6 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S14, ClpP (InterPro:IPR001907); BEST Arabidopsis thaliana protein match is: CLPR1; serine-type endopeptidase (TAIR:AT1G49970.1); Has 8201 Blast hits to 8199 proteins in 1643 species: Archae - 0; Bacteria - 4098; Metazoa - 115; Fungi - 50; Plants - 684; Viruses - 3; Other Eukaryotes - 3251 (source: NCBI BLink).
AT1G09140AT1G09140.1ACAGGCCCATTAAEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09140.1ATATGGGCCGATEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09140.1GGGCTATTEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09140.2ACAGGCCCATTAAEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09140.2ATATGGGCCGATEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09140.2GGGCTATTEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed.
AT1G09150AT1G09150.1AATAGCCCpseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).
AT1G09150.1ATCGGCCCATATpseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).
AT1G09150.1TTAATGGGCCTGTpseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink).
AT1G09200AT1G09200.1TAATGGGCTTGhistone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G65360.1); Has 10220 Blast hits to 10217 proteins in 5279 species: Archae - 0; Bacteria - 0; Metazoa - 7338; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 576 (source: NCBI BLink).
AT1G09320AT1G09320.1GTGGCCCAAGagenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT3G06520.1); Has 424 Blast hits to 179 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 3; Plants - 387; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G09320.1TAAGCCCAAATagenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT3G06520.1); Has 424 Blast hits to 179 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 3; Plants - 387; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G09320.1TTAGCCCATagenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT3G06520.1); Has 424 Blast hits to 179 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 17; Fungi - 3; Plants - 387; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G09330AT1G09330.1TAATTGGGCCTAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF846, eukaryotic (InterPro:IPR008564); Has 381 Blast hits to 381 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 100; Plants - 39; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink).
AT1G09330.1TTATTGGGCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF846, eukaryotic (InterPro:IPR008564); Has 381 Blast hits to 381 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 100; Plants - 39; Viruses - 0; Other Eukaryotes - 92 (source: NCBI BLink).
AT1G09340AT1G09340.1GTTAGGCCCAATTAEncodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes.
AT1G09340.1TGGCCCAATAAEncodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes.
AT1G09350AT1G09350.1TAGGGCCCArabidopsis thaliana galactinol synthase 3 (AtGolS3); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem, hypocotyl; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 871 Blast hits to 870 proteins in 198 species: Archae - 0; Bacteria - 55; Metazoa - 224; Fungi - 186; Plants - 285; Viruses - 70; Other Eukaryotes - 51 (source: NCBI BLink).
AT1G09415AT1G09415.1CCCATGGGCencodes a kinase that physically interacts with NPR1/NIM1
AT1G09415.1TTTGGGCCAAencodes a kinase that physically interacts with NPR1/NIM1
AT1G09490AT1G09490.1AGCCCATTTsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565
AT1G09490.1CAAGGCCCATATsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565
AT1G09490.2AGCCCATTTsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565
AT1G09490.2CAAGGCCCATATsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565
AT1G09500AT1G09500.1TTAATGGGsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase
AT1G09500.2TTAATGGGsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase
AT1G09500.3TTAATGGGsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase
AT1G09520AT1G09520.1AGTGGGCTCAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G09520.1TCAGCCCACTAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G09520.1TTATTGGGCCTTACprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G09520.1TTGGCCCAAGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G09590AT1G09590.1ACAGGCCCGTTA60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G09590.1TCAGCCCAAAT60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G09620AT1G09620.1GTGGCCCAAATATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: leucyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Leucyl-tRNA synthetase, class Ia, archaeal/eukaryotic cytosolic (InterPro:IPR004493), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding (TAIR:AT4G04350.1); Has 10914 Blast hits to 10382 proteins in 1644 species: Archae - 486; Bacteria - 5815; Metazoa - 490; Fungi - 313; Plants - 129; Viruses - 0; Other Eukaryotes - 3681 (source: NCBI BLink).
AT1G09620.1TAAATGGGATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: leucyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Leucyl-tRNA synthetase, class Ia, archaeal/eukaryotic cytosolic (InterPro:IPR004493), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding (TAIR:AT4G04350.1); Has 10914 Blast hits to 10382 proteins in 1644 species: Archae - 486; Bacteria - 5815; Metazoa - 490; Fungi - 313; Plants - 129; Viruses - 0; Other Eukaryotes - 3681 (source: NCBI BLink).
AT1G09620.1TCTGGGCCTTTTATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: nucleotide binding, aminoacyl-tRNA ligase activity, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: leucyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Leucyl-tRNA synthetase, class Ia, archaeal/eukaryotic cytosolic (InterPro:IPR004493), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: EMB2369 (EMBRYO DEFECTIVE 2369); ATP binding / aminoacyl-tRNA ligase/ leucine-tRNA ligase/ nucleotide binding (TAIR:AT4G04350.1); Has 10914 Blast hits to 10382 proteins in 1644 species: Archae - 486; Bacteria - 5815; Metazoa - 490; Fungi - 313; Plants - 129; Viruses - 0; Other Eukaryotes - 3681 (source: NCBI BLink).
AT1G09630AT1G09630.1TAAGCCCAACTEncodes a putative GTP-binding protein. Associates with organelles on a pathway from the Golgi to the plasma membrane in interphase. In dividing cells acts at the cell plate.
AT1G09640AT1G09640.1AGTTGGGCTTAelongation factor 1B-gamma, putative / eEF-1B gamma, putative; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, cultured cell, pollen tube, leaf, seed; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, gamma chain, conserved (InterPro:IPR001662), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: elongation factor 1B-gamma, putative / eEF-1B gamma, putative (TAIR:AT1G57720.2); Has 6774 Blast hits to 6759 proteins in 920 species: Archae - 2; Bacteria - 2995; Metazoa - 1594; Fungi - 400; Plants - 499; Viruses - 0; Other Eukaryotes - 1284 (source: NCBI BLink).
AT1G09660AT1G09660.1GAAGCCCAATAAKH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G09660.1GTAGGCCCATTATKH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G09660.1TAAGCCCATTAAKH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G09660.2GAAGCCCAATAAKH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G09660.2GTAGGCCCATTATKH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G09660.2TAAGCCCATTAAKH domain-containing quaking protein, putative; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G26480.1); Has 1026 Blast hits to 1025 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 712; Fungi - 103; Plants - 149; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G09690AT1G09690.1GAAGCCCAACT60S ribosomal protein L21 (RPL21C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: juvenile leaf, pollen tube; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21A) (TAIR:AT1G09590.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G09690.1TGTGGGCCGGTTAT60S ribosomal protein L21 (RPL21C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: juvenile leaf, pollen tube; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21A) (TAIR:AT1G09590.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G09740AT1G09740.1AAAAGCCCethylene-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G11930.1); Has 2952 Blast hits to 2858 proteins in 613 species: Archae - 247; Bacteria - 2061; Metazoa - 48; Fungi - 51; Plants - 388; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G09760AT1G09760.1CAATGGGCCGTTTAU2 small nuclear ribonucleoprotein A (U2A'); FUNCTIONS IN: protein binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae - 0; Bacteria - 1581; Metazoa - 2979; Fungi - 220; Plants - 106; Viruses - 2; Other Eukaryotes - 591 (source: NCBI BLink).
AT1G09760.1TTATGGGCCTAACCGACTGGGCCAATU2 small nuclear ribonucleoprotein A (U2A'); FUNCTIONS IN: protein binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae - 0; Bacteria - 1581; Metazoa - 2979; Fungi - 220; Plants - 106; Viruses - 2; Other Eukaryotes - 591 (source: NCBI BLink).
AT1G09770AT1G09770.1ATTGGCCCAGTCGGTTAGGCCCATAAMember of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1.
AT1G09770.1TAAACGGCCCATTGMember of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1.
AT1G09780AT1G09780.1GGGCCCATAT2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion, response to cold; LOCATED IN: cytosol, mitochondrial envelope, chloroplast, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT3G08590.2); Has 3363 Blast hits to 3360 proteins in 901 species: Archae - 36; Bacteria - 1671; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1228 (source: NCBI BLink).
AT1G09780.1GTGGCCCAATTG2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion, response to cold; LOCATED IN: cytosol, mitochondrial envelope, chloroplast, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT3G08590.2); Has 3363 Blast hits to 3360 proteins in 901 species: Archae - 36; Bacteria - 1671; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1228 (source: NCBI BLink).
AT1G09800AT1G09800.1AAAGCCCACTAtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink).
AT1G09800.1TGGGCTTTtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink).
AT1G09800.1TGTGGGCCATCGGCCCACAtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink).
AT1G09815AT1G09815.1CAATGGGCCGATPOLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 58; Plants - 33; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G09815.1CCCAATTAPOLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 58; Plants - 33; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G09815.1GAAGCCCATTAPOLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 58; Plants - 33; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G09830AT1G09830.1TATTGGGCCTTATglycinamide ribonucleotide synthetase (GAR synthetase) that catalyzes the conversion of phosphoribosyl amine to phosphoribosyl glycineamide
AT1G09950AT1G09950.1CAAGCCCAATGtranscription factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf apex, flower, root, leaf; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: ZW2 (TAIR:AT1G58330.1); Has 330 Blast hits to 329 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 330; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G09995AT1G09995.1AAATGGGCCCAGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: helicase-related (TAIR:AT1G79890.1); Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G09995.1CCCAATAGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: helicase-related (TAIR:AT1G79890.1); Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G09995.1TTATTGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: helicase-related (TAIR:AT1G79890.1); Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10030AT1G10030.1GAAGCCCAATTGAAAAGCCCATTTArabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G10030.1TCGGCCCATCAArabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G10050AT1G10050.1ACAGGCCCGGCCCATTTAEncodes a putative glycosyl hydrolase family 10 protein (xylanase).
AT1G10090AT1G10090.1GCCCAATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G10090.1GTTTGGGCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G10170AT1G10170.1TATAGGCCCATTGTTAGCCCATTAGEncodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response.
AT1G10210AT1G10210.1TAAGCCCAAATEncodes ATMPK1.
AT1G10210.1TAATTGGGCTCAEncodes ATMPK1.
AT1G10210.2TAAGCCCAAATEncodes ATMPK1.
AT1G10210.2TAATTGGGCTCAEncodes ATMPK1.
AT1G10220AT1G10220.2TTAATGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: ZCF37 (TAIR:AT1G59590.1); Has 30 Blast hits to 30 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G10230AT1G10230.1GTTTGGGCTTTATARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink).
AT1G10230.1TTTAGGCCCATAAARABIDOPSIS SKP1-LIKE 18 (ASK18); FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: E3 ubiquitin ligase, SCF complex, Skp subunit (InterPro:IPR016897), SKP1 component, dimerisation (InterPro:IPR016072), SKP1 component (InterPro:IPR001232), BTB/POZ fold (InterPro:IPR011333), SKP1 component, POZ (InterPro:IPR016073); BEST Arabidopsis thaliana protein match is: ASK15 (ARABIDOPSIS SKP1-LIKE 15); protein binding / ubiquitin-protein ligase (TAIR:AT3G25650.1); Has 1086 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 473; Fungi - 107; Plants - 362; Viruses - 11; Other Eukaryotes - 133 (source: NCBI BLink).
AT1G10240AT1G10240.1TAAATGGGFAR1-related sequence 11 (FRS11); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: MULE transposase, conserved domain (InterPro:IPR018289), Transcription factor, FAR1-related (InterPro:IPR004330), Zinc finger, PMZ-type (InterPro:IPR006564), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS10 (FAR1-related sequence 10); zinc ion binding (TAIR:AT5G28530.1); Has 770 Blast hits to 690 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 74; Plants - 691; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G10280AT1G10280.1TGGGCCCTCCGGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G21310.1); Has 332 Blast hits to 332 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 306; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G10380AT1G10380.1CCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17350.1); Has 148 Blast hits to 147 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10417AT1G10417.1CTGGGCCTGGGCTATTEncodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens.
AT1G10417.1TACTGGGCCCATATAEncodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens.
AT1G10470AT1G10470.1ATAGGCCCEncodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner.
AT1G10570AT1G10570.1AAAGCCCACEncodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation.
AT1G10570.1GAAGCCCACTAEncodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation.
AT1G10570.2AAAGCCCACEncodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation.
AT1G10570.2GAAGCCCACTAEncodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation.
AT1G10580AT1G10580.1CTATTGGGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT5G54520.1); Has 48476 Blast hits to 23700 proteins in 723 species: Archae - 63; Bacteria - 5525; Metazoa - 21675; Fungi - 8965; Plants - 4026; Viruses - 24; Other Eukaryotes - 8198 (source: NCBI BLink).
AT1G10585AT1G10585.1CCCGGCCCtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription regulator (TAIR:AT1G10586.1); Has 43 Blast hits to 43 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10740AT1G10740.1AGCCCACTunknown protein; INVOLVED IN: glycerol biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23330.1); Has 369 Blast hits to 369 proteins in 87 species: Archae - 0; Bacteria - 252; Metazoa - 1; Fungi - 4; Plants - 26; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT1G10740.2AGCCCACTunknown protein; INVOLVED IN: glycerol biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23330.1); Has 369 Blast hits to 369 proteins in 87 species: Archae - 0; Bacteria - 252; Metazoa - 1; Fungi - 4; Plants - 26; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT1G10840AT1G10840.1CCATGGGCEncodes eukaryotic initiation factor 3H1 subunit (TIF3H1).
AT1G10840.1TAATGGGCCCATGEncodes eukaryotic initiation factor 3H1 subunit (TIF3H1).
AT1G10840.2CCATGGGCEncodes eukaryotic initiation factor 3H1 subunit (TIF3H1).
AT1G10840.2TAATGGGCCCATGEncodes eukaryotic initiation factor 3H1 subunit (TIF3H1).
AT1G10890AT1G10890.1ATAAGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: petal, flower, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13340.1); Has 124670 Blast hits to 55842 proteins in 2000 species: Archae - 645; Bacteria - 12681; Metazoa - 61376; Fungi - 8660; Plants - 4059; Viruses - 685; Other Eukaryotes - 36564 (source: NCBI BLink).
AT1G10890.1ATAAGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: petal, flower, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13340.1); Has 124670 Blast hits to 55842 proteins in 2000 species: Archae - 645; Bacteria - 12681; Metazoa - 61376; Fungi - 8660; Plants - 4059; Viruses - 685; Other Eukaryotes - 36564 (source: NCBI BLink).
AT1G10910AT1G10910.1AAAAGCCCATCAINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G10910.1TAAAAGCCCATTTINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G10910.1TATGGCCCGTTAINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G10950AT1G10950.1AAAGGCCCAATendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).
AT1G10950.1CAAGCCCAATTAendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).
AT1G10950.1TATATGGGendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).
AT1G10950.1TATATGGGCCGendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink).
AT1G11080AT1G11080.1CCCATATAserine carboxypeptidase-like 31 (scpl31); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL32 (SERINE CARBOXYPEPTIDASE-LIKE 32); serine-type carboxypeptidase (TAIR:AT1G61130.1); Has 2478 Blast hits to 2433 proteins in 263 species: Archae - 0; Bacteria - 97; Metazoa - 570; Fungi - 568; Plants - 896; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink).
AT1G11180AT1G11180.1ATTTGGGCTTGsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).
AT1G11180.1TAGTGGGCTTTTsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: SC3 (SECRETORY CARRIER 3); transmembrane transporter (TAIR:AT1G61250.1); Has 511 Blast hits to 511 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 333; Fungi - 12; Plants - 121; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink).
AT1G11240AT1G11240.1TACCCTTATAATGGGCCAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink).
AT1G11240.1TTAAAGCCTAAAGCCCAATTAAAAGGCCunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 2452 Blast hits to 1845 proteins in 201 species: Archae - 0; Bacteria - 81; Metazoa - 1026; Fungi - 315; Plants - 107; Viruses - 18; Other Eukaryotes - 905 (source: NCBI BLink).
AT1G11270AT1G11270.1GAGCCCAAAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: heat acclimation; EXPRESSED IN: embryo, pedicel; EXPRESSED DURING: 4 anthesis, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527); BEST Arabidopsis thaliana protein match is: S locus F-box-related / SLF-related (TAIR:AT2G34280.1); Has 674 Blast hits to 664 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 672; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G11270.2GAGCCCAAAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: heat acclimation; EXPRESSED IN: embryo, pedicel; EXPRESSED DURING: 4 anthesis, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527); BEST Arabidopsis thaliana protein match is: S locus F-box-related / SLF-related (TAIR:AT2G34280.1); Has 674 Blast hits to 664 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 672; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G11270.3GAGCCCAAAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: heat acclimation; EXPRESSED IN: embryo, pedicel; EXPRESSED DURING: 4 anthesis, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527); BEST Arabidopsis thaliana protein match is: S locus F-box-related / SLF-related (TAIR:AT2G34280.1); Has 674 Blast hits to 664 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 672; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G11310AT1G11310.1CCCAATAAA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter.
