version

Summary of AAACG(C/G) (All List)

Organism Arabidopsis thaliana
PPDB Motif AAACG(C/G)
Description function unknown
Total Entry Count 2007

Entry Sequences (2007 entries)

LocusGene modelSequenceDescription
AT1G01010AT1G01010.1AAACGCTGArabidopsis NAC domain containing protein 1 (ANAC001); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac069 (Arabidopsis NAC domain containing protein 69); transcription factor (TAIR:AT4G01550.1); Has 1331 Blast hits to 1329 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1331; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01630AT1G01630.1AAAACGGCSEC14 cytosolic factor, putative / phosphoglyceride transfer protein, putative; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT1G14820.3); Has 2114 Blast hits to 2114 proteins in 176 species: Archae - 0; Bacteria - 0; Metazoa - 944; Fungi - 440; Plants - 452; Viruses - 0; Other Eukaryotes - 278 (source: NCBI BLink).
AT1G01650AT1G01650.1CAGCGTTTTAaspartic-type endopeptidase/ peptidase; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: protease-associated (PA) domain-containing protein (TAIR:AT1G63690.1); Has 1108 Blast hits to 1084 proteins in 196 species: Archae - 0; Bacteria - 119; Metazoa - 534; Fungi - 104; Plants - 174; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).
AT1G01730AT1G01730.1TGCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 4; Fungi - 2; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G01790AT1G01790.1AAAACGGCCTTAGK efflux antiporter KEA1
AT1G01840AT1G01840.1TTAAAGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G02000AT1G02000.1AAAACGGCAUDP-D-glucuronate 4-epimerase
AT1G02080AT1G02080.1CAAAACGCtranscriptional regulator-related; FUNCTIONS IN: transcription regulator activity; LOCATED IN: membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CCR4-Not complex component, Not1 (InterPro:IPR007196); Has 1072 Blast hits to 502 proteins in 170 species: Archae - 0; Bacteria - 115; Metazoa - 354; Fungi - 245; Plants - 79; Viruses - 0; Other Eukaryotes - 279 (source: NCBI BLink).
AT1G02370AT1G02370.1ACGCCGTTTTpentatricopeptide (PPR) repeat-containing protein; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G01990.1); Has 3083 Blast hits to 1840 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 43; Fungi - 27; Plants - 2899; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink).
AT1G02560AT1G02560.1CGCGTTTTGOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).
AT1G02810AT1G02810.1ACGCGTTTTpectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: ATPMEPCRB; pectinesterase (TAIR:AT4G02330.1); Has 1267 Blast hits to 1233 proteins in 181 species: Archae - 0; Bacteria - 238; Metazoa - 5; Fungi - 135; Plants - 888; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G02860AT1G02860.1CGTTTTGACTTTEncodes a likely ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses.
AT1G02860.2CGTTTTGACTTTEncodes a likely ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses.
AT1G02920AT1G02920.1CGCCGTTTEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G02930AT1G02930.1CGCCGTTTEncodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G03130AT1G03130.1TCAAAACGEncodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2)
AT1G03310AT1G03310.1AAAACGGCAEncodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex.
AT1G03310.2AAAACGGCAEncodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex.
AT1G03970AT1G03970.1ACGCGTTTencodes a basic leucine zipper G-box binding factor that can bind to G-box motifs only as heterodimers with GBF2 or GBF3. A single amino acid change can confer G-box binding as homodimers.
AT1G04070AT1G04070.1GGCCCGTTASubunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.
AT1G04080AT1G04080.1TAACGGGCCPRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink).
AT1G04260AT1G04260.1GCGTTTTGEncodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.
AT1G04260.1TTAATGGGCCTTTAAEncodes protein that interacts with CaMV movement protein. Colocalizes in the cytoplasm with the movement protein. Has similarity to mammalian proteins (such as the rat PRA1) which have been described as rab acceptors.
AT1G04270AT1G04270.1CGTTTTGAEncodes cytosolic ribosomal protein S15.
AT1G04270.2CGTTTTGAEncodes cytosolic ribosomal protein S15.
AT1G04710AT1G04710.1GGCGTTTTEC2.3.1.16 thiolase.
AT1G04750AT1G04750.1CGTTTTGAvesicle-associated membrane protein 7B (At VAMP7B) mRNA,
AT1G04750.2CGTTTTGAvesicle-associated membrane protein 7B (At VAMP7B) mRNA,
AT1G05170AT1G05170.1GCGTTTTGgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, 4 leaf senescence stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT2G32430.1); Has 928 Blast hits to 924 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 0; Plants - 320; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G05170.2GCGTTTTGgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, 4 leaf senescence stage, petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT2G32430.1); Has 928 Blast hits to 924 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 0; Plants - 320; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G05580AT1G05580.1GCCGTTTAmember of Putative Na+/H+ antiporter family
AT1G05580.2GCCGTTTAmember of Putative Na+/H+ antiporter family
AT1G05830AT1G05830.1AAAACGGCGTCGTEncodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1.
AT1G05830.2AAAACGGCGTCGTEncodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1.
AT1G05900AT1G05900.1CGCCGTTTTendonuclease-related; FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, sequence-specific DNA binding, DNA binding, catalytic activity, endonuclease activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Endonuclease III-like, iron-sulphur cluster loop (InterPro:IPR003651), Endonuclease III, conserved site-2 (InterPro:IPR004036), Helix-hairpin-helix motif (InterPro:IPR000445), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: endonuclease-related (TAIR:AT2G31450.1); Has 9734 Blast hits to 9731 proteins in 1448 species: Archae - 228; Bacteria - 5250; Metazoa - 197; Fungi - 131; Plants - 86; Viruses - 0; Other Eukaryotes - 3842 (source: NCBI BLink).
AT1G05900.2CGCCGTTTTendonuclease-related; FUNCTIONS IN: 4 iron, 4 sulfur cluster binding, sequence-specific DNA binding, DNA binding, catalytic activity, endonuclease activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Endonuclease III-like, iron-sulphur cluster loop (InterPro:IPR003651), Endonuclease III, conserved site-2 (InterPro:IPR004036), Helix-hairpin-helix motif (InterPro:IPR000445), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: endonuclease-related (TAIR:AT2G31450.1); Has 9734 Blast hits to 9731 proteins in 1448 species: Archae - 228; Bacteria - 5250; Metazoa - 197; Fungi - 131; Plants - 86; Viruses - 0; Other Eukaryotes - 3842 (source: NCBI BLink).
AT1G06145AT1G06145.1AAACGCTGEMBRYO DEFECTIVE 1444 (EMB1444); INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 13972 Blast hits to 5050 proteins in 152 species: Archae - 1; Bacteria - 4; Metazoa - 54; Fungi - 73; Plants - 13519; Viruses - 0; Other Eukaryotes - 321 (source: NCBI BLink).
AT1G06220AT1G06220.1CAAAACGCEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.
AT1G06220.2CAAAACGCEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.
AT1G06290AT1G06290.1TAAACGGCEncodes an acyl-CoA oxidase with specificity for medium chain fatty acids.
AT1G06460AT1G06460.1CGCGTTTTGAACD32.1 encodes an alpha-crystallin domain containing protein with homology to small heat shock proteins.
AT1G06470AT1G06470.1TCAAAACGCGphosphate translocator-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT5G25400.1); Has 1538 Blast hits to 1535 proteins in 209 species: Archae - 2; Bacteria - 63; Metazoa - 491; Fungi - 247; Plants - 571; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink).
AT1G06470.2TCAAAACGCGphosphate translocator-related; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT5G25400.1); Has 1538 Blast hits to 1535 proteins in 209 species: Archae - 2; Bacteria - 63; Metazoa - 491; Fungi - 247; Plants - 571; Viruses - 0; Other Eukaryotes - 164 (source: NCBI BLink).
AT1G06700AT1G06700.1AAAACGCCserine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).
AT1G06700.2AAAACGCCserine/threonine protein kinase, putative; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase, active site (InterPro:IPR008266), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G30740.1); Has 80916 Blast hits to 79948 proteins in 3116 species: Archae - 48; Bacteria - 7582; Metazoa - 35663; Fungi - 6087; Plants - 17766; Viruses - 321; Other Eukaryotes - 13449 (source: NCBI BLink).
AT1G06820AT1G06820.1TTAAAGGCEncodes carotenoid isomerase. Catalyzes the isomerization of poly-cis-carotenoids to all-trans-carotenoids. Together with PDS and ZDS, CRTiso is required to complete the synthesis of lycopene from phytoene.
AT1G06900AT1G06900.1AAAACGGCAcatalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink).
AT1G06900.1AAACGCGTGTCGTTTTcatalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink).
AT1G06900.1TAAACGGCcatalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink).
AT1G06900.1TGCCGTTTcatalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding; FUNCTIONS IN: metalloendopeptidase activity, catalytic activity, zinc ion binding, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT2G41790.1); Has 36095 Blast hits to 16198 proteins in 1364 species: Archae - 66; Bacteria - 4521; Metazoa - 14084; Fungi - 4071; Plants - 1728; Viruses - 678; Other Eukaryotes - 10947 (source: NCBI BLink).
AT1G07170AT1G07170.1GCCTTTAALOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT1G07170.2GCCTTTAALOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30000.1); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT1G07180AT1G07180.1AAAACGCCInternal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane.
AT1G07210AT1G07210.1TTAAAGGCCTTAT30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink).
AT1G07400AT1G07400.1AGCCCATTATAGCCCATAAAACGC17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink).
AT1G07670AT1G07670.1TCAAAACGcalcium-transporting ATPase; FUNCTIONS IN: calcium-transporting ATPase activity; INVOLVED IN: cation transport, calcium ion transport, metabolic process, ATP biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: guard cell, callus, cultured cell; CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, calcium-transporting (InterPro:IPR005782), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type phosphorylation site (InterPro:IPR018303), ATPase, P-type cation-transporter, C-terminal (InterPro:IPR006068); BEST Arabidopsis thaliana protein match is: ECA1 (ER-TYPE CA2+-ATPASE 1); calcium-transporting ATPase (TAIR:AT1G07810.1); Has 28836 Blast hits to 19765 proteins in 1902 species: Archae - 663; Bacteria - 17966; Metazoa - 3771; Fungi - 1873; Plants - 1364; Viruses - 3; Other Eukaryotes - 3196 (source: NCBI BLink).
AT1G07750AT1G07750.1TCAAAACGCCcupin family protein; FUNCTIONS IN: nutrient reservoir activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cupin, RmlC-type (InterPro:IPR011051), Cupin 1 (InterPro:IPR006045), RmlC-like jelly roll fold (InterPro:IPR014710), 11-S plant seed storage protein (InterPro:IPR006044); BEST Arabidopsis thaliana protein match is: cupin family protein (TAIR:AT2G28680.1); Has 689 Blast hits to 606 proteins in 95 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 685; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G07930AT1G07930.1CAGCGTTTelongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: cotyledon, male gametophyte, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).
AT1G07930.2CAGCGTTTelongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, vacuole; EXPRESSED IN: cotyledon, male gametophyte, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT5G60390.3); Has 56800 Blast hits to 56727 proteins in 13736 species: Archae - 656; Bacteria - 18781; Metazoa - 15486; Fungi - 8697; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).
AT1G08010AT1G08010.1TAAAACGCGTzinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT1G08000.2); Has 927 Blast hits to 903 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 418; Plants - 418; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G08010.2TAAAACGCGTzinc finger (GATA type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: zinc finger (GATA type) family protein (TAIR:AT1G08000.2); Has 927 Blast hits to 903 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 418; Plants - 418; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G08370AT1G08370.1CGTTTTGAEncodes DCP1 involved in mRNA decapping. DCP1 forms a mRNA decapping complex with DCP2 (At5g13570) and VCS (VARICOSE) (At3g13300). However, unlike DCP2, DCP1 itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP2.
AT1G09300AT1G09300.1GCGTTTTAmetallopeptidase M24 family protein; FUNCTIONS IN: metallopeptidase activity, manganese ion binding, metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, cellular process; LOCATED IN: mitochondrion; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714); BEST Arabidopsis thaliana protein match is: aminopeptidase/ manganese ion binding (TAIR:AT4G29490.1); Has 10472 Blast hits to 10446 proteins in 1515 species: Archae - 187; Bacteria - 5828; Metazoa - 520; Fungi - 371; Plants - 118; Viruses - 0; Other Eukaryotes - 3448 (source: NCBI BLink).
AT1G09300.2GCGTTTTAmetallopeptidase M24 family protein; FUNCTIONS IN: metallopeptidase activity, manganese ion binding, metalloexopeptidase activity, aminopeptidase activity; INVOLVED IN: proteolysis, cellular process; LOCATED IN: mitochondrion; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994), Peptidase M24, methionine aminopeptidase (InterPro:IPR001714); BEST Arabidopsis thaliana protein match is: aminopeptidase/ manganese ion binding (TAIR:AT4G29490.1); Has 10472 Blast hits to 10446 proteins in 1515 species: Archae - 187; Bacteria - 5828; Metazoa - 520; Fungi - 371; Plants - 118; Viruses - 0; Other Eukaryotes - 3448 (source: NCBI BLink).
AT1G09380AT1G09380.1CAAAACGCCintegral membrane family protein / nodulin MtN21-related; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G07050.1); Has 3622 Blast hits to 3602 proteins in 598 species: Archae - 50; Bacteria - 1859; Metazoa - 6; Fungi - 2; Plants - 646; Viruses - 0; Other Eukaryotes - 1059 (source: NCBI BLink).
AT1G09590AT1G09590.1ACAGGCCCGTTA60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G09760AT1G09760.1CAATGGGCCGTTTAU2 small nuclear ribonucleoprotein A (U2A'); FUNCTIONS IN: protein binding; INVOLVED IN: nuclear mRNA splicing, via spliceosome, response to cold; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: U2A'/phosphoprotein 32 family A, C-terminal (InterPro:IPR003603); Has 5479 Blast hits to 4495 proteins in 302 species: Archae - 0; Bacteria - 1581; Metazoa - 2979; Fungi - 220; Plants - 106; Viruses - 2; Other Eukaryotes - 591 (source: NCBI BLink).
AT1G09770AT1G09770.1TAAACGGCCCATTGMember of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1.
AT1G09850AT1G09850.1CAGCGTTTTGArabidopsis thaliana papain-like cysteine peptidase
AT1G09850.1TAAAACGCCArabidopsis thaliana papain-like cysteine peptidase
AT1G10180AT1G10180.1TGCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49830.1); Has 70 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G10340AT1G10340.1GCGTTTTAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT2G24600.3); Has 18692 Blast hits to 10007 proteins in 394 species: Archae - 19; Bacteria - 1110; Metazoa - 11135; Fungi - 977; Plants - 1495; Viruses - 133; Other Eukaryotes - 3823 (source: NCBI BLink).
AT1G10340.2GCGTTTTAankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT2G24600.3); Has 18692 Blast hits to 10007 proteins in 394 species: Archae - 19; Bacteria - 1110; Metazoa - 11135; Fungi - 977; Plants - 1495; Viruses - 133; Other Eukaryotes - 3823 (source: NCBI BLink).
AT1G10610AT1G10610.1GCCGTTTTDNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: AMS (ABORTED MICROSPORES); DNA binding / transcription factor (TAIR:AT2G16910.1); Has 798 Blast hits to 792 proteins in 87 species: Archae - 0; Bacteria - 6; Metazoa - 60; Fungi - 5; Plants - 716; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G10770AT1G10770.1CAAAACGCGinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G60760.1); Has 92 Blast hits to 92 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 92; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G10820AT1G10820.1TTAAAGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G60670.2); Has 91 Blast hits to 91 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G10820.2TTAAAGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G60670.2); Has 91 Blast hits to 91 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 85; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G10865AT1G10865.1TCAAAACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G10865.2TCAAAACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase assembly protein PET191, N-terminal (InterPro:IPR018793); Has 170 Blast hits to 170 proteins in 83 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 61; Plants - 21; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G10910AT1G10910.1AAAACGCGINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G10910.1AAAACGGCGTINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G10910.1TATGGCCCGTTAINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G11680AT1G11680.1ACGCCGTTputative obtusifoliol 14-alpha demethylase involved in sterol biosynthesis.
AT1G11890AT1G11890.1CAAAACGCGTmember of SEC22 Gene Family
AT1G11960AT1G11960.1CAGCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT1G62320.1); Has 746 Blast hits to 706 proteins in 111 species: Archae - 0; Bacteria - 4; Metazoa - 131; Fungi - 370; Plants - 224; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT1G12030AT1G12030.1CAAAACGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: pollen tube, leaf; EXPRESSED DURING: LP.04 four leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62420.1); Has 213 Blast hits to 213 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 211; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G12380AT1G12380.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62870.1); Has 97 Blast hits to 97 proteins in 28 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 8; Plants - 48; Viruses - 6; Other Eukaryotes - 6 (source: NCBI BLink).
AT1G12920AT1G12920.1TAAACGGCACGEncodes a eukaryotic release factor one homolog.
AT1G12990AT1G12990.1AAACGCTGglycosyl transferase family 17 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: protein amino acid N-linked glycosylation; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 17 (InterPro:IPR006813); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 17 protein (TAIR:AT1G67880.1); Has 972 Blast hits to 971 proteins in 58 species: Archae - 0; Bacteria - 24; Metazoa - 46; Fungi - 23; Plants - 68; Viruses - 4; Other Eukaryotes - 807 (source: NCBI BLink).
AT1G13220AT1G13220.1TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13220.2TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13370AT1G13370.1GCCTTTAAhistone H3, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, chloroplast, nucleosome; EXPRESSED IN: flower, inflorescence, root, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3 (TAIR:AT5G10980.1); Has 10206 Blast hits to 10203 proteins in 5279 species: Archae - 0; Bacteria - 0; Metazoa - 7337; Fungi - 1299; Plants - 998; Viruses - 0; Other Eukaryotes - 572 (source: NCBI BLink).
AT1G13390AT1G13390.1GCGTTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68490.1); Has 53 Blast hits to 53 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13390.2GCGTTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68490.1); Has 53 Blast hits to 53 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G13820AT1G13820.1CAGCGTTTTAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G39220.1); Has 5140 Blast hits to 5134 proteins in 762 species: Archae - 39; Bacteria - 3125; Metazoa - 236; Fungi - 50; Plants - 322; Viruses - 0; Other Eukaryotes - 1368 (source: NCBI BLink).
AT1G13960AT1G13960.1CGTTTTGAEncodes WRKY DNA-binding protein 4 (WRKY4).
AT1G13960.2CGTTTTGAEncodes WRKY DNA-binding protein 4 (WRKY4).
AT1G13970AT1G13970.1TAAAACGCTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1336 (InterPro:IPR009769); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G29180.1); Has 129 Blast hits to 129 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 114; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G14030AT1G14030.1ATAATGGGCCTTTAAribulose-1,5 bisphosphate carboxylase oxygenase large subunit N-methyltransferase, putative; FUNCTIONS IN: [ribulose-bisphosphate carboxylase]-lysine N-methyltransferase activity; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rubisco methyltransferase (InterPro:IPR011192), SET (InterPro:IPR001214), Rubisco LSMT substrate-binding (InterPro:IPR015353); BEST Arabidopsis thaliana protein match is: SET domain-containing protein (TAIR:AT3G07670.1); Has 838 Blast hits to 833 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 218; Plants - 233; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).
AT1G14240AT1G14240.1GCCGTTTTGAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT1G14240.2GCCGTTTTGAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT1G14240.3GCCGTTTTGAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT1G14240.4GCCGTTTTGAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1092 Blast hits to 1087 proteins in 171 species: Archae - 0; Bacteria - 20; Metazoa - 528; Fungi - 214; Plants - 197; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT1G14340AT1G14340.1TAAACGGCGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / oxidoreductase (TAIR:AT3G01210.1); Has 201 Blast hits to 201 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 59; Plants - 135; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14340.1TTAAAGGCCCAACARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / oxidoreductase (TAIR:AT3G01210.1); Has 201 Blast hits to 201 proteins in 49 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 59; Plants - 135; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14345AT1G14345.1TCAAAACGoxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); Has 255 Blast hits to 255 proteins in 67 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT1G14360AT1G14360.1AAAACGGCAUDP-GALACTOSE TRANSPORTER 3 (UTR3); FUNCTIONS IN: pyrimidine nucleotide sugar transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UAA transporter (InterPro:IPR013657); BEST Arabidopsis thaliana protein match is: UTR1 (UDP-GALACTOSE TRANSPORTER 1); UDP-galactose transmembrane transporter/ UDP-glucose transmembrane transporter/ pyrimidine nucleotide sugar transmembrane transporter (TAIR:AT2G02810.1); Has 750 Blast hits to 744 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 423; Fungi - 103; Plants - 108; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).
AT1G14380AT1G14380.1GCCTTTAAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).
AT1G14380.2GCCTTTAAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).
AT1G14380.3GCCTTTAAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink).
AT1G14590AT1G14590.1CGCAGCGTTTTGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14590.1CGCAGCGTTTTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14590.1CGCAGCGTTTTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen; CONTAINS InterPro DOMAIN/s: Nucleotide-diphospho-sugar transferase, predicted (InterPro:IPR005069); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02061.1); Has 179 Blast hits to 175 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 172; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G14650AT1G14650.1GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G14650.2GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G14660AT1G14660.1CGTTTTGAmember of putative Na+/H+ antiporter (AtNHX) family. Functions as a plasma membrane Li+/H+ antiporter. Involved in Li+ efflux and detoxification.
AT1G14685AT1G14685.1AAACGCTGArabidopsis GBP Basic Penta Cysteine 1
AT1G14685.2AAACGCTGArabidopsis GBP Basic Penta Cysteine 1
AT1G14685.3AAACGCTGArabidopsis GBP Basic Penta Cysteine 1
AT1G14830AT1G14830.1ACGCGTTTEncodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts.
AT1G14940AT1G14940.1GCCGTTTTmajor latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT1G14930.1); Has 223 Blast hits to 201 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 223; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15010AT1G15010.1GCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G01300.1); Has 43 Blast hits to 42 proteins in 8 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15130AT1G15130.1ACGCCGTTTThydroxyproline-rich glycoprotein family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: BRO1 (InterPro:IPR004328); Has 24106 Blast hits to 13529 proteins in 779 species: Archae - 27; Bacteria - 1802; Metazoa - 9356; Fungi - 3772; Plants - 5606; Viruses - 598; Other Eukaryotes - 2945 (source: NCBI BLink).
AT1G15270AT1G15270.1TTTAACGGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G15280AT1G15280.1TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.2TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15330AT1G15330.1TACTGGGCCGTTCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G15410AT1G15410.1GCCGTTTAaspartate-glutamate racemase family; FUNCTIONS IN: racemase and epimerase activity, acting on amino acids and derivatives; INVOLVED IN: amino acid metabolic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Asp/Glu/hydantoin racemase (InterPro:IPR015942), Aspartate racemase (InterPro:IPR004380), Asp/Glu racemase (InterPro:IPR001920); Has 1506 Blast hits to 1496 proteins in 349 species: Archae - 38; Bacteria - 814; Metazoa - 0; Fungi - 2; Plants - 18; Viruses - 0; Other Eukaryotes - 634 (source: NCBI BLink).
AT1G15430AT1G15430.1GCCGTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G15430.2GCCGTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G80220.1); Has 144 Blast hits to 135 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 144; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G16080AT1G16080.1TGCCGTTTTunknown protein; LOCATED IN: apoplast, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 18 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G16080.1TGCCGTTTTunknown protein; LOCATED IN: apoplast, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 18 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G16190AT1G16190.1GCGTTTTGDNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink).
AT1G16190.1TCAAAACGDNA repair protein RAD23, putative; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: protein modification process, proteasomal ubiquitin-dependent protein catabolic process, base-excision repair, nucleotide-excision repair; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), UV excision repair protein Rad23 (InterPro:IPR004806), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin (InterPro:IPR000626), UV excision repair protein Rad23, C-terminal (InterPro:IPR014761), XPC-binding domain (InterPro:IPR015360), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: RAD23; damaged DNA binding (TAIR:AT1G79650.2); Has 6642 Blast hits to 3540 proteins in 541 species: Archae - 2; Bacteria - 30; Metazoa - 2967; Fungi - 872; Plants - 1499; Viruses - 130; Other Eukaryotes - 1142 (source: NCBI BLink).
AT1G16460AT1G16460.1GCGTTTTAencodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase.
AT1G16460.2GCGTTTTAencodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase.
AT1G16460.3GCGTTTTAencodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase.
AT1G16470AT1G16470.1TAAAACGCEncodes 20S proteasome subunit PAB1 (PAB1).
AT1G16470.2TAAAACGCEncodes 20S proteasome subunit PAB1 (PAB1).
AT1G16905AT1G16905.1CGTTTTGAsugar binding; FUNCTIONS IN: sugar binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480); BEST Arabidopsis thaliana protein match is: curculin-like (mannose-binding) lectin family protein (TAIR:AT1G78860.1); Has 1413 Blast hits to 1382 proteins in 73 species: Archae - 0; Bacteria - 26; Metazoa - 0; Fungi - 0; Plants - 1385; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G17070AT1G17070.1GCGTTTTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G17270AT1G17270.1AAAACGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G50420.1); Has 68 Blast hits to 68 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G17455AT1G17455.1GGGCCGTTTTELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G17455.2GGGCCGTTTTELF4-Like 4 (ELF4-L4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1313 (InterPro:IPR009741); BEST Arabidopsis thaliana protein match is: ELF4-L2 (ELF4-Like 2) (TAIR:AT1G72630.1); Has 69 Blast hits to 68 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G17470AT1G17470.1CGCAGCGTTTEncodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues.
AT1G17470.1CGCAGCGTTTEncodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues.
AT1G17470.2CGCAGCGTTTEncodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues.
AT1G17470.2CGCAGCGTTTEncodes a member of the DRG (developmentally regulated G-protein) family expressed throughout the plant, with highest expression in actively growing tissues.
AT1G17690AT1G17690.1CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1253 (InterPro:IPR010678); Has 24487 Blast hits to 12385 proteins in 666 species: Archae - 70; Bacteria - 4843; Metazoa - 8327; Fungi - 2833; Plants - 863; Viruses - 487; Other Eukaryotes - 7064 (source: NCBI BLink).
AT1G18270AT1G18270.1TTAAAGGCketose-bisphosphate aldolase class-II family protein; FUNCTIONS IN: in 8 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, glycolysis, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Ketose-bisphosphate aldolase, class-II (InterPro:IPR000771), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71170.1); Has 23566 Blast hits to 15271 proteins in 1513 species: Archae - 155; Bacteria - 12191; Metazoa - 519; Fungi - 517; Plants - 221; Viruses - 0; Other Eukaryotes - 9963 (source: NCBI BLink).
AT1G18270.2TTAAAGGCketose-bisphosphate aldolase class-II family protein; FUNCTIONS IN: in 8 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, glycolysis, metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), Ketose-bisphosphate aldolase, class-II (InterPro:IPR000771), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase NAD-binding domain-containing protein (TAIR:AT1G71170.1); Has 23566 Blast hits to 15271 proteins in 1513 species: Archae - 155; Bacteria - 12191; Metazoa - 519; Fungi - 517; Plants - 221; Viruses - 0; Other Eukaryotes - 9963 (source: NCBI BLink).
AT1G18360AT1G18360.1GCGTTTTAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G73480.1); Has 3797 Blast hits to 3785 proteins in 942 species: Archae - 19; Bacteria - 2420; Metazoa - 132; Fungi - 101; Plants - 246; Viruses - 60; Other Eukaryotes - 819 (source: NCBI BLink).
AT1G18470AT1G18470.1ACGCGTTTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G73950.1); Has 2136 Blast hits to 2130 proteins in 191 species: Archae - 0; Bacteria - 0; Metazoa - 1341; Fungi - 16; Plants - 291; Viruses - 220; Other Eukaryotes - 268 (source: NCBI BLink).