AT1G11310.2CCCAATAAA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter.
AT1G11400AT1G11400.1GTGGGCTTAThe PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus.
AT1G11400.2GTGGGCTTAThe PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus.
AT1G11400.3GTGGGCTTAThe PYM gene encodes a protein capable of interacting with MAGO, and Y14, whose orthologs form part of the exon junction complex in animal cells. In vitro binding assays indicate that PYM can bind to MAGO and Y14 either individually, or when they are together. But, MAGO-Y14-PYM ternary complexes are difficult to detect in vivo in Arabidopsis based on pull-down experiments. However there is some evidence for a weak association in Arabidopsis flowers. PYM appears primarily cytoplasmic, but it also seems to into the nucleus at times. Its nuclear localization signal has not been rigorously defined, but there is evidence for a nuclear export signal between amino acids 171-205 in the C-terminus.
AT1G11430AT1G11430.1CTAATGGGCCTAATplastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G11430.1TCAGGCCCAAACplastid developmental protein DAG, putative; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT3G06790.2); Has 147 Blast hits to 135 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 147; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G11710AT1G11710.1GCCCAATTGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G01110.1); Has 19625 Blast hits to 5674 proteins in 176 species: Archae - 2; Bacteria - 23; Metazoa - 403; Fungi - 262; Plants - 18143; Viruses - 0; Other Eukaryotes - 792 (source: NCBI BLink).
AT1G11710.1TAATGGGCTCApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G01110.1); Has 19625 Blast hits to 5674 proteins in 176 species: Archae - 2; Bacteria - 23; Metazoa - 403; Fungi - 262; Plants - 18143; Viruses - 0; Other Eukaryotes - 792 (source: NCBI BLink).
AT1G11750AT1G11750.1ATTTGGGCTTATOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G11750.1ATTTGGGCTTATOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G11750.1GTGGGCCTATTOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G11800AT1G11800.1TATATGGGendonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Zinc finger, RanBP2-type (InterPro:IPR001876); Has 273 Blast hits to 263 proteins in 68 species: Archae - 0; Bacteria - 12; Metazoa - 134; Fungi - 10; Plants - 55; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G11870AT1G11870.1TGGGCTCACATGGGCCATASeryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.
AT1G11870.2TGGGCTCACATGGGCCATASeryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.
AT1G11870.3TGGGCTCACATGGGCCATASeryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana.
AT1G11890AT1G11890.1ATAAGCCCAATmember of SEC22 Gene Family
AT1G12000AT1G12000.1AAAAGCCCAAAApyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex, cell wall, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: MEE51 (maternal effect embryo arrest 51); diphosphate-fructose-6-phosphate 1-phosphotransferase (TAIR:AT4G04040.1); Has 3585 Blast hits to 3515 proteins in 1006 species: Archae - 20; Bacteria - 2321; Metazoa - 52; Fungi - 90; Plants - 237; Viruses - 2; Other Eukaryotes - 863 (source: NCBI BLink).
AT1G12000.1AATTGGGCCTTAApyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative; FUNCTIONS IN: diphosphate-fructose-6-phosphate 1-phosphotransferase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: pyrophosphate-dependent phosphofructokinase complex, beta-subunit complex, cell wall, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase PfpB (InterPro:IPR011183), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: MEE51 (maternal effect embryo arrest 51); diphosphate-fructose-6-phosphate 1-phosphotransferase (TAIR:AT4G04040.1); Has 3585 Blast hits to 3515 proteins in 1006 species: Archae - 20; Bacteria - 2321; Metazoa - 52; Fungi - 90; Plants - 237; Viruses - 2; Other Eukaryotes - 863 (source: NCBI BLink).
AT1G12010AT1G12010.1CCCAATTAencodes a protein whose sequence is similar to 1-amino-cyclopropane-1-carboxylic acid oxidase
AT1G12010.1CCCAATTAencodes a protein whose sequence is similar to 1-amino-cyclopropane-1-carboxylic acid oxidase
AT1G12090AT1G12090.1TTGGGCTTTTextensin-like protein (ELP)
AT1G12110AT1G12110.1CAAGCCCACEncodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium.
AT1G12310AT1G12310.1AGTTGGGCCTTGcalmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G62820.1); Has 12140 Blast hits to 10293 proteins in 1212 species: Archae - 0; Bacteria - 26; Metazoa - 5264; Fungi - 3120; Plants - 2025; Viruses - 0; Other Eukaryotes - 1705 (source: NCBI BLink).
AT1G12310.1TAAATGGGCCAcalmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G62820.1); Has 12140 Blast hits to 10293 proteins in 1212 species: Archae - 0; Bacteria - 26; Metazoa - 5264; Fungi - 3120; Plants - 2025; Viruses - 0; Other Eukaryotes - 1705 (source: NCBI BLink).
AT1G12320AT1G12320.1GGGCCATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1442 (InterPro:IPR009902); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62840.1); Has 43 Blast hits to 43 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G12390AT1G12390.1AGAGGCCCAATGcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT1G12390.1GCCCAAACcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT1G12390.1TAATTGGGCTAAcornichon family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular signaling cascade; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Cornichon (InterPro:IPR003377); BEST Arabidopsis thaliana protein match is: cornichon family protein (TAIR:AT1G62880.1); Has 466 Blast hits to 466 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 278; Fungi - 110; Plants - 42; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT1G12570AT1G12570.1CTATTGGGglucose-methanol-choline (GMC) oxidoreductase family protein; FUNCTIONS IN: aldehyde-lyase activity, oxidoreductase activity, acting on CH-OH group of donors, FAD binding; INVOLVED IN: cellular alcohol metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Glucose-methanol-choline oxidoreductase, N-terminal (InterPro:IPR000172), Glucose-methanol-choline oxidoreductase (InterPro:IPR012132), Glucose-methanol-choline oxidoreductase, C-terminal (InterPro:IPR007867); BEST Arabidopsis thaliana protein match is: glucose-methanol-choline (GMC) oxidoreductase family protein (TAIR:AT5G51950.1); Has 8149 Blast hits to 8036 proteins in 676 species: Archae - 2; Bacteria - 2324; Metazoa - 714; Fungi - 1044; Plants - 126; Viruses - 12; Other Eukaryotes - 3927 (source: NCBI BLink).
AT1G12730AT1G12730.1AGCCCAACAcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT1G12730.1GGGCCCTAAGCCCcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT1G12730.2AGCCCAACAcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT1G12730.2GGGCCCTAAGCCCcell division cycle protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI transamidase subunit PIG-U (InterPro:IPR009600); BEST Arabidopsis thaliana protein match is: cell division cycle protein-related (TAIR:AT1G63110.1); Has 250 Blast hits to 246 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 79; Plants - 31; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT1G12760AT1G12760.1ACGGGCCTTTTprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).
AT1G12760.1GTGGCCCATTTAprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).
AT1G12760.2ACGGGCCTTTTprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).
AT1G12760.2GTGGCCCATTTAprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).
AT1G12780AT1G12780.1AGCCCACTEncodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress.
AT1G12800AT1G12800.1AGCCCAATS1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink).
AT1G12800.1CTATTGGGCCAATTTTAGGCCCATGS1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: S1 RNA-binding domain-containing protein (TAIR:AT3G23700.1); Has 11447 Blast hits to 6135 proteins in 1348 species: Archae - 6; Bacteria - 6604; Metazoa - 236; Fungi - 109; Plants - 97; Viruses - 3; Other Eukaryotes - 4392 (source: NCBI BLink).
AT1G12810AT1G12810.1ATAGGCCCAATAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.
AT1G12810.1ATCGGCCCAAATCCAATAAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.
AT1G12810.2ATAGGCCCAATAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.
AT1G12810.2ATCGGCCCAAATCCAATAAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages.
AT1G12830AT1G12830.1TAAATGGGCTAATACTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink).
AT1G12840AT1G12840.1TTGGCCCAGTATTAGCCCATTTAEncodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8.
AT1G12850AT1G12850.1GTTTGGGCCGGGTCGphosphoglycerate/bisphosphoglycerate mutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: N-terminal protein myristoylation, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate mutase (InterPro:IPR013078), Uncharacterised conserved protein UCP036920, phosphoglycerate mutase, plant X4/Y4 (InterPro:IPR017070); BEST Arabidopsis thaliana protein match is: catalytic (TAIR:AT3G26780.1); Has 1266 Blast hits to 1214 proteins in 304 species: Archae - 4; Bacteria - 504; Metazoa - 376; Fungi - 31; Plants - 127; Viruses - 2; Other Eukaryotes - 222 (source: NCBI BLink).
AT1G12900AT1G12900.1GAAGCCCAAGLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).
AT1G12900.1GAAGCCCATGLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).
AT1G12900.2GAAGCCCAAGLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).
AT1G12900.2GAAGCCCATGLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).
AT1G12900.3GAAGCCCAAGLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).
AT1G12900.3GAAGCCCATGLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT 2 (GAPA-2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, glyceraldehyde-3-phosphate dehydrogenase activity, catalytic activity; INVOLVED IN: glycolysis, glucose metabolic process, metabolic process; LOCATED IN: apoplast, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPA (GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE A SUBUNIT); glyceraldehyde-3-phosphate dehydrogenase/ protein binding (TAIR:AT3G26650.1); Has 17333 Blast hits to 17327 proteins in 3916 species: Archae - 27; Bacteria - 6603; Metazoa - 1325; Fungi - 1881; Plants - 2522; Viruses - 0; Other Eukaryotes - 4975 (source: NCBI BLink).
AT1G12920AT1G12920.1ATAAAGCCCATTAGEncodes a eukaryotic release factor one homolog.
AT1G12920.1TAATTGGGCCTTTTEncodes a eukaryotic release factor one homolog.
AT1G12990AT1G12990.1ATTGGCCCglycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G67880.1); Has 972 Blast hits to 971 proteins in 58 species: Archae - 0; Bacteria - 24; Metazoa - 46; Fungi - 23; Plants - 68; Viruses - 4; Other Eukaryotes - 807 (source: NCBI BLink).
AT1G13000AT1G13000.1TGAGCCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G13000.2TGAGCCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF707 (InterPro:IPR007877); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26440.2); Has 194 Blast hits to 193 proteins in 14 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G13030AT1G13030.1ATATGGGCTTAAATGGGCTTTAAATAAGGCCCAATsphere organelles protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; Has 13894 Blast hits to 8686 proteins in 584 species: Archae - 12; Bacteria - 813; Metazoa - 5398; Fungi - 1230; Plants - 486; Viruses - 98; Other Eukaryotes - 5857 (source: NCBI BLink).
AT1G13060AT1G13060.1AGCCCAATATEncodes 20S proteasome beta subunit PBE1 (PBE1).
AT1G13060.1ATCGGCCCATTAAEncodes 20S proteasome beta subunit PBE1 (PBE1).
AT1G13060.1TATGGCCCATATEncodes 20S proteasome beta subunit PBE1 (PBE1).
AT1G13090AT1G13090.1ATTTGGGCCTAAACCCATTAGputative cytochrome P450
AT1G13090.1CATTGGGCCCATAAputative cytochrome P450
AT1G13120AT1G13120.1GGCCTTTTTAGGCCCAATembryo defective 1745 (emb1745); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nuclear pore; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GLE1-like (InterPro:IPR012476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G05523.1); Has 32122 Blast hits to 20275 proteins in 1392 species: Archae - 166; Bacteria - 5743; Metazoa - 12337; Fungi - 2633; Plants - 1041; Viruses - 221; Other Eukaryotes - 9981 (source: NCBI BLink).
AT1G13180AT1G13180.1TCAGCCCAGTAMutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype.
AT1G13220AT1G13220.1CATTGGGCTTTTEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13220.1TTTAGGCCCAAAAEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13220.2CATTGGGCTTTTEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13220.2TTTAGGCCCAAAAEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13270AT1G13270.1CAAGCCCAATGGGCTTTAAEncodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C.
AT1G13270.2CAAGCCCAATGGGCTTTAAEncodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C.
AT1G13320AT1G13320.1CTAATGGGone of three genes encoding the 65 kDa regulatory subunit of protein phosphatase 2A (PP2A)
AT1G13320.2CTAATGGGone of three genes encoding the 65 kDa regulatory subunit of protein phosphatase 2A (PP2A)
AT1G13330AT1G13330.1TAAAGGCCCATATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink).
AT1G13330.1TAAATGGGCTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink).
AT1G13330.1TAATTGGGCCTGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink).
AT1G13340AT1G13340.1GCCCAAAAunknown protein; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 416 Blast hits to 416 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 148; Fungi - 88; Plants - 145; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT1G13350AT1G13350.1AGCCCAAAAGGCCCAAAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink).
AT1G13350.1ATGGCCCATGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G53640.1); Has 80312 Blast hits to 71745 proteins in 1717 species: Archae - 65; Bacteria - 5105; Metazoa - 38133; Fungi - 9588; Plants - 8768; Viruses - 394; Other Eukaryotes - 18259 (source: NCBI BLink).
AT1G13380AT1G13380.1ATTTGGGCTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27435.1); Has 150 Blast hits to 150 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13380.1TTAGCCCATCAAGCCCATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1218 (InterPro:IPR009606); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27435.1); Has 150 Blast hits to 150 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 150; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13390AT1G13390.1AGTGGGCTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68490.1); Has 53 Blast hits to 53 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13390.2AGTGGGCTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68490.1); Has 53 Blast hits to 53 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13440AT1G13440.1CCGGCCCAGCCCATAGLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C2 (GAPC2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, catalytic activity, glyceraldehyde-3-phosphate dehydrogenase activity; INVOLVED IN: response to oxidative stress, response to cadmium ion, gluconeogenesis, defense response to bacterium, glycolysis; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPC1 (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)/ glyceraldehyde-3-phosphate dehydrogenase (TAIR:AT3G04120.1); Has 17650 Blast hits to 17639 proteins in 4048 species: Archae - 58; Bacteria - 6630; Metazoa - 1441; Fungi - 1939; Plants - 2582; Viruses - 0; Other Eukaryotes - 5000 (source: NCBI BLink).
AT1G13440.2CCGGCCCAGCCCATAGLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C2 (GAPC2); FUNCTIONS IN: NAD or NADH binding, glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity, binding, catalytic activity, glyceraldehyde-3-phosphate dehydrogenase activity; INVOLVED IN: response to oxidative stress, response to cadmium ion, gluconeogenesis, defense response to bacterium, glycolysis; LOCATED IN: in 8 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glyceraldehyde 3-phosphate dehydrogenase (InterPro:IPR000173), Glyceraldehyde-3-phosphate dehydrogenase, type I (InterPro:IPR006424), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GAPC1 (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE C SUBUNIT 1); glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)/ glyceraldehyde-3-phosphate dehydrogenase (TAIR:AT3G04120.1); Has 17650 Blast hits to 17639 proteins in 4048 species: Archae - 58; Bacteria - 6630; Metazoa - 1441; Fungi - 1939; Plants - 2582; Viruses - 0; Other Eukaryotes - 5000 (source: NCBI BLink).
AT1G13560AT1G13560.1CAAAGCCCEncodes aminoalcoholphosphotransferase AAPT1.
AT1G13560.2CAAAGCCCEncodes aminoalcoholphosphotransferase AAPT1.
AT1G13690AT1G13690.1AAAAAGCCCATTTAAtE1 - stimulates the ATPase activity of DnaK/DnaJ
AT1G13690.1TATATGGGAtE1 - stimulates the ATPase activity of DnaK/DnaJ
AT1G13690.1TTATTGGGCCAATAtE1 - stimulates the ATPase activity of DnaK/DnaJ
AT1G13690.1TTATTGGGCCGACCCGAtE1 - stimulates the ATPase activity of DnaK/DnaJ
AT1G13900AT1G13900.1GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATAcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G13910AT1G13910.1TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTACleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink).
AT1G13950AT1G13950.1GGCTTTAAAGCCCATAEncodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced.
AT1G13970AT1G13970.1CCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29180.1); Has 129 Blast hits to 129 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 114; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G14010AT1G14010.1CCCAATTAemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).
AT1G14010.1TTAAAGCCCAATTemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).
AT1G14010.1TTAATGGGCCTTAAemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: guard cell, callus; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 family protein (TAIR:AT1G26690.1); Has 1149 Blast hits to 1147 proteins in 172 species: Archae - 0; Bacteria - 0; Metazoa - 587; Fungi - 291; Plants - 154; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).
AT1G14030AT1G14030.1ATAATGGGCCTTTAAribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 838 Blast hits to 833 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 218; Plants - 233; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).
AT1G14080AT1G14080.1CCCATTAGmember of Xyloglucan fucosyltransferase family
AT1G14140AT1G14140.1CATGGGCCCATAAmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).
AT1G14140.1TTAAAGCCCAATATmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink).
AT1G14250AT1G14250.1ATCGGCCCACAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14240.4); Has 1087 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 20; Metazoa - 530; Fungi - 212; Plants - 197; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G14270AT1G14270.1TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14270.1TTAATGGGCTTTGGGCCTATACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14270.2TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14270.2TTAATGGGCTTTGGGCCTATACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14270.3TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14270.3TTAATGGGCTTTGGGCCTATACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14270.4TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14270.4TTAATGGGCTTTGGGCCTATACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT1G14320AT1G14320.1GATGGGCCCTAEncodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself.
AT1G14320.1TTAAAGCCCATTAGEncodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself.
AT1G14320.2GATGGGCCCTAEncodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself.
AT1G14320.2TTAAAGCCCATTAGEncodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself.
AT1G14340AT1G14340.1ATATGGGCTAARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / oxidoreductase (TAIR:AT3G01210.1); Has 201 Blast hits to 201 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 59; Plants - 135; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14340.1CATTGGGCCTTTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / oxidoreductase (TAIR:AT3G01210.1); Has 201 Blast hits to 201 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 59; Plants - 135; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14340.1TTAAAGGCCCAACARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / oxidoreductase (TAIR:AT3G01210.1); Has 201 Blast hits to 201 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 59; Plants - 135; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14360AT1G14360.1TTAAGGCCCAAGUDP-GALACTOSE TRANSPORTER 3 (UTR3); FUNCTIONS IN: pyrimidine nucleotide sugar transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: UTR1 (UDP-GALACTOSE TRANSPORTER 1); UDP-galactose transmembrane transporter/ UDP-glucose transmembrane transporter/ pyrimidine nucleotide sugar transmembrane transporter (TAIR:AT2G02810.1); Has 750 Blast hits to 744 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 423; Fungi - 103; Plants - 108; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).
AT1G14380AT1G14380.1TAATTGGGCCCAGAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).
AT1G14380.2TAATTGGGCCCAGAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).
AT1G14380.3TAATTGGGCCCAGAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).
AT1G14420AT1G14420.1CTATTGGGAT59; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase, N-terminal (InterPro:IPR007524), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT2G02720.1); Has 935 Blast hits to 930 proteins in 165 species: Archae - 0; Bacteria - 369; Metazoa - 0; Fungi - 157; Plants - 399; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G14420.1TAATTGGGAT59; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase, N-terminal (InterPro:IPR007524), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT2G02720.1); Has 935 Blast hits to 930 proteins in 165 species: Archae - 0; Bacteria - 369; Metazoa - 0; Fungi - 157; Plants - 399; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G14450AT1G14450.1GAAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G14450.1GAAGCCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G14450.1TTAAAGCCCATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G14450.1TTAAAGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G14490AT1G14490.1AAAGGCCCATCDNA-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT5G49700.1); Has 415 Blast hits to 414 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 415; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G14560AT1G14560.1GTTTGGGCTAAmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Graves disease carrier protein (InterPro:IPR002167); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT4G26180.1); Has 18676 Blast hits to 9940 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 9411; Fungi - 4887; Plants - 2588; Viruses - 0; Other Eukaryotes - 1790 (source: NCBI BLink).
AT1G14650AT1G14650.1GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G14650.2GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G14770AT1G14770.1CCAGGCCCAATAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G14770.1GTAAGGCCCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G14770.1TACGGCCCAATATprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G14770.2CCAGGCCCAATAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G14770.2GTAAGGCCCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G14770.2TACGGCCCAATATprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger protein-related (TAIR:AT1G68030.1); Has 45 Blast hits to 42 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 7; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G14820AT1G14820.1GCCCATTAASEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).
AT1G14820.2GCCCATTAASEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).
AT1G14820.3GCCCATTAASEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative (TAIR:AT1G01630.1); Has 1147 Blast hits to 1147 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 327; Fungi - 313; Plants - 357; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).
AT1G14830AT1G14830.1TTATTGGGEncodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts.
AT1G14940AT1G14940.1TATATGGGmajor latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT1G14930.1); Has 223 Blast hits to 201 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 223; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G14980AT1G14980.1TATAGGCCCAAACEncodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs.
AT1G14980.1TGAGGCCCATTAAEncodes mitochondrial-localized chaperonin 10 that complements the E.coli groES mutant. Its mRNA is upregulated in response to heat shock treatment and is expressed uniformly in various organs.
AT1G14990AT1G14990.1ATAGGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G14990.1TTATTGGGCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15000AT1G15000.1TATGGGCCTATserine carboxypeptidase-like 50 (scpl50); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2538 Blast hits to 2426 proteins in 320 species: Archae - 0; Bacteria - 215; Metazoa - 624; Fungi - 565; Plants - 842; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink).
AT1G15000.1TTCGGCCCAATAAserine carboxypeptidase-like 50 (scpl50); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2538 Blast hits to 2426 proteins in 320 species: Archae - 0; Bacteria - 215; Metazoa - 624; Fungi - 565; Plants - 842; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink).
AT1G15010AT1G15010.1TTAATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01300.1); Has 43 Blast hits to 42 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15020AT1G15020.1ATAAAGCCCAGTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.
AT1G15020.1TAATGGGCCTATAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.
AT1G15020.1TTTTGGGCGGGTCAAAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.
AT1G15020.2ATAAAGCCCAGTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.
AT1G15020.2TAATGGGCCTATAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.
AT1G15020.2TTTTGGGCGGGTCAAAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.
AT1G15060AT1G15060.1ATTTGGGCTTTTLOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase, At1g15070 (InterPro:IPR016969); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73750.1); Has 120 Blast hits to 104 proteins in 29 species: Archae - 0; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G15060.1TGGCCCAAAALOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP031088, alpha/beta hydrolase, At1g15070 (InterPro:IPR016969); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73750.1); Has 120 Blast hits to 104 proteins in 29 species: Archae - 0; Bacteria - 61; Metazoa - 1; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G15110AT1G15110.1GGGCCTAAAphosphatidyl serine synthase family protein; FUNCTIONS IN: CDP-diacylglycerol-serine O-phosphatidyltransferase activity; INVOLVED IN: phosphatidylserine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidyl serine synthase (InterPro:IPR004277); Has 247 Blast hits to 246 proteins in 87 species: Archae - 0; Bacteria - 0; Metazoa - 158; Fungi - 4; Plants - 30; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G15110.2GGGCCTAAAphosphatidyl serine synthase family protein; FUNCTIONS IN: CDP-diacylglycerol-serine O-phosphatidyltransferase activity; INVOLVED IN: phosphatidylserine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidyl serine synthase (InterPro:IPR004277); Has 247 Blast hits to 246 proteins in 87 species: Archae - 0; Bacteria - 0; Metazoa - 158; Fungi - 4; Plants - 30; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G15120AT1G15120.1CAAAGGCCCAAATubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1).
AT1G15120.1GAATGGGCTTTTAubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1).
AT1G15120.1TTAATGGGCTTTTAubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT2G01090.1).
AT1G15125AT1G15125.1TATGGCCCS-adenosylmethionine-dependent methyltransferase/ methyltransferase; FUNCTIONS IN: S-adenosylmethionine-dependent methyltransferase activity, methyltransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: SAM dependent carboxyl methyltransferase (InterPro:IPR005299); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine:carboxyl methyltransferase family protein (TAIR:AT1G68040.1); Has 579 Blast hits to 569 proteins in 97 species: Archae - 0; Bacteria - 48; Metazoa - 12; Fungi - 3; Plants - 445; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT1G15210AT1G15210.1CATGGGCCATPLEIOTROPIC DRUG RESISTANCE 7 (PDR7); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: multidrug transport; LOCATED IN: plasma membrane, chloroplast, membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 (InterPro:IPR000412), Plant PDR ABC transporter associated (InterPro:IPR013581), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: PEN3 (PENETRATION 3); ATPase, coupled to transmembrane movement of substances / cadmium ion transmembrane transporter (TAIR:AT1G59870.1); Has 219007 Blast hits to 166393 proteins in 2528 species: Archae - 4373; Bacteria - 156456; Metazoa - 8068; Fungi - 4637; Plants - 3146; Viruses - 4; Other Eukaryotes - 42323 (source: NCBI BLink).
AT1G15215AT1G15215.1TAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15215.1TTTAGGCCCATTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15215.2TAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15215.2TTTAGGCCCATTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15215.3TAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15215.3TTTAGGCCCATTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15220AT1G15220.1CAAGGCCCATGEncodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2.
AT1G15220.2CAAGGCCCATGEncodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2.
AT1G15230AT1G15230.1GGGCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15230.1TTGGGCTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15240AT1G15240.1AATAGCCCphox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1).
AT1G15240.1TGAGCCCAAphox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1).
AT1G15240.2AATAGCCCphox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1).
AT1G15240.2TGAGCCCAAphox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: PX-associated, sorting nexin 13 (InterPro:IPR013996), Sorting nexin, C-terminal (InterPro:IPR013937), Phox-like (InterPro:IPR001683), Phox-associated domain (InterPro:IPR003114); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT2G15900.1).
AT1G15250AT1G15250.1CCAGGCCCATGAAGCCCATTAAGAAGCCCATAT60S ribosomal protein L37 (RPL37A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331), Ribosomal protein L37e (InterPro:IPR001569); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37C) (TAIR:AT3G16080.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink).
AT1G15260AT1G15260.1CATGGGCCTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16070.1); Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15270AT1G15270.1AGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G15270.1GGCCTTTTAATGGGCCATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G15270.1TTTAACGGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G15280AT1G15280.1TAAATGGGCTglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.1TATGGCCCATTAAAAGGCCglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.1TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.2TAAATGGGCTglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.2TATGGCCCATTAAAAGGCCglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.2TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15310AT1G15310.1CATTGGGCCTGT54 kDa protein subunit of SRP that interacts with the signal peptide of secreted proteins
AT1G15330AT1G15330.1CTAAGGCCCAATGCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G15330.1TACTGGGCCGTTCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G15370AT1G15370.1TAATTACGAAAAGGCCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); Has 48 Blast hits to 48 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 39; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G15380AT1G15380.1CCCATTAAlactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).
AT1G15380.2CCCATTAAlactoylglutathione lyase family protein / glyoxalase I family protein; FUNCTIONS IN: lactoylglutathione lyase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Glyoxalase/bleomycin resistance protein/dioxygenase (InterPro:IPR004360); BEST Arabidopsis thaliana protein match is: lactoylglutathione lyase family protein / glyoxalase I family protein (TAIR:AT1G80160.1); Has 483 Blast hits to 483 proteins in 168 species: Archae - 1; Bacteria - 286; Metazoa - 3; Fungi - 2; Plants - 125; Viruses - 0; Other Eukaryotes - 66 (source: NCBI BLink).
AT1G15420AT1G15420.1GAGCCCAACTATTGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function NUC189, C-terminal (InterPro:IPR012979); Has 698 Blast hits to 572 proteins in 149 species: Archae - 0; Bacteria - 42; Metazoa - 236; Fungi - 117; Plants - 61; Viruses - 27; Other Eukaryotes - 215 (source: NCBI BLink).
AT1G15420.1TAAGTCGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function NUC189, C-terminal (InterPro:IPR012979); Has 698 Blast hits to 572 proteins in 149 species: Archae - 0; Bacteria - 42; Metazoa - 236; Fungi - 117; Plants - 61; Viruses - 27; Other Eukaryotes - 215 (source: NCBI BLink).
AT1G15440AT1G15440.1GAAGCCCATATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15440.1GCCCAACAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15440.1TTGGGCTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15440.2GAAGCCCATATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15440.2GCCCAACAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15440.2TTGGGCTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink).
AT1G15460AT1G15460.1AGTTGGGCEncodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions.
AT1G15460.1GTAGGCCCAACAEncodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions.
AT1G15460.1TAAATGGGCCCTEncodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions.
AT1G15470AT1G15470.1ATAAGCCCtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G15610.1); Has 30729 Blast hits to 16551 proteins in 545 species: Archae - 52; Bacteria - 4851; Metazoa - 13118; Fungi - 6378; Plants - 2293; Viruses - 0; Other Eukaryotes - 4037 (source: NCBI BLink).
AT1G15720AT1G15720.1ATAATGGGCCGArabidopsis thaliana myb family transcription factor (At1g15720)
AT1G15720.1TTATGGGCCGATArabidopsis thaliana myb family transcription factor (At1g15720)
AT1G15750AT1G15750.1GCCCAAACEncodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background.
AT1G15750.2GCCCAAACEncodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background.
AT1G15750.3GCCCAAACEncodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background.
AT1G15750.4GCCCAAACEncodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background.
AT1G15810AT1G15810.1AATTGGGCCTTTTribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink).
AT1G15810.1GGGCTTTGribosomal protein S15 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15 (InterPro:IPR000589), Ribosomal protein S15, bacterial-type (InterPro:IPR005290), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ribosomal protein S15 family protein (TAIR:AT1G80620.1); Has 5651 Blast hits to 5651 proteins in 1607 species: Archae - 0; Bacteria - 3067; Metazoa - 94; Fungi - 81; Plants - 397; Viruses - 0; Other Eukaryotes - 2012 (source: NCBI BLink).
AT1G15870AT1G15870.1AGTGGGCTmitochondrial glycoprotein family protein / MAM33 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrial matrix; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT1G80720.1); Has 278 Blast hits to 278 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 81; Plants - 116; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT1G15920AT1G15920.1ATTTGGGCCCR4-NOT transcription complex protein, putative; FUNCTIONS IN: ribonuclease activity, nucleic acid binding; INVOLVED IN: RNA modification; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease CAF1 (InterPro:IPR006941), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: CCR4-NOT transcription complex protein, putative (TAIR:AT2G32070.1); Has 634 Blast hits to 622 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 94; Plants - 224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).
AT1G15920.2ATTTGGGCCCR4-NOT transcription complex protein, putative; FUNCTIONS IN: ribonuclease activity, nucleic acid binding; INVOLVED IN: RNA modification; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribonuclease CAF1 (InterPro:IPR006941), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: CCR4-NOT transcription complex protein, putative (TAIR:AT2G32070.1); Has 634 Blast hits to 622 proteins in 156 species: Archae - 0; Bacteria - 0; Metazoa - 218; Fungi - 94; Plants - 224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).
AT1G15930AT1G15930.1AGCCCAATTAATAGGCCCATTTAAGCCCAAAT40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).
AT1G15930.2AGCCCAATTAATAGGCCCATTTAAGCCCAAAT40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink).
AT1G16000AT1G16000.1TGATGGGCCATAATAAGGCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80890.1); Has 24 Blast hits to 23 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G16030AT1G16030.1AAAAGCCCheat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink).
AT1G16030.1ACGGGCCTACheat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink).
AT1G16030.1ACTGGGCCTTTTheat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink).
AT1G16030.1ATATGGGCTTTAATAGGCCCATTTAheat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink).
AT1G16040AT1G16040.1AAAAGGCCCAGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G16040.1GTAGGCCCGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G16040.1TAAATGGGCCTATTAAAGCCCATATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G16060AT1G16060.1GGGCCGTAovule development protein, putative; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: organ morphogenesis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: ovule development protein, putative (TAIR:AT1G79700.2); Has 4033 Blast hits to 3000 proteins in 193 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 3968; Viruses - 2; Other Eukaryotes - 57 (source: NCBI BLink).
AT1G16060.2GGGCCGTAovule development protein, putative; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: organ morphogenesis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: ovule development protein, putative (TAIR:AT1G79700.2); Has 4033 Blast hits to 3000 proteins in 193 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 3968; Viruses - 2; Other Eukaryotes - 57 (source: NCBI BLink).