AT1G18470.2ACGCGTTTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G73950.1); Has 2136 Blast hits to 2130 proteins in 191 species: Archae - 0; Bacteria - 0; Metazoa - 1341; Fungi - 16; Plants - 291; Viruses - 220; Other Eukaryotes - 268 (source: NCBI BLink).
AT1G18850AT1G18850.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G18950AT1G18950.1AAAACGACAGCGTTTaminoacyl-tRNA synthetase family; FUNCTIONS IN: aminoacyl-tRNA ligase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25580.1); Has 20587 Blast hits to 12449 proteins in 605 species: Archae - 33; Bacteria - 1436; Metazoa - 9619; Fungi - 2230; Plants - 832; Viruses - 219; Other Eukaryotes - 6218 (source: NCBI BLink).
AT1G19140AT1G19140.1AAAACGCCCAATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19140.2AAAACGCCCAATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquinone biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COQ9 (InterPro:IPR013718), Ubiquinone biosynthesis protein COQ9 (InterPro:IPR012762); Has 598 Blast hits to 598 proteins in 175 species: Archae - 0; Bacteria - 149; Metazoa - 114; Fungi - 60; Plants - 22; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT1G19150AT1G19150.1AATTGGGCGTTTTPSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA,
AT1G19350AT1G19350.1TCAAAACGCGEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.4TCAAAACGCGEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.5TCAAAACGCGEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.6TCAAAACGCGEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19540AT1G19540.1GGGCCGTTCGGTTisoflavone reductase, putative; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: isoflavone reductase, putative (TAIR:AT1G75280.1); Has 1273 Blast hits to 1271 proteins in 317 species: Archae - 2; Bacteria - 478; Metazoa - 4; Fungi - 289; Plants - 363; Viruses - 7; Other Eukaryotes - 130 (source: NCBI BLink).
AT1G19710AT1G19710.1AAAACGGCGTglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink).
AT1G19710.1AAACGGCAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G75420.1); Has 4243 Blast hits to 4240 proteins in 780 species: Archae - 115; Bacteria - 2336; Metazoa - 83; Fungi - 27; Plants - 65; Viruses - 0; Other Eukaryotes - 1617 (source: NCBI BLink).
AT1G19910AT1G19910.1GCCTTTAAvacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2)
AT1G20340AT1G20340.1AAAACGCCACGTCATrecombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis.
AT1G20350AT1G20350.1ATGACGTGGCGTTTTmitochondrial inner membrane translocase
AT1G20370AT1G20370.1ATTTGGGCTTAAAGGCCCAATATtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G76120.1); Has 2413 Blast hits to 2196 proteins in 790 species: Archae - 88; Bacteria - 1223; Metazoa - 281; Fungi - 214; Plants - 87; Viruses - 0; Other Eukaryotes - 520 (source: NCBI BLink).
AT1G20810AT1G20810.1GCCTTTAAimmunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT3G10060.1); Has 1226 Blast hits to 1216 proteins in 397 species: Archae - 0; Bacteria - 652; Metazoa - 72; Fungi - 47; Plants - 158; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).
AT1G20810.1TAAAACGCimmunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT3G10060.1); Has 1226 Blast hits to 1216 proteins in 397 species: Archae - 0; Bacteria - 652; Metazoa - 72; Fungi - 47; Plants - 158; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).
AT1G20830AT1G20830.1AACGGCCCAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20840AT1G20840.1TCAAAACGThe protein encoded by this gene is found in the tonoplast (vacuole membrane) of Arabidopsis cells. The gene is expressed at highest levels in juvenile (sink) and adult (source) leaves, followed by flower tissues.
AT1G20920AT1G20920.2CGTTTTGADEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT3G09620.1); Has 311341 Blast hits to 125887 proteins in 2991 species: Archae - 1477; Bacteria - 39060; Metazoa - 141008; Fungi - 36045; Plants - 14531; Viruses - 1599; Other Eukaryotes - 77621 (source: NCBI BLink).
AT1G20960AT1G20960.1TCAAAACGGCAembryo defective 1507 (emb1507); FUNCTIONS IN: in 6 functions; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: nucleolus, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Sec63 domain (InterPro:IPR004179), Sec63 domain, subgroup (InterPro:IPR018127), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: U5 small nuclear ribonucleoprotein helicase, putative (TAIR:AT2G42270.1); Has 13822 Blast hits to 8453 proteins in 1026 species: Archae - 1055; Bacteria - 3787; Metazoa - 2595; Fungi - 1690; Plants - 529; Viruses - 118; Other Eukaryotes - 4048 (source: NCBI BLink).
AT1G21050AT1G21050.1TGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76610.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21080AT1G21080.1AAAACGCGTGGCGADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT1G76700.1); Has 15885 Blast hits to 15795 proteins in 1909 species: Archae - 104; Bacteria - 5202; Metazoa - 3341; Fungi - 1479; Plants - 1172; Viruses - 17; Other Eukaryotes - 4570 (source: NCBI BLink).
AT1G21110AT1G21110.1GCCTTTAAO-methyltransferase, putative; FUNCTIONS IN: methyltransferase activity, O-methyltransferase activity, protein dimerization activity; LOCATED IN: cytosol; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Plant methyltransferase dimerisation (InterPro:IPR012967), O-methyltransferase, family 2 (InterPro:IPR001077), O-methyltransferase, COMT, eukaryota (InterPro:IPR016461); BEST Arabidopsis thaliana protein match is: O-methyltransferase, putative (TAIR:AT1G21120.1); Has 2067 Blast hits to 2064 proteins in 410 species: Archae - 0; Bacteria - 560; Metazoa - 81; Fungi - 421; Plants - 923; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink).
AT1G21160AT1G21160.1CAAAACGCGTP binding / GTPase/ translation initiation factor; FUNCTIONS IN: GTP binding, GTPase activity, translation initiation factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation initiation factor 2 related (InterPro:IPR015760), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 2 family protein / eIF-2 family protein (TAIR:AT1G76810.1); Has 71507 Blast hits to 54819 proteins in 2426 species: Archae - 693; Bacteria - 21506; Metazoa - 19210; Fungi - 4963; Plants - 1848; Viruses - 213; Other Eukaryotes - 23074 (source: NCBI BLink).
AT1G21170AT1G21170.1GCGTTTTGSEC5B; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen germination, pollen tube growth; LOCATED IN: cytosol; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: SEC5A (EXOCYST COMPLEX COMPONENT SEC5) (TAIR:AT1G76850.1); Has 651 Blast hits to 643 proteins in 149 species: Archae - 0; Bacteria - 21; Metazoa - 353; Fungi - 111; Plants - 82; Viruses - 8; Other Eukaryotes - 76 (source: NCBI BLink).
AT1G21380AT1G21380.1AAACGCGTTTVHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Target of Myb protein 1 (InterPro:IPR014645), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT1G76970.1); Has 1297 Blast hits to 1295 proteins in 140 species: Archae - 0; Bacteria - 6; Metazoa - 767; Fungi - 311; Plants - 152; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT1G21500AT1G21500.1CGCAGCGTTTunknown protein; LOCATED IN: 1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21500.1GCGTTTTGunknown protein; LOCATED IN: 1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G21610AT1G21610.1TTAAAGGCwound-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77310.1); Has 468 Blast hits to 442 proteins in 110 species: Archae - 0; Bacteria - 20; Metazoa - 233; Fungi - 51; Plants - 45; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).
AT1G21610.2TTAAAGGCwound-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G77310.1); Has 468 Blast hits to 442 proteins in 110 species: Archae - 0; Bacteria - 20; Metazoa - 233; Fungi - 51; Plants - 45; Viruses - 0; Other Eukaryotes - 119 (source: NCBI BLink).
AT1G22190AT1G22190.1TAAAACGCAP2 domain-containing transcription factor, putative; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA-binding, integrase-type (InterPro:IPR016177), Pathogenesis-related transcriptional factor and ERF, DNA-binding (InterPro:IPR001471); BEST Arabidopsis thaliana protein match is: RAP2.4 (related to AP2 4); DNA binding / transcription factor (TAIR:AT1G78080.1); Has 3906 Blast hits to 3758 proteins in 206 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 3863; Viruses - 7; Other Eukaryotes - 34 (source: NCBI BLink).
AT1G22270AT1G22270.1TAAACGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78190.1); Has 289 Blast hits to 289 proteins in 134 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G22860AT1G22860.1TAAACGACAGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 284 Blast hits to 266 proteins in 98 species: Archae - 0; Bacteria - 2; Metazoa - 148; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT1G22890AT1G22890.1TTAAAGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 10 Blast hits to 10 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23060AT1G23060.1TAAACGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70950.1); Has 368 Blast hits to 334 proteins in 83 species: Archae - 0; Bacteria - 32; Metazoa - 145; Fungi - 21; Plants - 89; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink).
AT1G23060.2TAAACGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70950.1); Has 368 Blast hits to 334 proteins in 83 species: Archae - 0; Bacteria - 32; Metazoa - 145; Fungi - 21; Plants - 89; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink).
AT1G23149AT1G23149.1CAAAACGCGTTTUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF29 represents a conserved upstream opening reading frame relative to major ORF AT1G23150.1
AT1G23150AT1G23150.1CAAAACGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70780.1); Has 61 Blast hits to 61 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G23890AT1G23890.1ACTGGGCCGTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.1TAAATGGGCCCTACTTGGGCCGTTTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.2ACTGGGCCGTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23890.2TAAATGGGCCCTACTTGGGCCGTTTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT1G23900AT1G23900.1AAAACGGCCCAAGTAGGGCCCATTTAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.1AACGGCCCAGTEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.2AAAACGGCCCAAGTAGGGCCCATTTAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G23900.2AACGGCCCAGTEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane
AT1G24040AT1G24040.1TCAAAACGCGGCGTTTTAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G24040.2TCAAAACGCGGCGTTTTAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G24050AT1G24050.1TAAAACGCCGCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT1G24170AT1G24170.1ACGCGTTTTEncodes a protein with putative galacturonosyltransferase activity.
AT1G25220AT1G25220.1CAAAACGCCatalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2).
AT1G25260AT1G25260.1AACGGGCCacidic ribosomal protein P0-related; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 809 Blast hits to 807 proteins in 249 species: Archae - 78; Bacteria - 0; Metazoa - 294; Fungi - 172; Plants - 102; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).
AT1G25682AT1G25682.1CGCGTTTTcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25988.1); Has 517 Blast hits to 517 proteins in 152 species: Archae - 0; Bacteria - 5; Metazoa - 212; Fungi - 149; Plants - 56; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).
AT1G25682.1GGCGTTTTcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25988.1); Has 517 Blast hits to 517 proteins in 152 species: Archae - 0; Bacteria - 5; Metazoa - 212; Fungi - 149; Plants - 56; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).
AT1G26670AT1G26670.1TAAAACGCmember of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles.
AT1G26740AT1G26740.1TCAAAACGCstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32p (InterPro:IPR002677); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G69485.1); Has 76 Blast hits to 76 proteins in 26 species: Archae - 0; Bacteria - 21; Metazoa - 0; Fungi - 12; Plants - 31; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G26750AT1G26750.1CGGCGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G26750.1GCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G26880AT1G26880.1CATGGGCCTTTAA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G26880.2CATGGGCCTTTAA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT1G27200AT1G27200.1AAAACGCGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40720.1); Has 205 Blast hits to 205 proteins in 57 species: Archae - 0; Bacteria - 108; Metazoa - 2; Fungi - 4; Plants - 62; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G27310AT1G27310.1TAACGGGCCCAACTEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.
AT1G27360AT1G27360.1AAACGCTGsquamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27360.2AAACGCTGsquamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27360.3AAACGCTGsquamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27360.4AAACGCTGsquamosa promoter-binding protein-like 11 (SPL11); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, SBP-box (InterPro:IPR004333); BEST Arabidopsis thaliana protein match is: squamosa promoter-binding protein-like 10 (SPL10) (TAIR:AT1G27370.4); Has 550 Blast hits to 550 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 550; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27461AT1G27461.1AAAACGGCAunknown protein; Has 19 Blast hits to 19 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G27590AT1G27590.1AAAACGGCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT1G27570.1); Has 81 Blast hits to 81 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 59; Fungi - 4; Plants - 17; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G27600AT1G27600.1CAGCGTTTglycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G27600.2CAGCGTTTglycosyl transferase family 43 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 43 (InterPro:IPR005027); BEST Arabidopsis thaliana protein match is: IRX9 (IRREGULAR XYLEM 9); transferase, transferring glycosyl groups / xylosyltransferase (TAIR:AT2G37090.1); Has 547 Blast hits to 546 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 381; Fungi - 0; Plants - 154; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G27680AT1G27680.1TGCCGTTTTADP-glucose pyrophosphorylase catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described.Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions.
AT1G27752AT1G27752.1CGCGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Ubiquitin system component Cue (InterPro:IPR003892); Has 330 Blast hits to 312 proteins in 96 species: Archae - 0; Bacteria - 26; Metazoa - 143; Fungi - 77; Plants - 32; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT1G28090AT1G28090.1CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28090.2CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G28090.3CTAATGGGCTTTAAAGGCCpolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink).
AT1G29060AT1G29060.1ATCGGCCCGTTAAAAAAGCCCATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G29060.1TAAAACGCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G29150AT1G29150.1CAAAACGCGTTTTspecifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A.
AT1G29280AT1G29280.1CAAAACGCmember of WRKY Transcription Factor; Group II-e
AT1G29330AT1G29330.1TAAAACGCEncodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves.
AT1G29380AT1G29380.1GGCGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30933.2); Has 72661 Blast hits to 25630 proteins in 1396 species: Archae - 121; Bacteria - 23698; Metazoa - 22516; Fungi - 4473; Plants - 9059; Viruses - 967; Other Eukaryotes - 11827 (source: NCBI BLink).
AT1G29470AT1G29470.1AAAACGACGCCGTTTdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G34300.2); Has 60693 Blast hits to 25760 proteins in 1331 species: Archae - 209; Bacteria - 12823; Metazoa - 19500; Fungi - 5083; Plants - 2714; Viruses - 653; Other Eukaryotes - 19711 (source: NCBI BLink).
AT1G29470.2AAAACGACGCCGTTTdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT2G34300.2); Has 60693 Blast hits to 25760 proteins in 1331 species: Archae - 209; Bacteria - 12823; Metazoa - 19500; Fungi - 5083; Plants - 2714; Viruses - 653; Other Eukaryotes - 19711 (source: NCBI BLink).
AT1G29660AT1G29660.1TCAAAACGGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: apoplast, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT1G29670.1); Has 2112 Blast hits to 2093 proteins in 271 species: Archae - 0; Bacteria - 436; Metazoa - 1; Fungi - 65; Plants - 1585; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT1G29700AT1G29700.1CGCAGCGTTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 321 Blast hits to 321 proteins in 85 species: Archae - 0; Bacteria - 142; Metazoa - 0; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G29800AT1G29800.1GCCTTTAAphosphoinositide binding / zinc ion binding; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: zinc finger (FYVE type) family protein (TAIR:AT3G43230.1); Has 2856 Blast hits to 2789 proteins in 224 species: Archae - 0; Bacteria - 155; Metazoa - 1698; Fungi - 436; Plants - 186; Viruses - 3; Other Eukaryotes - 378 (source: NCBI BLink).
AT1G29800.2GCCTTTAAphosphoinositide binding / zinc ion binding; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: zinc finger (FYVE type) family protein (TAIR:AT3G43230.1); Has 2856 Blast hits to 2789 proteins in 224 species: Archae - 0; Bacteria - 155; Metazoa - 1698; Fungi - 436; Plants - 186; Viruses - 3; Other Eukaryotes - 378 (source: NCBI BLink).
AT1G29920AT1G29920.1CAAAACGCEncodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II.
AT1G29990AT1G29990.1ATATTGGGCCGTTAAAEncodes a cytoplastic protein with similarity to yeast prefoldin6, a subunit of the prefoldin complex. The PFD complex is thought to function along with the TCP ring complex to properly fold microtubule proteins.
AT1G30130AT1G30130.1AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1365 (InterPro:IPR010775); Has 1416 Blast hits to 1416 proteins in 265 species: Archae - 0; Bacteria - 477; Metazoa - 0; Fungi - 4; Plants - 20; Viruses - 0; Other Eukaryotes - 915 (source: NCBI BLink).
AT1G30130.2AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1365 (InterPro:IPR010775); Has 1416 Blast hits to 1416 proteins in 265 species: Archae - 0; Bacteria - 477; Metazoa - 0; Fungi - 4; Plants - 20; Viruses - 0; Other Eukaryotes - 915 (source: NCBI BLink).
AT1G30450AT1G30450.1GCCTTTAAmember of Cation-chloride co-transporter family
AT1G30450.2GCCTTTAAmember of Cation-chloride co-transporter family
AT1G30450.3GCCTTTAAmember of Cation-chloride co-transporter family
AT1G30500AT1G30500.1TAAAACGCNUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G30500.1TGCCGTTTNUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G30500.2TAAAACGCNUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G30500.2TGCCGTTTNUCLEAR FACTOR Y, SUBUNIT A7 (NF-YA7); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289); BEST Arabidopsis thaliana protein match is: NF-YA4 (NUCLEAR FACTOR Y, SUBUNIT A4); specific transcriptional repressor/ transcription factor (TAIR:AT2G34720.1); Has 441 Blast hits to 441 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 88; Plants - 215; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G30540AT1G30540.1TCAAAACGATPase, BadF/BadG/BcrA/BcrD-type family; FUNCTIONS IN: ATPase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, BadF/BadG/BcrA/BcrD type (InterPro:IPR002731); Has 975 Blast hits to 975 proteins in 386 species: Archae - 31; Bacteria - 696; Metazoa - 107; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).
AT1G30630AT1G30630.1AAAACGCGTTTTAcoatomer protein epsilon subunit family protein / COPE family protein; FUNCTIONS IN: protein transporter activity, protein binding, structural molecule activity, binding; INVOLVED IN: retrograde vesicle-mediated transport, Golgi to ER; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Coatomer, epsilon subunit (InterPro:IPR006822); BEST Arabidopsis thaliana protein match is: coatomer protein epsilon subunit family protein / COPE family protein (TAIR:AT2G34840.1); Has 326 Blast hits to 326 proteins in 131 species: Archae - 2; Bacteria - 5; Metazoa - 149; Fungi - 59; Plants - 65; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink).
AT1G30810AT1G30810.1AAAACGACGCGTTTTGtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), FY-rich, C-terminal subgroup (InterPro:IPR018516), Transcription factor jumonji (InterPro:IPR013129), FY-rich, N-terminal subgroup (InterPro:IPR018518); BEST Arabidopsis thaliana protein match is: MEE27 (maternal effect embryo arrest 27); transcription factor (TAIR:AT2G34880.1); Has 1543 Blast hits to 1140 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 960; Fungi - 297; Plants - 152; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink).
AT1G30810.1AAACGCTGtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), FY-rich, C-terminal (InterPro:IPR003889), FY-rich, N-terminal (InterPro:IPR003888), Transcription factor jumonji, JmjN (InterPro:IPR003349), Zinc finger, C5HC2-type (InterPro:IPR004198), FY-rich, C-terminal subgroup (InterPro:IPR018516), Transcription factor jumonji (InterPro:IPR013129), FY-rich, N-terminal subgroup (InterPro:IPR018518); BEST Arabidopsis thaliana protein match is: MEE27 (maternal effect embryo arrest 27); transcription factor (TAIR:AT2G34880.1); Has 1543 Blast hits to 1140 proteins in 133 species: Archae - 0; Bacteria - 0; Metazoa - 960; Fungi - 297; Plants - 152; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink).
AT1G30825AT1G30825.1AAACGGCGTCGTTInvolved in trichome maturation. mutant displays enlarged trichomes
AT1G31020AT1G31020.1TGCCGTTTArabidopsis thioredoxin o2 (ATO2); INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like subdomain (InterPro:IPR006662), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATO1 (Arabidopsis thioredoxin O1) (TAIR:AT2G35010.2); Has 8280 Blast hits to 8267 proteins in 1604 species: Archae - 109; Bacteria - 3630; Metazoa - 858; Fungi - 399; Plants - 738; Viruses - 3; Other Eukaryotes - 2543 (source: NCBI BLink).
AT1G31130AT1G31130.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44860.1); Has 131 Blast hits to 129 proteins in 19 species: Archae - 2; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 117; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G31190AT1G31190.1AAAACGCCEncodes a myo-inositol monophosphatase IMPL1 (myo-Inositol monophosphatase like 1).
AT1G31300AT1G31300.1GCCTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G31300.2GCCTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT1G31850AT1G31850.1GCCGTTTTdehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G31850.2GCCGTTTTdehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G31850.3GCCGTTTTdehydration-responsive protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: ERD3 (early-responsive to dehydration 3) (TAIR:AT4G19120.2); Has 539 Blast hits to 532 proteins in 52 species: Archae - 2; Bacteria - 50; Metazoa - 0; Fungi - 3; Plants - 476; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G32050AT1G32050.1AAAACGGCCCATATAsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: secretory carrier membrane protein (SCAMP) family protein (TAIR:AT2G20840.1); Has 522 Blast hits to 522 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 335; Fungi - 12; Plants - 120; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G32160AT1G32160.1GCGTTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.2); Has 83 Blast hits to 83 proteins in 18 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G32160.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF760 (InterPro:IPR008479); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G17800.2); Has 83 Blast hits to 83 proteins in 18 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT1G32210AT1G32210.1AAAACGACGCCGTTEncodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation.
AT1G32220AT1G32220.1AACGGCGTCGTTTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to oxidative stress; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G10730.1); Has 499 Blast hits to 498 proteins in 184 species: Archae - 8; Bacteria - 193; Metazoa - 18; Fungi - 98; Plants - 68; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink).
AT1G32530AT1G32530.1TAAAACGCTGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink).
AT1G32730AT1G32730.1GCCCAAACGGCAunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G32860AT1G32860.1TCAAAACGglycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: ATBG_PAP; glucan endo-1,3-beta-D-glucosidase/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT5G42100.2); Has 1388 Blast hits to 1375 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 1382; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G32940AT1G32940.1CGTTTTGASBT3.5; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, F mature embryo stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: SBT3.3; identical protein binding / serine-type endopeptidase (TAIR:AT1G32960.1); Has 3781 Blast hits to 3568 proteins in 616 species: Archae - 127; Bacteria - 2040; Metazoa - 74; Fungi - 118; Plants - 905; Viruses - 0; Other Eukaryotes - 517 (source: NCBI BLink).
AT1G33120AT1G33120.1TTTAACGGGCCATGGGCTTAT60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G33260AT1G33260.1AAAACGGCAprotein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G10390.1); Has 73899 Blast hits to 73190 proteins in 2186 species: Archae - 51; Bacteria - 6759; Metazoa - 31156; Fungi - 5980; Plants - 17078; Viruses - 326; Other Eukaryotes - 12549 (source: NCBI BLink).
AT1G33260.2AAAACGGCAprotein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G10390.1); Has 73899 Blast hits to 73190 proteins in 2186 species: Archae - 51; Bacteria - 6759; Metazoa - 31156; Fungi - 5980; Plants - 17078; Viruses - 326; Other Eukaryotes - 12549 (source: NCBI BLink).
AT1G33390AT1G33390.1AAACGGCGThelicase domain-containing protein; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: helicase domain-containing protein (TAIR:AT1G48650.2); Has 11093 Blast hits to 6432 proteins in 948 species: Archae - 0; Bacteria - 3704; Metazoa - 3089; Fungi - 1453; Plants - 542; Viruses - 298; Other Eukaryotes - 2007 (source: NCBI BLink).
AT1G34210AT1G34210.1GCGTTTTGPlasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production.
AT1G34430AT1G34430.1AAAACGCGCGTGTembryo defective 3003 (EMB3003); FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosolic ribosome, plasma membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: LTA2; dihydrolipoyllysine-residue acetyltransferase (TAIR:AT3G25860.1); Has 15590 Blast hits to 14171 proteins in 1332 species: Archae - 64; Bacteria - 7001; Metazoa - 632; Fungi - 308; Plants - 200; Viruses - 0; Other Eukaryotes - 7385 (source: NCBI BLink).
AT1G42990AT1G42990.1AAAACGCGTAtbZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. GFP fusions containing the first 260 amino acids (AtbZIP60deltaC) are nuclear-localized. AtbZIP60 is upregulated by the addition of tunicamycin (ER stress response inductor), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress the protein is proteolyzed and the soluble part is translocalized into the nucleus. AtbZIP60deltaC can activate the promoters of the ER chaperones BiP1, BiP2 and BiP3 and CNX1 and CNX2 via binding to the ER stress response element (ERSE) and the plant unfolded protein response element(P-UPRE). It can also activate its own transcription.
AT1G43130AT1G43130.1AAACGGCGTLIKE COV 2 (LCV2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: stem vascular tissue pattern formation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF502 (InterPro:IPR007462); BEST Arabidopsis thaliana protein match is: COV1 (CONTINUOUS VASCULAR RING) (TAIR:AT2G20120.1); Has 1946 Blast hits to 1946 proteins in 369 species: Archae - 4; Bacteria - 692; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 1166 (source: NCBI BLink).
AT1G44770AT1G44770.1AAAACGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49710.3); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G44770.2AAAACGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49710.3); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G45688AT1G45688.1ACGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42860.1); Has 170 Blast hits to 157 proteins in 33 species: Archae - 0; Bacteria - 10; Metazoa - 10; Fungi - 13; Plants - 113; Viruses - 16; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G45688.2ACGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42860.1); Has 170 Blast hits to 157 proteins in 33 species: Archae - 0; Bacteria - 10; Metazoa - 10; Fungi - 13; Plants - 113; Viruses - 16; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G48600AT1G48600.1CGTTTTGAphosphoethanolamine N-methyltransferase 2, putative (NMT2); FUNCTIONS IN: methyltransferase activity, phosphoethanolamine N-methyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: sperm cell, cotyledon, male gametophyte, guard cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: XPL1 (XIPOTL 1); methyltransferase/ phosphoethanolamine N-methyltransferase (TAIR:AT3G18000.1); Has 13276 Blast hits to 12887 proteins in 1498 species: Archae - 390; Bacteria - 8641; Metazoa - 259; Fungi - 577; Plants - 323; Viruses - 4; Other Eukaryotes - 3082 (source: NCBI BLink).
AT1G48620AT1G48620.1AAAACGCCACGTCATCThis gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation.
AT1G48900AT1G48900.1CGTTTTGAsignal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).
AT1G48900.2CGTTTTGAsignal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C); FUNCTIONS IN: 7S RNA binding, mRNA binding, nucleoside-triphosphatase activity, GTP binding, nucleotide binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B) (TAIR:AT5G49500.1); Has 12023 Blast hits to 12019 proteins in 1590 species: Archae - 312; Bacteria - 5666; Metazoa - 264; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5442 (source: NCBI BLink).
AT1G49410AT1G49410.1AACGGCCCATATtranslocase of the outer mitochondrial membrane 6 (TOM6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G49410.1TTAAAGGCtranslocase of the outer mitochondrial membrane 6 (TOM6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G49950AT1G49950.1AAAACGCGTTTEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.1AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.1AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.2AAAACGCGTTTEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.2AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.2AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.3AAAACGCGTTTEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.3AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G49950.3AAAACGCGTTTTAAGGCCEncodes a telomeric DNA binding protein. In vitro, an N-terminal Myb domain enables it to interact with double-stranded telomeric repeats.
AT1G50410AT1G50410.1GCGTTTTASNF2 domain-containing protein / helicase domain-containing protein / RING finger domain-containing protein; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021), SNF2-related (InterPro:IPR000330); BEST Arabidopsis thaliana protein match is: SNF2 domain-containing protein / helicase domain-containing protein / RING finger domain-containing protein (TAIR:AT3G20010.1); Has 17251 Blast hits to 10882 proteins in 1059 species: Archae - 56; Bacteria - 4149; Metazoa - 5282; Fungi - 3525; Plants - 1191; Viruses - 138; Other Eukaryotes - 2910 (source: NCBI BLink).
AT1G51620AT1G51620.1AACGGCCCAAAAprotein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, LP.12 twelve leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat protein kinase, putative (TAIR:AT1G51805.1); Has 67324 Blast hits to 66732 proteins in 1779 species: Archae - 34; Bacteria - 5197; Metazoa - 29240; Fungi - 4902; Plants - 16777; Viruses - 189; Other Eukaryotes - 10985 (source: NCBI BLink).
AT1G51650AT1G51650.1CTTAATGGGCCGTTAAAATP synthase epsilon chain, mitochondrial; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP biosynthetic process, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, epsilon subunit, mitochondrial (InterPro:IPR006721); Has 170 Blast hits to 170 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 3; Plants - 40; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT1G51660AT1G51660.1ACGCGTTTEncodes a mitogen-activated map kinase kinase (there are nine in Arabidopsis) involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK5. In plants with both MKK5 and MKK6 levels reduced by RNAi plants, floral organs do not abscise suggestion a role for both proteins in mediating floral organ abscission.
AT1G52360AT1G52360.1GGCGTTTTAcoatomer protein complex, subunit beta 2 (beta prime), putative; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, COPI vesicle coat; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Coatomer, WD associated region (InterPro:IPR006692), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat (InterPro:IPR001680), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), Coatomer, beta' subunit (InterPro:IPR016453), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT3G15980.3); Has 57972 Blast hits to 24958 proteins in 644 species: Archae - 48; Bacteria - 5666; Metazoa - 27314; Fungi - 11164; Plants - 5401; Viruses - 42; Other Eukaryotes - 8337 (source: NCBI BLink).
AT1G52420AT1G52420.1TGCCGTTTTglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT3G15940.1); Has 4722 Blast hits to 4718 proteins in 799 species: Archae - 145; Bacteria - 2692; Metazoa - 11; Fungi - 32; Plants - 84; Viruses - 0; Other Eukaryotes - 1758 (source: NCBI BLink).
AT1G52510AT1G52510.1TAAAACGChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink).
AT1G52510.2TAAAACGChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink).
AT1G52880AT1G52880.1CGTTTTGATranscription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo.
AT1G53140AT1G53140.1ACGCGTTTTGEncodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis.
AT1G53620AT1G53620.1TAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G53610.1); Has 5418 Blast hits to 2090 proteins in 300 species: Archae - 0; Bacteria - 1374; Metazoa - 2188; Fungi - 175; Plants - 1090; Viruses - 68; Other Eukaryotes - 523 (source: NCBI BLink).
AT1G53645AT1G53645.1AAACGGCGhydroxyproline-rich glycoprotein family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 14086 Blast hits to 10901 proteins in 729 species: Archae - 8; Bacteria - 1034; Metazoa - 5759; Fungi - 2428; Plants - 1292; Viruses - 226; Other Eukaryotes - 3339 (source: NCBI BLink).
AT1G53850AT1G53850.1AAACGCTGCGEncodes alpha5 subunit of 20s proteosome involved in protein degradation.
AT1G53850.2AAACGCTGCGEncodes alpha5 subunit of 20s proteosome involved in protein degradation.
AT1G54050AT1G54050.1TAAACGGCCTATA17.4 kDa class III heat shock protein (HSP17.4-CIII); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, response to heat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 2777 Blast hits to 2777 proteins in 704 species: Archae - 100; Bacteria - 1361; Metazoa - 1; Fungi - 104; Plants - 843; Viruses - 0; Other Eukaryotes - 368 (source: NCBI BLink).
AT1G54070AT1G54070.1TAAACGGCAdormancy/auxin associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated family protein (TAIR:AT1G56220.1); Has 105 Blast hits to 105 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G54140AT1G54140.1GCGTTTTAputative TATA binding protein associated factor 21kDa
AT1G54150AT1G54150.1TAAAACGCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 1572 Blast hits to 1571 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1041; Fungi - 23; Plants - 178; Viruses - 133; Other Eukaryotes - 197 (source: NCBI BLink).
AT1G54780AT1G54780.1TAAAACGCCACGTCGthylakoid lumen 18.3 kDa protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF477 (InterPro:IPR007621); Has 159 Blast hits to 159 proteins in 71 species: Archae - 0; Bacteria - 103; Metazoa - 2; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT1G55020AT1G55020.1GGCGTTTTlipoxygenase, a defense gene conferring resistance Xanthomonas campestris
AT1G55080AT1G55080.1GAAACGACGGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29580.1); Has 64498 Blast hits to 23302 proteins in 980 species: Archae - 12; Bacteria - 3118; Metazoa - 24455; Fungi - 7046; Plants - 5363; Viruses - 296; Other Eukaryotes - 24208 (source: NCBI BLink).
AT1G55880AT1G55880.1AAAACGGCGpyridoxal-5'-phosphate-dependent enzyme, beta family protein; FUNCTIONS IN: lyase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: amino acid metabolic process, cysteine biosynthetic process from serine, metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Cysteine synthase/cystathionine beta-synthase P-phosphate-binding site (InterPro:IPR001216), Pyridoxal phosphate-dependent enzyme, beta subunit (InterPro:IPR001926); BEST Arabidopsis thaliana protein match is: cysteine synthase, putative / O-acetylserine (thiol)-lyase, putative / O-acetylserine sulfhydrylase, putative (TAIR:AT5G28030.2); Has 11031 Blast hits to 11019 proteins in 1463 species: Archae - 236; Bacteria - 5849; Metazoa - 328; Fungi - 337; Plants - 322; Viruses - 0; Other Eukaryotes - 3959 (source: NCBI BLink).
AT1G55880.2AAAACGGCGpyridoxal-5'-phosphate-dependent enzyme, beta family protein; FUNCTIONS IN: lyase activity, pyridoxal phosphate binding, catalytic activity; INVOLVED IN: amino acid metabolic process, cysteine biosynthetic process from serine, metabolic process; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Cysteine synthase/cystathionine beta-synthase P-phosphate-binding site (InterPro:IPR001216), Pyridoxal phosphate-dependent enzyme, beta subunit (InterPro:IPR001926); BEST Arabidopsis thaliana protein match is: cysteine synthase, putative / O-acetylserine (thiol)-lyase, putative / O-acetylserine sulfhydrylase, putative (TAIR:AT5G28030.2); Has 11031 Blast hits to 11019 proteins in 1463 species: Archae - 236; Bacteria - 5849; Metazoa - 328; Fungi - 337; Plants - 322; Viruses - 0; Other Eukaryotes - 3959 (source: NCBI BLink).
AT1G56060AT1G56060.1AAACGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G32190.1); Has 124 Blast hits to 124 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G56200AT1G56200.1CCCACGTGCCGTTTembryo defective 1303 (emb1303); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G30475.3); Has 46 Blast hits to 46 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G56200.2CCCACGTGCCGTTTembryo defective 1303 (emb1303); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G30475.3); Has 46 Blast hits to 46 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 5; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G56440AT1G56440.1AACGGGCCGGTTTATserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).
AT1G56450AT1G56450.1ATAAACCGGCCCGTT20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds
AT1G56610AT1G56610.1CGTTTTGAsyntaxin-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14096.1); Has 624 Blast hits to 612 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 624; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G56610.2CGTTTTGAsyntaxin-related family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14096.1); Has 624 Blast hits to 612 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 624; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57820AT1G57820.1CGTTTTGAEncodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts.
AT1G57820.2CGTTTTGAEncodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts.
AT1G60380AT1G60380.1CGCCGTTTAapical meristem formation protein-related; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac024 (Arabidopsis NAC domain containing protein 24); transcription factor (TAIR:AT1G60350.1); Has 227 Blast hits to 222 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 227; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G60550AT1G60550.1GCGTTTTGENOYL-COA HYDRATASE/ISOMERASE D (ECHID); FUNCTIONS IN: naphthoate synthase activity, catalytic activity; INVOLVED IN: vitamin K biosynthetic process, metabolic process, menaquinone biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Enoyl-CoA hydratase/isomerase, conserved site (InterPro:IPR018376), Naphthoate synthase (InterPro:IPR010198), Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: ECHIA (ENOYL-COA HYDRATASE/ISOMERASE A); catalytic (TAIR:AT4G16210.1); Has 24987 Blast hits to 24986 proteins in 1283 species: Archae - 197; Bacteria - 14016; Metazoa - 1333; Fungi - 490; Plants - 307; Viruses - 0; Other Eukaryotes - 8644 (source: NCBI BLink).
AT1G60600AT1G60600.1TAATGGGCCTTAAAGGCCCACEncodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.
AT1G60600.2TAATGGGCCTTAAAGGCCCACEncodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport.
AT1G61780AT1G61780.1AAGGGTATTTGCCGTTTACCGGAAApostsynaptic protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 171 Blast hits to 169 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 30; Plants - 32; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G61790AT1G61790.1TTTCCGGTAAACGGCOST3/OST6 family protein; FUNCTIONS IN: oligosaccharide transmembrane transporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: OST3/OST6 (InterPro:IPR006844); BEST Arabidopsis thaliana protein match is: OST3/OST6 family protein (TAIR:AT1G11560.1); Has 268 Blast hits to 268 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 171; Fungi - 49; Plants - 34; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G62290AT1G62290.1TCAAAACGaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).
AT1G62290.2TCAAAACGaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).
AT1G62600AT1G62600.1TAAAACGCAGCGTTTflavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960); BEST Arabidopsis thaliana protein match is: flavin-containing monooxygenase family protein / FMO family protein (TAIR:AT1G62620.1); Has 8846 Blast hits to 8478 proteins in 928 species: Archae - 35; Bacteria - 3635; Metazoa - 1030; Fungi - 886; Plants - 455; Viruses - 0; Other Eukaryotes - 2805 (source: NCBI BLink).
AT1G63010AT1G63010.1GGCGTTTTSPX (SYG1/Pho81/XPR1) domain-containing protein; LOCATED IN: vacuolar membrane, plant-type vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SPX (SYG1/Pho81/XPR1) domain-containing protein (TAIR:AT4G22990.1); Has 1732 Blast hits to 1731 proteins in 564 species: Archae - 25; Bacteria - 1083; Metazoa - 127; Fungi - 235; Plants - 128; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink).
AT1G63010.2GGCGTTTTSPX (SYG1/Pho81/XPR1) domain-containing protein; LOCATED IN: vacuolar membrane, plant-type vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SPX (SYG1/Pho81/XPR1) domain-containing protein (TAIR:AT4G22990.1); Has 1732 Blast hits to 1731 proteins in 564 species: Archae - 25; Bacteria - 1083; Metazoa - 127; Fungi - 235; Plants - 128; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink).
AT1G63010.3GGCGTTTTSPX (SYG1/Pho81/XPR1) domain-containing protein; LOCATED IN: vacuolar membrane, plant-type vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SPX (SYG1/Pho81/XPR1) domain-containing protein (TAIR:AT4G22990.1); Has 1732 Blast hits to 1731 proteins in 564 species: Archae - 25; Bacteria - 1083; Metazoa - 127; Fungi - 235; Plants - 128; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink).
AT1G63010.4GGCGTTTTSPX (SYG1/Pho81/XPR1) domain-containing protein; LOCATED IN: vacuolar membrane, plant-type vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: SPX (SYG1/Pho81/XPR1) domain-containing protein (TAIR:AT4G22990.1); Has 1732 Blast hits to 1731 proteins in 564 species: Archae - 25; Bacteria - 1083; Metazoa - 127; Fungi - 235; Plants - 128; Viruses - 0; Other Eukaryotes - 134 (source: NCBI BLink).
AT1G63970AT1G63970.1CGCCGTTTTEncodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF
AT1G63970.2CGCCGTTTTEncodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF
AT1G64190AT1G64190.1AAAACGGCA6-phosphogluconate dehydrogenase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to salt stress; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, decarboxylating (InterPro:IPR006113), 6-phosphogluconate dehydrogenase, C-terminal (InterPro:IPR006114), 6-phosphogluconate dehydrogenase (InterPro:IPR006183), NAD(P)-binding (InterPro:IPR016040), Fibritin/6-phosphogluconate dehydrogenase, C-terminal extension (InterPro:IPR012284); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase family protein (TAIR:AT5G41670.2); Has 8640 Blast hits to 8571 proteins in 1490 species: Archae - 50; Bacteria - 4787; Metazoa - 524; Fungi - 177; Plants - 212; Viruses - 2; Other Eukaryotes - 2888 (source: NCBI BLink).
AT1G64190.1ACGACACCGTTTTGA6-phosphogluconate dehydrogenase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to salt stress; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 6-phosphogluconate dehydrogenase, decarboxylating (InterPro:IPR006113), 6-phosphogluconate dehydrogenase, C-terminal (InterPro:IPR006114), 6-phosphogluconate dehydrogenase (InterPro:IPR006183), NAD(P)-binding (InterPro:IPR016040), Fibritin/6-phosphogluconate dehydrogenase, C-terminal extension (InterPro:IPR012284); BEST Arabidopsis thaliana protein match is: 6-phosphogluconate dehydrogenase family protein (TAIR:AT5G41670.2); Has 8640 Blast hits to 8571 proteins in 1490 species: Archae - 50; Bacteria - 4787; Metazoa - 524; Fungi - 177; Plants - 212; Viruses - 2; Other Eukaryotes - 2888 (source: NCBI BLink).
AT1G64510AT1G64510.1AACGGGCCTTTAACAGGCCCAATAAribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink).
AT1G64520AT1G64520.1TTATTGGGCCTGTTAAAGGCCCGTTRegulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).
AT1G64680AT1G64680.1AACGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03055.1); Has 64 Blast hits to 64 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G64850AT1G64850.1TAAATGGGCCGTTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G65150AT1G65150.1CGTTTTGAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G65150.1TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G65150.2CGTTTTGAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G65150.2TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G65280AT1G65280.1GGGCCTAAACGGGCCTTTAheat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G22080.1); Has 22647 Blast hits to 16088 proteins in 1412 species: Archae - 102; Bacteria - 2761; Metazoa - 9875; Fungi - 2142; Plants - 1453; Viruses - 33; Other Eukaryotes - 6281 (source: NCBI BLink).
AT1G65440AT1G65440.1TAAAACGCRelated to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly.
AT1G65440.2TAAAACGCRelated to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly.
AT1G65445AT1G65445.1AAAACGCCtransferase-related; FUNCTIONS IN: transferase activity, transferring acyl groups other than amino-acyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST Arabidopsis thaliana protein match is: HCT (HYDROXYCINNAMOYL-COA SHIKIMATE/QUINATE HYDROXYCINNAMOYL TRANSFERASE); quinate O-hydroxycinnamoyltransferase/ shikimate O-hydroxycinnamoyltransferase/ transferase (TAIR:AT5G48930.1); Has 438 Blast hits to 437 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 3; Plants - 435; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G65660AT1G65660.1AAAACGGCGTCEncodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells.
AT1G65845AT1G65845.1ACGCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G66260AT1G66260.1CAAAACGCCRNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G37720.1); Has 5292 Blast hits to 4874 proteins in 386 species: Archae - 0; Bacteria - 278; Metazoa - 2835; Fungi - 963; Plants - 678; Viruses - 27; Other Eukaryotes - 511 (source: NCBI BLink).
AT1G66280AT1G66280.1TTAAAGGCBGLU22; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: membrane; EXPRESSED IN: root, callus, pollen tube, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU21; catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT1G66270.1); Has 5733 Blast hits to 5507 proteins in 796 species: Archae - 98; Bacteria - 3122; Metazoa - 586; Fungi - 134; Plants - 853; Viruses - 0; Other Eukaryotes - 940 (source: NCBI BLink).
AT1G67510AT1G67510.1TCAAAACGleucine-rich repeat family protein; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT2G01210.1); Has 96726 Blast hits to 71715 proteins in 2384 species: Archae - 68; Bacteria - 8296; Metazoa - 31560; Fungi - 5101; Plants - 39529; Viruses - 187; Other Eukaryotes - 11985 (source: NCBI BLink).
AT1G67840AT1G67840.1CGCCGTTTTEncodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II.
AT1G67840.1TGCCGTTTAEncodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II.
AT1G67840.1TGCCGTTTAEncodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II.
AT1G67840.2CGCCGTTTTEncodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II.
AT1G67840.2TGCCGTTTAEncodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II.
AT1G67840.2TGCCGTTTAEncodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II.
AT1G67960AT1G67960.1ACGCCGTTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G67960.1CAGCGTTTTGEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Membrane protein,Tapt1/CMV receptor (InterPro:IPR008010); Has 243 Blast hits to 229 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 79; Fungi - 87; Plants - 18; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT1G68340AT1G68340.1AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G25370.1); Has 137 Blast hits to 137 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G68660AT1G68660.1GCCTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G68660.1GCGTTTTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G68660.2GCCTTTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G68660.2GCGTTTTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein catabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Adaptor protein ClpS, core (InterPro:IPR003769), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719); Has 513 Blast hits to 513 proteins in 129 species: Archae - 0; Bacteria - 273; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G69330AT1G69330.1GCGTTTTGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: ubiquitin-protein ligase (TAIR:AT3G29270.2); Has 225 Blast hits to 225 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G69340AT1G69340.1CAAAACGCappr-1-p processing enzyme family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Appr-1-p processing (InterPro:IPR002589); BEST Arabidopsis thaliana protein match is: appr-1-p processing enzyme family protein (TAIR:AT2G40600.1); Has 2230 Blast hits to 2187 proteins in 671 species: Archae - 43; Bacteria - 984; Metazoa - 848; Fungi - 95; Plants - 99; Viruses - 7; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G69390AT1G69390.1GCCTTTAAACGACAGCGTTTEncodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery.
AT1G69390.1TAAAACGCTGEncodes an Arabidopsis homologue of the bacterial MinE topological specificity factor ensuring correct division site placement. It is an essential integral component of the plastid division machinery.
AT1G69410AT1G69410.1AAAACGCCGCACGTGTAEUKARYOTIC ELONGATION FACTOR 5A-3 (ELF5A-3); FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation protein SH3-like, subgroup (InterPro:IPR014722), Eukaryotic initiation factor 5A hypusine (eIF-5A) (InterPro:IPR001884); BEST Arabidopsis thaliana protein match is: ELF5A-1 (EUKARYOTIC ELONGATION FACTOR 5A-1); translation initiation factor (TAIR:AT1G13950.1); Has 986 Blast hits to 984 proteins in 296 species: Archae - 160; Bacteria - 0; Metazoa - 294; Fungi - 163; Plants - 195; Viruses - 0; Other Eukaryotes - 174 (source: NCBI BLink).
AT1G70090AT1G70090.1TCAAAACGACEncodes a protein with putative galacturonosyltransferase activity.
AT1G70090.2TCAAAACGACEncodes a protein with putative galacturonosyltransferase activity.
AT1G70480AT1G70480.1AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G70480.2AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF220 (InterPro:IPR003863); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23560.1); Has 109 Blast hits to 99 proteins in 9 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT1G70610AT1G70610.1GAAACGACGCGTTTTAmember of TAP subfamily
AT1G70620AT1G70620.1TGCCGTTTcyclin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 100267 Blast hits to 50982 proteins in 1689 species: Archae - 87; Bacteria - 8947; Metazoa - 49870; Fungi - 13313; Plants - 8874; Viruses - 1379; Other Eukaryotes - 17797 (source: NCBI BLink).
AT1G70620.2TGCCGTTTcyclin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 100267 Blast hits to 50982 proteins in 1689 species: Archae - 87; Bacteria - 8947; Metazoa - 49870; Fungi - 13313; Plants - 8874; Viruses - 1379; Other Eukaryotes - 17797 (source: NCBI BLink).
AT1G70760AT1G70760.1AAACGGCGa subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity.
AT1G70780AT1G70780.1AAAAAGCCTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23150.1); Has 70 Blast hits to 70 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G70782AT1G70782.1AAAAAGCCTTTAAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF28 represents a conserved upstream opening reading frame relative to major ORF AT1G70780.1
AT1G70980AT1G70980.1CGCCGTTTTSYNC3; FUNCTIONS IN: in 6 functions; INVOLVED IN: asparaginyl-tRNA aminoacylation, aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Asparaginyl-tRNA synthetase, class IIb (InterPro:IPR004522), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: SYNC1; ATP binding / aminoacyl-tRNA ligase/ asparagine-tRNA ligase/ aspartate-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT5G56680.1); Has 10794 Blast hits to 8026 proteins in 1494 species: Archae - 413; Bacteria - 7139; Metazoa - 538; Fungi - 533; Plants - 135; Viruses - 0; Other Eukaryotes - 2036 (source: NCBI BLink).
AT1G71260AT1G71260.1TAAAGGCCCATTGGGCCGTTAAAEncodes a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus.
AT1G71270AT1G71270.1TCAAAACGEncodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network.
AT1G71270.1TTTAACGGCCCAATGGGCCTTTAEncodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network.
AT1G71360AT1G71360.1TCAAAACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: Sad1/UNC-like, C-terminal (InterPro:IPR012919), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22882.1); Has 9785 Blast hits to 6992 proteins in 496 species: Archae - 108; Bacteria - 691; Metazoa - 4011; Fungi - 621; Plants - 261; Viruses - 70; Other Eukaryotes - 4023 (source: NCBI BLink).
AT1G71750AT1G71750.1CGCGTTTTphosphoribosyltransferase family protein; FUNCTIONS IN: transferase activity, hypoxanthine phosphoribosyltransferase activity; INVOLVED IN: nucleoside metabolic process, purine ribonucleoside salvage; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Hypoxanthine phosphoribosyl transferase (InterPro:IPR005904); Has 3239 Blast hits to 3239 proteins in 1142 species: Archae - 35; Bacteria - 2162; Metazoa - 212; Fungi - 2; Plants - 19; Viruses - 0; Other Eukaryotes - 809 (source: NCBI BLink).
AT1G71820AT1G71820.1GCGTTTTGSEC6; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen germination, pollen tube growth; LOCATED IN: plasma membrane, exocyst; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Exocyst complex component Sec6 (InterPro:IPR010326); Has 404 Blast hits to 404 proteins in 118 species: Archae - 3; Bacteria - 4; Metazoa - 222; Fungi - 97; Plants - 34; Viruses - 0; Other Eukaryotes - 44 (source: NCBI BLink).
AT1G71840AT1G71840.1GACGCCGTTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Quinoprotein amine dehydrogenase, beta chain-like (InterPro:IPR011044); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 67893 Blast hits to 26212 proteins in 696 species: Archae - 58; Bacteria - 6808; Metazoa - 32655; Fungi - 12563; Plants - 6168; Viruses - 0; Other Eukaryotes - 9641 (source: NCBI BLink).
AT1G71900AT1G71900.1CAGCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF803 (InterPro:IPR008521); BEST Arabidopsis thaliana protein match is: permease-related (TAIR:AT1G34470.1); Has 875 Blast hits to 858 proteins in 150 species: Archae - 0; Bacteria - 55; Metazoa - 361; Fungi - 238; Plants - 146; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT1G72040AT1G72040.1TAAAACGCdeoxynucleoside kinase family; FUNCTIONS IN: phosphotransferase activity, alcohol group as acceptor, ATP binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Deoxynucleoside kinase (InterPro:IPR002624); Has 1720 Blast hits to 1716 proteins in 345 species: Archae - 0; Bacteria - 621; Metazoa - 410; Fungi - 0; Plants - 41; Viruses - 60; Other Eukaryotes - 588 (source: NCBI BLink).
AT1G72520AT1G72520.1CGCGTTTTAlipoxygenase, putative; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen, lipoxygenase activity, iron ion binding, metal ion binding; INVOLVED IN: growth, jasmonic acid biosynthetic process, response to wounding, defense response; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Lipoxygenase, C-terminal (InterPro:IPR013819), Lipoxygenase (InterPro:IPR000907), Lipoxygenase, plant (InterPro:IPR001246); BEST Arabidopsis thaliana protein match is: LOX3; electron carrier/ iron ion binding / lipoxygenase/ metal ion binding / oxidoreductase, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (TAIR:AT1G17420.1); Has 1119 Blast hits to 1103 proteins in 149 species: Archae - 0; Bacteria - 68; Metazoa - 485; Fungi - 38; Plants - 512; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT1G72650AT1G72650.1TAAAACGCArabidopsis thaliana myb family transcription factor (At1g72650)
AT1G72650.2TAAAACGCArabidopsis thaliana myb family transcription factor (At1g72650)
AT1G73060AT1G73060.1GACGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G48790.1); Has 45 Blast hits to 45 proteins in 18 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G73080AT1G73080.1AAAACGCGTEncodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks.
AT1G73080.1AAACGGCGTEncodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks.
AT1G73120AT1G73120.1CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; EXPRESSED IN: root, cultured cell; Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G73650AT1G73650.1TAAACGGCAoxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink).
AT1G73650.2TAAACGGCAoxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink).
AT1G73650.3TAAACGGCAoxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink).
AT1G73650.4TAAACGGCAoxidoreductase, acting on the CH-CH group of donors; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104), Protein of unknown function DUF1295 (InterPro:IPR010721); BEST Arabidopsis thaliana protein match is: oxidoreductase, acting on the CH-CH group of donors (TAIR:AT1G18180.1); Has 1671 Blast hits to 1671 proteins in 197 species: Archae - 0; Bacteria - 270; Metazoa - 72; Fungi - 80; Plants - 62; Viruses - 0; Other Eukaryotes - 1187 (source: NCBI BLink).
AT1G74240AT1G74240.1AAACGCTGmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SAMC1 (S-ADENOSYLMETHIONINE CARRIER 1); S-adenosylmethionine transmembrane transporter/ binding (TAIR:AT4G39460.1); Has 19112 Blast hits to 10154 proteins in 360 species: Archae - 0; Bacteria - 0; Metazoa - 9866; Fungi - 4980; Plants - 2508; Viruses - 0; Other Eukaryotes - 1758 (source: NCBI BLink).
AT1G74380AT1G74380.1ACGCGTTTXYLOGLUCAN XYLOSYLTRANSFERASE 5 (XXT5); FUNCTIONS IN: xyloglucan 6-xylosyltransferase activity, transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: N-terminal protein myristoylation, root hair elongation; LOCATED IN: Golgi apparatus, Golgi membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Galactosyl transferase (InterPro:IPR008630); BEST Arabidopsis thaliana protein match is: galactosyl transferase GMA12/MNN10 family protein (TAIR:AT5G07720.1); Has 301 Blast hits to 301 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 117; Plants - 172; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G74380.1CAAAACGCXYLOGLUCAN XYLOSYLTRANSFERASE 5 (XXT5); FUNCTIONS IN: xyloglucan 6-xylosyltransferase activity, transferase activity, transferring glycosyl groups, transferase activity; INVOLVED IN: N-terminal protein myristoylation, root hair elongation; LOCATED IN: Golgi apparatus, Golgi membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Galactosyl transferase (InterPro:IPR008630); BEST Arabidopsis thaliana protein match is: galactosyl transferase GMA12/MNN10 family protein (TAIR:AT5G07720.1); Has 301 Blast hits to 301 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 117; Plants - 172; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G74510AT1G74510.1AACGGCGTCGTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink).
AT1G74510.2AACGGCGTCGTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT2G02870.3); Has 6157 Blast hits to 3278 proteins in 180 species: Archae - 4; Bacteria - 239; Metazoa - 4985; Fungi - 29; Plants - 576; Viruses - 33; Other Eukaryotes - 291 (source: NCBI BLink).
AT1G74920AT1G74920.1GGCTTTTTCGTTTTGAArabidopsis thaliana similar to betaine aldehyde dehydrogenase
AT1G74940AT1G74940.1TGGGCCGTTsenescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT1G19200.1); Has 261 Blast hits to 261 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 261; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G75180AT1G75180.1AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G75180.2AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G75180.3AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G75420AT1G75420.1AAAACGGCAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G19710.1); Has 4771 Blast hits to 4769 proteins in 831 species: Archae - 149; Bacteria - 2715; Metazoa - 84; Fungi - 37; Plants - 75; Viruses - 0; Other Eukaryotes - 1711 (source: NCBI BLink).