AT1G16110AT1G16110.1GGGCTTTGWAK-like kinase
AT1G16130AT1G16130.1TGTGGGCCwall-associated kinase like
AT1G16180AT1G16180.1AAAAGCCCATTMS membrane family protein / tumour differentially expressed (TDE) family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TMS membrane protein/tumour differentially expressed protein (InterPro:IPR005016); BEST Arabidopsis thaliana protein match is: TMS membrane family protein / tumour differentially expressed (TDE) family protein (TAIR:AT3G06170.1); Has 608 Blast hits to 602 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 87; Plants - 80; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink).
AT1G16180.1ATTTGGGCCATTAGTGGGCCAATMS membrane family protein / tumour differentially expressed (TDE) family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TMS membrane protein/tumour differentially expressed protein (InterPro:IPR005016); BEST Arabidopsis thaliana protein match is: TMS membrane family protein / tumour differentially expressed (TDE) family protein (TAIR:AT3G06170.1); Has 608 Blast hits to 602 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 87; Plants - 80; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink).
AT1G16180.1CCCAATAGTMS membrane family protein / tumour differentially expressed (TDE) family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TMS membrane protein/tumour differentially expressed protein (InterPro:IPR005016); BEST Arabidopsis thaliana protein match is: TMS membrane family protein / tumour differentially expressed (TDE) family protein (TAIR:AT3G06170.1); Has 608 Blast hits to 602 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 87; Plants - 80; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink).
AT1G16210AT1G16210.1TTGGGCTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1014 (InterPro:IPR010422); Has 15664 Blast hits to 7512 proteins in 781 species: Archae - 22; Bacteria - 2461; Metazoa - 4728; Fungi - 1475; Plants - 417; Viruses - 118; Other Eukaryotes - 6443 (source: NCBI BLink).
AT1G16390AT1G16390.1CCCATTAAARABIDOPSIS THALIANA ORGANIC CATION/CARNITINE TRANSPORTER 3 (ATOCT3); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ATOCT2 (ARABIDOPSIS THALIANA ORGANIC CATION/CARNITINE TRANSPORTER 2); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G79360.1); Has 14668 Blast hits to 14637 proteins in 1162 species: Archae - 220; Bacteria - 6088; Metazoa - 3985; Fungi - 2765; Plants - 929; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G16410AT1G16410.1AAAAGCCCAAACmember of CYP79F
AT1G16410.2AAAAGCCCAAACmember of CYP79F
AT1G16430AT1G16430.1TTAAGGCCCAATAGsurfeit locus protein 5 family protein / SURF5 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Surfeit locus 5 (InterPro:IPR009332); BEST Arabidopsis thaliana protein match is: surfeit locus protein 5 family protein / SURF5 family protein (TAIR:AT1G07950.1); Has 176 Blast hits to 176 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 4; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G16445AT1G16445.1ATAAAGCCCAATATmethylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G16445.1CTATTGGGCCGAAmethylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G16570AT1G16570.1CATGGGCCTAACglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).
AT1G16570.1GGGCCCAATTAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).
AT1G16570.2CATGGGCCTAACglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).
AT1G16570.2GGGCCCAATTAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).
AT1G16590AT1G16590.1GTTAGGCCCATGputative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).
AT1G16590.1TAATTGGGCCCputative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).
AT1G16740AT1G16740.1TAAAGGCCCAGTAribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).
AT1G16740.1TAGTGGGCTTTGribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).
AT1G16790AT1G16790.1ATAAGCCCribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G16790.1TGGGCCCAAGCCCAACAribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G16810AT1G16810.1ATATTGGGCCCTATTGGGCTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G16810.1CAAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G16810.2ATATTGGGCCCTATTGGGCTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G16810.2CAAAGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT1G16870AT1G16870.1ATTGGCCCmitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT1G16870.1GGCCTTTATGGCCCAAACmitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT1G16870.1TCAGCCCACTmitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT1G16870.1TTAATGGGCCTAACmitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT1G16880AT1G16880.1GGGCCAATuridylyltransferase-related; INVOLVED IN: response to cold; LOCATED IN: chloroplast thylakoid membrane, stromule, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ACT domain-containing protein (TAIR:AT5G04740.1); Has 304 Blast hits to 276 proteins in 50 species: Archae - 0; Bacteria - 70; Metazoa - 0; Fungi - 0; Plants - 178; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT1G16880.2GGGCCAATuridylyltransferase-related; INVOLVED IN: response to cold; LOCATED IN: chloroplast thylakoid membrane, stromule, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ACT domain-containing protein (TAIR:AT5G04740.1); Has 304 Blast hits to 276 proteins in 50 species: Archae - 0; Bacteria - 70; Metazoa - 0; Fungi - 0; Plants - 178; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT1G16900AT1G16900.1ATAAGCCCATTATcurculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein
AT1G16900.1ATAATGGGCTTAcurculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein
AT1G16920AT1G16920.1ACACGCGCCCAATAGsmall GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking.
AT1G16970AT1G16970.1CCCAATAAKu80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity.
AT1G16970.1GTGGCCCAATAAKu80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity.
AT1G16970.1TTGGCCCAATAAKu80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity.
AT1G16970.1TTTTGGGCCTAACKu80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity.
AT1G17070AT1G17070.1ATAAAGCCCAAGTCGGTTD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G17070.1TAAATGGGCCTTTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G17070.1TAAATGGGCTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G17080AT1G17080.1GGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53560.1); Has 71 Blast hits to 71 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 71; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17130AT1G17130.1CAAGCCCAAAAAAGCCCcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink).
AT1G17130.2CAAGCCCAAAAAAGCCCcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink).
AT1G17190AT1G17190.1CCCAATAAEncodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G17210AT1G17210.1CTATTGGGCTCzinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).
AT1G17210.1TAAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).
AT1G17220AT1G17220.1GAGCCCAATAGEncodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal.
AT1G17220.1TAAATGGGCTTTAEncodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal.
AT1G17340AT1G17340.1GCCCAAAAphosphoinositide phosphatase family protein; FUNCTIONS IN: phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synaptojanin, N-terminal (InterPro:IPR002013); BEST Arabidopsis thaliana protein match is: phosphoinositide phosphatase family protein (TAIR:AT3G14205.1); Has 1218 Blast hits to 1174 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 466; Fungi - 372; Plants - 143; Viruses - 0; Other Eukaryotes - 237 (source: NCBI BLink).
AT1G17370AT1G17370.1ATTGGGCCTGAoligouridylate binding protein 1B (UBP1B); FUNCTIONS IN: mRNA 3'-UTR binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: oligouridylate-binding protein, putative (TAIR:AT3G14100.1); Has 17907 Blast hits to 12570 proteins in 534 species: Archae - 0; Bacteria - 870; Metazoa - 10427; Fungi - 2031; Plants - 2891; Viruses - 0; Other Eukaryotes - 1688 (source: NCBI BLink).
AT1G17370.2ATTGGGCCTGAoligouridylate binding protein 1B (UBP1B); FUNCTIONS IN: mRNA 3'-UTR binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: oligouridylate-binding protein, putative (TAIR:AT3G14100.1); Has 17907 Blast hits to 12570 proteins in 534 species: Archae - 0; Bacteria - 870; Metazoa - 10427; Fungi - 2031; Plants - 2891; Viruses - 0; Other Eukaryotes - 1688 (source: NCBI BLink).
AT1G17380AT1G17380.1CTTATTGGGJASMONATE-ZIM-DOMAIN PROTEIN 5 (JAZ5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to jasmonic acid stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ6 (JASMONATE-ZIM-DOMAIN PROTEIN 6) (TAIR:AT1G72450.1); Has 172 Blast hits to 167 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17455AT1G17455.1GGGCCGTTTTELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G17455.2GGGCCGTTTTELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G17560AT1G17560.1CAAAGCCCACMutant shows abnormal ovule development
AT1G17560.1TATGGCCCMutant shows abnormal ovule development
AT1G17620AT1G17620.1CCCATTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11890.1); Has 539 Blast hits to 538 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 539; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17690AT1G17690.1ATATTGGGCCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink).
AT1G17690.1CAAGGCCCATTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink).
AT1G17710AT1G17710.1CCCATATAphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G17710.2CCCATATAphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT1G17760AT1G17760.1CTAGGCCCGTEncodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit.
AT1G17760.1TTAATGGGCCAAEncodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit.
AT1G17780AT1G17780.1ATTTGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16575.1); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17780.2ATTTGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16575.1); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G17820AT1G17820.1CCCATTAAphosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT1G73200.1); Has 444 Blast hits to 309 proteins in 108 species: Archae - 0; Bacteria - 7; Metazoa - 132; Fungi - 162; Plants - 27; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).
AT1G17880AT1G17880.1ATTGGCCCAGTnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G17880.1GCCCAGTAnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G17880.1TTTTGGGCCTTATGGGCCAATnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G17890AT1G17890.1AAATGGGCGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).
AT1G17890.1TTTAGGCCCATGGGCCAGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).
AT1G17890.2AAATGGGCGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).
AT1G17890.2TTTAGGCCCATGGGCCAGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).
AT1G17890.3AAATGGGCGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).
AT1G17890.3TTTAGGCCCATGGGCCAGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink).
AT1G17970AT1G17970.1GCCCAAAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G73760.1); Has 6054 Blast hits to 6047 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 2083; Fungi - 451; Plants - 2360; Viruses - 9; Other Eukaryotes - 1151 (source: NCBI BLink).
AT1G17980AT1G17980.1GGGCCTAAAnucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.9); Has 591 Blast hits to 589 proteins in 160 species: Archae - 0; Bacteria - 11; Metazoa - 239; Fungi - 130; Plants - 103; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G18030AT1G18030.1GGGCCTAAAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G25620.1); Has 4082 Blast hits to 4070 proteins in 241 species: Archae - 3; Bacteria - 20; Metazoa - 1276; Fungi - 498; Plants - 1296; Viruses - 9; Other Eukaryotes - 980 (source: NCBI BLink).
AT1G18030.2GGGCCTAAAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT2G25620.1); Has 4082 Blast hits to 4070 proteins in 241 species: Archae - 3; Bacteria - 20; Metazoa - 1276; Fungi - 498; Plants - 1296; Viruses - 9; Other Eukaryotes - 980 (source: NCBI BLink).
AT1G18040AT1G18040.1TAATTGGGCCYCLIN-DEPENDENT KINASE D1;3 (CDKD1;3); FUNCTIONS IN: protein kinase activity, kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: CDKD1;1 (CYCLIN-DEPENDENT KINASE D1;1); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G73690.1); Has 86988 Blast hits to 85857 proteins in 2791 species: Archae - 31; Bacteria - 7397; Metazoa - 37676; Fungi - 8140; Plants - 16874; Viruses - 362; Other Eukaryotes - 16508 (source: NCBI BLink).
AT1G18070AT1G18070.1ATATGGGCCTTEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).
AT1G18070.1CTAAGGCCCATTAGTTGGGCTTTEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).
AT1G18070.2ATATGGGCCTTEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).
AT1G18070.2CTAAGGCCCATTAGTTGGGCTTTEF-1-alpha-related GTP-binding protein, putative; FUNCTIONS IN: translation factor activity, nucleic acid binding, GTP binding, translation release factor activity, GTPase activity; INVOLVED IN: translational termination; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Yeast eukaryotic release factor (InterPro:IPR003285); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 54271 Blast hits to 54210 proteins in 13560 species: Archae - 559; Bacteria - 19088; Metazoa - 14337; Fungi - 8307; Plants - 1150; Viruses - 0; Other Eukaryotes - 10830 (source: NCBI BLink).
AT1G18080AT1G18080.1ATAAGCCCATTAAEncodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene.
AT1G18080.1ATATGGGCTGAEncodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene.
AT1G18080.1TAGCCCATATAEncodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene.
AT1G18080.1TGAGCCCATATEncodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene.
AT1G18160AT1G18160.1CTTATTGGGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G73660.1); Has 89958 Blast hits to 88675 proteins in 3367 species: Archae - 41; Bacteria - 7257; Metazoa - 40465; Fungi - 7352; Plants - 18895; Viruses - 448; Other Eukaryotes - 15500 (source: NCBI BLink).
AT1G18480AT1G18480.1CAAAGCCCAACTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae - 12; Bacteria - 139; Metazoa - 0; Fungi - 17; Plants - 53; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink).
AT1G18480.1CAATGGGCcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae - 12; Bacteria - 139; Metazoa - 0; Fungi - 17; Plants - 53; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink).
AT1G18480.1TTAATGGGCCTACcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: calcineurin-like phosphoesterase family protein (TAIR:AT1G07010.1); Has 433 Blast hits to 431 proteins in 108 species: Archae - 12; Bacteria - 139; Metazoa - 0; Fungi - 17; Plants - 53; Viruses - 3; Other Eukaryotes - 209 (source: NCBI BLink).
AT1G18485AT1G18485.1ATTTGGGCTGApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16634 Blast hits to 4852 proteins in 154 species: Archae - 0; Bacteria - 2; Metazoa - 40; Fungi - 40; Plants - 16325; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink).
AT1G18540AT1G18540.1ATAAGGGCCCATTAG60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT1G18540.1GAAGCCCATAT60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT1G18540.1TTAAAGCCCAATAT60S ribosomal protein L6 (RPL6A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6, N-terminal (InterPro:IPR005568), Ribosomal protein L6E (InterPro:IPR000915); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L6 (RPL6C) (TAIR:AT1G74050.1); Has 549 Blast hits to 548 proteins in 200 species: Archae - 13; Bacteria - 0; Metazoa - 257; Fungi - 97; Plants - 77; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT1G18850AT1G18850.1GCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G19130AT1G19130.1ATATGGGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF985 (InterPro:IPR009327), RmlC-like jelly roll fold (InterPro:IPR014710); Has 778 Blast hits to 778 proteins in 280 species: Archae - 8; Bacteria - 513; Metazoa - 2; Fungi - 16; Plants - 22; Viruses - 0; Other Eukaryotes - 217 (source: NCBI BLink).
AT1G19140AT1G19140.1AAAACGCCCAATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19140.1TAGTGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19140.1TTATGGGCTTTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19140.2AAAACGCCCAATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19140.2TAGTGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19140.2TTATGGGCTTTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19150AT1G19150.1AATTGGGCGTTTTPSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,
AT1G19150.1ATTGGCCCACTAPSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,
AT1G19150.1CAAAGCCCATAAPSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,
AT1G19380AT1G19380.1GGCTTTTAGCCCATunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65650.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G19480AT1G19480.1GGCTGGGCTTTTTHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19480.1GTTTGGGCTTTAAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19480.1TAAAAGCCCATATAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19480.1TTTTGGGCTTTAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19480.2GGCTGGGCTTTTTHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19480.2GTTTGGGCTTTAAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19480.2TAAAAGCCCATATAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19480.2TTTTGGGCTTTAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink).
AT1G19530AT1G19530.1AGTGGGCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, leaf apex, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G19540AT1G19540.1GGGCCGTTCGGTTisoflavone reductase, putative; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: isoflavone reductase, putative (TAIR:AT1G75280.1); Has 1273 Blast hits to 1271 proteins in 317 species: Archae - 2; Bacteria - 478; Metazoa - 4; Fungi - 289; Plants - 363; Viruses - 7; Other Eukaryotes - 130 (source: NCBI BLink).
AT1G19570AT1G19570.1ATGGCCCAEncodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.
AT1G19570.2ATGGCCCAEncodes a member of the dehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.
AT1G19710AT1G19710.1AATAGGCCTTTTAAAGCCCATTATglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink).
AT1G19800AT1G19800.1ATATTGGGCTTTACGGCCCAEncodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.
AT1G19800.2ATATTGGGCTTTACGGCCCAEncodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.
AT1G19800.3ATATTGGGCTTTACGGCCCAEncodes a permease-Like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate.
AT1G19890AT1G19890.1ATTAGGCCCACTGGCCCAGAhistone 3.3, male-gamete-specific expression
AT1G19890.1CCCATTAGhistone 3.3, male-gamete-specific expression
AT1G19920AT1G19920.1AGGGCCCATCTencodes a chloroplast form of ATP sulfurylase
AT1G19920.1TGATGGGCCGAAencodes a chloroplast form of ATP sulfurylase
AT1G20110AT1G20110.1AAAAGCCCAAAAzinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT3G14270.1); Has 25361 Blast hits to 16508 proteins in 676 species: Archae - 11; Bacteria - 1450; Metazoa - 10130; Fungi - 5149; Plants - 3412; Viruses - 575; Other Eukaryotes - 4634 (source: NCBI BLink).