AT1G75420.1AACGGCGTglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G19710.1); Has 4771 Blast hits to 4769 proteins in 831 species: Archae - 149; Bacteria - 2715; Metazoa - 84; Fungi - 37; Plants - 75; Viruses - 0; Other Eukaryotes - 1711 (source: NCBI BLink).
AT1G75510AT1G75510.1AACGGCCCATTAAtranscription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G75670AT1G75670.1CAGCGTTTDNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G75670.2CAGCGTTTDNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G75840AT1G75840.1AACGGCCCAAAABelongs to the plant-specific ROP group of Rho GTPases; localized to the plasma membrane of tips of root hairs; involved in polar growth control.
AT1G75870AT1G75870.1AAAAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G75870.1AAACGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G76050AT1G76050.1TAAACGGCApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink).
AT1G76050.2TAAACGGCApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink).
AT1G76940AT1G76940.1AACGGGCCGGGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G76970AT1G76970.1AAACGCGTTTTVHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Target of Myb protein 1 (InterPro:IPR014645), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT1G21380.1); Has 1291 Blast hits to 1289 proteins in 143 species: Archae - 0; Bacteria - 2; Metazoa - 773; Fungi - 302; Plants - 157; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).
AT1G76970.1GACGCCGTTTTVHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), Target of Myb protein 1 (InterPro:IPR014645), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT1G21380.1); Has 1291 Blast hits to 1289 proteins in 143 species: Archae - 0; Bacteria - 2; Metazoa - 773; Fungi - 302; Plants - 157; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink).
AT1G77080AT1G77080.2TCAAAACGCMADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
AT1G77080.4TCAAAACGCMADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
AT1G77080.5TCAAAACGCMADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering.
AT1G77370AT1G77370.1CGTTTTGAglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT5G20500.1); Has 4324 Blast hits to 4321 proteins in 856 species: Archae - 10; Bacteria - 1999; Metazoa - 364; Fungi - 233; Plants - 336; Viruses - 107; Other Eukaryotes - 1275 (source: NCBI BLink).
AT1G77590AT1G77590.1GCGTTTTGEncodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids.
AT1G77600AT1G77600.1TCAAAACGbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47690.3); Has 420 Blast hits to 371 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 83; Plants - 153; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G77760AT1G77760.1TTAAAGGCCEncodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin.
AT1G77920AT1G77920.1GCGTTTTGbZIP family transcription factor; FUNCTIONS IN: transcription factor activity, calmodulin binding; INVOLVED IN: defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: TGA3; DNA binding / calmodulin binding / protein binding / transcription factor (TAIR:AT1G22070.1); Has 659 Blast hits to 658 proteins in 62 species: Archae - 0; Bacteria - 5; Metazoa - 8; Fungi - 11; Plants - 533; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink).
AT1G78300AT1G78300.1ATCCAACGGCCCAGAG-box binding factor GF14 omega encoding a 14-3-3 protein
AT1G78570AT1G78570.1CAAAACGCGEncodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in <i>E. coli</i>.
AT1G79230AT1G79230.1CAAAACGCGencodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification.
AT1G79230.2CAAAACGCGencodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification.
AT1G79230.3CAAAACGCGencodes a sulfurtransferase/rhodaneses, which belongs to a group of enzymes widely distributed in all three phyla that catalyze the transfer of sulfur from a donor to a thiophilic acceptor substrate. The protein and transcript levels are NOT affected by senescence or exogenous cyanide, suggesting that sulfurtransferases are involved in cyanide detoxification.
AT1G79280AT1G79280.1TCAAAACGCCEncodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development.
AT1G79790AT1G79790.1AAACGCTGCGhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G79790.2AAACGCTGCGhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); Has 955 Blast hits to 955 proteins in 292 species: Archae - 2; Bacteria - 583; Metazoa - 141; Fungi - 36; Plants - 14; Viruses - 0; Other Eukaryotes - 179 (source: NCBI BLink).
AT1G79830AT1G79830.1GAAACGACGCCGTTTThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c).
AT1G79830.2GAAACGACGCCGTTTThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c).
AT1G79990AT1G79990.3AAAACGCGTprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, endomembrane system, COPI vesicle coat; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Coatomer, WD associated region (InterPro:IPR006692), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT1G52360.1); Has 55918 Blast hits to 24188 proteins in 622 species: Archae - 40; Bacteria - 5752; Metazoa - 25846; Fungi - 10921; Plants - 5304; Viruses - 8; Other Eukaryotes - 8047 (source: NCBI BLink).
AT1G79990.5AAAACGCGTprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: membrane coat, endomembrane system, COPI vesicle coat; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Coatomer, WD associated region (InterPro:IPR006692), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: coatomer protein complex, subunit beta 2 (beta prime), putative (TAIR:AT1G52360.1); Has 55918 Blast hits to 24188 proteins in 622 species: Archae - 40; Bacteria - 5752; Metazoa - 25846; Fungi - 10921; Plants - 5304; Viruses - 8; Other Eukaryotes - 8047 (source: NCBI BLink).
AT1G80480AT1G80480.1CGTTTTGAPLASTID TRANSCRIPTIONALLY ACTIVE17 (PTAC17); LOCATED IN: plastid chromosome, chloroplast stroma, chloroplast, nucleoid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cobalamin (vitamin B12) biosynthesis CobW-like (InterPro:IPR003495), Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (InterPro:IPR011629); BEST Arabidopsis thaliana protein match is: PRLI-interacting factor L, putative (TAIR:AT1G15730.1); Has 18597 Blast hits to 10859 proteins in 1179 species: Archae - 146; Bacteria - 6676; Metazoa - 2747; Fungi - 687; Plants - 516; Viruses - 15; Other Eukaryotes - 7810 (source: NCBI BLink).
AT1G80580AT1G80580.1ATTGCCACGTCAAAACGCencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G80580.1GCGTTTTAencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G80790AT1G80790.1CAGCGTTTXH/XS domain-containing protein / XS zinc finger domain-containing protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function XS (InterPro:IPR005380), Region of unknown function XH (InterPro:IPR005379), Region of unknown function, putative Zinc finger, XS and XH (InterPro:IPR005381); BEST Arabidopsis thaliana protein match is: XH/XS domain-containing protein / XS zinc finger domain-containing protein (TAIR:AT1G15910.1); Has 67806 Blast hits to 38036 proteins in 1354 species: Archae - 728; Bacteria - 6143; Metazoa - 32571; Fungi - 3879; Plants - 1839; Viruses - 312; Other Eukaryotes - 22334 (source: NCBI BLink).
AT1G80930AT1G80930.1GTGTCGTTTTGAMIF4G domain-containing protein / MA3 domain-containing protein; FUNCTIONS IN: protein binding, RNA binding, binding; INVOLVED IN: translation, RNA metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891), Armadillo-type fold (InterPro:IPR016024), MIF4G-like, type 3 (InterPro:IPR003890), MIF4-like, type 1/2/3 (InterPro:IPR016021); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G52325.1); Has 47042 Blast hits to 24073 proteins in 1049 species: Archae - 54; Bacteria - 3998; Metazoa - 22628; Fungi - 5603; Plants - 2672; Viruses - 351; Other Eukaryotes - 11736 (source: NCBI BLink).
AT2G01090AT2G01090.1AAACGGCAubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT1G15120.1); Has 95 Blast hits to 95 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT2G01100AT2G01100.1AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink).
AT2G01100.1TAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink).
AT2G01100.2AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink).
AT2G01100.2TAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink).
AT2G01100.3AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink).
AT2G01100.3TAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 18138 Blast hits to 9351 proteins in 574 species: Archae - 0; Bacteria - 666; Metazoa - 10236; Fungi - 1653; Plants - 1129; Viruses - 52; Other Eukaryotes - 4402 (source: NCBI BLink).
AT2G01600AT2G01600.1CAAAACGCepsin N-terminal homology (ENTH) domain-containing protein; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: N-terminal protein myristoylation, clathrin coat assembly; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein (TAIR:AT1G14910.1); Has 692 Blast hits to 673 proteins in 140 species: Archae - 0; Bacteria - 10; Metazoa - 279; Fungi - 125; Plants - 239; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).
AT2G01640AT2G01640.1GCCTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 18; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G01860AT2G01860.1GTCGTTTTGAEMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT2G01870AT2G01870.1AATTGGGCCTTTAAAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G02000AT2G02000.1CGTTTTGAglutamate decarboxylase 3 (GAD3); FUNCTIONS IN: calmodulin binding; INVOLVED IN: carboxylic acid metabolic process, glutamate metabolic process, glutamate decarboxylation to succinate; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent decarboxylase (InterPro:IPR002129), Glutamate decarboxylase (InterPro:IPR010107), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GAD4 (glutamate decarboxylase 4); calmodulin binding (TAIR:AT2G02010.1); Has 1647 Blast hits to 1645 proteins in 499 species: Archae - 126; Bacteria - 839; Metazoa - 130; Fungi - 220; Plants - 174; Viruses - 7; Other Eukaryotes - 151 (source: NCBI BLink).
AT2G02100AT2G02100.1AAACGCGTPredicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT2G02140AT2G02140.1GCCTTTAATTACGPredicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT2G02170AT2G02170.1TTAAAGGCremorin family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516); BEST Arabidopsis thaliana protein match is: remorin family protein (TAIR:AT1G30320.1); Has 3130 Blast hits to 2122 proteins in 368 species: Archae - 6; Bacteria - 639; Metazoa - 620; Fungi - 332; Plants - 367; Viruses - 5; Other Eukaryotes - 1161 (source: NCBI BLink).
AT2G02170.2TTAAAGGCremorin family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516); BEST Arabidopsis thaliana protein match is: remorin family protein (TAIR:AT1G30320.1); Has 3130 Blast hits to 2122 proteins in 368 species: Archae - 6; Bacteria - 639; Metazoa - 620; Fungi - 332; Plants - 367; Viruses - 5; Other Eukaryotes - 1161 (source: NCBI BLink).
AT2G02570AT2G02570.1AAAACGGCGTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02570.1ACGCGCCGCGTTTTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02570.2AAAACGGCGTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02570.2ACGCGCCGCGTTTTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02570.3AAAACGGCGTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02570.3ACGCGCCGCGTTTTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02570.4AAAACGGCGTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02570.4ACGCGCCGCGTTTTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tudor subgroup (InterPro:IPR018351), Tudor (InterPro:IPR002999); Has 231 Blast hits to 231 proteins in 107 species: Archae - 0; Bacteria - 5; Metazoa - 106; Fungi - 55; Plants - 29; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT2G02810AT2G02810.1AAAACGGCGTEncodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER.
AT2G03150AT2G03150.1AACGGGCCTATAembryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink).
AT2G03150.1TAACGGGCCembryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink).
AT2G03350AT2G03350.1TCAAAACGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08890.2); Has 292 Blast hits to 292 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 291; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G03430AT2G03430.1AAAAGGCCCATAAACGGGCCCAATATankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink).
AT2G03680AT2G03680.1CGTTTTGAThe SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle.
AT2G03680.2CGTTTTGAThe SPR1 gene encodes a plant-specific 12-kD protein which has a repeated motif at both ends, separated by a predicted rod-like domain, suggesting that it may act as an intermolecular linker. Ubiquitously expressed and belongs to a six-member gene family in Arabidopsis; expressed in transgenic seedlings localized to microtubules within the cortical array, preprophase band, phragmoplast, and mitotic spindle.
AT2G04280AT2G04280.1CGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12700.1); Has 74 Blast hits to 74 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G04350AT2G04350.1CAGCGTTTlong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.1GCGTTTTGAlong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.2CAGCGTTTlong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04350.2GCGTTTTGAlong-chain-fatty-acid--CoA ligase family protein / long-chain acyl-CoA synthetase family protein (LACS8); FUNCTIONS IN: long-chain-fatty-acid-CoA ligase activity, catalytic activity; INVOLVED IN: fatty acid biosynthetic process, metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: AMP-dependent synthetase and ligase (InterPro:IPR000873); BEST Arabidopsis thaliana protein match is: LACS9 (LONG CHAIN ACYL-COA SYNTHETASE 9); long-chain-fatty-acid-CoA ligase (TAIR:AT1G77590.1); Has 43862 Blast hits to 37315 proteins in 2139 species: Archae - 522; Bacteria - 25138; Metazoa - 2389; Fungi - 2269; Plants - 1180; Viruses - 2; Other Eukaryotes - 12362 (source: NCBI BLink).
AT2G04378AT2G04378.1GCCTTTAAbeta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G04378.2GCCTTTAAbeta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G04390AT2G04390.1TTAAAGGC40S ribosomal protein S17 (RPS17A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus, plasma membrane; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT2G04410AT2G04410.1TAACGGGCCCATTAAGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G04650AT2G04650.1TAAAACGCADP-glucose pyrophosphorylase family protein; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: ADP-glucose pyrophosphorylase family protein (TAIR:AT1G74910.2); Has 7354 Blast hits to 7349 proteins in 1328 species: Archae - 421; Bacteria - 4278; Metazoa - 363; Fungi - 219; Plants - 282; Viruses - 0; Other Eukaryotes - 1791 (source: NCBI BLink).
AT2G04660AT2G04660.1GCGTTTTAa highly conserved ubiquitin-protein ligase involved in cell cycle regulation
AT2G04780AT2G04780.1AAAACGGCAfasciclin-like arabinogalactan-protein 7 (Fla7)
AT2G04780.2AAAACGGCAfasciclin-like arabinogalactan-protein 7 (Fla7)
AT2G04842AT2G04842.1CAAAACGCEncodes a dual localized threonyl-tRNA synthetase found both in the mitochondrion and the chloroplast. Plants mutated in this gene terminate as embryos in the globular stage.
AT2G04842.1CAAAACGCEncodes a dual localized threonyl-tRNA synthetase found both in the mitochondrion and the chloroplast. Plants mutated in this gene terminate as embryos in the globular stage.
AT2G04880AT2G04880.1GCGTTTTGEncodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.
AT2G04880.2GCGTTTTGEncodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.
AT2G05260AT2G05260.1TAAAACGCCGTCGTTTClipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G05260.2TAAAACGCCGTCGTTTClipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G10955.1); Has 115 Blast hits to 115 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 115; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G05910AT2G05910.1AAAGTCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF567 (InterPro:IPR007612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20640.1); Has 150 Blast hits to 150 proteins in 11 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G06530AT2G06530.1ACGCGTTTVPS2.1; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT III complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS2.3 (VACUOLAR PROTEIN SORTING-ASSOCIATED PROTEIN 2.3) (TAIR:AT1G03950.1); Has 1847 Blast hits to 1844 proteins in 191 species: Archae - 6; Bacteria - 15; Metazoa - 919; Fungi - 326; Plants - 342; Viruses - 6; Other Eukaryotes - 233 (source: NCBI BLink).
AT2G07180AT2G07180.1CGTTTTGAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G01020.1); Has 83377 Blast hits to 82332 proteins in 3112 species: Archae - 42; Bacteria - 7499; Metazoa - 37069; Fungi - 6338; Plants - 18225; Viruses - 294; Other Eukaryotes - 13910 (source: NCBI BLink).
AT2G09990AT2G09990.1TCAAAACGCC40S ribosomal protein S16 (RPS16A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast, membrane; EXPRESSED IN: guard cell, callus, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Ribosomal protein S9 (InterPro:IPR000754), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S16 (RPS16C) (TAIR:AT5G18380.1); Has 4968 Blast hits to 4968 proteins in 1538 species: Archae - 152; Bacteria - 2664; Metazoa - 274; Fungi - 125; Plants - 112; Viruses - 0; Other Eukaryotes - 1641 (source: NCBI BLink).
AT2G10950AT2G10950.1GCGTTTTGBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 132 Blast hits to 124 proteins in 24 species: Archae - 0; Bacteria - 2; Metazoa - 28; Fungi - 2; Plants - 81; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT2G10950.1TCAAAACGBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 132 Blast hits to 124 proteins in 24 species: Archae - 0; Bacteria - 2; Metazoa - 28; Fungi - 2; Plants - 81; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT2G12461AT2G12461.1GGGCCGTTunknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT2G13560AT2G13560.1CGTTTTGAmalate oxidoreductase, putative; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor, malic enzyme activity, ATP binding; INVOLVED IN: response to salt stress, malate metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Malic oxidoreductase (InterPro:IPR001891), Malic enzyme, NAD-binding (InterPro:IPR012302), Malic enzyme, conserved site (InterPro:IPR015884), Malic enzyme, N-terminal (InterPro:IPR012301), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: malate oxidoreductase, putative (TAIR:AT4G00570.1); Has 5981 Blast hits to 5971 proteins in 1332 species: Archae - 86; Bacteria - 3249; Metazoa - 553; Fungi - 152; Plants - 269; Viruses - 0; Other Eukaryotes - 1672 (source: NCBI BLink).
AT2G14890AT2G14890.1CGCGTTTTGAputative proline-rich protein (At2g14890) mRNA, complete
AT2G14890.2CGCGTTTTGAputative proline-rich protein (At2g14890) mRNA, complete
AT2G15240AT2G15240.1TCAAAACGUNC-50 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UNC-50 (InterPro:IPR007881); Has 239 Blast hits to 239 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 63; Plants - 24; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT2G15290AT2G15290.1CAATGGGCCGTTEncodes a protein located in the chloroplast inner envelope. The study of mutant defective in the gene product suggests that the protein is involved in the translocation of protein across the envelope membrane into the chloroplast stroma.
AT2G15790AT2G15790.1TGTCGTTTTGASQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot.
AT2G16750AT2G16750.1GCCGTTTAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G35030.2); Has 78634 Blast hits to 77772 proteins in 2243 species: Archae - 39; Bacteria - 7066; Metazoa - 34040; Fungi - 5682; Plants - 18147; Viruses - 374; Other Eukaryotes - 13286 (source: NCBI BLink).
AT2G16780AT2G16780.1AAAACGGCAEncodes a WD-40 repeat protein similar to yeast MSI1.
AT2G17240AT2G17240.1TTATGGGCCACCCAATAAAAGCCTTTAAAAGCCCACTATCAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24506.1); Has 3052 Blast hits to 987 proteins in 134 species: Archae - 0; Bacteria - 363; Metazoa - 1137; Fungi - 63; Plants - 119; Viruses - 54; Other Eukaryotes - 1316 (source: NCBI BLink).
AT2G17530AT2G17530.1GGCCTTTAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G35500.1); Has 26763 Blast hits to 22425 proteins in 758 species: Archae - 2; Bacteria - 1135; Metazoa - 12294; Fungi - 4189; Plants - 3231; Viruses - 62; Other Eukaryotes - 5850 (source: NCBI BLink).
AT2G17530.2GGCCTTTAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G35500.1); Has 26763 Blast hits to 22425 proteins in 758 species: Archae - 2; Bacteria - 1135; Metazoa - 12294; Fungi - 4189; Plants - 3231; Viruses - 62; Other Eukaryotes - 5850 (source: NCBI BLink).
AT2G17695AT2G17695.1CGTGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 104; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT2G17695.2CGTGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 104; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT2G17972AT2G17972.1CTTGGGCCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; Has 19 Blast hits to 19 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G17975AT2G17975.1CAAAACGCzinc finger (Ran-binding) family protein; FUNCTIONS IN: binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: zinc finger (Ran-binding) family protein (TAIR:AT5G25490.1); Has 893 Blast hits to 535 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 304; Fungi - 62; Plants - 313; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink).
AT2G18250AT2G18250.1TAAACGGCGAt2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis.
AT2G18250.1TGCCGTTTTAt2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis.
AT2G18280AT2G18280.1GCCTTTAAMember of TLP family
AT2G18280.2GCCTTTAAMember of TLP family
AT2G18400AT2G18400.1CGTGCCGTTTTribosomal protein L6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: emb2394 (embryo defective 2394); structural constituent of ribosome (TAIR:AT1G05190.1); Has 5053 Blast hits to 5053 proteins in 1481 species: Archae - 1; Bacteria - 2961; Metazoa - 3; Fungi - 77; Plants - 71; Viruses - 0; Other Eukaryotes - 1940 (source: NCBI BLink).
AT2G19340AT2G19340.1AAAACGGCAmembrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29870.1); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT2G19340.2AAAACGGCAmembrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G29870.1); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT2G19385AT2G19385.1CGTTTTGAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2, LYAR-type (InterPro:IPR014898); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G19380.1); Has 443 Blast hits to 397 proteins in 133 species: Archae - 0; Bacteria - 6; Metazoa - 196; Fungi - 75; Plants - 41; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink).
AT2G19910AT2G19910.1AAAACGCGRNA-dependent RNA polymerase family protein; FUNCTIONS IN: RNA-directed RNA polymerase activity; INVOLVED IN: posttranscriptional gene silencing; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-dependent RNA polymerase, eukaryotic-type (InterPro:IPR007855); BEST Arabidopsis thaliana protein match is: RNA-dependent RNA polymerase family protein (TAIR:AT2G19920.1); Has 326 Blast hits to 325 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 52; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT2G19910.1TAAACGGCRNA-dependent RNA polymerase family protein; FUNCTIONS IN: RNA-directed RNA polymerase activity; INVOLVED IN: posttranscriptional gene silencing; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA-dependent RNA polymerase, eukaryotic-type (InterPro:IPR007855); BEST Arabidopsis thaliana protein match is: RNA-dependent RNA polymerase family protein (TAIR:AT2G19920.1); Has 326 Blast hits to 325 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 52; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT2G20260AT2G20260.1AAACGCTGEncodes subunit E of photosystem I.
AT2G20360AT2G20360.1TGCCGTTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink).
AT2G20450AT2G20450.1TTAATGGGCCTTTAA60S ribosomal protein L14 (RPL14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, endoplasmic reticulum, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14B) (TAIR:AT4G27090.1); Has 531 Blast hits to 531 proteins in 234 species: Archae - 58; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT2G20530AT2G20530.1GCCGTTTAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).
AT2G20530.2GCCGTTTAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink).
AT2G20770AT2G20770.1AAACGCTGEncodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase.
AT2G20800AT2G20800.1CAAAACGCNAD(P)H dehydrogenase B4 (NDB4); FUNCTIONS IN: NADH dehydrogenase activity; LOCATED IN: extrinsic to mitochondrial inner membrane, mitochondrion, plastid; EXPRESSED IN: 7 plant structures; CONTAINS InterPro DOMAIN/s: Pyridine nucleotide-disulphide oxidoreductase, class-II (InterPro:IPR000103), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327), EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: NDB3; NADH dehydrogenase (TAIR:AT4G21490.1); Has 6313 Blast hits to 5938 proteins in 1236 species: Archae - 167; Bacteria - 4494; Metazoa - 37; Fungi - 382; Plants - 242; Viruses - 0; Other Eukaryotes - 991 (source: NCBI BLink).
AT2G20820AT2G20820.1CAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G20820.2CAAAACGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 28 Blast hits to 28 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G20920AT2G20920.1CGCCGTTTunknown protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 178 Blast hits to 177 proteins in 58 species: Archae - 0; Bacteria - 89; Metazoa - 0; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink).
AT2G21160AT2G21160.1CAAAACGCTGTCGTTTTtranslocon-associated protein alpha (TRAP alpha) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated protein (TRAP), alpha subunit (InterPro:IPR005595); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16595.1); Has 195 Blast hits to 195 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 18; Plants - 38; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT2G21160.2CAAAACGCTGTCGTTTTtranslocon-associated protein alpha (TRAP alpha) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, endoplasmic reticulum, plasma membrane, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated protein (TRAP), alpha subunit (InterPro:IPR005595); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G16595.1); Has 195 Blast hits to 195 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 18; Plants - 38; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT2G21280AT2G21280.1CAAAGCCCAATAAGGGCCTTTAAA nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system.
AT2G21290AT2G21290.1TTAAAGGCCCTTATTGGGCTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G21500AT2G21500.1AACGGCGTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT2G21500.2AACGGCGTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G39140.5); Has 194 Blast hits to 166 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 48; Fungi - 29; Plants - 92; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT2G21540AT2G21540.1AAAACGGCASEC14-LIKE 3 (SFH3); FUNCTIONS IN: phosphatidylinositol transporter activity; INVOLVED IN: flower development, transport; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14; phosphatidylinositol transporter (TAIR:AT4G39180.1); Has 2080 Blast hits to 2076 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 815; Fungi - 459; Plants - 466; Viruses - 0; Other Eukaryotes - 340 (source: NCBI BLink).
AT2G21540.2AAAACGGCASEC14-LIKE 3 (SFH3); FUNCTIONS IN: phosphatidylinositol transporter activity; INVOLVED IN: flower development, transport; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14; phosphatidylinositol transporter (TAIR:AT4G39180.1); Has 2080 Blast hits to 2076 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 815; Fungi - 459; Plants - 466; Viruses - 0; Other Eukaryotes - 340 (source: NCBI BLink).
AT2G21640AT2G21640.1TAAAACGCTGCGEncodes a protein of unknown function that is a marker for oxidative stress response.
AT2G21960AT2G21960.1CGTTTTGAunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56180.1); Has 140 Blast hits to 140 proteins in 40 species: Archae - 0; Bacteria - 50; Metazoa - 0; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT2G22460AT2G22460.1AAACGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF617, plant (InterPro:IPR006460); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65340.1); Has 134 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 134; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G22610AT2G22610.1CAAAACGCkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT1G72250.1); Has 61125 Blast hits to 37324 proteins in 1305 species: Archae - 470; Bacteria - 4361; Metazoa - 29529; Fungi - 3969; Plants - 2072; Viruses - 206; Other Eukaryotes - 20518 (source: NCBI BLink).
AT2G22970AT2G22970.1TAAAACGCCSERINE CARBOXYPEPTIDASE-LIKE 11 (SCPL11); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S10 family protein (TAIR:AT2G22920.2); Has 2721 Blast hits to 2662 proteins in 326 species: Archae - 0; Bacteria - 303; Metazoa - 562; Fungi - 550; Plants - 980; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink).
AT2G22970.2TAAAACGCCSERINE CARBOXYPEPTIDASE-LIKE 11 (SCPL11); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S10 family protein (TAIR:AT2G22920.2); Has 2721 Blast hits to 2662 proteins in 326 species: Archae - 0; Bacteria - 303; Metazoa - 562; Fungi - 550; Plants - 980; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink).
AT2G22970.3TAAAACGCCSERINE CARBOXYPEPTIDASE-LIKE 11 (SCPL11); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563); BEST Arabidopsis thaliana protein match is: serine carboxypeptidase S10 family protein (TAIR:AT2G22920.2); Has 2721 Blast hits to 2662 proteins in 326 species: Archae - 0; Bacteria - 303; Metazoa - 562; Fungi - 550; Plants - 980; Viruses - 0; Other Eukaryotes - 326 (source: NCBI BLink).
AT2G23090AT2G23090.1TTTAACGGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 33; Plants - 46; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT2G23290AT2G23290.1AAAACGGCAMember of the R2R3 factor gene family.
AT2G23810AT2G23810.1TTCACGCGTTTMember of TETRASPANIN family
AT2G23985AT2G23985.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G23985.2TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G24600AT2G24600.1AAACGCGTankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G10340.1); Has 19378 Blast hits to 9653 proteins in 395 species: Archae - 20; Bacteria - 1127; Metazoa - 11375; Fungi - 1040; Plants - 1601; Viruses - 129; Other Eukaryotes - 4086 (source: NCBI BLink).
AT2G24600.2AAACGCGTankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G10340.1); Has 19378 Blast hits to 9653 proteins in 395 species: Archae - 20; Bacteria - 1127; Metazoa - 11375; Fungi - 1040; Plants - 1601; Viruses - 129; Other Eukaryotes - 4086 (source: NCBI BLink).
AT2G24600.3AAACGCGTankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT1G10340.1); Has 19378 Blast hits to 9653 proteins in 395 species: Archae - 20; Bacteria - 1127; Metazoa - 11375; Fungi - 1040; Plants - 1601; Viruses - 129; Other Eukaryotes - 4086 (source: NCBI BLink).
AT2G24762AT2G24762.1TAAACGGCAArabidopsis thaliana GLUTAMINE DUMPER 4 (AtGDU4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: GDU1 (GLUTAMINE DUMPER 1) (TAIR:AT4G31730.1); Has 64 Blast hits to 64 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G24970AT2G24970.1TGCCGTTTAGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G25670AT2G25670.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32610.1); Has 39716 Blast hits to 23014 proteins in 1226 species: Archae - 64; Bacteria - 4437; Metazoa - 16033; Fungi - 4681; Plants - 1370; Viruses - 266; Other Eukaryotes - 12865 (source: NCBI BLink).
AT2G25670.2TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32610.1); Has 39716 Blast hits to 23014 proteins in 1226 species: Archae - 64; Bacteria - 4437; Metazoa - 16033; Fungi - 4681; Plants - 1370; Viruses - 266; Other Eukaryotes - 12865 (source: NCBI BLink).
AT2G25950AT2G25950.1AAACGCTGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1000 (InterPro:IPR010400); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04780.1); Has 429 Blast hits to 429 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 205; Fungi - 104; Plants - 50; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).
AT2G25950.1CAAAACGCTGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1000 (InterPro:IPR010400); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G04780.1); Has 429 Blast hits to 429 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 205; Fungi - 104; Plants - 50; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).
AT2G26280AT2G26280.1TCAAAACGsmr (Small MutS Related) domain-containing protein mRNA, complete cds
AT2G26450AT2G26450.1CGTTTTGApectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT4G33230.1); Has 1480 Blast hits to 1433 proteins in 226 species: Archae - 0; Bacteria - 312; Metazoa - 5; Fungi - 138; Plants - 1022; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT2G26710AT2G26710.1ACGCCGTTEncodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion.
AT2G26975AT2G26975.1TCAAAACGcopper transporter, putative; FUNCTIONS IN: copper ion transmembrane transporter activity; INVOLVED IN: copper ion transport; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ctr copper transporter (InterPro:IPR007274); BEST Arabidopsis thaliana protein match is: COPT2; copper ion transmembrane transporter/ high affinity copper ion transmembrane transporter (TAIR:AT3G46900.1); Has 272 Blast hits to 271 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 32; Plants - 81; Viruses - 0; Other Eukaryotes - 30 (source: NCBI BLink).
AT2G27250AT2G27250.1TGCCGTTTTOne of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function.
AT2G27250.2TGCCGTTTTOne of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function.
AT2G27250.3TGCCGTTTTOne of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) is a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline. CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function.
AT2G27600AT2G27600.1AAAACGCCEncodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function.
AT2G27600.1AAAACGGCAEncodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function.
AT2G28620AT2G28620.1ACGCCGTTkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT3G45850.1); Has 38255 Blast hits to 26694 proteins in 1178 species: Archae - 315; Bacteria - 3865; Metazoa - 19131; Fungi - 3066; Plants - 1862; Viruses - 111; Other Eukaryotes - 9905 (source: NCBI BLink).
AT2G28690AT2G28690.1AAAACGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1635 (InterPro:IPR012862); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59760.1); Has 49 Blast hits to 49 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT2G29450AT2G29450.1AAAACGGCAEncodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002)
AT2G29700AT2G29700.1CAAAACGCEncodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension
AT2G29700.1TAAAACGCEncodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension
AT2G30260AT2G30260.1TAAACGGCGTencodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus.
AT2G30280AT2G30280.1AAAACGCGGCGTTTTunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 44325 Blast hits to 17174 proteins in 814 species: Archae - 92; Bacteria - 12397; Metazoa - 14270; Fungi - 4388; Plants - 1716; Viruses - 607; Other Eukaryotes - 10855 (source: NCBI BLink).
AT2G30280.1CGTTTTGAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 44325 Blast hits to 17174 proteins in 814 species: Archae - 92; Bacteria - 12397; Metazoa - 14270; Fungi - 4388; Plants - 1716; Viruses - 607; Other Eukaryotes - 10855 (source: NCBI BLink).
AT2G30280.1TAAAACGCCunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 44325 Blast hits to 17174 proteins in 814 species: Archae - 92; Bacteria - 12397; Metazoa - 14270; Fungi - 4388; Plants - 1716; Viruses - 607; Other Eukaryotes - 10855 (source: NCBI BLink).
AT2G30330AT2G30330.1TCAAAACGGCGCGTGCN5L1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-like 1 (InterPro:IPR009395); Has 143 Blast hits to 143 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 4; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G30490AT2G30490.1ACGCCGTTTAEncodes a cinnamate-4-hydroxylase.
AT2G30490.1ACGCCGTTTAEncodes a cinnamate-4-hydroxylase.
AT2G30840AT2G30840.1TGCCGTTTencodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase
AT2G31710AT2G31710.1AAAACGGCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05780.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G32060AT2G32060.1AAACGACAGCGTTT40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT2G32060.2AAACGACAGCGTTT40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT2G32060.3AAACGACAGCGTTT40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT2G32380AT2G32380.1GCCGTTTAAACCGGTTCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane protein 97, predicted (InterPro:IPR016964); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05210.1); Has 102 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 0; Metazoa - 50; Fungi - 9; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G33010AT2G33010.1AAAACGGCubiquitin-associated (UBA)/TS-N domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin-associated (UBA)/TS-N domain-containing protein-related (TAIR:AT2G33000.1); Has 20 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 1; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G33120AT2G33120.1ACGCGTTTEncodes a member of Synaptobrevin -like protein family.
AT2G33120.2ACGCGTTTEncodes a member of Synaptobrevin -like protein family.
AT2G33250AT2G33250.1CGCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G33530AT2G33530.1TCAAAACGserine carboxypeptidase-like 46 (scpl46); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL45 (SERINE CARBOXYPEPTIDASE-LIKE 45 PRECURSOR); serine-type carboxypeptidase (TAIR:AT1G28110.2); Has 2557 Blast hits to 2506 proteins in 333 species: Archae - 0; Bacteria - 228; Metazoa - 572; Fungi - 560; Plants - 882; Viruses - 0; Other Eukaryotes - 315 (source: NCBI BLink).
AT2G33580AT2G33580.1ACGCGTTTprotein kinase family protein / peptidoglycan-binding LysM domain-containing protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation, cell wall macromolecule catabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidoglycan-binding lysin domain (InterPro:IPR018392), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein / peptidoglycan-binding LysM domain-containing protein (TAIR:AT2G23770.1); Has 73583 Blast hits to 72807 proteins in 2831 species: Archae - 40; Bacteria - 6039; Metazoa - 33365; Fungi - 5168; Plants - 16933; Viruses - 330; Other Eukaryotes - 11708 (source: NCBI BLink).
AT2G34520AT2G34520.1TCAAAACGnuclear-encoded mitochondrial ribosomal protein S14
AT2G34630AT2G34630.2GCCGTTTTEncodes a geranyl diphosphate synthase. RNAi lines are dwarf. T-DNA knock-out lines are embryo lethal.
AT2G34710AT2G34710.1GGCGTTTTDominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA.
AT2G35060AT2G35060.1TCAAAACGCpotassium transporter
AT2G35060.2TCAAAACGCpotassium transporter
AT2G35320AT2G35320.1ATAATGGGCCTTTAATTGGGCCGAhomologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent.
AT2G35520AT2G35520.1AAAACGGCGDEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT2G35520.2AAAACGGCGDEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT2G35720AT2G35720.1CAAAACGCCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT3G47940.1); Has 15787 Blast hits to 15749 proteins in 1885 species: Archae - 105; Bacteria - 5397; Metazoa - 3297; Fungi - 1386; Plants - 1147; Viruses - 13; Other Eukaryotes - 4442 (source: NCBI BLink).
AT2G35750AT2G35750.1TTAAAGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G36300AT2G36300.1TCAAAACGintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT3G52760.1); Has 503 Blast hits to 503 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 288; Fungi - 81; Plants - 66; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink).
AT2G36390AT2G36390.1TCAAAACGEncodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues.
AT2G36640AT2G36640.1TAAACGGCEncodes putative phosphotyrosine protein belonging to late embryogenesis abundant (LEA) protein in group 3 that might be involved in maturation and desiccation tolerance of seeds. RFLP and CAPS mapping place it on chromosome 4 but the nucleotide sequence maps it to chromosome 2.
AT2G36770AT2G36770.1ACGCGTTTTUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT2G36780.1); Has 4947 Blast hits to 4898 proteins in 307 species: Archae - 0; Bacteria - 69; Metazoa - 1996; Fungi - 15; Plants - 2733; Viruses - 103; Other Eukaryotes - 31 (source: NCBI BLink).
AT2G36885AT2G36885.1AAAACGGCAGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT2G36885.2AAAACGGCAGCGTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 134 Blast hits to 134 proteins in 42 species: Archae - 0; Bacteria - 96; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT2G36895AT2G36895.1CAGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G36895.2CAGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G37400AT2G37400.1CAGCGTTTTGAchloroplast lumen common family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast thylakoid lumen, plastid, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT3G53560.1); Has 1554 Blast hits to 1284 proteins in 289 species: Archae - 132; Bacteria - 762; Metazoa - 103; Fungi - 19; Plants - 70; Viruses - 0; Other Eukaryotes - 468 (source: NCBI BLink).
AT2G37660AT2G37660.1TCAGGCCCGTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, apoplast, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 1711 Blast hits to 1685 proteins in 445 species: Archae - 20; Bacteria - 1147; Metazoa - 3; Fungi - 23; Plants - 245; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink).
AT2G37680AT2G37680.1CAAAACGCCONTAINS InterPro DOMAIN/s: Vacuolar import and degradation protein Vid24 (InterPro:IPR018618); Has 214 Blast hits to 214 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 124; Plants - 31; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G37760AT2G37760.1AAAACGCCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).
AT2G37760.2AAAACGCCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).
AT2G37760.3AAAACGCCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).
AT2G37760.4AAAACGCCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).
AT2G37760.5AAAACGCCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT2G37790.1); Has 15140 Blast hits to 15119 proteins in 1396 species: Archae - 191; Bacteria - 8564; Metazoa - 1885; Fungi - 1157; Plants - 688; Viruses - 0; Other Eukaryotes - 2655 (source: NCBI BLink).
AT2G38000AT2G38000.1CAAAACGCGchaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT2G38320AT2G38320.1GCCTTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01620.2); Has 716 Blast hits to 702 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 714; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G38480AT2G38480.1ACGCGTTTTintegral membrane protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36330.1); Has 109 Blast hits to 109 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 109; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G38650AT2G38650.1TAAACGGCGGALACTURONOSYLTRANSFERASE 7 (GAUT7); FUNCTIONS IN: polygalacturonate 4-alpha-galacturonosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: Golgi apparatus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: GAUT4 (Galacturonosyltransferase 4); polygalacturonate 4-alpha-galacturonosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT5G47780.1); Has 882 Blast hits to 876 proteins in 179 species: Archae - 0; Bacteria - 255; Metazoa - 131; Fungi - 43; Plants - 430; Viruses - 2; Other Eukaryotes - 21 (source: NCBI BLink).
AT2G38760AT2G38760.1TCAAAACGAnnexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane.
AT2G39445AT2G39445.1TTAAAGGCCCATTCGAGGCCCAACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: PIG-P (InterPro:IPR013717), Phosphatidylinositol N-acetylglucosaminyltransferase, GPI19/PIG-P subunit (InterPro:IPR016542); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61280.1); Has 228 Blast hits to 228 proteins in 105 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 60; Plants - 24; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT2G39550AT2G39550.1CGCCGTTTTencodes the beta subunit of geranylgeranyl transferase (GGT-IB), involved in both ABA-mediated and auxin signaling pathways.
AT2G39670AT2G39670.1CAAAACGCradical SAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity, RNA methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Conserved hypothetical protein CHP00048 (InterPro:IPR004383), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein (TAIR:AT3G19630.1); Has 4690 Blast hits to 4686 proteins in 1263 species: Archae - 5; Bacteria - 2900; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 5; Other Eukaryotes - 1705 (source: NCBI BLink).
AT2G39670.2CAAAACGCradical SAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity, RNA methyltransferase activity; INVOLVED IN: rRNA processing; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Conserved hypothetical protein CHP00048 (InterPro:IPR004383), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein (TAIR:AT3G19630.1); Has 4690 Blast hits to 4686 proteins in 1263 species: Archae - 5; Bacteria - 2900; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 5; Other Eukaryotes - 1705 (source: NCBI BLink).
AT2G40060AT2G40060.1CGTTTTGAprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT3G51890.1); Has 403 Blast hits to 391 proteins in 99 species: Archae - 2; Bacteria - 32; Metazoa - 184; Fungi - 36; Plants - 54; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink).
AT2G40290AT2G40290.1TGCCGTTTAeukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink).
AT2G40290.2TGCCGTTTAeukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink).
AT2G40290.3TGCCGTTTAeukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink).
AT2G40316AT2G40316.1TAAATGGGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G40316.2TAAATGGGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G40650AT2G40650.1AACGGCGTpre-mRNA splicing factor PRP38 family protein; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PRP38 (InterPro:IPR005037); Has 67657 Blast hits to 21471 proteins in 814 species: Archae - 56; Bacteria - 20349; Metazoa - 26407; Fungi - 5687; Plants - 2913; Viruses - 323; Other Eukaryotes - 11922 (source: NCBI BLink).
AT2G40660AT2G40660.1ACGCCGTTtRNA-binding region domain-containing protein; FUNCTIONS IN: tRNA binding; INVOLVED IN: tRNA aminoacylation for protein translation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), tRNA-binding region (InterPro:IPR002547); BEST Arabidopsis thaliana protein match is: methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative (TAIR:AT4G13780.1); Has 3620 Blast hits to 3608 proteins in 1164 species: Archae - 158; Bacteria - 2173; Metazoa - 404; Fungi - 148; Plants - 87; Viruses - 1; Other Eukaryotes - 649 (source: NCBI BLink).
AT2G40750AT2G40750.1GGCGTTTTmember of WRKY Transcription Factor; Group III
AT2G40765AT2G40765.1AAACGGCGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G40770AT2G40770.1TGCCGTTTTATP binding / DNA binding / helicase/ nucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), SNF2-related (InterPro:IPR000330), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: RAD5; ATP binding / ATP-dependent helicase/ DNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / protein binding / zinc ion binding (TAIR:AT5G22750.1); Has 13590 Blast hits to 8685 proteins in 812 species: Archae - 59; Bacteria - 2742; Metazoa - 4195; Fungi - 3438; Plants - 951; Viruses - 102; Other Eukaryotes - 2103 (source: NCBI BLink).
AT2G40810AT2G40810.1AAAACGGCACGAtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).
AT2G40810.2AAAACGGCACGAtATG18c; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18d (TAIR:AT3G56440.1); Has 1082 Blast hits to 1038 proteins in 176 species: Archae - 0; Bacteria - 32; Metazoa - 492; Fungi - 307; Plants - 112; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink).
AT2G41830AT2G41830.1CGTTTTGAcyclin-related; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin, C-terminal (InterPro:IPR004367); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G21080.1); Has 188 Blast hits to 186 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 115; Fungi - 3; Plants - 65; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT2G41905AT2G41905.1AAACGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; Has 27 Blast hits to 27 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G42230AT2G42230.1CTTAATGGGCCGTTTAAAGCCCATTTAtubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT2G42230.2CTTAATGGGCCGTTTAAAGCCCATTTAtubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT2G42790AT2G42790.1ACGCCGTTGGATEncodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.
AT2G43100AT2G43100.1TCAAAACGCaconitase C-terminal domain-containing protein; FUNCTIONS IN: hydro-lyase activity, 3-isopropylmalate dehydratase activity; INVOLVED IN: leucine biosynthetic process, metabolic process; LOCATED IN: 3-isopropylmalate dehydratase complex, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: 3-isopropylmalate dehydratase, small subunit (InterPro:IPR012305), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase-like core (InterPro:IPR015937); BEST Arabidopsis thaliana protein match is: aconitase C-terminal domain-containing protein (TAIR:AT2G43090.1); Has 5949 Blast hits to 5949 proteins in 1261 species: Archae - 224; Bacteria - 3135; Metazoa - 7; Fungi - 224; Plants - 45; Viruses - 0; Other Eukaryotes - 2314 (source: NCBI BLink).
AT2G43210AT2G43210.1TCAAAACGUBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink).
AT2G43210.2TCAAAACGUBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012); Has 1155 Blast hits to 742 proteins in 155 species: Archae - 0; Bacteria - 70; Metazoa - 347; Fungi - 206; Plants - 87; Viruses - 16; Other Eukaryotes - 429 (source: NCBI BLink).
AT2G43560AT2G43560.1TGCCGTTTimmunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6015 Blast hits to 5817 proteins in 1052 species: Archae - 33; Bacteria - 2800; Metazoa - 1234; Fungi - 332; Plants - 391; Viruses - 0; Other Eukaryotes - 1225 (source: NCBI BLink).
AT2G43790AT2G43790.1TGCCGTTTEncodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development.
AT2G43980AT2G43980.1TCAAAACGACinositol 1,3,4-trisphosphate 5/6-kinase 4 (AtITPK4); FUNCTIONS IN: magnesium ion binding, inositol-1,3,4-trisphosphate 5/6-kinase activity, catalytic activity, ATP binding, inositol tetrakisphosphate 1-kinase activity; INVOLVED IN: inositol trisphosphate metabolic process; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATP-grasp fold (InterPro:IPR011761), Inositol-tetrakisphosphate 1-kinase, uncharacterised-N-terminal (InterPro:IPR017418), Inositol 1, 3, 4-trisphosphate 56-kinase (InterPro:IPR008656); BEST Arabidopsis thaliana protein match is: inositol 1,3,4-trisphosphate 5/6-kinase family protein (TAIR:AT4G08170.2); Has 282 Blast hits to 279 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 0; Plants - 168; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT2G44065AT2G44065.1TAAAACGCribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink).
AT2G44065.2TAAAACGCribosomal protein L2 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding, transferase activity; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Translation protein SH3-like, subgroup (InterPro:IPR014722), Ribosomal protein L2, bacterial-type (InterPro:IPR005880), Ribosomal protein L2 (InterPro:IPR002171); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG01310.1); Has 7469 Blast hits to 7469 proteins in 2227 species: Archae - 235; Bacteria - 3117; Metazoa - 361; Fungi - 186; Plants - 960; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink).
AT2G44130AT2G44130.1GCGTTTTGkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G59940.1); Has 4261 Blast hits to 2607 proteins in 150 species: Archae - 8; Bacteria - 234; Metazoa - 3290; Fungi - 24; Plants - 494; Viruses - 5; Other Eukaryotes - 206 (source: NCBI BLink).
AT2G44130.1TTAAAGGCkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G59940.1); Has 4261 Blast hits to 2607 proteins in 150 species: Archae - 8; Bacteria - 234; Metazoa - 3290; Fungi - 24; Plants - 494; Viruses - 5; Other Eukaryotes - 206 (source: NCBI BLink).
AT2G44270AT2G44270.1TGCCGTTTATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink).
AT2G44270.1TGCCGTTTAATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink).
AT2G44310AT2G44310.1TCAAAACGcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G54530.1); Has 158 Blast hits to 153 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT2G44690AT2G44690.1GGCGTTTTGA member of ROP GTPase gene family.
AT2G44890AT2G44890.1TCAAAACGACAmember of CYP704A
AT2G44920AT2G44920.1AACGGGCCTTTTthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink).
AT2G44920.2AACGGGCCTTTTthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink).
AT2G45770AT2G45770.1TAAAACGCchloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids.
AT2G46060AT2G46060.1TAAAACGCTGtransmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G46060.2TAAAACGCTGtransmembrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EGF-like region, conserved site (InterPro:IPR013032); Has 127 Blast hits to 127 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT2G46090AT2G46090.1AAAACGGCCCATAAEncodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs.
AT2G46170AT2G46170.1ACGCCGTTreticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT2G46170.2ACGCCGTTreticulon family protein (RTNLB5); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB6) (TAIR:AT3G61560.1); Has 951 Blast hits to 951 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 652; Fungi - 6; Plants - 274; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT2G46280AT2G46280.1AAACGCTGEncodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT2G46280.2AAACGCTGEncodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT2G46280.3AAACGCTGEncodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT2G46470AT2G46470.1CGCGTTTTGINNER MEMBRANE PROTEIN OXA1-LIKE (OXA1L); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein import into mitochondrial inner membrane; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 60 kDa inner membrane insertion protein (InterPro:IPR001708); BEST Arabidopsis thaliana protein match is: OXA1; P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT5G62050.1); Has 4383 Blast hits to 4383 proteins in 1328 species: Archae - 0; Bacteria - 2560; Metazoa - 212; Fungi - 138; Plants - 111; Viruses - 0; Other Eukaryotes - 1362 (source: NCBI BLink).
AT2G46490AT2G46490.1AACGGCGTCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35110.1); Has 10 Blast hits to 10 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46550AT2G46550.1TGCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01240.3); Has 47 Blast hits to 43 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46800AT2G46800.1AAAACGGCCACGTGTTEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis.
AT2G46800.2AAAACGGCCACGTGTTEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis.
AT2G46850AT2G46850.1GCGTTTTGATP binding / protein kinase/ protein tyrosine kinase; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G23450.2); Has 14254 Blast hits to 14061 proteins in 404 species: Archae - 0; Bacteria - 73; Metazoa - 2017; Fungi - 136; Plants - 11571; Viruses - 17; Other Eukaryotes - 440 (source: NCBI BLink).
AT2G46900AT2G46900.1TAAAACGCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix, Nulp1-type (InterPro:IPR006994); Has 3014 Blast hits to 2357 proteins in 239 species: Archae - 2; Bacteria - 96; Metazoa - 1166; Fungi - 321; Plants - 100; Viruses - 47; Other Eukaryotes - 1282 (source: NCBI BLink).
AT2G46915AT2G46915.1GTCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G19340.1); Has 101 Blast hits to 96 proteins in 30 species: Archae - 0; Bacteria - 24; Metazoa - 10; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT2G47050AT2G47050.1AAAACGCCinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT3G62180.1); Has 58 Blast hits to 57 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G47250AT2G47250.1TAACGGGCCTTGRNA helicase, putative; FUNCTIONS IN: in 7 functions; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT3G62310.1); Has 7386 Blast hits to 6689 proteins in 1000 species: Archae - 0; Bacteria - 1927; Metazoa - 2123; Fungi - 842; Plants - 395; Viruses - 601; Other Eukaryotes - 1498 (source: NCBI BLink).
AT2G47650AT2G47650.1AAAACGCCencodes a protein similar to UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.
AT2G47840AT2G47840.1AAAACGGCAGCGTTTtic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT2G47960AT2G47960.1AACGGCCCATTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF974 (InterPro:IPR010378); Has 215 Blast hits to 214 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 46; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT2G48100AT2G48100.1AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).
AT2G48100.2AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).
AT2G48100.3AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).
AT2G48100.4AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).
AT3G01150AT3G01150.1GGCGTTTTEncodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.
AT3G01150.2GGCGTTTTEncodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.
AT3G01280AT3G01280.1TAAACGACGCCGTTTAEncodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.
AT3G01410AT3G01410.1TAAACGGCARNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink).
AT3G01410.2TAAACGGCARNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink).
AT3G01435AT3G01435.1CGTGCCGTTTTACGTGACAExpressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 36 Blast hits to 36 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G01440AT3G01440.1AAACGGCGToxygen evolving enhancer 3 (PsbQ) family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast, oxygen evolving complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbQ (InterPro:IPR008797); BEST Arabidopsis thaliana protein match is: oxygen-evolving enhancer protein 3, chloroplast, putative (PSBQ1) (PSBQ) (TAIR:AT4G21280.2); Has 110 Blast hits to 110 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G01440.1TGTCACGTAAAACGGCACGoxygen evolving enhancer 3 (PsbQ) family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis, light reaction; LOCATED IN: chloroplast thylakoid membrane, chloroplast photosystem II, chloroplast thylakoid lumen, chloroplast, oxygen evolving complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbQ (InterPro:IPR008797); BEST Arabidopsis thaliana protein match is: oxygen-evolving enhancer protein 3, chloroplast, putative (PSBQ1) (PSBQ) (TAIR:AT4G21280.2); Has 110 Blast hits to 110 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G01480AT3G01480.1AAAGCCCAACTAACGGCCCATCAEncodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes.
AT3G01480.2AAAGCCCAACTAACGGCCCATCAEncodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes.
AT3G01780AT3G01780.1ACGCCGTTTTEncodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position.
AT3G01810AT3G01810.1CGCCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2); Has 1293 Blast hits to 384 proteins in 97 species: Archae - 2; Bacteria - 96; Metazoa - 212; Fungi - 99; Plants - 59; Viruses - 0; Other Eukaryotes - 825 (source: NCBI BLink).
AT3G01810.2CGCCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2); Has 1293 Blast hits to 384 proteins in 97 species: Archae - 2; Bacteria - 96; Metazoa - 212; Fungi - 99; Plants - 59; Viruses - 0; Other Eukaryotes - 825 (source: NCBI BLink).
AT3G01910AT3G01910.1AAAACGACGCCGTTEncodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite.
AT3G01910.2AAAACGACGCCGTTEncodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite.
AT3G01910.3AAAACGACGCCGTTEncodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite.
AT3G01980AT3G01980.1CGCCGTTTTshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).
AT3G01980.2CGCCGTTTTshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).
AT3G01980.3CGCCGTTTTshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).
AT3G01980.4CGCCGTTTTshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT3G55290.2); Has 28072 Blast hits to 28066 proteins in 1715 species: Archae - 143; Bacteria - 17671; Metazoa - 848; Fungi - 1117; Plants - 688; Viruses - 0; Other Eukaryotes - 7605 (source: NCBI BLink).
AT3G02160AT3G02160.1GCCTTTAADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Bromodomain transcription factor (InterPro:IPR006565); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15570.1); Has 126 Blast hits to 126 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 70; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT3G02170AT3G02170.1GCCTTTAAEncodes LONGIFOLIA2 (LNG2). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG2 homologue LNG1 (At5g15580) has similar function.
AT3G02200AT3G02200.1CAGCGTTTproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02200.2CAGCGTTTproteasome family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: proteasome family protein (TAIR:AT5G15610.2); Has 450 Blast hits to 450 proteins in 138 species: Archae - 0; Bacteria - 2; Metazoa - 207; Fungi - 99; Plants - 78; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G02555AT3G02555.1AAATGGGCCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G02560AT3G02560.1TTTAACGGCCCATTT40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT3G02560.2TTTAACGGCCCATTT40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT3G02570AT3G02570.1AACGGCCCACAEncodes a protein with phosphomannose isomerase activity.
AT3G02620AT3G02620.1AAACGGCAacyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-[acyl-carrier-protein] desaturase/ oxidoreductase/ transition metal ion binding (TAIR:AT3G02610.1); Has 576 Blast hits to 573 proteins in 126 species: Archae - 0; Bacteria - 209; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT3G02630AT3G02630.1GCGTTTTAacyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative (TAIR:AT5G16240.1); Has 567 Blast hits to 564 proteins in 126 species: Archae - 0; Bacteria - 200; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT3G02660AT3G02660.1TTTAACGGGCCGTAEMBRYO DEFECTIVE 2768 (emb2768); FUNCTIONS IN: RNA binding, tyrosine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), RNA-binding S4 (InterPro:IPR002942), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6358 Blast hits to 6354 proteins in 1524 species: Archae - 11; Bacteria - 2982; Metazoa - 99; Fungi - 101; Plants - 19; Viruses - 0; Other Eukaryotes - 3146 (source: NCBI BLink).
AT3G02790AT3G02790.1GCGTTTTAzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT5G16470.1); Has 55 Blast hits to 55 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT3G02910AT3G02910.1AAACGCGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Butirosin biosynthesis, BtrG-like (InterPro:IPR013024), AIG2-like (InterPro:IPR009288); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G46720.1); Has 210 Blast hits to 210 proteins in 66 species: Archae - 2; Bacteria - 27; Metazoa - 122; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT3G03010AT3G03010.1AAATGGGCCGTTaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae - 158; Bacteria - 4; Metazoa - 158; Fungi - 86; Plants - 40; Viruses - 8; Other Eukaryotes - 171 (source: NCBI BLink).