AT1G20110.1TTAATGGGzinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT3G14270.1); Has 25361 Blast hits to 16508 proteins in 676 species: Archae - 11; Bacteria - 1450; Metazoa - 10130; Fungi - 5149; Plants - 3412; Viruses - 575; Other Eukaryotes - 4634 (source: NCBI BLink).
AT1G20160AT1G20160.1GCCCAATTATSBT5.2; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: subtilase family protein (TAIR:AT1G20150.1); Has 5222 Blast hits to 4440 proteins in 781 species: Archae - 163; Bacteria - 2880; Metazoa - 167; Fungi - 492; Plants - 899; Viruses - 0; Other Eukaryotes - 621 (source: NCBI BLink).
AT1G20160.2GCCCAATTATSBT5.2; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: subtilase family protein (TAIR:AT1G20150.1); Has 5222 Blast hits to 4440 proteins in 781 species: Archae - 163; Bacteria - 2880; Metazoa - 167; Fungi - 492; Plants - 899; Viruses - 0; Other Eukaryotes - 621 (source: NCBI BLink).
AT1G20200AT1G20200.1TTTTGGGCTATTEMBRYO DEFECTIVE 2719 (EMB2719); FUNCTIONS IN: enzyme regulator activity; INVOLVED IN: embryonic development ending in seed dormancy, ubiquitin-dependent protein catabolic process; LOCATED IN: plasma membrane, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717), PCI/PINT associated module (InterPro:IPR013143), 26S proteasome regulatory subunit, C-terminal (InterPro:IPR013586); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit S3, putative (RPN3) (TAIR:AT1G75990.1); Has 549 Blast hits to 549 proteins in 160 species: Archae - 0; Bacteria - 0; Metazoa - 253; Fungi - 109; Plants - 101; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT1G20260AT1G20260.1CCCATTTAhydrogen ion transporting ATP synthase, rotational mechanism / hydrolase, acting on acid anhydrides, catalyzing transmembrane movement of substances / proton-transporting ATPase, rotational mechanism; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP metabolic process, ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, chloroplast, vacuole; EXPRESSED IN: cotyledon, male gametophyte, guard cell, cultured cell; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (InterPro:IPR000793), ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (InterPro:IPR004100), ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding (InterPro:IPR000194), ATPase, V1 complex, subunit B (InterPro:IPR005723); BEST Arabidopsis thaliana protein match is: vacuolar ATP synthase subunit B / V-ATPase B subunit / vacuolar proton pump B subunit / V-ATPase 57 kDa subunit (TAIR:AT1G76030.1); Has 27320 Blast hits to 26657 proteins in 6970 species: Archae - 676; Bacteria - 12331; Metazoa - 1302; Fungi - 527; Plants - 6592; Viruses - 0; Other Eukaryotes - 5892 (source: NCBI BLink).
AT1G20340AT1G20340.1CAAAGCCCATTAAGGCCCATTTrecombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.
AT1G20350AT1G20350.1AAATGGGCCTTAATGGGCTTTGmitochondrial inner membrane translocase
AT1G20370AT1G20370.1ATAAGCCCtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G76120.1); Has 2413 Blast hits to 2196 proteins in 790 species: Archae - 88; Bacteria - 1223; Metazoa - 281; Fungi - 214; Plants - 87; Viruses - 0; Other Eukaryotes - 520 (source: NCBI BLink).
AT1G20370.1ATTTGGGCTTAAAGGCCCAATATtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G76120.1); Has 2413 Blast hits to 2196 proteins in 790 species: Archae - 88; Bacteria - 1223; Metazoa - 281; Fungi - 214; Plants - 87; Viruses - 0; Other Eukaryotes - 520 (source: NCBI BLink).
AT1G20430AT1G20430.1AAAAGCCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20430.1CTTATTGGGCTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20460AT1G20460.1ATGGGCTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20460.1GGGCCCAATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20510AT1G20510.1TAAAGGCCCATTATOPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).
AT1G20510.1TTTGGGCTTTTAOPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).
AT1G20510.2TAAAGGCCCATTATOPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).
AT1G20510.2TTTGGGCTTTTAOPC-8:0 COA LIGASE1 (OPCL1); FUNCTIONS IN: 4-coumarate-CoA ligase activity; INVOLVED IN: phenylpropanoid metabolic process, jasmonic acid biosynthetic process, response to wounding; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: 4-coumarate-CoA ligase (TAIR:AT1G20500.1); Has 55786 Blast hits to 51629 proteins in 2281 species: Archae - 597; Bacteria - 29739; Metazoa - 3091; Fungi - 3124; Plants - 1312; Viruses - 1; Other Eukaryotes - 17922 (source: NCBI BLink).
AT1G20540AT1G20540.1ATTGGGCCTGAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae - 0; Bacteria - 624; Metazoa - 3227; Fungi - 1427; Plants - 781; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).
AT1G20540.1GGGCCTAATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae - 0; Bacteria - 624; Metazoa - 3227; Fungi - 1427; Plants - 781; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).
AT1G20540.1GTTAGGCCCATTAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G76260.1); Has 6759 Blast hits to 5575 proteins in 300 species: Archae - 0; Bacteria - 624; Metazoa - 3227; Fungi - 1427; Plants - 781; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).
AT1G20560AT1G20560.1GCCCACTAACYL ACTIVATING ENZYME 1 (AAE1); FUNCTIONS IN: AMP binding; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: AMP-dependent synthetase and ligase family protein (TAIR:AT2G17650.1); Has 51225 Blast hits to 47390 proteins in 2212 species: Archae - 568; Bacteria - 27901; Metazoa - 2931; Fungi - 2228; Plants - 1263; Viruses - 1; Other Eukaryotes - 16333 (source: NCBI BLink).
AT1G20560.2GCCCACTAACYL ACTIVATING ENZYME 1 (AAE1); FUNCTIONS IN: AMP binding; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: AMP-dependent synthetase and ligase family protein (TAIR:AT2G17650.1); Has 51225 Blast hits to 47390 proteins in 2212 species: Archae - 568; Bacteria - 27901; Metazoa - 2931; Fungi - 2228; Plants - 1263; Viruses - 1; Other Eukaryotes - 16333 (source: NCBI BLink).
AT1G20575AT1G20575.1ATTAGGCCCAATTdolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink).
AT1G20575.1TTTTGGGCTTTATATAGGCCCATATdolichyl-phosphate beta-D-mannosyltransferase, putative / dolichol-phosphate mannosyltransferase, putative / mannose-P-dolichol synthase, putative; FUNCTIONS IN: elongation factor-2 kinase activity, dolichyl-phosphate beta-D-mannosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 2 (InterPro:IPR001173); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 2 protein (TAIR:AT2G39630.1); Has 14265 Blast hits to 14249 proteins in 1426 species: Archae - 553; Bacteria - 8256; Metazoa - 255; Fungi - 173; Plants - 49; Viruses - 21; Other Eukaryotes - 4958 (source: NCBI BLink).
AT1G20580AT1G20580.1AATTGGGCCTAATsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).
AT1G20580.1ATATGGGCCTATATAAAGCCCAAAAsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: SmD3 (snRNP core protein SmD3) (TAIR:AT1G76300.1); Has 893 Blast hits to 893 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 391; Fungi - 219; Plants - 128; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).
AT1G20620AT1G20620.1ATGGCCCATTTCatalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.
AT1G20620.2ATGGCCCATTTCatalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.
AT1G20620.4TAGGGCTTTTTCatalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.
AT1G20620.5ATGGCCCATTTCatalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.
AT1G20760AT1G20760.1AGTGGGCTTATAAAAGCCCATTTAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink).
AT1G20760.1ATTAGGCCTATAAAGGCCCATTTAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink).
AT1G20770AT1G20770.1GGGCTATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20770.1GGGCTATTGGGCCTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20770.1TTAATGGGCCTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20780AT1G20780.1AATAGCCCEncodes a protein containing a U-box and an ARM domain.
AT1G20780.1TAAAGGCCCATTAAEncodes a protein containing a U-box and an ARM domain.
AT1G20830AT1G20830.1AACGGCCCAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20960AT1G20960.1ACAGGCCCAGCCCAATembryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink).
AT1G20960.1GTTGGGCTTAGembryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink).
AT1G20980AT1G20980.1ATATGGGCEncodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture.
AT1G21100AT1G21100.1AGAGGCCCATTAGO-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; EXPRESSED IN: stem, cotyledon, hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21130.1); Has 2126 Blast hits to 2123 proteins in 426 species: Archae - 0; Bacteria - 600; Metazoa - 84; Fungi - 432; Plants - 916; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).
AT1G21140AT1G21140.1CCCATATAnodulin, putative; INVOLVED IN: biological_process unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF125, transmembrane (InterPro:IPR008217); BEST Arabidopsis thaliana protein match is: nodulin, putative (TAIR:AT3G43630.1); Has 1036 Blast hits to 1028 proteins in 341 species: Archae - 39; Bacteria - 627; Metazoa - 0; Fungi - 71; Plants - 99; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink).
AT1G21190AT1G21190.1ATATTGGGCCGATsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G76860.1); Has 924 Blast hits to 924 proteins in 209 species: Archae - 244; Bacteria - 0; Metazoa - 275; Fungi - 141; Plants - 102; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).
AT1G21190.1GAGCCCAAAAsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G76860.1); Has 924 Blast hits to 924 proteins in 209 species: Archae - 244; Bacteria - 0; Metazoa - 275; Fungi - 141; Plants - 102; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink).
AT1G21200AT1G21200.1ATCGGCCCAATATtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 251 Blast hits to 233 proteins in 48 species: Archae - 2; Bacteria - 24; Metazoa - 66; Fungi - 2; Plants - 75; Viruses - 9; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G21200.1TTTTGGGCTCtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 251 Blast hits to 233 proteins in 48 species: Archae - 2; Bacteria - 24; Metazoa - 66; Fungi - 2; Plants - 75; Viruses - 9; Other Eukaryotes - 73 (source: NCBI BLink).
AT1G21270AT1G21270.1TTATTGGGcytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase.
AT1G21280AT1G21280.1CAAGGCCCATTAAGCCCAACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21280.1TTAATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21280.1TTTGGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 594 Blast hits to 592 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 590; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21350AT1G21350.1ATATTGGGCTantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.1TTATGGGCTTGantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.1TTCGGCCCATCAantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.2ATATTGGGCTantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.2TTATGGGCTTGantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.2TTCGGCCCATCAantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.3ATATTGGGCTantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.3TTATGGGCTTGantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21350.3TTCGGCCCATCAantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink).
AT1G21370AT1G21370.1TGGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 97 Blast hits to 97 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 67; Plants - 22; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G21370.2TGGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 97 Blast hits to 97 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 67; Plants - 22; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G21390AT1G21390.1TTAAAGCCCCAATAGembryo defective 2170 (emb2170); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76980.2); Has 24 Blast hits to 24 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G21440AT1G21440.1CCCAATAAmutase family protein; FUNCTIONS IN: isocitrate lyase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G77060.1); Has 6447 Blast hits to 6447 proteins in 860 species: Archae - 75; Bacteria - 2907; Metazoa - 29; Fungi - 322; Plants - 109; Viruses - 0; Other Eukaryotes - 3005 (source: NCBI BLink).
AT1G21560AT1G21560.1AGTTGGGCCTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21560.1TGAGCCCAATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21560.1TTATGGGCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G01170.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21580AT1G21580.1GTGGCCCAATAAGhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 5883 Blast hits to 3865 proteins in 351 species: Archae - 2; Bacteria - 340; Metazoa - 2117; Fungi - 809; Plants - 1304; Viruses - 149; Other Eukaryotes - 1162 (source: NCBI BLink).
AT1G21580.1TACGGCCCATAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 5883 Blast hits to 3865 proteins in 351 species: Archae - 2; Bacteria - 340; Metazoa - 2117; Fungi - 809; Plants - 1304; Viruses - 149; Other Eukaryotes - 1162 (source: NCBI BLink).
AT1G21651AT1G21651.1CCGGCCCATAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G24530.1); Has 24082 Blast hits to 13732 proteins in 513 species: Archae - 28; Bacteria - 3626; Metazoa - 10644; Fungi - 4830; Plants - 1984; Viruses - 3; Other Eukaryotes - 2967 (source: NCBI BLink).
AT1G21680AT1G21680.1GGGCCCTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21670.1); Has 6869 Blast hits to 3873 proteins in 790 species: Archae - 41; Bacteria - 3697; Metazoa - 41; Fungi - 39; Plants - 64; Viruses - 0; Other Eukaryotes - 2987 (source: NCBI BLink).
AT1G21720AT1G21720.1GAAGCCCAATAA20S proteasome beta subunit PBC1 truncated protein (PBC1)
AT1G21720.1GGCCTAAATTAGGCCCAAAA20S proteasome beta subunit PBC1 truncated protein (PBC1)
AT1G21790AT1G21790.1AAATGGGCCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G21790.1AAATGGGCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G21880AT1G21880.1TGGGCCTCALYSM DOMAIN GPI-ANCHORED PROTEIN 1 PRECURSOR (LYM1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidoglycan-binding lysin domain (InterPro:IPR018392), Peptidoglycan-binding Lysin subgroup (InterPro:IPR002482); BEST Arabidopsis thaliana protein match is: peptidoglycan-binding LysM domain-containing protein (TAIR:AT1G77630.1); Has 356 Blast hits to 346 proteins in 78 species: Archae - 0; Bacteria - 128; Metazoa - 0; Fungi - 1; Plants - 210; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G21880.2TGGGCCTCALYSM DOMAIN GPI-ANCHORED PROTEIN 1 PRECURSOR (LYM1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidoglycan-binding lysin domain (InterPro:IPR018392), Peptidoglycan-binding Lysin subgroup (InterPro:IPR002482); BEST Arabidopsis thaliana protein match is: peptidoglycan-binding LysM domain-containing protein (TAIR:AT1G77630.1); Has 356 Blast hits to 346 proteins in 78 species: Archae - 0; Bacteria - 128; Metazoa - 0; Fungi - 1; Plants - 210; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G21980AT1G21980.1GTGGGCTTTTTType I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution.
AT1G21980.1TAGCCCATAType I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution.
AT1G22200AT1G22200.1ATATGGGCCTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).
AT1G22200.1GAGCCCAAGCCCAATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).
AT1G22200.2ATATGGGCCTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).
AT1G22200.2GAGCCCAAGCCCAATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1692 (InterPro:IPR012936); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G36050.2); Has 903 Blast hits to 793 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 386; Fungi - 184; Plants - 142; Viruses - 0; Other Eukaryotes - 191 (source: NCBI BLink).
AT1G22410AT1G22410.1GCCCATTC2-dehydro-3-deoxyphosphoheptonate aldolase, putative / 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase, putative / DAHP synthetase, putative; FUNCTIONS IN: 3-deoxy-7-phosphoheptulonate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DAHP synthetase, class II (InterPro:IPR002480); BEST Arabidopsis thaliana protein match is: DHS1 (3-DEOXY-D-ARABINO-HEPTULOSONATE 7-PHOSPHATE SYNTHASE 1); 3-deoxy-7-phosphoheptulonate synthase (TAIR:AT4G39980.1); Has 3140 Blast hits to 3125 proteins in 395 species: Archae - 0; Bacteria - 662; Metazoa - 0; Fungi - 68; Plants - 129; Viruses - 0; Other Eukaryotes - 2281 (source: NCBI BLink).
AT1G22450AT1G22450.1ACAGGCCCAAATsubunit 6b of cytochrome c oxidase
AT1G22450.1CTTATTGGGCCTAAAsubunit 6b of cytochrome c oxidase
AT1G22520AT1G22520.1ATAAGGCCCATTAATCGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).
AT1G22520.2ATAAGGCCCATTAATCGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1).
AT1G22540AT1G22540.1GGGCTATTproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT1G72140.1); Has 4482 Blast hits to 4367 proteins in 786 species: Archae - 0; Bacteria - 2034; Metazoa - 529; Fungi - 315; Plants - 1121; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).
AT1G22840AT1G22840.1CCCATTAAGGGCCCATTAAGEncodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.
AT1G22840.1TGAGCCCAEncodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.
AT1G22840.2CCCATTAAGGGCCCATTAAGEncodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.
AT1G22840.2TGAGCCCAEncodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers.
AT1G22850AT1G22850.1GAAGCCCATINVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03260.1); Has 3098 Blast hits to 3098 proteins in 664 species: Archae - 6; Bacteria - 1614; Metazoa - 182; Fungi - 59; Plants - 145; Viruses - 0; Other Eukaryotes - 1092 (source: NCBI BLink).