AT3G03010.2AAATGGGCCGTTaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae - 158; Bacteria - 4; Metazoa - 158; Fungi - 86; Plants - 40; Viruses - 8; Other Eukaryotes - 171 (source: NCBI BLink).
AT3G03020AT3G03020.1AACGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G03020.2AACGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G03050AT3G03050.1GGCGTTTTGAencodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide.
AT3G03150AT3G03150.1AAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G03150.1AACGGCGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G03160AT3G03160.1GACGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G03160.1TGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G03210AT3G03210.1AAAACGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G03320AT3G03320.1GGCGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ProFAR isomerase-like (InterPro:IPR010759), ASCH domain (InterPro:IPR007374); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G43465.1); Has 65 Blast hits to 65 proteins in 18 species: Archae - 31; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT3G03650AT3G03650.1CGTTTTGAembryo sac development arrest 5 (EDA5); FUNCTIONS IN: catalytic activity; INVOLVED IN: megagametogenesis, pollen tube development; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT3G45400.1); Has 625 Blast hits to 623 proteins in 41 species: Archae - 0; Bacteria - 6; Metazoa - 31; Fungi - 0; Plants - 536; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT3G03840AT3G03840.1CGTTTTGAauxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT3G03820.1); Has 578 Blast hits to 575 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 577; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G04130AT3G04130.1TAAAACGCpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).
AT3G04130.2TAAAACGCpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G22670.1); Has 14751 Blast hits to 5328 proteins in 171 species: Archae - 2; Bacteria - 18; Metazoa - 312; Fungi - 238; Plants - 13610; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink).
AT3G04240AT3G04240.1AACGGCGTHas O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene.
AT3G04560AT3G04560.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink).
AT3G04750AT3G04750.1GCGTTTTGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G29760.1); Has 13201 Blast hits to 4902 proteins in 138 species: Archae - 0; Bacteria - 4; Metazoa - 48; Fungi - 60; Plants - 12893; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).
AT3G04760AT3G04760.1CGCCGTTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G09900.1); Has 26507 Blast hits to 6286 proteins in 193 species: Archae - 4; Bacteria - 28; Metazoa - 952; Fungi - 704; Plants - 23378; Viruses - 0; Other Eukaryotes - 1441 (source: NCBI BLink).
AT3G04830AT3G04830.1TAAAACGCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G04830.1TAAAACGCAGCGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G04830.2TAAAACGCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G04830.2TAAAACGCAGCGTTTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G04880AT3G04880.1TTAAAGGCCGCCACGencodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes).
AT3G04950AT3G04950.1AAACGCTGCGunknown protein; Has 344 Blast hits to 344 proteins in 131 species: Archae - 0; Bacteria - 268; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT3G05060AT3G05060.1AACGGGCCSAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein
AT3G05060.1GGCGTTTTASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein
AT3G05060.1TAAAACGCCSAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein
AT3G05070AT3G05070.1GGCCCGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink).
AT3G05070.1GGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink).
AT3G05070.1TAAAACGCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink).
AT3G05345AT3G05345.1GGCGTTTTGheat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1).
AT3G05410AT3G05410.1AAACGCTGcalcium ion binding; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: oxygen evolving complex, extrinsic to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: PPL1 (PsbP-like protein 1); calcium ion binding (TAIR:AT3G55330.1).
AT3G05410.2AAACGCTGcalcium ion binding; FUNCTIONS IN: calcium ion binding; INVOLVED IN: photosynthesis; LOCATED IN: oxygen evolving complex, extrinsic to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683), Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); BEST Arabidopsis thaliana protein match is: PPL1 (PsbP-like protein 1); calcium ion binding (TAIR:AT3G55330.1).
AT3G05490AT3G05490.1AAACGCGTMember of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT3G05500AT3G05500.1AACGGCCCAAArubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 77 Blast hits to 77 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G05520AT3G05520.1TCAAAACGACACCGTCAGAF-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865).
AT3G05520.2TCAAAACGACACCGTCAGAF-actin capping protein alpha subunit family protein; FUNCTIONS IN: actin binding; INVOLVED IN: actin cytoskeleton organization; LOCATED IN: F-actin capping protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: F-actin capping protein, alpha subunit, actin binding (InterPro:IPR018315), F-actin capping protein, alpha subunit (InterPro:IPR002189), F-actin capping protein, alpha subunit, conserved site (InterPro:IPR017865).
AT3G05710AT3G05710.1TGCCGTTTTmember of SYP4 Gene Family
AT3G05710.2TGCCGTTTTmember of SYP4 Gene Family
AT3G05730AT3G05730.1AGATGGGCCTTTAAAGGCEncodes a defensin-like (DEFL) family protein.
AT3G06050AT3G06050.1AAAACGGCAEncodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions.
AT3G06310AT3G06310.1TCAAAACGCAGCGTTTNADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G06310.2TCAAAACGCAGCGTTTNADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G06320AT3G06320.1AAACGCTGCGTTTTGAribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink).
AT3G06455AT3G06455.1TCAAAACGAAAAGCCCAACTsplicing factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT4G01000.1); Has 5886 Blast hits to 2871 proteins in 525 species: Archae - 0; Bacteria - 0; Metazoa - 2661; Fungi - 609; Plants - 1364; Viruses - 154; Other Eukaryotes - 1098 (source: NCBI BLink).
AT3G06510AT3G06510.1ACGCCGTTTCAATGGGCCEncodes a protein with beta-glucosidase activity, mutants show increased sensitivity to freezing
AT3G06510.2ACGCCGTTTCAATGGGCCEncodes a protein with beta-glucosidase activity, mutants show increased sensitivity to freezing
AT3G06590AT3G06590.1GGGCCGTTtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G17100.2); Has 141 Blast hits to 141 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G06590.2GGGCCGTTtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT3G17100.2); Has 141 Blast hits to 141 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G06680AT3G06680.1AACGGGCCTAAG60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).
AT3G06680.2AACGGGCCTAAG60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).
AT3G06890AT3G06890.1AAACGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; Has 35 Blast hits to 35 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G06950AT3G06950.1TCAAAACGtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G34150.1); Has 6144 Blast hits to 6136 proteins in 1570 species: Archae - 113; Bacteria - 2971; Metazoa - 267; Fungi - 167; Plants - 77; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink).
AT3G06960AT3G06960.1AAAACGGCAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G06960.2AAAACGGCAPIGMENT DEFECTIVE 320 (PDE320); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: acylglycerol transport; LOCATED IN: endoplasmic reticulum, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G44640.1); Has 24 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G07020AT3G07020.1CAGCGTTTTAUDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink).
AT3G07020.2CAGCGTTTTAUDP-glucose:sterol glucosyltransferase (UGT80A2); FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28 (InterPro:IPR004276), UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UDP-glucose:sterol glucosyltransferase, putative (TAIR:AT1G43620.3); Has 1535 Blast hits to 1509 proteins in 402 species: Archae - 0; Bacteria - 841; Metazoa - 296; Fungi - 260; Plants - 77; Viruses - 3; Other Eukaryotes - 58 (source: NCBI BLink).
AT3G07230AT3G07230.1AAAACGCCwound-responsive protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Wound-inducible basic (InterPro:IPR012643); Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G07500AT3G07500.1CGTGCCGTTTfar-red impaired responsive family protein / FAR1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcription factor, FAR1-related (InterPro:IPR004330); BEST Arabidopsis thaliana protein match is: far-red impaired responsive family protein / FAR1 family protein (TAIR:AT2G43280.1); Has 470 Blast hits to 432 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 470; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G07720AT3G07720.1TGCCGTTTTkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: NSP5 (NITRILE SPECIFIER PROTEIN 5) (TAIR:AT5G48180.1); Has 8161 Blast hits to 4457 proteins in 239 species: Archae - 8; Bacteria - 208; Metazoa - 4770; Fungi - 730; Plants - 968; Viruses - 16; Other Eukaryotes - 1461 (source: NCBI BLink).
AT3G07780AT3G07780.1ACGCGTTTEncodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems.
AT3G07790AT3G07790.1CAAAACGCGTDGCR14-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 242 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 55; Plants - 18; Viruses - 13; Other Eukaryotes - 37 (source: NCBI BLink).
AT3G07790.1TCAAAACGDGCR14-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 242 Blast hits to 238 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 55; Plants - 18; Viruses - 13; Other Eukaryotes - 37 (source: NCBI BLink).
AT3G08590AT3G08590.1AAACGGCA2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink).
AT3G08590.2AAACGGCA2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative; FUNCTIONS IN: manganese ion binding, phosphoglycerate mutase activity, 2,3-bisphosphoglycerate-independent phosphoglycerate mutase activity, catalytic activity, metal ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Alkaline phosphatase-like, alpha/beta/alpha (InterPro:IPR017849), Metalloenzyme (InterPro:IPR006124), BPG-independent PGAM, N-terminal (InterPro:IPR011258), Alkaline-phosphatase-like, core domain (InterPro:IPR017850), Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent (InterPro:IPR005995); BEST Arabidopsis thaliana protein match is: 2,3-biphosphoglycerate-independent phosphoglycerate mutase, putative / phosphoglyceromutase, putative (TAIR:AT1G09780.1); Has 3366 Blast hits to 3363 proteins in 901 species: Archae - 36; Bacteria - 1673; Metazoa - 32; Fungi - 52; Plants - 344; Viruses - 0; Other Eukaryotes - 1229 (source: NCBI BLink).
AT3G08680AT3G08680.1CAAAACGCleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink).
AT3G08680.1TGCCGTTTAleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink).
AT3G08680.2CAAAACGCleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink).
AT3G08680.2TGCCGTTTAleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane, plant-type cell wall; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT5G58300.2); Has 86665 Blast hits to 68248 proteins in 2030 species: Archae - 34; Bacteria - 5383; Metazoa - 28963; Fungi - 4621; Plants - 36049; Viruses - 327; Other Eukaryotes - 11288 (source: NCBI BLink).
AT3G08780AT3G08780.1TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G08780.2TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G08950AT3G08950.1TGCCGTTTTelectron transport SCO1/SenC family protein; FUNCTIONS IN: copper ion binding; INVOLVED IN: copper ion transport, respiratory chain complex IV assembly, cellular copper ion homeostasis, cell redox homeostasis; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Synthesis of cytochrome c oxidase, Sco1/Sco2 (InterPro:IPR017276), Copper chaperone SCO1/SenC (InterPro:IPR003782), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: electron transport SCO1/SenC family protein (TAIR:AT4G39740.1); Has 3037 Blast hits to 3037 proteins in 688 species: Archae - 11; Bacteria - 1550; Metazoa - 132; Fungi - 105; Plants - 35; Viruses - 0; Other Eukaryotes - 1204 (source: NCBI BLink).
AT3G09060AT3G09060.1AAAACGGCpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 25596 Blast hits to 6045 proteins in 189 species: Archae - 8; Bacteria - 12; Metazoa - 612; Fungi - 717; Plants - 23009; Viruses - 0; Other Eukaryotes - 1238 (source: NCBI BLink).
AT3G09090AT3G09090.1GCGTTTTAEncodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development.
AT3G09090.1TCAAAACGGCAEncodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development.
AT3G09090.2GCGTTTTAEncodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development.
AT3G09090.2TCAAAACGGCAEncodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development.
AT3G09180AT3G09180.1AAAACGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 88 Blast hits to 88 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G09350AT3G09350.1TTAAAGGCCCAATTarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT3G09350.2TTAAAGGCCCAATTarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT3G09350.3TTAAAGGCCCAATTarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G53800.1); Has 443 Blast hits to 439 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 178; Fungi - 109; Plants - 94; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).
AT3G09440AT3G09440.1TAAACGGCheat shock cognate 70 kDa protein 3 (HSC70-3) (HSP70-3); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to heat; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24859 Blast hits to 24560 proteins in 3087 species: Archae - 103; Bacteria - 9593; Metazoa - 3143; Fungi - 1202; Plants - 719; Viruses - 241; Other Eukaryotes - 9858 (source: NCBI BLink).
AT3G09570AT3G09570.1TCAAAACGCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transmembrane receptor, eukaryota (InterPro:IPR009637); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18520.1); Has 385 Blast hits to 385 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 216; Fungi - 12; Plants - 132; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT3G09630AT3G09630.1TTAAAGGC60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).
AT3G09630.2TTAAAGGC60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink).
AT3G09650AT3G09650.1TCAAAACGACGACGTRNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit.
AT3G09740AT3G09740.1TAAAACGCsyntaxin of plants 71 (SYP71)
AT3G09800AT3G09800.1AAAACGGCAprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink).
AT3G09800.1AAACGGCAprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink).
AT3G09800.1TAAACGGCprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink).
AT3G09800.2AAAACGGCAprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink).
AT3G09800.2AAACGGCAprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink).
AT3G09800.2TAAACGGCprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complex small chain family protein (TAIR:AT4G08520.1); Has 539 Blast hits to 539 proteins in 166 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 100; Plants - 101; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink).
AT3G09922AT3G09922.1TAAAACGCAF236376 Arabidopsis thaliana IPS1 mRNA, complete sequence
AT3G10070AT3G10070.1AAACGCTGCGTTTTAEncodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12.
AT3G10160AT3G10160.1CTTGGGCCTTTAAEncodes a protein with tetrahydrofolylpolyglutamate synthase activity that is located in the mitochondrial matrix.
AT3G10270AT3G10270.1GCGTTTTAProtein targeting to mitochondria is influenced by UTR sequences.
AT3G10330AT3G10330.1TAGGGCTTCAAAACGTTGGGCCGGGtranscription initiation factor IIB-2 / general transcription factor TFIIB-2 (TFIIB2); FUNCTIONS IN: protein binding, RNA polymerase II transcription factor activity, transcription regulator activity, zinc ion binding, translation initiation factor activity; INVOLVED IN: translational initiation, regulation of transcription, DNA-dependent, transcription initiation, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor TFIIB related (InterPro:IPR000812), Cyclin-like (InterPro:IPR011028), Transcription factor TFIIB, cyclin-related (InterPro:IPR013150), Cyclin-related (InterPro:IPR013763), Zinc finger, TFIIB-type (InterPro:IPR013137), Cyclin (InterPro:IPR006670); BEST Arabidopsis thaliana protein match is: TFIIB (TRANSCRIPTION FACTOR II B); RNA polymerase II transcription factor/ protein binding / transcription regulator/ translation initiation factor/ zinc ion binding (TAIR:AT2G41630.1); Has 1521 Blast hits to 1508 proteins in 255 species: Archae - 348; Bacteria - 0; Metazoa - 268; Fungi - 189; Plants - 107; Viruses - 10; Other Eukaryotes - 599 (source: NCBI BLink).
AT3G10350AT3G10350.1TCAAAACGanion-transporting ATPase family protein; FUNCTIONS IN: ATP binding; INVOLVED IN: cellular metal ion homeostasis, anion transport; LOCATED IN: chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, anion-transporting (InterPro:IPR003348); BEST Arabidopsis thaliana protein match is: anion-transporting ATPase family protein (TAIR:AT5G60730.1); Has 1736 Blast hits to 1472 proteins in 461 species: Archae - 116; Bacteria - 1153; Metazoa - 110; Fungi - 90; Plants - 58; Viruses - 0; Other Eukaryotes - 209 (source: NCBI BLink).
AT3G10420AT3G10420.1TCAAAACGsporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).
AT3G10420.2TCAAAACGsporulation protein-related; FUNCTIONS IN: nucleoside-triphosphatase activity, nucleotide binding; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent peptidase/ nucleoside-triphosphatase/ nucleotide binding / serine-type endopeptidase (TAIR:AT1G73170.1); Has 837 Blast hits to 828 proteins in 331 species: Archae - 16; Bacteria - 586; Metazoa - 12; Fungi - 5; Plants - 64; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).
AT3G10970AT3G10970.1AAAACGGCAhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT3G10970.2AAAACGGCAhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT3G10970.3AAAACGGCAhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), HAD-superfamily hydrolase, subfamily IA, variant 3 (InterPro:IPR006402); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT4G11570.2); Has 2146 Blast hits to 2146 proteins in 695 species: Archae - 20; Bacteria - 1836; Metazoa - 9; Fungi - 4; Plants - 93; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT3G11400AT3G11400.1TCAAAACGOne of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3).
AT3G11400.2TCAAAACGOne of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3).
AT3G11410AT3G11410.1AACGGCGTEncodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA.
AT3G11450AT3G11450.1TAAAACGCDNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT5G06110.1); Has 51717 Blast hits to 34681 proteins in 2122 species: Archae - 166; Bacteria - 8879; Metazoa - 19405; Fungi - 4515; Plants - 2164; Viruses - 194; Other Eukaryotes - 16394 (source: NCBI BLink).
AT3G11620AT3G11620.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).
AT3G11620.2TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).
AT3G11620.3TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).
AT3G11620.4TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 239 Blast hits to 236 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 67; Plants - 26; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink).
AT3G11630AT3G11630.1CGTTTTGAEncodes a 2-Cys peroxiredoxin (2-Cys PrxA) that contains two catalytic Cys residues.
AT3G11760AT3G11760.1ACGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G04860.1); Has 43 Blast hits to 38 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G11800AT3G11800.1TTAAAGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44150.1); Has 44 Blast hits to 42 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G11830AT3G11830.1TAAAACGCTGCGTTTTAchaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, eta subunit (InterPro:IPR012720), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: ATTCP-1; ATP binding / protein binding / unfolded protein binding (TAIR:AT3G20050.1); Has 14866 Blast hits to 14802 proteins in 2423 species: Archae - 394; Bacteria - 5781; Metazoa - 1895; Fungi - 1006; Plants - 468; Viruses - 0; Other Eukaryotes - 5322 (source: NCBI BLink).
AT3G11930AT3G11930.1GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT3G11930.2GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT3G11930.3GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT3G11930.4GGCGTTTTAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G58450.1); Has 734 Blast hits to 733 proteins in 134 species: Archae - 26; Bacteria - 262; Metazoa - 38; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT3G12170AT3G12170.1GCCGTTTADNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: ATJ6 (Arabidopsis J-domain protein 6); heat shock protein binding / unfolded protein binding (TAIR:AT5G06910.1); Has 16438 Blast hits to 16435 proteins in 1943 species: Archae - 109; Bacteria - 5179; Metazoa - 3539; Fungi - 1500; Plants - 1231; Viruses - 45; Other Eukaryotes - 4835 (source: NCBI BLink).
AT3G12280AT3G12280.1AAACGGCAEncodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA.
AT3G12280.1CAGCGTTTEncodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA.
AT3G12290AT3G12290.1AAACGCTGtetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00620.1); Has 7113 Blast hits to 7108 proteins in 1554 species: Archae - 77; Bacteria - 3117; Metazoa - 345; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 3287 (source: NCBI BLink).
AT3G12290.1TGCCGTTTtetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00620.1); Has 7113 Blast hits to 7108 proteins in 1554 species: Archae - 77; Bacteria - 3117; Metazoa - 345; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 3287 (source: NCBI BLink).
AT3G12390AT3G12390.1GGCGTTTTnascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative; INVOLVED IN: response to salt stress; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: NACA3 (NASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 3) (TAIR:AT5G13850.1); Has 5006 Blast hits to 2282 proteins in 284 species: Archae - 50; Bacteria - 639; Metazoa - 1963; Fungi - 710; Plants - 330; Viruses - 56; Other Eukaryotes - 1258 (source: NCBI BLink).
AT3G12570AT3G12570.1AAACGGCAFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12570.1AAACGGCGTCFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12570.2AAACGGCAFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12570.2AAACGGCGTCFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12570.3AAACGGCAFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12570.3AAACGGCGTCFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12570.4AAACGGCAFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12570.4AAACGGCGTCFYD; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: SLT1 (sodium- and lithium-tolerant 1) (TAIR:AT2G37570.1); Has 56 Blast hits to 56 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12580AT3G12580.1TCAAAACGheat shock protein 70 (HSP70); FUNCTIONS IN: ATP binding; INVOLVED IN: in 8 processes; LOCATED IN: cytosol, mitochondrion, cell wall, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24865 Blast hits to 24554 proteins in 3102 species: Archae - 103; Bacteria - 9662; Metazoa - 3184; Fungi - 1196; Plants - 727; Viruses - 243; Other Eukaryotes - 9750 (source: NCBI BLink).
AT3G12640AT3G12640.1CAAAACGCRNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G24350.1); Has 5419 Blast hits to 5243 proteins in 418 species: Archae - 0; Bacteria - 543; Metazoa - 2418; Fungi - 873; Plants - 1071; Viruses - 1; Other Eukaryotes - 513 (source: NCBI BLink).
AT3G12740AT3G12740.1TTAAAGGCCCAATGPhysically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3.
AT3G12800AT3G12800.1AAACGCTGSHORT-CHAIN DEHYDROGENASE-REDUCTASE B (SDRB); FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: D2,D4-dienoyl-CoA reductase-related (TAIR:AT2G07640.1); Has 72870 Blast hits to 72725 proteins in 2181 species: Archae - 462; Bacteria - 41132; Metazoa - 3880; Fungi - 3552; Plants - 1537; Viruses - 2; Other Eukaryotes - 22305 (source: NCBI BLink).
AT3G12920AT3G12920.1AAACGCTGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G79110.2); Has 1234 Blast hits to 1231 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 768; Fungi - 0; Plants - 306; Viruses - 33; Other Eukaryotes - 127 (source: NCBI BLink).
AT3G13040AT3G13040.1CAAAACGCmyb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 1402 Blast hits to 1356 proteins in 112 species: Archae - 2; Bacteria - 14; Metazoa - 251; Fungi - 38; Plants - 910; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).
AT3G13040.2CAAAACGCmyb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PHR1 (PHOSPHATE STARVATION RESPONSE 1); transcription factor (TAIR:AT4G28610.1); Has 1402 Blast hits to 1356 proteins in 112 species: Archae - 2; Bacteria - 14; Metazoa - 251; Fungi - 38; Plants - 910; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink).
AT3G13175AT3G13175.1AAACGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13222AT3G13222.1AAACGCGTEncodes a protein that binds to G-box binding transcription factors and enhances their binding affinities to G-box in vitro. This protein localizes to the nucleus and is expressed predominantly in the root.
AT3G13224AT3G13224.1ACGCGTTTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G40490.1); Has 66411 Blast hits to 30653 proteins in 1240 species: Archae - 29; Bacteria - 14885; Metazoa - 30073; Fungi - 5081; Plants - 8541; Viruses - 347; Other Eukaryotes - 7455 (source: NCBI BLink).
AT3G13224.2ACGCGTTTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G40490.1); Has 66411 Blast hits to 30653 proteins in 1240 species: Archae - 29; Bacteria - 14885; Metazoa - 30073; Fungi - 5081; Plants - 8541; Viruses - 347; Other Eukaryotes - 7455 (source: NCBI BLink).
AT3G13300AT3G13300.1TTAAAGGCCCAAACEncodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development.
AT3G13300.2TTAAAGGCCCAAACEncodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development.
AT3G13320AT3G13320.1AAACGGCGlow affinity calcium antiporter CAX2
AT3G13410AT3G13410.1AAAACGACGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 28 Blast hits to 28 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13450AT3G13450.1GTGTCGTTTTGAbranched chain alpha-keto acid dehydrogenase E1 beta
AT3G13720AT3G13720.1AAAACGCCPRA8; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.F4 (PRENYLATED RAB ACCEPTOR 1.F4) (TAIR:AT3G13710.1); Has 259 Blast hits to 259 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 20; Plants - 181; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT3G13772AT3G13772.1TCAAAACGACendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT1G55130.1); Has 1018 Blast hits to 1005 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 142; Plants - 240; Viruses - 0; Other Eukaryotes - 190 (source: NCBI BLink).
AT3G13845AT3G13845.1TAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G14075AT3G14075.1TAAAACGClipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity, carboxylesterase activity; INVOLVED IN: lipid catabolic process, lipid metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT4G16070.1); Has 687 Blast hits to 620 proteins in 137 species: Archae - 3; Bacteria - 35; Metazoa - 217; Fungi - 109; Plants - 144; Viruses - 28; Other Eukaryotes - 151 (source: NCBI BLink).
AT3G14080AT3G14080.1GCGTTTTAsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G19120.1); Has 774 Blast hits to 773 proteins in 160 species: Archae - 46; Bacteria - 0; Metazoa - 325; Fungi - 215; Plants - 116; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT3G14080.2GCGTTTTAsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G19120.1); Has 774 Blast hits to 773 proteins in 160 species: Archae - 46; Bacteria - 0; Metazoa - 325; Fungi - 215; Plants - 116; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT3G14110AT3G14110.1AAACGCTGCGEncodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift.
AT3G14110.2AAACGCTGCGEncodes a novel coiled-coil, TPR domain containing protein that is localized to the chloroplast membrane and is involved in chlorophyll biosynthesis. Mutants accumulate protochlorophyllide, an intermediate in the chlorophyll biosynthesis pathway, in dark and release singlet oxygen in plastids in a controlled and non-invasive manner upon a dark/light shift.
AT3G14120AT3G14120.1CGCAGCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear pore protein 84/107 (InterPro:IPR007252); Has 207 Blast hits to 206 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 57; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G14120.2CGCAGCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: nuclear pore; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear pore protein 84/107 (InterPro:IPR007252); Has 207 Blast hits to 206 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 57; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G14172AT3G14172.1GCCGTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 2665 Blast hits to 1956 proteins in 215 species: Archae - 2; Bacteria - 189; Metazoa - 878; Fungi - 141; Plants - 132; Viruses - 5; Other Eukaryotes - 1318 (source: NCBI BLink).
AT3G14230AT3G14230.1TTAAAGGCencodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.
AT3G14230.2TTAAAGGCencodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.
AT3G14230.3TTAAAGGCencodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.
AT3G14270AT3G14270.1AAAACGCGTTTEncodes a FYVE domain protein containing the following domains: FYVE + Chaperonin + PIP5K.
AT3G14290AT3G14290.1TTAAGGCCCGTTEncodes 20S proteasome subunit PAE2 (PAE2).
AT3G14430AT3G14430.1AACGGCCCATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G14590AT3G14590.1AAAACGACAGCGTTTNTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT3G14590.1ACGCGTTTNTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT3G14590.2AAAACGACAGCGTTTNTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT3G14590.2ACGCGTTTNTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT3G14600AT3G14600.1TTAAAGGCCCAAG60S ribosomal protein L18A (RPL18aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: N-terminal protein myristoylation, translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aB) (TAIR:AT2G34480.1); Has 544 Blast hits to 543 proteins in 201 species: Archae - 0; Bacteria - 0; Metazoa - 241; Fungi - 102; Plants - 93; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT3G14890AT3G14890.1GTTAGGCCTTTAAAGCCCAAATAAGCCCAATGphosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).
AT3G14890.2GTTAGGCCTTTAAAGCCCAAATAAGCCCAATGphosphoesterase; FUNCTIONS IN: DNA binding, catalytic activity, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIIA (InterPro:IPR006549), Polynucleotide kinase 3 phosphatase, central region (InterPro:IPR013954), Zinc finger, PARP-type (InterPro:IPR001510), Polynucleotide kinase 3, phosphatase (InterPro:IPR015636), DNA 3-phosphatase (InterPro:IPR006551); BEST Arabidopsis thaliana protein match is: PARP2 (POLY(ADP-RIBOSE) POLYMERASE 2); DNA binding / NAD or NADH binding / NAD+ ADP-ribosyltransferase/ zinc ion binding (TAIR:AT2G31320.1); Has 1759 Blast hits to 1202 proteins in 196 species: Archae - 2; Bacteria - 25; Metazoa - 851; Fungi - 144; Plants - 126; Viruses - 44; Other Eukaryotes - 567 (source: NCBI BLink).
AT3G14900AT3G14900.1CAAAACGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; Has 17241 Blast hits to 9527 proteins in 489 species: Archae - 20; Bacteria - 1435; Metazoa - 6456; Fungi - 2273; Plants - 860; Viruses - 369; Other Eukaryotes - 5828 (source: NCBI BLink).
AT3G14910AT3G14910.1GGCGTTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 111 Blast hits to 111 proteins in 53 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT3G15040AT3G15040.1AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21970.1); Has 2804 Blast hits to 412 proteins in 66 species: Archae - 0; Bacteria - 22; Metazoa - 419; Fungi - 51; Plants - 212; Viruses - 0; Other Eukaryotes - 2100 (source: NCBI BLink).
AT3G15080AT3G15080.1AAACGGCAGCGTTTTGexonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1314 Blast hits to 1314 proteins in 179 species: Archae - 0; Bacteria - 14; Metazoa - 651; Fungi - 418; Plants - 111; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink).
AT3G15180AT3G15180.1ATTGCCACGCGTTTproteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae - 0; Bacteria - 1; Metazoa - 56; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT3G15220AT3G15220.1TATATGGGCCGTTAAAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: spindle, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATMAP4K ALPHA1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G53165.2); Has 97460 Blast hits to 95819 proteins in 3033 species: Archae - 88; Bacteria - 8614; Metazoa - 42541; Fungi - 8570; Plants - 18723; Viruses - 614; Other Eukaryotes - 18310 (source: NCBI BLink).
AT3G15260AT3G15260.1AACGGCCCATCTprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink).
AT3G15260.2AACGGCCCATCTprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink).
AT3G15280AT3G15280.1AACGGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G15280.1AACGGGCCunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G15290AT3G15290.1GGCCCGTT3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink).
AT3G15290.1TTATTGGGCCGTT3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink).
AT3G15510AT3G15510.1GGCGTTTTANote of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2.
AT3G15920AT3G15920.1GCGTTTTGAphox (PX) domain-containing protein; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, intracellular signaling cascade; CONTAINS InterPro DOMAIN/s: Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: phox (PX) domain-containing protein (TAIR:AT4G32160.1); Has 32140 Blast hits to 19498 proteins in 1025 species: Archae - 337; Bacteria - 2422; Metazoa - 17764; Fungi - 2188; Plants - 1026; Viruses - 108; Other Eukaryotes - 8295 (source: NCBI BLink).
AT3G16050AT3G16050.1ACGACGCCGTTTTEncodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation.
AT3G16350AT3G16350.1GGCGTTTTmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 7 processes; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Zinc finger, CCHC-type (InterPro:IPR001878), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT5G47390.1); Has 2137 Blast hits to 1895 proteins in 207 species: Archae - 0; Bacteria - 110; Metazoa - 783; Fungi - 82; Plants - 935; Viruses - 13; Other Eukaryotes - 214 (source: NCBI BLink).
AT3G16580AT3G16580.1GGCGTTTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G14710.1); Has 659 Blast hits to 653 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 659; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G16830AT3G16830.1CAAAACGCTOPLESS-RELATED 2 (TPR2); INVOLVED IN: primary shoot apical meristem specification; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594); BEST Arabidopsis thaliana protein match is: TPR3 (TOPLESS-RELATED 3) (TAIR:AT5G27030.1); Has 10164 Blast hits to 6720 proteins in 387 species: Archae - 16; Bacteria - 2370; Metazoa - 3628; Fungi - 1973; Plants - 737; Viruses - 0; Other Eukaryotes - 1440 (source: NCBI BLink).
AT3G16910AT3G16910.1AAAACGGCGEncodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle.
AT3G17300AT3G17300.1CTTATTGGGCCGTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G17300.1TAAATGGGCCGTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G17300.2CTTATTGGGCCGTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G17300.2TAAATGGGCCGTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT3G17330AT3G17330.1AAACGCTGCGevolutionarily conserved C-terminal region 6 (ECT6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT7 (evolutionarily conserved C-terminal region 7) (TAIR:AT1G48110.2); Has 715 Blast hits to 696 proteins in 119 species: Archae - 0; Bacteria - 2; Metazoa - 345; Fungi - 82; Plants - 210; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT3G18100AT3G18100.1CCCGGCCCGTTMember of the R2R3 transcription factor gene family.
AT3G18380AT3G18380.1AAATGGGCCTTTAATGGGsequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G18380.2AAATGGGCCTTTAATGGGsequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G18390AT3G18390.1CCCATTAAAGGCCCATTTembryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink).
AT3G18420AT3G18420.1TTAAAGGCCCATAAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: chloroplast lumen common family protein (TAIR:AT2G37400.1); Has 2006 Blast hits to 1561 proteins in 415 species: Archae - 271; Bacteria - 982; Metazoa - 160; Fungi - 19; Plants - 64; Viruses - 0; Other Eukaryotes - 510 (source: NCBI BLink).
AT3G18430AT3G18430.1TTATGGGCCTTTAAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: CAM9 (CALMODULIN 9); calcium ion binding (TAIR:AT3G51920.1); Has 3772 Blast hits to 3771 proteins in 389 species: Archae - 0; Bacteria - 11; Metazoa - 2178; Fungi - 257; Plants - 701; Viruses - 0; Other Eukaryotes - 625 (source: NCBI BLink).
AT3G18470AT3G18470.1AAAACGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49030.1); Has 531 Blast hits to 530 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 76; Plants - 317; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink).
AT3G18750AT3G18750.1GCGTTTTGEncodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
AT3G18750.2GCGTTTTGEncodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
AT3G18760AT3G18760.1CGCCGTTTribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 21 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G18760.2CGCCGTTTribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 21 Blast hits to 20 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G18830AT3G18830.1TGCCGTTTThis gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The AtPLT5 symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (<i>myo</i>-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily.
AT3G18950AT3G18950.1TAAAACGCCACGTGTCATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G49450.1); Has 22480 Blast hits to 12151 proteins in 451 species: Archae - 14; Bacteria - 3107; Metazoa - 9780; Fungi - 4621; Plants - 1980; Viruses - 0; Other Eukaryotes - 2978 (source: NCBI BLink).
AT3G19150AT3G19150.1AAAACGCGTTTKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT3G19150.1AAAACGGCAKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT3G19150.1AACGGCGTKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT3G19150.2AAAACGCGTTTKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT3G19150.2AAAACGGCAKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT3G19150.2AACGGCGTKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT3G19508AT3G19508.1TTAAAGGCCCATTAAGunknown protein; LOCATED IN: mitochondrion; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G19590AT3G19590.1AAACGCGTWD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink).
AT3G19590.1AACGGCCCATCTWD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink).
AT3G19760AT3G19760.1TGTCGTTTTGAeukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP binding, ATP-dependent helicase activity, nucleic acid binding; LOCATED IN: nucleolus, nucleus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative (TAIR:AT1G51380.1); Has 32402 Blast hits to 31825 proteins in 1817 species: Archae - 512; Bacteria - 14379; Metazoa - 5291; Fungi - 3422; Plants - 1433; Viruses - 38; Other Eukaryotes - 7327 (source: NCBI BLink).
AT3G19980AT3G19980.1GCGTTTTGAEncodes catalytic subunit of serine/threonine protein phosphatase 2A. It can associate with phytochromes A and B in vitro. Mutant plants display an accelerated flowering phenotype.
AT3G20230AT3G20230.1TCAAAACGC50S ribosomal protein L18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT1G08845.2); Has 911 Blast hits to 911 proteins in 312 species: Archae - 0; Bacteria - 630; Metazoa - 35; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).
AT3G20240AT3G20240.1GCGTTTTGAmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: SHS1 (SODIUM HYPERSENSITIVE 1); binding / nucleotide transmembrane transporter/ transporter (TAIR:AT4G32400.1); Has 16786 Blast hits to 9647 proteins in 354 species: Archae - 0; Bacteria - 0; Metazoa - 7901; Fungi - 4785; Plants - 2484; Viruses - 0; Other Eukaryotes - 1616 (source: NCBI BLink).
AT3G20280AT3G20280.1GCGTTTTGAPHD finger family protein; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT1G50620.1); Has 9770 Blast hits to 5029 proteins in 476 species: Archae - 22; Bacteria - 1974; Metazoa - 3487; Fungi - 1858; Plants - 150; Viruses - 195; Other Eukaryotes - 2084 (source: NCBI BLink).
AT3G20898AT3G20898.1AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G51355.1).
AT3G20910AT3G20910.1TCAAAACGNUCLEAR FACTOR Y, SUBUNIT A9 (NF-YA9); FUNCTIONS IN: transcription factor activity, specific transcriptional repressor activity; INVOLVED IN: negative regulation of gene-specific transcription, regulation of transcription, DNA-dependent; LOCATED IN: CCAAT-binding factor complex, nucleus; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: CCAAT-binding transcription factor, subunit B (InterPro:IPR001289), CCAAT-binding factor, conserved site (InterPro:IPR018362); BEST Arabidopsis thaliana protein match is: NF-YA1 (NUCLEAR FACTOR Y, SUBUNIT A1); transcription factor (TAIR:AT5G12840.4); Has 452 Blast hits to 452 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 97; Plants - 214; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT3G20960AT3G20960.1CAGCGTTTmember of CYP705A
AT3G20970AT3G20970.1ACGCCGTTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU5 than to NFU1,2, and 3. Targeted to the mitochondrion.
AT3G20970.1TAAAACGCGTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU5 than to NFU1,2, and 3. Targeted to the mitochondrion.
AT3G20970.2ACGCCGTTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU5 than to NFU1,2, and 3. Targeted to the mitochondrion.
AT3G20970.2TAAAACGCGTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU5 than to NFU1,2, and 3. Targeted to the mitochondrion.
AT3G21175AT3G21175.1ACGACGCCGTTTmember of a novel family of plant-specific GATA-type transcription factors.
AT3G21175.2ACGACGCCGTTTmember of a novel family of plant-specific GATA-type transcription factors.
AT3G21175.3ACGACGCCGTTTmember of a novel family of plant-specific GATA-type transcription factors.
AT3G21290AT3G21290.1CAGCGTTTTGdentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink).
AT3G21295AT3G21295.1TAAAACGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G51745.1); Has 428 Blast hits to 314 proteins in 77 species: Archae - 0; Bacteria - 111; Metazoa - 87; Fungi - 55; Plants - 63; Viruses - 0; Other Eukaryotes - 112 (source: NCBI BLink).
AT3G21300AT3G21300.1TCAAAACGCTGRNA methyltransferase family protein; FUNCTIONS IN: methyltransferase activity, RNA binding, RNA methyltransferase activity; INVOLVED IN: RNA processing; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Methyltransferase small (InterPro:IPR007848), (Uracil-5)-methyltransferase (InterPro:IPR010280), 23S rRNA methyltransferase/RumA (InterPro:IPR001566), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein (TAIR:AT2G28450.1); Has 5920 Blast hits to 5453 proteins in 1374 species: Archae - 144; Bacteria - 4401; Metazoa - 174; Fungi - 148; Plants - 63; Viruses - 6; Other Eukaryotes - 984 (source: NCBI BLink).
AT3G21400AT3G21400.1TCAAAACGACGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G21640AT3G21640.1ACGCCGTTAAAencodes a 42 kDa FK506-binding protein (AtFKBP42) that possesses similarity to multidomain peptidyl-prolyl cis/trans isomerases (PPIases, EC 5.2.1.8), which are known to be components of mammalian steroid hormone receptor complexes. The protein appears to be localized to the plasma membrane by electron microscopy and binds to HSP90.1 and calmodulin in vitro. It also aggregates citrate synthase in vitro but does NOT show PPIase activity in vivo. Mutants are reduced in size and exhibit disoriented growth in all organs.
AT3G21660AT3G21660.1AAGCGCGTTTTGUBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012), SEP (InterPro:IPR012989); BEST Arabidopsis thaliana protein match is: PUX5 (Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma); protein binding (TAIR:AT4G15410.1); Has 901 Blast hits to 569 proteins in 154 species: Archae - 0; Bacteria - 31; Metazoa - 481; Fungi - 168; Plants - 100; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).
AT3G21865AT3G21865.1CAAAACGCInteracts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes.
AT3G22260AT3G22260.1AAAACGCGOTU-like cysteine protease family protein; FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); BEST Arabidopsis thaliana protein match is: OTU-like cysteine protease family protein (TAIR:AT3G02070.1); Has 586 Blast hits to 576 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 289; Fungi - 51; Plants - 137; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink).
AT3G22260.2AAAACGCGOTU-like cysteine protease family protein; FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Ovarian tumour, otubain (InterPro:IPR003323); BEST Arabidopsis thaliana protein match is: OTU-like cysteine protease family protein (TAIR:AT3G02070.1); Has 586 Blast hits to 576 proteins in 120 species: Archae - 0; Bacteria - 0; Metazoa - 289; Fungi - 51; Plants - 137; Viruses - 8; Other Eukaryotes - 101 (source: NCBI BLink).
AT3G22410AT3G22410.1TTTAACGGCGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05370.1); Has 1032 Blast hits to 1032 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 245; Fungi - 243; Plants - 390; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).
AT3G22420AT3G22420.1TGCCGTTTTEncodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
AT3G22420.2TGCCGTTTTEncodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
AT3G22430AT3G22430.1AACGACGCCGTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; Has 493 Blast hits to 438 proteins in 88 species: Archae - 2; Bacteria - 43; Metazoa - 185; Fungi - 27; Plants - 37; Viruses - 4; Other Eukaryotes - 195 (source: NCBI BLink).
AT3G22440AT3G22440.1GCCTTTAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Frigida-like (InterPro:IPR012474); BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G14900.1); Has 1107 Blast hits to 1058 proteins in 102 species: Archae - 0; Bacteria - 5; Metazoa - 133; Fungi - 62; Plants - 888; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT3G23090AT3G23090.1AACGGCGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, leaf apex, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: WDL1 (TAIR:AT3G04630.3); Has 483 Blast hits to 450 proteins in 87 species: Archae - 2; Bacteria - 15; Metazoa - 188; Fungi - 17; Plants - 148; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink).
AT3G23310AT3G23310.1TAAAACGCCprotein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G14350.3); Has 79428 Blast hits to 78405 proteins in 2456 species: Archae - 57; Bacteria - 7287; Metazoa - 33281; Fungi - 7809; Plants - 14818; Viruses - 393; Other Eukaryotes - 15783 (source: NCBI BLink).
AT3G23750AT3G23750.1AAAACGCGTleucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: protein binding, protein serine/threonine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: TMK1 (TRANSMEMBRANE KINASE 1); transmembrane receptor protein serine/threonine kinase (TAIR:AT1G66150.1); Has 123032 Blast hits to 100120 proteins in 3534 species: Archae - 85; Bacteria - 9593; Metazoa - 49390; Fungi - 7521; Plants - 38429; Viruses - 417; Other Eukaryotes - 17597 (source: NCBI BLink).
AT3G23940AT3G23940.1TAAACGACAGCGTTTdehydratase family; FUNCTIONS IN: catalytic activity, dihydroxy-acid dehydratase activity; INVOLVED IN: branched chain family amino acid biosynthetic process, isoleucine biosynthetic process, metabolic process, valine biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Dihydroxy-acid dehydratase (InterPro:IPR004404), Dihydroxy-acid and 6-phosphogluconate dehydratase (InterPro:IPR000581); Has 10437 Blast hits to 10433 proteins in 1298 species: Archae - 138; Bacteria - 4265; Metazoa - 2; Fungi - 197; Plants - 21; Viruses - 0; Other Eukaryotes - 5814 (source: NCBI BLink).
AT3G24050AT3G24050.1ACGCCGTTGATA transcription factor 1 (GATA-1); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: GATA transcription factor 3, putative (GATA-3) (TAIR:AT4G34680.2); Has 1004 Blast hits to 980 proteins in 134 species: Archae - 0; Bacteria - 2; Metazoa - 150; Fungi - 352; Plants - 444; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT3G24050.1ACGCCGTTGATA transcription factor 1 (GATA-1); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, NHR/GATA-type (InterPro:IPR013088), Zinc finger, GATA-type (InterPro:IPR000679); BEST Arabidopsis thaliana protein match is: GATA transcription factor 3, putative (GATA-3) (TAIR:AT4G34680.2); Has 1004 Blast hits to 980 proteins in 134 species: Archae - 0; Bacteria - 2; Metazoa - 150; Fungi - 352; Plants - 444; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT3G24200AT3G24200.1AAACGGCGTCGTTTFAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).
AT3G24200.2AAACGGCGTCGTTTFAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).
AT3G25070AT3G25070.1AACGGCGTEncodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation.
AT3G25070.1ATAAAGCCGCCTTTAACGGEncodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation.
AT3G25290AT3G25290.1TCAAAACGauxin-responsive family protein; INVOLVED IN: multicellular organismal development; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT4G12980.1); Has 386 Blast hits to 386 proteins in 66 species: Archae - 0; Bacteria - 4; Metazoa - 51; Fungi - 67; Plants - 253; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT3G25290.2TCAAAACGauxin-responsive family protein; INVOLVED IN: multicellular organismal development; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT4G12980.1); Has 386 Blast hits to 386 proteins in 66 species: Archae - 0; Bacteria - 4; Metazoa - 51; Fungi - 67; Plants - 253; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT3G25800AT3G25800.1TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit
AT3G25800.2TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit
AT3G25805AT3G25805.1AAACGGCGTTTTATAAGGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 32 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G26330AT3G26330.1CGTTTTGAputative cytochrome P450
AT3G26330.1TAAAACGCputative cytochrome P450
AT3G26560AT3G26560.1TAAAACGCAGCGTTTTAATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink).
AT3G26620AT3G26620.1TTAAAGGCLOB DOMAIN-CONTAINING PROTEIN 23 (LBD23); INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: LBD24 (LOB DOMAIN-CONTAINING PROTEIN 24) (TAIR:AT3G26660.1); Has 567 Blast hits to 564 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 567; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G26922AT3G26922.1GGCGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G52680.2).
AT3G26980AT3G26980.1TCAAAACGCCMEMBRANE-ANCHORED UBIQUITIN-FOLD PROTEIN 4 PRECURSOR (MUB4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-anchored ubiquitin-fold protein, HCG-1 (InterPro:IPR017000), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ATGP4 (TAIR:AT4G24990.1); Has 103 Blast hits to 103 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 7; Plants - 96; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G27100AT3G27100.1AAAACGGCACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G27100.1AAACGGCACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G27100.1TAAACGGCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G27100.2AAAACGGCACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G27100.2AAACGGCACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G27100.2TAAACGGCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, enhancer of yellow 2 (InterPro:IPR018783); Has 157 Blast hits to 157 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G27330AT3G27330.1AAAACGGCGTCGTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF23 (InterPro:IPR008166); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40720.1); Has 6969 Blast hits to 6918 proteins in 1619 species: Archae - 0; Bacteria - 145; Metazoa - 5625; Fungi - 356; Plants - 343; Viruses - 13; Other Eukaryotes - 487 (source: NCBI BLink).
AT3G27340AT3G27340.1ACGACGCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).
AT3G27340.2ACGACGCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).
AT3G27340.3ACGACGCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF971 (InterPro:IPR010376); Has 707 Blast hits to 707 proteins in 252 species: Archae - 0; Bacteria - 455; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 229 (source: NCBI BLink).
AT3G27550AT3G27550.1ACGCCGTTgroup II intron splicing factor CRS1-related; FUNCTIONS IN: RNA binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 9126 Blast hits to 4840 proteins in 369 species: Archae - 10; Bacteria - 3168; Metazoa - 2761; Fungi - 870; Plants - 511; Viruses - 93; Other Eukaryotes - 1713 (source: NCBI BLink).
AT3G28100AT3G28100.1TGCCGTTTTnodulin MtN21 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: nodulin MtN21 family protein (TAIR:AT3G28070.1); Has 1662 Blast hits to 1653 proteins in 290 species: Archae - 24; Bacteria - 733; Metazoa - 11; Fungi - 3; Plants - 622; Viruses - 0; Other Eukaryotes - 269 (source: NCBI BLink).
AT3G28455AT3G28455.1AACGGGCCCATATMember of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.
AT3G29360AT3G29360.1AAACGCGTUDP-glucose 6-dehydrogenase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucose/GDP-mannose dehydrogenase, N-terminal (InterPro:IPR001732), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), UDP-glucose/GDP-mannose dehydrogenase, dimerisation and substrate-binding (InterPro:IPR014028), UDP-glucose/GDP-mannose dehydrogenase, C-terminal (InterPro:IPR014027), NAD(P)-binding (InterPro:IPR016040), UDP-glucose/GDP-mannose dehydrogenase, dimerisation (InterPro:IPR014026), Nucleotide sugar dehydrogenase (InterPro:IPR017476); BEST Arabidopsis thaliana protein match is: UDP-glucose 6-dehydrogenase, putative (TAIR:AT5G39320.1); Has 10030 Blast hits to 10014 proteins in 1239 species: Archae - 198; Bacteria - 3909; Metazoa - 183; Fungi - 74; Plants - 116; Viruses - 14; Other Eukaryotes - 5536 (source: NCBI BLink).
AT3G29360.2AAACGCGTUDP-glucose 6-dehydrogenase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucose/GDP-mannose dehydrogenase, N-terminal (InterPro:IPR001732), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), UDP-glucose/GDP-mannose dehydrogenase, dimerisation and substrate-binding (InterPro:IPR014028), UDP-glucose/GDP-mannose dehydrogenase, C-terminal (InterPro:IPR014027), NAD(P)-binding (InterPro:IPR016040), UDP-glucose/GDP-mannose dehydrogenase, dimerisation (InterPro:IPR014026), Nucleotide sugar dehydrogenase (InterPro:IPR017476); BEST Arabidopsis thaliana protein match is: UDP-glucose 6-dehydrogenase, putative (TAIR:AT5G39320.1); Has 10030 Blast hits to 10014 proteins in 1239 species: Archae - 198; Bacteria - 3909; Metazoa - 183; Fungi - 74; Plants - 116; Viruses - 14; Other Eukaryotes - 5536 (source: NCBI BLink).
AT3G44100AT3G44100.1CCCAATAAGTCAAAACGACMD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT3G11780.1); Has 181 Blast hits to 181 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 83; Plants - 77; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT3G44310AT3G44310.2CAAAACGCMutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes.
AT3G44310.2TTTAACGGCGTMutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes.
AT3G44326AT3G44326.1AAACGCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G27310.1); Has 56 Blast hits to 56 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G44340AT3G44340.1TAAAACGCGhomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.
AT3G44340.2TAAAACGCGhomologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.
AT3G44560AT3G44560.1TGCCGTTTTFATTY ACID REDUCTASE 8 (FAR8); FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, fatty acyl-CoA reductase (alcohol-forming) activity; INVOLVED IN: microsporogenesis, metabolic process; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Male sterility (InterPro:IPR004262), NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: FAR5 (FATTY ACID REDUCTASE 5); binding / catalytic/ oxidoreductase, acting on the CH-CH group of donors (TAIR:AT3G44550.1); Has 1765 Blast hits to 1740 proteins in 316 species: Archae - 0; Bacteria - 436; Metazoa - 870; Fungi - 157; Plants - 137; Viruses - 0; Other Eukaryotes - 165 (source: NCBI BLink).
AT3G44740AT3G44740.1ACGACGCCGTTATP binding / aminoacyl-tRNA ligase/ glycine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, glycyl-tRNA aminoacylation; LOCATED IN: endomembrane system, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160); BEST Arabidopsis thaliana protein match is: glycyl-tRNA synthetase / glycine--tRNA ligase (TAIR:AT1G29880.1); Has 2112 Blast hits to 1719 proteins in 565 species: Archae - 218; Bacteria - 665; Metazoa - 233; Fungi - 205; Plants - 56; Viruses - 0; Other Eukaryotes - 735 (source: NCBI BLink).
AT3G44740.1GCCGTTTTATP binding / aminoacyl-tRNA ligase/ glycine-tRNA ligase/ nucleotide binding; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: translation, tRNA aminoacylation for protein translation, glycyl-tRNA aminoacylation; LOCATED IN: endomembrane system, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160); BEST Arabidopsis thaliana protein match is: glycyl-tRNA synthetase / glycine--tRNA ligase (TAIR:AT1G29880.1); Has 2112 Blast hits to 1719 proteins in 565 species: Archae - 218; Bacteria - 665; Metazoa - 233; Fungi - 205; Plants - 56; Viruses - 0; Other Eukaryotes - 735 (source: NCBI BLink).
AT3G44750AT3G44750.1AAAACGGCEncodes a histone deacetylase. Controls the development of adaxial/abaxial leaf polarity. Two lines with RNAi-directed against this gene show reduced Agrobacterium-mediated DNA transformation of the roots.
AT3G44750.1AACGGCGTCGTEncodes a histone deacetylase. Controls the development of adaxial/abaxial leaf polarity. Two lines with RNAi-directed against this gene show reduced Agrobacterium-mediated DNA transformation of the roots.
AT3G44750.1CGCCGTTTEncodes a histone deacetylase. Controls the development of adaxial/abaxial leaf polarity. Two lines with RNAi-directed against this gene show reduced Agrobacterium-mediated DNA transformation of the roots.
AT3G45070AT3G45070.1AAACGCTGsulfotransferase family protein; FUNCTIONS IN: sulfotransferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Sulfotransferase (InterPro:IPR000863); BEST Arabidopsis thaliana protein match is: sulfotransferase family protein (TAIR:AT3G45080.1); Has 2245 Blast hits to 2207 proteins in 147 species: Archae - 0; Bacteria - 151; Metazoa - 1459; Fungi - 1; Plants - 307; Viruses - 0; Other Eukaryotes - 327 (source: NCBI BLink).
AT3G45280AT3G45280.1CGCCGTTTAsyntaxin of plants 72 (SYP72)
AT3G45443AT3G45443.1AAAACGGCGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G45870AT3G45870.2CGTTTTGAintegral membrane family protein / nodulin MtN21-related; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6, transmembrane (InterPro:IPR000620); BEST Arabidopsis thaliana protein match is: integral membrane family protein (TAIR:AT4G19185.1); Has 2381 Blast hits to 2369 proteins in 430 species: Archae - 23; Bacteria - 1346; Metazoa - 6; Fungi - 3; Plants - 624; Viruses - 0; Other Eukaryotes - 379 (source: NCBI BLink).
AT3G46020AT3G46020.1AAAACGGCGTCGTRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink).
AT3G46230AT3G46230.1AAACGGCAmember of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds
AT3G46660AT3G46660.1CAAAACGCUDP-GLUCOSYL TRANSFERASE 76E12 (UGT76E12); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT76E11 (UDP-GLUCOSYL TRANSFERASE 76E11); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 7-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G46670.1); Has 4906 Blast hits to 4874 proteins in 316 species: Archae - 0; Bacteria - 143; Metazoa - 1916; Fungi - 13; Plants - 2719; Viruses - 92; Other Eukaryotes - 23 (source: NCBI BLink).
AT3G46870AT3G46870.1AAAACGCGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62350.1); Has 3561 Blast hits to 1614 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 53; Plants - 3447; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT3G47000AT3G47000.1AAACGCGTglycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G47010.1); Has 6353 Blast hits to 5926 proteins in 906 species: Archae - 20; Bacteria - 3224; Metazoa - 6; Fungi - 919; Plants - 287; Viruses - 0; Other Eukaryotes - 1897 (source: NCBI BLink).
AT3G47000.1CCGTTAAACGCTGglycosyl hydrolase family 3 protein; FUNCTIONS IN: hydrolase activity, hydrolyzing O-glycosyl compounds; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 3, N-terminal (InterPro:IPR001764), Glycoside hydrolase, family 3, C-terminal (InterPro:IPR002772), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G47010.1); Has 6353 Blast hits to 5926 proteins in 906 species: Archae - 20; Bacteria - 3224; Metazoa - 6; Fungi - 919; Plants - 287; Viruses - 0; Other Eukaryotes - 1897 (source: NCBI BLink).