AT1G22885AT1G22885.1AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22885.2AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22940AT1G22940.1TTATTGGGEncodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media.
AT1G22970AT1G22970.1GGGCTTTTunknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71150.1); Has 102 Blast hits to 102 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 62; Fungi - 9; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G23100AT1G23100.1GAATGGGCCTGGGCCACGTA10 kDa chaperonin, putative; FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), Chaperonin Cpn10, conserved site (InterPro:IPR018369), Chaperonin Cpn10 (InterPro:IPR001476); BEST Arabidopsis thaliana protein match is: CPN10 (CHAPERONIN 10); chaperone binding (TAIR:AT1G14980.1); Has 5807 Blast hits to 5744 proteins in 1499 species: Archae - 0; Bacteria - 3188; Metazoa - 245; Fungi - 75; Plants - 201; Viruses - 2; Other Eukaryotes - 2096 (source: NCBI BLink).
AT1G23205AT1G23205.1TCAGGCCCAGATCGGCCCATTAAinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G70720.1); Has 417 Blast hits to 412 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 417; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23280AT1G23280.1AATTGGGCTMAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).
AT1G23280.1TGAGGCCCATTATMAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).
AT1G23280.1TTGGCCCAATTAMAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).
AT1G23280.1TTTTGGGCTTTTTMAK16 protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mak16 protein (InterPro:IPR006958); Has 5463 Blast hits to 3446 proteins in 254 species: Archae - 5; Bacteria - 214; Metazoa - 2654; Fungi - 567; Plants - 207; Viruses - 131; Other Eukaryotes - 1685 (source: NCBI BLink).
AT1G23290AT1G23290.1AAAAAGCCCAAAAEncodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20.
AT1G23290.1AGCCCAATTEncodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20.
AT1G23290.1ATAATGGGCCTCAEncodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20.
AT1G23290.1TAATTGGGCCAAEncodes a ribosomal protein L27A, a constituent of the large subunit of the ribosomal complex. Regulated by TCP20.
AT1G23310AT1G23310.1AATAGGCCCAAAIdentified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.
AT1G23310.2AATAGGCCCAAAIdentified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway.
AT1G23360AT1G23360.1CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).
AT1G23360.1GCCCATAAUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).
AT1G23360.2CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).
AT1G23360.2GCCCATAAUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).
AT1G23360.3CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).
AT1G23360.3GCCCATAAUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink).
AT1G23400AT1G23400.1TAAAGCCCPromotes the splicing of chloroplast group II introns.
AT1G23400.1TTATGGGCCTGGCCTTAGGGCCCAATTPromotes the splicing of chloroplast group II introns.
AT1G23460AT1G23460.1CCCATTAApolygalacturonase; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Parallel beta-helix repeat (InterPro:IPR006626), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: polygalacturonase, putative / pectinase, putative (TAIR:AT1G70500.1); Has 2595 Blast hits to 2585 proteins in 348 species: Archae - 2; Bacteria - 471; Metazoa - 8; Fungi - 1135; Plants - 896; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).
AT1G23460.1TGGGCTTGpolygalacturonase; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Parallel beta-helix repeat (InterPro:IPR006626), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: polygalacturonase, putative / pectinase, putative (TAIR:AT1G70500.1); Has 2595 Blast hits to 2585 proteins in 348 species: Archae - 2; Bacteria - 471; Metazoa - 8; Fungi - 1135; Plants - 896; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).
AT1G23490AT1G23490.1CAAGGCCCGene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.
AT1G23530AT1G23530.1TAAAGCCCACTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70470.1); Has 25 Blast hits to 25 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G23530.1TTATTGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70470.1); Has 25 Blast hits to 25 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G23710AT1G23710.1ATTGGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G23710.1TCAGCCCATCACGCGCTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT1G23740AT1G23740.1TTATGGGCCACoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink).
AT1G23740.1TTTAGGCCCATTAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G13010.1); Has 25735 Blast hits to 25635 proteins in 1642 species: Archae - 321; Bacteria - 14032; Metazoa - 1331; Fungi - 2499; Plants - 781; Viruses - 3; Other Eukaryotes - 6768 (source: NCBI BLink).
AT1G23750AT1G23750.1AATTGGGCTTTATDNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G23750.1ATAAGCCCAACADNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G23750.1TTAATGGGCCTAAADNA-binding protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT1G10590.3); Has 136 Blast hits to 136 proteins in 34 species: Archae - 26; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G23780AT1G23780.1CCCATATAF-box family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G23770.1); Has 177 Blast hits to 177 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G23780.1TATAGGCCCAAATACGGCCCATAAF-box family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G23770.1); Has 177 Blast hits to 177 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G23850AT1G23850.1CCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23840.1); Has 23 Blast hits to 20 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23890AT1G23890.1ACTGGGCCGTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.1TAAATGGGCCCTACTTGGGCCGTTTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.1TCAGGCCCNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.2ACTGGGCCGTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.2TAAATGGGCCCTACTTGGGCCGTTTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.2TCAGGCCCNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23900AT1G23900.1AAAACGGCCCAAGTAGGGCCCATTTAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.1AACGGCCCAGTEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.1GGGCCTGAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.2AAAACGGCCCAAGTAGGGCCCATTTAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.2AACGGCCCAGTEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.2GGGCCTGAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23960AT1G23960.1AGTTGGGCCTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23960.1TATATGGGCCCTTATAGCCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23960.2AGTTGGGCCTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23960.2TATATGGGCCCTTATAGCCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23970AT1G23970.1AAAAAGCCCAACTGAAGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23950.2); Has 75 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23970.2AAAAAGCCCAACTGAAGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23950.2); Has 75 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G24040AT1G24040.1ATATGGGCCTTAAGCCCAAATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G24040.1TATATGGGCCATAAGGGCCCAATAAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G24040.2ATATGGGCCTTAAGCCCAAATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G24040.2TATATGGGCCATAAGGGCCCAATAAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G24050AT1G24050.1ATTTGGGCTTAAGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT1G24050.1TTATTGGGCCCTTATGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT1G24170AT1G24170.1CTTAATGGGCCAAEncodes a protein with putative galacturonosyltransferase activity.
AT1G24290AT1G24290.1TTATGGGCAAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding, ATP binding; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), ATPase, AAA-type, core (InterPro:IPR003959), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: replication factor C 36 kDA, putative (TAIR:AT1G77470.1); Has 14020 Blast hits to 13994 proteins in 1675 species: Archae - 392; Bacteria - 8113; Metazoa - 478; Fungi - 462; Plants - 133; Viruses - 43; Other Eukaryotes - 4399 (source: NCBI BLink).
AT1G24510AT1G24510.1AGATGGGCTTTAAT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).
AT1G24510.1ATAAGCCCAAACT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).
AT1G24510.1GTTAGGCCCATGT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).
AT1G24510.2AGATGGGCTTTAAT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).
AT1G24510.2ATAAGCCCAAACT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).
AT1G24510.2GTTAGGCCCATGT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink).
AT1G24520AT1G24520.1TTAAAGCCCATCTMale fertility gene acting on tapetum and microspore
AT1G24560AT1G24560.1CAAAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49055.1); Has 56279 Blast hits to 28796 proteins in 1542 species: Archae - 818; Bacteria - 6598; Metazoa - 28656; Fungi - 4716; Plants - 2272; Viruses - 181; Other Eukaryotes - 13038 (source: NCBI BLink).
AT1G24560.1GTTGGGCCTAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49055.1); Has 56279 Blast hits to 28796 proteins in 1542 species: Archae - 818; Bacteria - 6598; Metazoa - 28656; Fungi - 4716; Plants - 2272; Viruses - 181; Other Eukaryotes - 13038 (source: NCBI BLink).
AT1G24575AT1G24575.1GCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G24706AT1G24706.1GCCCATTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink).
AT1G24706.1TGAGCCCATGGGCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink).
AT1G25230AT1G25230.1CTAAGCCCpurple acid phosphatase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: PAP3 (PURPLE ACID PHOSPHATASE 3); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT1G14700.1); Has 873 Blast hits to 869 proteins in 210 species: Archae - 0; Bacteria - 175; Metazoa - 324; Fungi - 6; Plants - 91; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink).
AT1G25260AT1G25260.1ATCGGCCCAGAacidic ribosomal protein P0-related; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 809 Blast hits to 807 proteins in 249 species: Archae - 78; Bacteria - 0; Metazoa - 294; Fungi - 172; Plants - 102; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).
AT1G25280AT1G25280.2AGATGGGCTAAMember of TLP family
AT1G25280.2GGGCCTGAMember of TLP family
AT1G25280.3AGATGGGCTAAMember of TLP family
AT1G25280.3GGGCCTGAMember of TLP family
AT1G25420AT1G25420.1CCCATTAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 391 Blast hits to 384 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 89; Plants - 145; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT1G25420.2CCCATTAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 391 Blast hits to 384 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 89; Plants - 145; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT1G25420.3CCCATTAAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 391 Blast hits to 384 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 89; Plants - 145; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT1G25490AT1G25490.1AAAGCCCAAAATGGCCCAATTAOne of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem
AT1G25490.1TTAAAGCCCAACAOne of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem
AT1G25530AT1G25530.1GAGCCCAACAlysine and histidine specific transporter, putative; FUNCTIONS IN: amino acid transmembrane transporter activity; INVOLVED IN: amino acid transport; LOCATED IN: membrane; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid transporter, transmembrane (InterPro:IPR013057); BEST Arabidopsis thaliana protein match is: lysine and histidine specific transporter, putative (TAIR:AT1G67640.1); Has 2150 Blast hits to 2144 proteins in 183 species: Archae - 2; Bacteria - 19; Metazoa - 787; Fungi - 349; Plants - 832; Viruses - 0; Other Eukaryotes - 161 (source: NCBI BLink).
AT1G26110AT1G26110.1AATTGGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45330.1); Has 43564 Blast hits to 18145 proteins in 930 species: Archae - 33; Bacteria - 8614; Metazoa - 16661; Fungi - 5004; Plants - 6818; Viruses - 592; Other Eukaryotes - 5842 (source: NCBI BLink).
AT1G26110.2AATTGGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45330.1); Has 43564 Blast hits to 18145 proteins in 930 species: Archae - 33; Bacteria - 8614; Metazoa - 16661; Fungi - 5004; Plants - 6818; Viruses - 592; Other Eukaryotes - 5842 (source: NCBI BLink).
AT1G26230AT1G26230.1TCGGCCCAACAchaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24360 Blast hits to 24320 proteins in 5137 species: Archae - 390; Bacteria - 14007; Metazoa - 1488; Fungi - 952; Plants - 459; Viruses - 2; Other Eukaryotes - 7062 (source: NCBI BLink).
AT1G26230.1TGTTGGGCCCGAACCAchaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24360 Blast hits to 24320 proteins in 5137 species: Archae - 390; Bacteria - 14007; Metazoa - 1488; Fungi - 952; Plants - 459; Viruses - 2; Other Eukaryotes - 7062 (source: NCBI BLink).
AT1G26300AT1G26300.1GTGGGCTTCBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26300.1TAAGCCCATAABSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26300.1TTATTGGGCCCTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26300.2GTGGGCTTCBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26300.2TAAGCCCATAABSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26300.2TTATTGGGCCCTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G26370AT1G26370.1ACTGGGCCGGGRNA helicase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 6916 Blast hits to 6404 proteins in 949 species: Archae - 2; Bacteria - 1916; Metazoa - 1973; Fungi - 797; Plants - 383; Viruses - 390; Other Eukaryotes - 1455 (source: NCBI BLink).
AT1G26370.1ATATTGGGCCATRNA helicase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 6916 Blast hits to 6404 proteins in 949 species: Archae - 2; Bacteria - 1916; Metazoa - 1973; Fungi - 797; Plants - 383; Viruses - 390; Other Eukaryotes - 1455 (source: NCBI BLink).
AT1G26460AT1G26460.1GTTTGGGCTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT1G26460.1TTAATGGGCTGGGCTTTATpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 4278 Blast hits to 2050 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 59; Plants - 4056; Viruses - 0; Other Eukaryotes - 160 (source: NCBI BLink).
AT1G26470AT1G26470.1GGCCTTAAATATGGGCCGGCCCAGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, H4/H2A histone acetyltransferase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CT20 (InterPro:IPR012423); Has 39 Blast hits to 39 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G26530AT1G26530.1TATATGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G26540AT1G26540.1ATATGGGCTTGagenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395), Protein of unknown function DUF724 (InterPro:IPR007930); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT2G47230.1); Has 651 Blast hits to 562 proteins in 98 species: Archae - 0; Bacteria - 24; Metazoa - 210; Fungi - 27; Plants - 225; Viruses - 3; Other Eukaryotes - 162 (source: NCBI BLink).
AT1G26540.1GTTGGGCTATTAGGCCCAATAAGagenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395), Protein of unknown function DUF724 (InterPro:IPR007930); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT2G47230.1); Has 651 Blast hits to 562 proteins in 98 species: Archae - 0; Bacteria - 24; Metazoa - 210; Fungi - 27; Plants - 225; Viruses - 3; Other Eukaryotes - 162 (source: NCBI BLink).
AT1G26550AT1G26550.1CAAGCCCATATpeptidyl-prolyl cis-trans isomerase PPIC-type family protein; FUNCTIONS IN: isomerase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, PpiC-type (InterPro:IPR000297); BEST Arabidopsis thaliana protein match is: PIN1AT (PEPTIDYLPROLYL CIS/TRANS ISOMERASE, NIMA-INTERACTING 1); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G18040.1); Has 4470 Blast hits to 4300 proteins in 976 species: Archae - 12; Bacteria - 3095; Metazoa - 206; Fungi - 127; Plants - 110; Viruses - 0; Other Eukaryotes - 920 (source: NCBI BLink).
AT1G26550.1CTTATTGGGCCTAATAGCCCAACpeptidyl-prolyl cis-trans isomerase PPIC-type family protein; FUNCTIONS IN: isomerase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, PpiC-type (InterPro:IPR000297); BEST Arabidopsis thaliana protein match is: PIN1AT (PEPTIDYLPROLYL CIS/TRANS ISOMERASE, NIMA-INTERACTING 1); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G18040.1); Has 4470 Blast hits to 4300 proteins in 976 species: Archae - 12; Bacteria - 3095; Metazoa - 206; Fungi - 127; Plants - 110; Viruses - 0; Other Eukaryotes - 920 (source: NCBI BLink).
AT1G26570AT1G26570.1TTATTGGGUDP-GLUCOSE DEHYDROGENASE 1 (UGD1); FUNCTIONS IN: in 7 functions; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucose/GDP-mannose dehydrogenase, N-terminal (InterPro:IPR001732), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), UDP-glucose/GDP-mannose dehydrogenase, dimerisation and substrate-binding (InterPro:IPR014028), UDP-glucose/GDP-mannose dehydrogenase, C-terminal (InterPro:IPR014027), NAD(P)-binding (InterPro:IPR016040), UDP-glucose/GDP-mannose dehydrogenase, dimerisation (InterPro:IPR014026), Nucleotide sugar dehydrogenase (InterPro:IPR017476); BEST Arabidopsis thaliana protein match is: UDP-glucose 6-dehydrogenase, putative (TAIR:AT3G29360.2); Has 10075 Blast hits to 10057 proteins in 1239 species: Archae - 198; Bacteria - 3905; Metazoa - 183; Fungi - 77; Plants - 116; Viruses - 14; Other Eukaryotes - 5582 (source: NCBI BLink).
AT1G26580AT1G26580.1TTTTGGGCCGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: myb family transcription factor / ELM2 domain-containing protein (TAIR:AT2G03470.1); Has 82 Blast hits to 82 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 78; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G26630AT1G26630.1GTTTGGGCTGGGCTGAEukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection.
AT1G26630.2GTTTGGGCTGGGCTGAEukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection.
AT1G26640AT1G26640.1CTTAATGGGCTTCaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).
AT1G26640.1GTTAGGCCCAATAAaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink).
AT1G26650AT1G26650.1GAAGCCCATTAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G26650.1TTATTGGGCCTAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G26660AT1G26660.1GTGGGCCTTTAc-myc binding protein, putative / prefoldin, putative; FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053); Has 263 Blast hits to 263 proteins in 87 species: Archae - 12; Bacteria - 2; Metazoa - 174; Fungi - 30; Plants - 21; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT1G26761AT1G26761.1AGTGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 197 Blast hits to 129 proteins in 53 species: Archae - 0; Bacteria - 148; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G26800AT1G26800.1TTTAGGCCCATGGGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G14200.1); Has 6695 Blast hits to 6676 proteins in 207 species: Archae - 0; Bacteria - 0; Metazoa - 2341; Fungi - 548; Plants - 2751; Viruses - 14; Other Eukaryotes - 1041 (source: NCBI BLink).
AT1G26880AT1G26880.1AAAAGGCCCATATA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G26880.1CATGGGCCTTTAA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G26880.2AAAAGGCCCATATA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G26880.2CATGGGCCTTTAA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G26940AT1G26940.1ATATGGGCCTTACpeptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink).
AT1G26940.1CAAGCCCAApeptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink).
AT1G26940.1CATTGGGCCCAATApeptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink).
AT1G26940.1TTTTGGGCCTTAApeptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink).
AT1G26960AT1G26960.1AAAAGCCCATATEncodes a homeodomain leucine zipper class I (HD-Zip I) protein.
AT1G27070AT1G27070.1AAATGGGCCTATA5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G27070.1AGGGCCCATCA5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G27070.1GCCCATTT5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT1G27310AT1G27310.1ATAAGGCCCATTTAEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.
AT1G27310.1CCCATATAEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.
AT1G27310.1TAACGGGCCCAACTEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.
AT1G27350AT1G27350.1CCCAATTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ribosome associated membrane RAMP4 (InterPro:IPR010580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27330.1); Has 267 Blast hits to 267 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 183; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G27380AT1G27380.1TTATTGGGencodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Protein most similar to RIC4 (family subgroup V). Gene is expressed in all tissues examined.
AT1G27380.2TTATTGGGencodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Protein most similar to RIC4 (family subgroup V). Gene is expressed in all tissues examined.
AT1G27385AT1G27385.1AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).
AT1G27385.2AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).
AT1G27385.3AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).
AT1G27385.4AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454).
AT1G27390AT1G27390.1AAAAAGCCCAATTAForm of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins
AT1G27390.1ATATGGGCCTTCTGGGCCACForm of TOM20, which is a component of the TOM complex, involved in transport of nuclear-encoded mitochondrial proteins
AT1G27400AT1G27400.1GTGGCCCAGAAGGCCCATAT60S ribosomal protein L17 (RPL17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17B) (TAIR:AT1G67430.1); Has 1647 Blast hits to 1647 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink).
AT1G27400.1TAATTGGGCTTTTT60S ribosomal protein L17 (RPL17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17B) (TAIR:AT1G67430.1); Has 1647 Blast hits to 1647 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink).
AT1G27435AT1G27435.1AAATGGGCCTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27435.1TAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27450AT1G27450.1CATTGGGCCTTGAdenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP.
AT1G27450.1TTATGGGCTGAAdenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP.
AT1G27450.2CATTGGGCCTTGAdenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP.
AT1G27450.2TTATGGGCTGAAdenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP.
AT1G27460AT1G27460.1TTTTGGGCencodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits.
AT1G27461AT1G27461.1CTTATTGGCCCunknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G27470AT1G27470.1TATGGCCCAATGGGTCGGGTCGACCCGACCtransducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).
AT1G27480AT1G27480.1GGTCGGGTCGACCCGACCCATTGGGCCATAlecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).
AT1G27540AT1G27540.1GACGTCGTATATTGGGCCATAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27540.1TACTGGGCCTGGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27540.2GACGTCGTATATTGGGCCATAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27540.2TACTGGGCCTGGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27630AT1G27630.1AAAGTCAAAGCCCATATCYCLIN T 1;3 (CYCT1;3); FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT5G45190.1); Has 1136 Blast hits to 1136 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 700; Fungi - 230; Plants - 139; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G27630.1GAAGCCCATATCYCLIN T 1;3 (CYCT1;3); FUNCTIONS IN: cyclin-dependent protein kinase activity; INVOLVED IN: regulation of cell cycle; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like (InterPro:IPR011028), Transcription regulator cyclin (InterPro:IPR015429), Cyclin-related (InterPro:IPR013763), Cyclin, N-terminal (InterPro:IPR006671), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: cyclin family protein (TAIR:AT5G45190.1); Has 1136 Blast hits to 1136 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 700; Fungi - 230; Plants - 139; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT1G27670AT1G27670.1CCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; Has 17 Blast hits to 17 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27770AT1G27770.1CCCATATAEncodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor.
AT1G27770.2CCCATATAEncodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor.
AT1G27990AT1G27990.1CCCATTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52420.1); Has 43 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28050AT1G28050.1CAAAGCCCzinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT2G33500.2); Has 1872 Blast hits to 1279 proteins in 90 species: Archae - 2; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1798; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).
AT1G28060AT1G28060.1AAATGGGCTTCAGCCCATAAsmall nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink).
AT1G28060.1TAAAAGCCCATTAGsmall nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink).
AT1G28090AT1G28090.1CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28090.1GGGCCCAATAApolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28090.2CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28090.2GGGCCCAATAApolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28090.3CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28090.3GGGCCCAATAApolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28120AT1G28120.1TGTTGGGCCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin thioesterase Otubain (InterPro:IPR016615), Ovarian tumour, otubain (InterPro:IPR003323); Has 295 Blast hits to 295 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 50; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G28120.1TTTAGGCCCATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin thioesterase Otubain (InterPro:IPR016615), Ovarian tumour, otubain (InterPro:IPR003323); Has 295 Blast hits to 295 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 50; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G28190AT1G28190.1GTTTGGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12340.1); Has 113 Blast hits to 106 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 25; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT1G28281AT1G28281.1GGGCTTTGunknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT1G28290AT1G28290.1TTTTGGGCEncodes an atypical arabinogalactan protein that is localized to the plasma membrange. AGP31 is highly expressed in flowers and vascular tissue and is repressed by jasmonic acid. AGP31 may play a role in vascular tissue function during defense and development.
AT1G28290.2TTTTGGGCEncodes an atypical arabinogalactan protein that is localized to the plasma membrange. AGP31 is highly expressed in flowers and vascular tissue and is repressed by jasmonic acid. AGP31 may play a role in vascular tissue function during defense and development.
AT1G28375AT1G28375.1ATTTGGGCCTTACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28375.1TACTGGGCCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395AT1G28395.1AAAAGCCCTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395.2AAAAGCCCTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395.3AAAAGCCCTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28395.4AAAAGCCCTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33847.2); Has 65 Blast hits to 65 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28490AT1G28490.1CTTATTGGGCTCEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.
AT1G28490.1CTTATTGGGCTTTATEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.
AT1G28490.2CTTATTGGGCTCEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.
AT1G28490.2CTTATTGGGCTTTATEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed.
AT1G28580AT1G28580.1CCCAATAAGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28570.1); Has 1868 Blast hits to 1834 proteins in 164 species: Archae - 0; Bacteria - 265; Metazoa - 1; Fungi - 5; Plants - 1584; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G28580.2CCCAATAAGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28570.1); Has 1868 Blast hits to 1834 proteins in 164 species: Archae - 0; Bacteria - 265; Metazoa - 1; Fungi - 5; Plants - 1584; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G28610AT1G28610.1TTGGCCCAGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: lipase, putative (TAIR:AT2G27360.1); Has 1800 Blast hits to 1773 proteins in 147 species: Archae - 0; Bacteria - 219; Metazoa - 1; Fungi - 4; Plants - 1572; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G28610.2TTGGCCCAGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: lipase, putative (TAIR:AT2G27360.1); Has 1800 Blast hits to 1773 proteins in 147 species: Archae - 0; Bacteria - 219; Metazoa - 1; Fungi - 4; Plants - 1572; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G28710AT1G28710.1TATATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G28710.2TATATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G29060AT1G29060.1ATCGGCCCGTTAAAAAAGCCCATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G29060.1TAATTGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G29070AT1G29070.1TATTGGGCTTTTAribosomal protein L34 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271); Has 389 Blast hits to 389 proteins in 164 species: Archae - 0; Bacteria - 342; Metazoa - 0; Fungi - 9; Plants - 23; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT1G29070.1TTATGGGCTGAribosomal protein L34 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271); Has 389 Blast hits to 389 proteins in 164 species: Archae - 0; Bacteria - 342; Metazoa - 0; Fungi - 9; Plants - 23; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT1G29150AT1G29150.1ATATTGGGCCTTTAspecifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A.
AT1G29220AT1G29220.1TTATTGGGCCTTTAtranscriptional regulator family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HCNGP-like (InterPro:IPR012479); Has 10343 Blast hits to 2896 proteins in 211 species: Archae - 2; Bacteria - 122; Metazoa - 7536; Fungi - 402; Plants - 244; Viruses - 187; Other Eukaryotes - 1850 (source: NCBI BLink).
AT1G29250AT1G29250.1CCCAATTGGGCCTATTGGGCTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G29250.1TAGCCCATTTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G29260AT1G29260.1AAATGGGCTAEncodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function.
AT1G29260.1AGCCCAATAGGCCCAATTGGGEncodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function.
AT1G29390AT1G29390.1TTATGGGCCCencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29390.2TTATGGGCCCencodes a protein similar to the cold acclimation protein WCOR413 in wheat. Possibly targeted to thylakoid membrane.
AT1G29400AT1G29400.1TTAATGGGA member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices.
AT1G29400.2TTAATGGGA member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices.
AT1G29490AT1G29490.1GGGCCTACauxin-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: petal, male gametophyte, sepal, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29420.1); Has 338 Blast hits to 328 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 338; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G29800AT1G29800.1TATATGGGphosphoinositide binding / zinc ion binding; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: zinc finger (FYVE type) family protein (TAIR:AT3G43230.1); Has 2856 Blast hits to 2789 proteins in 224 species: Archae - 0; Bacteria - 155; Metazoa - 1698; Fungi - 436; Plants - 186; Viruses - 3; Other Eukaryotes - 378 (source: NCBI BLink).
AT1G29800.2TATATGGGphosphoinositide binding / zinc ion binding; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: zinc finger (FYVE type) family protein (TAIR:AT3G43230.1); Has 2856 Blast hits to 2789 proteins in 224 species: Archae - 0; Bacteria - 155; Metazoa - 1698; Fungi - 436; Plants - 186; Viruses - 3; Other Eukaryotes - 378 (source: NCBI BLink).
AT1G29850AT1G29850.1CTTAATGGGdouble-stranded DNA-binding family protein; FUNCTIONS IN: double-stranded DNA binding, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding TFAR19-related protein (InterPro:IPR002836).
AT1G29850.2CTTAATGGGdouble-stranded DNA-binding family protein; FUNCTIONS IN: double-stranded DNA binding, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding TFAR19-related protein (InterPro:IPR002836).
AT1G29850.3CTTAATGGGdouble-stranded DNA-binding family protein; FUNCTIONS IN: double-stranded DNA binding, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding TFAR19-related protein (InterPro:IPR002836).
AT1G29880AT1G29880.1CTTGGGCCCAAAglycyl-tRNA synthetase / glycine--tRNA ligase; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, glycyl-tRNA aminoacylation; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Glycyl-tRNA synthetase, alpha2 dimer (InterPro:IPR002315), Anticodon-binding (InterPro:IPR004154), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: tRNA synthetase class II (G, H, P and S) family protein (TAIR:AT1G29870.1); Has 4267 Blast hits to 3231 proteins in 634 species: Archae - 169; Bacteria - 1528; Metazoa - 158; Fungi - 116; Plants - 33; Viruses - 0; Other Eukaryotes - 2263 (source: NCBI BLink).
AT1G29880.1TTATTGGGglycyl-tRNA synthetase / glycine--tRNA ligase; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, glycyl-tRNA aminoacylation; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Glycyl-tRNA synthetase, alpha2 dimer (InterPro:IPR002315), Anticodon-binding (InterPro:IPR004154), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: tRNA synthetase class II (G, H, P and S) family protein (TAIR:AT1G29870.1); Has 4267 Blast hits to 3231 proteins in 634 species: Archae - 169; Bacteria - 1528; Metazoa - 158; Fungi - 116; Plants - 33; Viruses - 0; Other Eukaryotes - 2263 (source: NCBI BLink).
AT1G29900AT1G29900.1CCCAATAAcarbamoyl phosphate synthetase large chain (CARB) mRNA,
AT1G29920AT1G29920.1TTATTGGGEncodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II.
AT1G29952AT1G29952.1AAATGGGCUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF34 represents a conserved upstream opening reading frame relative to major ORF AT1G29950.2
AT1G29965AT1G29965.1AAAAGGCCCAATGGGCTTTA60S ribosomal protein L18A (RPL18aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: RPL18AA (60S RIBOSOMAL PROTEIN L18A-1); structural constituent of ribosome (TAIR:AT1G29970.2); Has 545 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G29970AT1G29970.1CAAGCCCATTT60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G29970.2CAAGCCCATTT60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G29970.3CAAGCCCATTT60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT1G29990AT1G29990.1ATATTGGGCCGTTAAAEncodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.
AT1G29990.1GGGCTTTAACGGEncodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.
AT1G29990.1TTTTGGGCCTTACEncodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.
AT1G30070AT1G30070.1AAAGCCCAASGS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), SGS (InterPro:IPR007699), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G30060.1); Has 228 Blast hits to 227 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 14; Plants - 46; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G30070.1TAAATGGGCTTGSGS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), SGS (InterPro:IPR007699), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G30060.1); Has 228 Blast hits to 227 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 14; Plants - 46; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT1G30110AT1G30110.1CCCGGCCCAATAARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 25 (ATNUDX25); FUNCTIONS IN: bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: diadenosine tetraphosphate catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 4194 Blast hits to 4194 proteins in 805 species: Archae - 14; Bacteria - 2251; Metazoa - 23; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 1859 (source: NCBI BLink).
AT1G30230AT1G30230.1TAAAGCCCACelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30230.1TAATTGGGCCACelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30230.1TATAGGCCCACTAelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30230.2TAAAGCCCACelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30230.2TAATTGGGCCACelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30230.2TATAGGCCCACTAelongation factor 1-beta / EF-1-beta; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: plasma membrane, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1-beta, putative / EF-1-beta, putative (TAIR:AT2G18110.1); Has 758 Blast hits to 758 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 410; Fungi - 111; Plants - 109; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink).
AT1G30260AT1G30260.1CCCAATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cytokinin stimulus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT4G21060.1); Has 16 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G30380AT1G30380.1GAAGCCCAAAAEncodes subunit K of photosystem I reaction center.
AT1G30380.1TAAATGGGCCTGEncodes subunit K of photosystem I reaction center.
AT1G30450AT1G30450.1CCCAATTAAAAAGCCCATTTmember of Cation-chloride co-transporter family
AT1G30450.1CTTATTGGGmember of Cation-chloride co-transporter family
AT1G30450.2CCCAATTAAAAAGCCCATTTmember of Cation-chloride co-transporter family
AT1G30450.2CTTATTGGGmember of Cation-chloride co-transporter family
AT1G30450.3CCCAATTAAAAAGCCCATTTmember of Cation-chloride co-transporter family
AT1G30450.3CTTATTGGGmember of Cation-chloride co-transporter family
AT1G30520AT1G30520.1TAAAGCCCATTTEncodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal.
AT1G30520.1TAATTGGGCCTGGCCTATAEncodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal.
AT1G30630AT1G30630.1AAAAGCCCATTGGGCCTAAAcoatomer protein epsilon subunit family protein / COPE family protein; FUNCTIONS IN: protein transporter activity, protein binding, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); BEST Arabidopsis thaliana protein match is: coatomer protein epsilon subunit family protein / COPE family protein (TAIR:AT2G34840.1); Has 326 Blast hits to 326 proteins in 131 species: Archae - 2; Bacteria - 5; Metazoa - 149; Fungi - 59; Plants - 65; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).
AT1G30630.1TAATTGGGcoatomer protein epsilon subunit family protein / COPE family protein; FUNCTIONS IN: protein transporter activity, protein binding, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); BEST Arabidopsis thaliana protein match is: coatomer protein epsilon subunit family protein / COPE family protein (TAIR:AT2G34840.1); Has 326 Blast hits to 326 proteins in 131 species: Archae - 2; Bacteria - 5; Metazoa - 149; Fungi - 59; Plants - 65; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).
AT1G30680AT1G30680.1AAATGGGCCAGGCCCAATtoprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).
AT1G30680.1GAAGCCCATTTAtoprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).
AT1G30680.1TTAATGGGCCTTTTtoprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink).
AT1G30825AT1G30825.1AAATGGGCTCAInvolved in trichome maturation. mutant displays enlarged trichomes
AT1G30825.1TAATTGGGCCTATGGGCCATInvolved in trichome maturation. mutant displays enlarged trichomes
AT1G30845AT1G30845.1CAATGGGCTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 71 Blast hits to 71 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 19; Plants - 11; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G30845.1TTAATGGGCCATAAGCCCATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 71 Blast hits to 71 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 19; Plants - 11; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G30880AT1G30880.1ATTTGGGCCTAAATTGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G30890AT1G30890.1ATTGGCCCAATTTAGGCCCAAATintegral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).
AT1G30890.2ATTGGCCCAATTTAGGCCCAAATintegral membrane HRF1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Hrf1 (InterPro:IPR005578); BEST Arabidopsis thaliana protein match is: integral membrane HRF1 family protein (TAIR:AT3G59500.1); Has 338 Blast hits to 338 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 89; Plants - 40; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).
AT1G31160AT1G31160.1CCCATTAAzinc-binding protein, putative / protein kinase C inhibitor, putative; FUNCTIONS IN: protein kinase C binding, zinc ion binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine triad-like motif (InterPro:IPR011146), Histidine triad (HIT) protein (InterPro:IPR001310), Histidine triad motif (InterPro:IPR011151); BEST Arabidopsis thaliana protein match is: zinc-binding protein, putative / protein kinase C inhibitor, putative (TAIR:AT3G56490.1); Has 5594 Blast hits to 5592 proteins in 1456 species: Archae - 103; Bacteria - 2673; Metazoa - 341; Fungi - 103; Plants - 63; Viruses - 0; Other Eukaryotes - 2311 (source: NCBI BLink).
AT1G31170AT1G31170.1GTGGGCTTAAGTTGGGCTTTencodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress
AT1G31170.2GTGGGCTTAAGTTGGGCTTTencodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress
AT1G31170.3GTGGGCTTAAGTTGGGCTTTencodes a cysteine-sulfinic acid reductase (sulfiredoxin - EC 1.8.98.2) capable of reducing overoxidized plastidic 2-Cys-Prx involved in peroxide detoxification and response to oxidative stress
AT1G31220AT1G31220.1TCAGCCCATTAAGN10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide
AT1G31240AT1G31240.1TGGGCTCAAACCGGTCDNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: TAF8 (TBP-ASSOCIATED FACTOR 8); DNA binding (TAIR:AT4G34340.1); Has 104 Blast hits to 104 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G31340AT1G31340.1AGCCCAAAAEncodes a ubiquitin-related protein that is conjugated to target proteins by neddylation. It has been shown to be conjugated to the cullin AtCUL1. The RUB-conjugation pathway has been implicated in in auxin response.
AT1G31360AT1G31360.1AAAAGCCCATTTAEncodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro.
AT1G31360.1TTAAGGCCCAATATEncodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro.
AT1G31360.2AAAAGCCCATTTAEncodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro.
AT1G31360.2TTAAGGCCCAATATEncodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro.
AT1G31420AT1G31420.1TAATGGGCCTTAAAAATGGGCCCAATGEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT1G31420.1TAATTGGGEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT1G31420.1TGGGCTTATEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT1G31660AT1G31660.1AGTTGGGCCTAATGGGCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bystin (InterPro:IPR007955); Has 370 Blast hits to 362 proteins in 156 species: Archae - 0; Bacteria - 7; Metazoa - 139; Fungi - 93; Plants - 32; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink).
AT1G31730AT1G31730.1CTATTGGGepsilon-adaptin, putative; FUNCTIONS IN: protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Adaptor protein complex AP-4, epsilon subunit (InterPro:IPR017109), Armadillo-type fold (InterPro:IPR016024), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553); BEST Arabidopsis thaliana protein match is: GAMMA-ADAPTIN 1 (GAMMA-ADAPTIN 1); binding / clathrin binding / protein binding / protein transporter (TAIR:AT1G23900.2); Has 4111 Blast hits to 2632 proteins in 228 species: Archae - 0; Bacteria - 67; Metazoa - 1478; Fungi - 596; Plants - 220; Viruses - 3; Other Eukaryotes - 1747 (source: NCBI BLink).
AT1G31812AT1G31812.1TTATGGGCCTGAAcyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases.
AT1G31814AT1G31814.1TTTGACCCAATAGfamily member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885
AT1G31817AT1G31817.1AGCCCAATANUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink).
AT1G31817.1GAGCCCAATAAGNUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink).
AT1G31817.1GAGGCCCATGNUCLEAR FUSION DEFECTIVE 3 (NFD3); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00750.1); Has 5242 Blast hits to 5242 proteins in 1532 species: Archae - 8; Bacteria - 2826; Metazoa - 58; Fungi - 4; Plants - 484; Viruses - 0; Other Eukaryotes - 1862 (source: NCBI BLink).
AT1G31870AT1G31870.1GGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2050, pre-mRNA-splicing factor (InterPro:IPR018609); Has 11793 Blast hits to 8312 proteins in 386 species: Archae - 8; Bacteria - 320; Metazoa - 6710; Fungi - 1763; Plants - 711; Viruses - 126; Other Eukaryotes - 2155 (source: NCBI BLink).
AT1G31870.2GGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2050, pre-mRNA-splicing factor (InterPro:IPR018609); Has 11793 Blast hits to 8312 proteins in 386 species: Archae - 8; Bacteria - 320; Metazoa - 6710; Fungi - 1763; Plants - 711; Viruses - 126; Other Eukaryotes - 2155 (source: NCBI BLink).
AT1G32050AT1G32050.1AAAACGGCCCATATAsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: secretory carrier membrane protein (SCAMP) family protein (TAIR:AT2G20840.1); Has 522 Blast hits to 522 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 335; Fungi - 12; Plants - 120; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G32050.1GGGCCTACsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: secretory carrier membrane protein (SCAMP) family protein (TAIR:AT2G20840.1); Has 522 Blast hits to 522 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 335; Fungi - 12; Plants - 120; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G32050.1TTAAAGCCCsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: secretory carrier membrane protein (SCAMP) family protein (TAIR:AT2G20840.1); Has 522 Blast hits to 522 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 335; Fungi - 12; Plants - 120; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G32060AT1G32060.1CCCATTTAPHOSPHORIBULOKINASE (PRK); FUNCTIONS IN: protein binding, phosphoribulokinase activity, ATP binding; INVOLVED IN: response to cold, defense response to bacterium, peptidyl-cysteine S-nitrosylation, biosynthetic process; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribulokinase/uridine kinase (InterPro:IPR006083), Phosphoribulokinase (InterPro:IPR006082); BEST Arabidopsis thaliana protein match is: uracil phosphoribosyltransferase, putative / UMP pyrophosphorylase, putative / UPRTase, putative (TAIR:AT3G27440.1); Has 3778 Blast hits to 3778 proteins in 1337 species: Archae - 19; Bacteria - 2109; Metazoa - 288; Fungi - 89; Plants - 839; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink).
AT1G32210AT1G32210.1ATAGGCCCEncodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation.
AT1G32210.1TAAAGCCCAAATEncodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation.
AT1G32220AT1G32220.1ATTTGGGCTTTAbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).
AT1G32220.1GGGCCTATbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).
AT1G32260AT1G32260.1ACGGCCCACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35480.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32260.1ACGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35480.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32260.1TGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35480.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32310AT1G32310.1ACGGGCCTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32310.1TGTTGGGCTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32400AT1G32400.1AGTTGGGCTCTOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, essential for efficient multiplication of tobacco mosaic viruses.
AT1G32400.2AGTTGGGCTCTOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, essential for efficient multiplication of tobacco mosaic viruses.
AT1G32400.3AGTTGGGCTCTOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, essential for efficient multiplication of tobacco mosaic viruses.
AT1G32470AT1G32470.1TGTGGGCCGAAglycine cleavage system H protein, mitochondrial, putative; FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity; INVOLVED IN: glycine catabolic process; LOCATED IN: mitochondrion, glycine cleavage complex, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Single hybrid motif (InterPro:IPR011053), Glycine cleavage H-protein (InterPro:IPR002930), Glycine cleavage H-protein, subgroup (InterPro:IPR017453); BEST Arabidopsis thaliana protein match is: GDCH; glycine dehydrogenase (decarboxylating) (TAIR:AT2G35370.1); Has 4756 Blast hits to 4756 proteins in 1228 species: Archae - 82; Bacteria - 2411; Metazoa - 143; Fungi - 84; Plants - 158; Viruses - 0; Other Eukaryotes - 1878 (source: NCBI BLink).
AT1G32490AT1G32490.1TTGGCCCATTTAEncodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing.
AT1G32500AT1G32500.1GAAGCCCATTTAGCCCAAACEncodes a member of a heterogenous group of non-intrinsic ATP-binding cassette (ABC) proteins. Members of this group bear no close resemblance to each other nor to representatives of specific ABC protein subfamilies from other organisms. This grouping is arbitrary and will likely change upon acquisition of further data.
AT1G32530AT1G32530.1TAATGGGCTCAAAGCCCATAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink).
AT1G32530.1TATATGGGCCCAAATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink).
AT1G32580AT1G32580.1ATTGGCCCATTTAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32580.1TTCGGCCCATTAAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32630AT1G32630.1CAAAGCCCTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 10 Blast hits to 10 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 4; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G32730AT1G32730.1ATATTGGGCTTTAAunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G32730.1CCAGGCCCATATAAAAACGACunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G32730.1GCCCAAACGGCAunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G32730.1TTGGGCTTTTTTTGGGCTTATunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G32870AT1G32870.1TAAATGGGArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT1G32870.2TAAATGGGArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT1G32990AT1G32990.1TAAATGGGCTTGmutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11
AT1G32990.1TTTAGGCCCATTAAGCCCATAAmutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11
AT1G33030AT1G33030.1TAAAAGCCCATTGGGCCTCAO-methyltransferase family 2 protein; FUNCTIONS IN: O-methyltransferase activity; INVOLVED IN: lignin biosynthetic process; LOCATED IN: cytosol; EXPRESSED IN: stem, stamen, leaf; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: ATOMT1 (O-METHYLTRANSFERASE 1); caffeate O-methyltransferase/ myricetin 3'-O-methyltransferase/ quercetin 3-O-methyltransferase (TAIR:AT5G54160.1); Has 2066 Blast hits to 2064 proteins in 423 species: Archae - 0; Bacteria - 584; Metazoa - 76; Fungi - 395; Plants - 923; Viruses - 0; Other Eukaryotes - 88 (source: NCBI BLink).
AT1G33040AT1G33040.1TGAGGCCCAATGGGCTTTTANASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 5 (NACA5); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT4G10480.2); Has 1370 Blast hits to 1229 proteins in 204 species: Archae - 10; Bacteria - 22; Metazoa - 702; Fungi - 200; Plants - 116; Viruses - 18; Other Eukaryotes - 302 (source: NCBI BLink).
AT1G33050AT1G33050.1ATTGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10470.1); Has 485 Blast hits to 194 proteins in 59 species: Archae - 0; Bacteria - 116; Metazoa - 108; Fungi - 45; Plants - 36; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).
AT1G33050.2ATTGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10470.1); Has 485 Blast hits to 194 proteins in 59 species: Archae - 0; Bacteria - 116; Metazoa - 108; Fungi - 45; Plants - 36; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).
AT1G33050.3ATTGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10470.1); Has 485 Blast hits to 194 proteins in 59 species: Archae - 0; Bacteria - 116; Metazoa - 108; Fungi - 45; Plants - 36; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink).
AT1G33110AT1G33110.1CCCAATAAAAATGACGMATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G33090.1); Has 5479 Blast hits to 5447 proteins in 1073 species: Archae - 107; Bacteria - 3568; Metazoa - 119; Fungi - 206; Plants - 704; Viruses - 0; Other Eukaryotes - 775 (source: NCBI BLink).
AT1G33110.2CCCAATAAAAATGACGMATE efflux family protein; FUNCTIONS IN: antiporter activity, drug transporter activity, transporter activity; INVOLVED IN: multidrug transport; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT1G33090.1); Has 5479 Blast hits to 5447 proteins in 1073 species: Archae - 107; Bacteria - 3568; Metazoa - 119; Fungi - 206; Plants - 704; Viruses - 0; Other Eukaryotes - 775 (source: NCBI BLink).
AT1G33120AT1G33120.1AGCCCAATAT60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G33120.1TAAAGGCCCACA60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G33120.1TAGTGGGCTGA60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G33120.1TTATGGGC60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G33120.1TTTAACGGGCCATGGGCTTAT60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G33250AT1G33250.1CTAAGCCCATTCfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G33250.1TACTGGGCCCATATTAGGCCCfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G33250.1TGTTGGGCTTTfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G33290AT1G33290.1TAAAAGCCCATAGGCCCAAAGGCCCATAAsporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).
AT1G33290.2TAAAAGCCCATAGGCCCAAAGGCCCATAAsporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: sporulation protein-related (TAIR:AT3G10420.2); Has 615 Blast hits to 609 proteins in 245 species: Archae - 8; Bacteria - 419; Metazoa - 33; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 94 (source: NCBI BLink).
AT1G33330AT1G33330.1TAAATGGGCCAAGCCCApeptide chain release factor, putative; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); BEST Arabidopsis thaliana protein match is: peptide chain release factor, putative (TAIR:AT1G56350.1); Has 9739 Blast hits to 9739 proteins in 1553 species: Archae - 0; Bacteria - 5377; Metazoa - 210; Fungi - 152; Plants - 96; Viruses - 10; Other Eukaryotes - 3894 (source: NCBI BLink).
AT1G33390AT1G33390.1ATTTGGGChelicase domain-containing protein; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: helicase domain-containing protein (TAIR:AT1G48650.2); Has 11093 Blast hits to 6432 proteins in 948 species: Archae - 0; Bacteria - 3704; Metazoa - 3089; Fungi - 1453; Plants - 542; Viruses - 298; Other Eukaryotes - 2007 (source: NCBI BLink).
AT1G33410AT1G33410.1CTAGGCCCAATAAsuppressor of auxin resistance1 (SAR1); INVOLVED IN: response to auxin stimulus, mRNA export from nucleus, developmental process; LOCATED IN: nuclear membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 129 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 24; Plants - 26; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G33410.1TAAATGGGCCGTAsuppressor of auxin resistance1 (SAR1); INVOLVED IN: response to auxin stimulus, mRNA export from nucleus, developmental process; LOCATED IN: nuclear membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 129 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 24; Plants - 26; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G33490AT1G33490.1ATAAAGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G33490.1TAAAAGCCCATTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G33500AT1G33500.1ATAATGGGCTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink).
AT1G33500.1TAATTGGGCTTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink).
AT1G33520AT1G33520.1ATATGGGCCTAACHas single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4;
AT1G33520.1TCGGCCCATATAHas single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4;
AT1G33610AT1G33610.1TATATGGGprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, root, petiole, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.02 two leaves visible, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210); BEST Arabidopsis thaliana protein match is: disease resistance protein-related / LRR protein-related (TAIR:AT1G33590.1); Has 79875 Blast hits to 20687 proteins in 757 species: Archae - 36; Bacteria - 5035; Metazoa - 29153; Fungi - 774; Plants - 39232; Viruses - 6; Other Eukaryotes - 5639 (source: NCBI BLink).
AT1G33680AT1G33680.1ATAGGCCCATRNA binding / nucleic acid binding; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G10070.1); Has 44280 Blast hits to 25473 proteins in 1107 species: Archae - 50; Bacteria - 4243; Metazoa - 22643; Fungi - 6988; Plants - 3074; Viruses - 316; Other Eukaryotes - 6966 (source: NCBI BLink).
AT1G33680.1ATGGGCTAARNA binding / nucleic acid binding; FUNCTIONS IN: RNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087), K Homology, type 1, subgroup (InterPro:IPR018111), K Homology, type 1 (InterPro:IPR004088); BEST Arabidopsis thaliana protein match is: KH domain-containing protein (TAIR:AT4G10070.1); Has 44280 Blast hits to 25473 proteins in 1107 species: Archae - 50; Bacteria - 4243; Metazoa - 22643; Fungi - 6988; Plants - 3074; Viruses - 316; Other Eukaryotes - 6966 (source: NCBI BLink).
AT1G33780AT1G33780.1TTATGGGCTTAGCCCACTAunknown protein; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF179 (InterPro:IPR003774); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29240.2); Has 1773 Blast hits to 1773 proteins in 611 species: Archae - 0; Bacteria - 1186; Metazoa - 0; Fungi - 0; Plants - 65; Viruses - 0; Other Eukaryotes - 522 (source: NCBI BLink).
AT1G33810AT1G33810.1ACGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_proc