AT3G47290AT3G47290.1GCCGTTTTphosphoinositide-specific phospholipase C family protein; FUNCTIONS IN: phospholipase C activity, phosphoinositide phospholipase C activity, phosphoric diester hydrolase activity; INVOLVED IN: signal transduction, intracellular signaling cascade, lipid metabolic process; CONTAINS InterPro DOMAIN/s: Phospholipase C, phosphatidylinositol-specific , X region (InterPro:IPR000909), PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (InterPro:IPR017946), C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phospholipase C, phosphoinositol-specific, C-terminal (PLC) (InterPro:IPR001192), C2 calcium-dependent membrane targeting (InterPro:IPR000008), Phospholipase C, phosphatidylinositol-specific, Y domain (InterPro:IPR001711); BEST Arabidopsis thaliana protein match is: phosphoinositide-specific phospholipase C family protein (TAIR:AT3G47220.1); Has 2199 Blast hits to 1617 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1697; Fungi - 148; Plants - 187; Viruses - 0; Other Eukaryotes - 167 (source: NCBI BLink).
AT3G47520AT3G47520.1TAAAACGCEncodes a protein with NAD-dependent malate dehydrogenase activity, located in chloroplasts.
AT3G47610AT3G47610.1TTTAGGCCCGTTtranscription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT3G48830AT3G48830.1AAACGGCApolynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: polynucleotide adenylyltransferase activity, RNA binding, nucleotide binding, nucleic acid binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Polynucleotide adenylyltransferase region (InterPro:IPR002646), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 8005 Blast hits to 7486 proteins in 1487 species: Archae - 2; Bacteria - 3572; Metazoa - 1145; Fungi - 573; Plants - 347; Viruses - 8; Other Eukaryotes - 2358 (source: NCBI BLink).
AT3G48830.1TAAAACGCTGCGpolynucleotide adenylyltransferase family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: polynucleotide adenylyltransferase activity, RNA binding, nucleotide binding, nucleic acid binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Polynucleotide adenylyltransferase region (InterPro:IPR002646), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 8005 Blast hits to 7486 proteins in 1487 species: Archae - 2; Bacteria - 3572; Metazoa - 1145; Fungi - 573; Plants - 347; Viruses - 8; Other Eukaryotes - 2358 (source: NCBI BLink).
AT3G48930AT3G48930.1CTAAGGCCCGTAATTAAAGGCCCAATAAembryo defective 1080 (EMB1080); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: RPS11-BETA (RIBOSOMAL PROTEIN S11-BETA); structural constituent of ribosome (TAIR:AT5G23740.1); Has 956 Blast hits to 954 proteins in 334 species: Archae - 160; Bacteria - 168; Metazoa - 241; Fungi - 98; Plants - 94; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink).
AT3G49120AT3G49120.1TAAAAGCCTTTAAClass III peroxidase Perx34. Expressed in roots, leaves and stems. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response.
AT3G49260AT3G49260.1AACGGCGTTTAACCGAACCCCACGTGACIQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT3G49260.2AACGGCGTTTAACCGAACCCCACGTGACIQ-domain 21 (iqd21); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD5 (IQ-domain 5); calmodulin binding (TAIR:AT3G22190.1); Has 512 Blast hits to 509 proteins in 49 species: Archae - 0; Bacteria - 2; Metazoa - 73; Fungi - 5; Plants - 419; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT3G49720AT3G49720.1AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G49720.1CGTGTCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G49720.1TAAAACGCTGTCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G49720.2AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G49720.2CGTGTCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G49720.2TAAAACGCTGTCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G49750AT3G49750.1TAAAACGCGReceptor Like Protein 44 (AtRLP44); FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT5G65830.1); Has 37763 Blast hits to 9232 proteins in 488 species: Archae - 16; Bacteria - 1150; Metazoa - 1956; Fungi - 137; Plants - 32378; Viruses - 0; Other Eukaryotes - 2126 (source: NCBI BLink).
AT3G50500AT3G50500.1CAAAACGCGencodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth.
AT3G50590AT3G50590.1AACGGCGTnucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink).
AT3G50630AT3G50630.1TCAAAACGKip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation.
AT3G50830AT3G50830.1CAAAACGCGcold acclimation protein WCOR413-like protein beta form. Transcript is not detectable.
AT3G51270AT3G51270.1GACGCCGTTATP binding / catalytic/ protein serine/threonine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RIO-like kinase (InterPro:IPR018934), RIO kinase (InterPro:IPR000687), Protein kinase-like (InterPro:IPR011009), RIO2 kinase, winged helix, N-terminal (InterPro:IPR015285); BEST Arabidopsis thaliana protein match is: RIO1 family protein (TAIR:AT5G37350.1); Has 12154 Blast hits to 7675 proteins in 577 species: Archae - 256; Bacteria - 1067; Metazoa - 4621; Fungi - 1373; Plants - 446; Viruses - 297; Other Eukaryotes - 4094 (source: NCBI BLink).
AT3G51660AT3G51660.1TCAAAACGmacrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; LOCATED IN: peroxisome; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G01650.2); Has 238 Blast hits to 238 proteins in 65 species: Archae - 0; Bacteria - 18; Metazoa - 119; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink).
AT3G51770AT3G51770.1GCCTTTAAEncodes a negative regulator of 1-aminocyclopropane-1-carboxylic acid synthase5(ACS5), which catalyze the rate-limiting step in ethylene biosynthesis. ETO1 directly interacts with ACS5 and inhibits its enzyme activity and targets it for degradation via proteasome-dependent pathway. It also interacts with CUL3 (a component of ubiquitin ligase complexes). eto1 (and eto3) mutations elevate ethylene biosynthesis by affecting the posttranscriptional regulation of ACS
AT3G51770.2GCCTTTAAEncodes a negative regulator of 1-aminocyclopropane-1-carboxylic acid synthase5(ACS5), which catalyze the rate-limiting step in ethylene biosynthesis. ETO1 directly interacts with ACS5 and inhibits its enzyme activity and targets it for degradation via proteasome-dependent pathway. It also interacts with CUL3 (a component of ubiquitin ligase complexes). eto1 (and eto3) mutations elevate ethylene biosynthesis by affecting the posttranscriptional regulation of ACS
AT3G51800AT3G51800.1AAAACGGCAputative nuclear DNA-binding protein G2p (AtG2) mRNA,
AT3G51800.2AAAACGGCAputative nuclear DNA-binding protein G2p (AtG2) mRNA,
AT3G51880AT3G51880.1CGTTTTGAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G51880.2CGTTTTGAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G51880.3CGTTTTGAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated.
AT3G51890AT3G51890.1TAAAACGCCprotein binding / structural molecule; FUNCTIONS IN: protein binding, structural molecule activity; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: clathrin coat of trans-Golgi network vesicle, clathrin coat of coated pit; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin light chain (InterPro:IPR000996); BEST Arabidopsis thaliana protein match is: protein binding / structural molecule (TAIR:AT2G40060.1); Has 258 Blast hits to 256 proteins in 83 species: Archae - 0; Bacteria - 2; Metazoa - 126; Fungi - 42; Plants - 56; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT3G51940AT3G51940.1GGGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03990.1); Has 134 Blast hits to 107 proteins in 33 species: Archae - 0; Bacteria - 32; Metazoa - 27; Fungi - 16; Plants - 34; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT3G52400AT3G52400.1AACCGCGTTTTAsyntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway
AT3G52470AT3G52470.1TAAAACGCGharpin-induced family protein / HIN1 family protein / harpin-responsive family protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: NHL12 (TAIR:AT2G35960.1); Has 615 Blast hits to 615 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G52480AT3G52480.1AAATGGGCCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G52960AT3G52960.1GTAGGCCCATTAAGGCCCAATAACGGCGTperoxiredoxin type 2, putative; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: defense response to bacterium, peptidyl-cysteine S-nitrosylation; LOCATED IN: thylakoid, chloroplast stroma, chloroplast, plant-type cell wall; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336), Redoxin (InterPro:IPR013740); BEST Arabidopsis thaliana protein match is: TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase (TAIR:AT1G65980.1); Has 3329 Blast hits to 3329 proteins in 622 species: Archae - 43; Bacteria - 1005; Metazoa - 160; Fungi - 217; Plants - 175; Viruses - 0; Other Eukaryotes - 1729 (source: NCBI BLink).
AT3G53235AT3G53235.1TTAAAGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT3G53410AT3G53410.1CGTTTTGAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: N-terminal protein myristoylation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G09770.1); Has 1550 Blast hits to 1550 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 783; Fungi - 60; Plants - 277; Viruses - 82; Other Eukaryotes - 348 (source: NCBI BLink).
AT3G53430AT3G53430.1CTAAGCCCATATAATATTGGGTTGGGCCGTT60S ribosomal protein L12 (RPL12B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12A) (TAIR:AT2G37190.1); Has 1163 Blast hits to 1163 proteins in 435 species: Archae - 208; Bacteria - 279; Metazoa - 292; Fungi - 110; Plants - 81; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink).
AT3G53970AT3G53970.1TTAAGGCCCGTTproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).
AT3G53970.2TTAAGGCCCGTTproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).
AT3G54190AT3G54190.1ACCCCTTAAACGCTGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT3G54260AT3G54260.1CAAAACGCunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G42570.1); Has 731 Blast hits to 699 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 730; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G54340AT3G54340.1TTAAAGGCFloral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA.
AT3G54430AT3G54430.1ATAAAGCCGTTTTA member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.
AT3G55050AT3G55050.1AAACGCGTserine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).
AT3G55050.2AAACGCGTserine/threonine protein phosphatase 2C (PP2C6); FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C family protein / PP2C family protein (TAIR:AT3G12620.2); Has 3613 Blast hits to 3612 proteins in 213 species: Archae - 0; Bacteria - 4; Metazoa - 1244; Fungi - 391; Plants - 1257; Viruses - 0; Other Eukaryotes - 717 (source: NCBI BLink).
AT3G55070AT3G55070.1AAACGCTGTCGTTTTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT3G55070.1AACGACGCCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT3G55070.2AAACGCTGTCGTTTTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT3G55070.2AACGACGCCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CTLH, C-terminal to LisH motif (InterPro:IPR006595), LisH dimerisation motif (InterPro:IPR006594), CT11-RanBPM (InterPro:IPR013144); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT4G37880.1); Has 669 Blast hits to 649 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink).
AT3G55440AT3G55440.1ACGCCGTTEncodes triosephosphate isomerase.
AT3G55460AT3G55460.1AAAACGCGATAAGGCCAAAAGCCCATTTAencodes an SC35-like splicing factor that is localized to nuclear specks.
AT3G55990AT3G55990.1GCCTTTAAEncodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance.
AT3G56020AT3G56020.1AGATGGGCCTTAAAGGCCCAATAT60S ribosomal protein L41 (RPL41G); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT3G56030AT3G56030.1ATATTGGGCCTTTAAGGCCCATCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G40240.1); Has 6707 Blast hits to 2251 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 13; Plants - 6562; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT3G56150AT3G56150.1GCGTTTTAmember of eIF3c - eukaryotic initiation factor 3c
AT3G56270AT3G56270.1AACGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT3G56270.1AACGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink).
AT3G56460AT3G56460.1TAAACGGCGTCGToxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Quinone oxidoreductase/zeta-crystallin, conserved site (InterPro:IPR002364), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT4G21580.1); Has 27533 Blast hits to 27426 proteins in 1649 species: Archae - 279; Bacteria - 14496; Metazoa - 1760; Fungi - 2501; Plants - 878; Viruses - 3; Other Eukaryotes - 7616 (source: NCBI BLink).
AT3G56800AT3G56800.1GGCGTTTTAencodes a calmodulin
AT3G56830AT3G56830.1CGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF565 (InterPro:IPR007572); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65420.1); Has 104 Blast hits to 104 proteins in 30 species: Archae - 0; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT3G56830.2CGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF565 (InterPro:IPR007572); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65420.1); Has 104 Blast hits to 104 proteins in 30 species: Archae - 0; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT3G56830.3CGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF565 (InterPro:IPR007572); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G65420.1); Has 104 Blast hits to 104 proteins in 30 species: Archae - 0; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT3G56990AT3G56990.1GGCGTTTTembryo sac development arrest 7 (EDA7); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: megagametogenesis; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NUC153 (InterPro:IPR012580), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 3435 Blast hits to 2597 proteins in 327 species: Archae - 0; Bacteria - 215; Metazoa - 1552; Fungi - 648; Plants - 432; Viruses - 52; Other Eukaryotes - 536 (source: NCBI BLink).
AT3G57420AT3G57420.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41770.1); Has 155 Blast hits to 155 proteins in 20 species: Archae - 2; Bacteria - 7; Metazoa - 47; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).
AT3G57550AT3G57550.1CAGCGTTTTCCGGTguanylate kinase
AT3G57550.2CAGCGTTTTCCGGTguanylate kinase
AT3G57560AT3G57560.1ACGTCAGCGTTTTGencodes a N-acetylglutamate kinase, involved in arginine biosynthesis
AT3G57570AT3G57570.1CAAAACGCTGACGTbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 29 Blast hits to 25 proteins in 12 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT3G57780AT3G57780.1TGCCGTTTTEXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2); Has 3024 Blast hits to 2177 proteins in 255 species: Archae - 2; Bacteria - 181; Metazoa - 988; Fungi - 289; Plants - 172; Viruses - 72; Other Eukaryotes - 1320 (source: NCBI BLink).
AT3G57800AT3G57800.1TGCCGTTTTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G57800.2TGCCGTTTTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT2G42300.1); Has 704 Blast hits to 701 proteins in 33 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 4; Plants - 692; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G58170AT3G58170.1AAAACGCGEncodes a Bet1/Sft1-like SNARE protein which fully suppresses the temperature-sensitive growth defect in <i>sft1-1</i> yeast cells; however, it cannot support the deletion of the yeast BET1 gene (<i>bet1&#916;</i>).
AT3G58180AT3G58180.1CGTTTTGAPBS lyase HEAT-like repeat-containing protein; FUNCTIONS IN: lyase activity, binding; INVOLVED IN: biological_process unknown; LOCATED IN: phycobilisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), PBS lyase HEAT-like repeat (InterPro:IPR004155); BEST Arabidopsis thaliana protein match is: PBS lyase HEAT-like repeat-containing protein (TAIR:AT3G62530.1); Has 1505 Blast hits to 797 proteins in 276 species: Archae - 192; Bacteria - 504; Metazoa - 254; Fungi - 237; Plants - 43; Viruses - 0; Other Eukaryotes - 275 (source: NCBI BLink).
AT3G58270AT3G58270.1CGTGCCGTTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT3G58270.1TGCCGTTTmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT3G58270.2CGTGCCGTTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT3G58270.2TGCCGTTTmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT3G58210.1); Has 981 Blast hits to 894 proteins in 145 species: Archae - 5; Bacteria - 16; Metazoa - 351; Fungi - 89; Plants - 415; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT3G58570AT3G58570.1AAAACGGCADEAD box RNA helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, ATP binding, nucleic acid binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 67728 Blast hits to 42681 proteins in 2188 species: Archae - 551; Bacteria - 21719; Metazoa - 21903; Fungi - 5394; Plants - 6790; Viruses - 334; Other Eukaryotes - 11037 (source: NCBI BLink).
AT3G58990AT3G58990.1GGCGTTTTaconitase C-terminal domain-containing protein; FUNCTIONS IN: hydro-lyase activity, 3-isopropylmalate dehydratase activity; INVOLVED IN: leucine biosynthetic process, metabolic process; LOCATED IN: 3-isopropylmalate dehydratase complex, chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: 3-isopropylmalate dehydratase, small subunit (InterPro:IPR012305), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase-like core (InterPro:IPR015937); BEST Arabidopsis thaliana protein match is: aconitase C-terminal domain-containing protein (TAIR:AT2G43090.1); Has 6188 Blast hits to 6188 proteins in 1286 species: Archae - 227; Bacteria - 3055; Metazoa - 1; Fungi - 250; Plants - 45; Viruses - 0; Other Eukaryotes - 2610 (source: NCBI BLink).
AT3G59190AT3G59190.1AAACGGCGTCGTTTCF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, embryo, seed; EXPRESSED DURING: D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G59200.1); Has 1274 Blast hits to 1236 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1274; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G59920AT3G59920.1TTAAAGGCRAB GDP DISSOCIATION INHIBITOR 2
AT3G60180AT3G60180.1AAAACGCCuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60180.1AACCGCGTGCCGTTTAuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60180.1ACGCCGTTTTuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60180.2AAAACGCCuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60180.2AACCGCGTGCCGTTTAuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60180.2ACGCCGTTTTuridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative; FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, uridylate kinase activity, nucleotide kinase activity, ATP binding, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UMP-CMP kinase (InterPro:IPR006266), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: PYR6; cytidylate kinase/ uridylate kinase (TAIR:AT5G26667.3); Has 8541 Blast hits to 8413 proteins in 1842 species: Archae - 61; Bacteria - 4370; Metazoa - 994; Fungi - 303; Plants - 243; Viruses - 0; Other Eukaryotes - 2570 (source: NCBI BLink).
AT3G60300AT3G60300.1TATTGGGCCGTTRWD domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Zinc finger, RING-type (InterPro:IPR001841), RWD (InterPro:IPR006575); Has 252 Blast hits to 252 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 198; Fungi - 9; Plants - 28; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT3G60490AT3G60490.1TCAAAACGencodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
AT3G60600AT3G60600.1ACGCGTTTEncodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2.
AT3G60600.2ACGCGTTTEncodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2.
AT3G60600.3ACGCGTTTEncodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2.
AT3G61070AT3G61070.1AAACGCTGCGTTTTAmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT3G61070.2AAACGCTGCGTTTTAmember of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT3G61220AT3G61220.1AACGGCGTCshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: (-)-menthol dehydrogenase activity, oxidoreductase activity, (+)-neomenthol dehydrogenase activity; INVOLVED IN: defense response; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT2G24190.1); Has 51177 Blast hits to 51130 proteins in 1941 species: Archae - 350; Bacteria - 30311; Metazoa - 4274; Fungi - 2433; Plants - 1287; Viruses - 0; Other Eukaryotes - 12522 (source: NCBI BLink).
AT3G61260AT3G61260.1AAAACGCGDNA-binding family protein / remorin family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G45820.1); Has 7363 Blast hits to 4653 proteins in 692 species: Archae - 12; Bacteria - 1846; Metazoa - 1409; Fungi - 602; Plants - 495; Viruses - 172; Other Eukaryotes - 2827 (source: NCBI BLink).
AT3G61670AT3G61670.1AAAACGCCGTCGTTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46380.1); Has 197 Blast hits to 162 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 13; Fungi - 15; Plants - 161; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT3G61670.1AACGGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46380.1); Has 197 Blast hits to 162 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 13; Fungi - 15; Plants - 161; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT3G61790AT3G61790.1CAGCGTTTCCGGTTCAseven in absentia (SINA) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process, protein ubiquitination; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), TRAF-like (InterPro:IPR008974), Seven in absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, SIAH-type (InterPro:IPR013010), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven in absentia protein (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: seven in absentia (SINA) family protein (TAIR:AT4G27880.1); Has 1422 Blast hits to 1414 proteins in 637 species: Archae - 0; Bacteria - 0; Metazoa - 1099; Fungi - 9; Plants - 250; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink).
AT3G61830AT3G61830.1AAAACGGCGAUXIN RESPONSE FACTOR 18 (ARF18); FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to hormone stimulus, regulation of transcription, DNA-dependent, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aux/IAA-ARF-dimerisation (InterPro:IPR011525), Transcriptional factor B3 (InterPro:IPR003340), AUX/IAA protein (InterPro:IPR003311), Auxin response factor (InterPro:IPR010525); BEST Arabidopsis thaliana protein match is: ARF11 (AUXIN RESPONSE FACTOR 11); transcription factor (TAIR:AT2G46530.1); Has 1526 Blast hits to 1303 proteins in 66 species: Archae - 2; Bacteria - 4; Metazoa - 20; Fungi - 2; Plants - 1497; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G61960AT3G61960.1TCAAAACGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G37840.1); Has 96538 Blast hits to 94555 proteins in 3142 species: Archae - 71; Bacteria - 8635; Metazoa - 41764; Fungi - 8770; Plants - 18509; Viruses - 485; Other Eukaryotes - 18304 (source: NCBI BLink).
AT3G61960.2TCAAAACGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G37840.1); Has 96538 Blast hits to 94555 proteins in 3142 species: Archae - 71; Bacteria - 8635; Metazoa - 41764; Fungi - 8770; Plants - 18509; Viruses - 485; Other Eukaryotes - 18304 (source: NCBI BLink).
AT3G62080AT3G62080.1AAACGGCASNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).
AT3G62080.1CGTTTTGASNF7 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); Has 955 Blast hits to 933 proteins in 178 species: Archae - 16; Bacteria - 52; Metazoa - 556; Fungi - 89; Plants - 91; Viruses - 1; Other Eukaryotes - 150 (source: NCBI BLink).
AT3G62110AT3G62110.1TAAACGACAGCGTTTglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: response to cyclopentenone, carbohydrate metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT4G33440.1); Has 2594 Blast hits to 2590 proteins in 344 species: Archae - 2; Bacteria - 575; Metazoa - 8; Fungi - 1060; Plants - 840; Viruses - 2; Other Eukaryotes - 107 (source: NCBI BLink).
AT3G62200AT3G62200.1TCAAAACGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: EDA32 (embryo sac development arrest 32) (TAIR:AT3G62210.1); Has 3380 Blast hits to 2820 proteins in 272 species: Archae - 0; Bacteria - 93; Metazoa - 1555; Fungi - 720; Plants - 473; Viruses - 42; Other Eukaryotes - 497 (source: NCBI BLink).
AT3G62410AT3G62410.1AAAACGGCCP12-2 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. CP12-2 is coordinately regulated by light with the photosynthetic GAPDH and PRK. The annotation of this gene is based on article 32494.
AT3G62450AT3G62450.1CAGCGTTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 11 Blast hits to 11 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G63210AT3G63210.1TAAAACGCencodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102
AT3G63220AT3G63220.1CGTTTTGAkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink).
AT3G63220.2CGTTTTGAkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G16250.1); Has 4947 Blast hits to 3281 proteins in 155 species: Archae - 4; Bacteria - 274; Metazoa - 3818; Fungi - 8; Plants - 628; Viruses - 20; Other Eukaryotes - 195 (source: NCBI BLink).
AT3G63370AT3G63370.1AACGGGCCCTApentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink).
AT3G63410AT3G63410.1CAAAACGCCCAATAEncodes a MPBQ/MSBQ methyltransferase located in the chloroplast inner envelope membrane. Mutant plants lack plastoquinone (PQ), suggesting that the APG1 protein is involved in the methylation step of PQ biosynthesis. The gene product is also involved in tocopherol (vitamin E) biosynthesis.
AT3G63520AT3G63520.1CGACGTGGCAGCGTTTEncodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including &#946;-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds.
AT4G00058AT4G00058.1CAATGGGCTCAAGCCCAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown.
AT4G00530AT4G00530.1AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G00530.1AAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G00550AT4G00550.1AAACGGCAencodes a UDP-galactose-dependent digalactosyldiacylglycerol(DGDG) synthase. Located in chloroplast outer membrane.
AT4G00700AT4G00700.1TTAAAGGCC2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT4G11610.1); Has 3245 Blast hits to 2276 proteins in 174 species: Archae - 0; Bacteria - 0; Metazoa - 1991; Fungi - 105; Plants - 877; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink).
AT4G00830AT4G00830.1AAAACGGCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink).
AT4G00830.1GCGTTTTGARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink).
AT4G00830.2AAAACGGCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink).
AT4G00830.2GCGTTTTGARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT3G52660.2); Has 43150 Blast hits to 23583 proteins in 806 species: Archae - 55; Bacteria - 2020; Metazoa - 23906; Fungi - 4438; Plants - 4282; Viruses - 424; Other Eukaryotes - 8025 (source: NCBI BLink).
AT4G01570AT4G01570.1AAAACGGCApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink).
AT4G01700AT4G01700.1AAAGTCAAAACGchitinase, putative; FUNCTIONS IN: chitinase activity; INVOLVED IN: cell wall macromolecule catabolic process; LOCATED IN: cell wall; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 19 (InterPro:IPR016283), Glycoside hydrolase, family 19, catalytic (InterPro:IPR000726); BEST Arabidopsis thaliana protein match is: chitinase, putative (TAIR:AT1G02360.1); Has 1469 Blast hits to 1463 proteins in 349 species: Archae - 0; Bacteria - 354; Metazoa - 35; Fungi - 2; Plants - 989; Viruses - 19; Other Eukaryotes - 70 (source: NCBI BLink).
AT4G01710AT4G01710.1AAACGGCAbelongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome.
AT4G01710.1CGTGCCGTTTAAGGCCbelongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome.
AT4G02080AT4G02080.1TGCCGTTTTA member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases.
AT4G02210AT4G02210.1GCCTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24960.2); Has 475 Blast hits to 288 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 12; Plants - 463; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G02380AT4G02380.1GCCGTTTAEncodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses.
AT4G02380.2GCCGTTTAEncodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses.
AT4G02400AT4G02400.1CAGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: rRNA processing; LOCATED IN: small-subunit processome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small-subunit processome, Utp14 (InterPro:IPR006709); BEST Arabidopsis thaliana protein match is: U3 ribonucleoprotein (Utp) family protein (TAIR:AT5G08600.1); Has 7412 Blast hits to 4272 proteins in 301 species: Archae - 10; Bacteria - 517; Metazoa - 2926; Fungi - 722; Plants - 242; Viruses - 149; Other Eukaryotes - 2846 (source: NCBI BLink).
AT4G02450AT4G02450.1TAAAACGCglycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03773.1); Has 46378 Blast hits to 11178 proteins in 874 species: Archae - 70; Bacteria - 23566; Metazoa - 10100; Fungi - 1919; Plants - 4009; Viruses - 377; Other Eukaryotes - 6337 (source: NCBI BLink).
AT4G02450.2TAAAACGCglycine-rich protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03773.1); Has 46378 Blast hits to 11178 proteins in 874 species: Archae - 70; Bacteria - 23566; Metazoa - 10100; Fungi - 1919; Plants - 4009; Viruses - 377; Other Eukaryotes - 6337 (source: NCBI BLink).
AT4G02570AT4G02570.1TAAAACGCAGCGTEncodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response.
AT4G02570.2TAAAACGCAGCGTEncodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response.
AT4G02570.3TAAAACGCAGCGTEncodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response.
AT4G02580AT4G02580.1AAATGGGCCTTTAANADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae - 12; Bacteria - 1956; Metazoa - 160; Fungi - 76; Plants - 28; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT4G02580.1TATGGGCCTTTAANADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae - 12; Bacteria - 1956; Metazoa - 160; Fungi - 76; Plants - 28; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT4G02600AT4G02600.1AAAACGCGTTTA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO1 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and in papillae, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT4G02600.2AAAACGCGTTTA member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO1 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and in papillae, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT4G02720AT4G02720.1AAACGGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF926 (InterPro:IPR009269); Has 94634 Blast hits to 43088 proteins in 1394 species: Archae - 72; Bacteria - 10621; Metazoa - 45152; Fungi - 10187; Plants - 3989; Viruses - 718; Other Eukaryotes - 23895 (source: NCBI BLink).
AT4G02790AT4G02790.1GCCTTTAAGTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT2G41670.1); Has 6347 Blast hits to 6027 proteins in 1205 species: Archae - 72; Bacteria - 3880; Metazoa - 692; Fungi - 374; Plants - 122; Viruses - 0; Other Eukaryotes - 1207 (source: NCBI BLink).
AT4G02820AT4G02820.1CGTTTTGApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02150.1); Has 6981 Blast hits to 3279 proteins in 125 species: Archae - 0; Bacteria - 14; Metazoa - 76; Fungi - 59; Plants - 6627; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink).
AT4G02880AT4G02880.1GGCCTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03290.1); Has 3704 Blast hits to 3126 proteins in 384 species: Archae - 40; Bacteria - 363; Metazoa - 1661; Fungi - 338; Plants - 170; Viruses - 7; Other Eukaryotes - 1125 (source: NCBI BLink).
AT4G02890AT4G02890.1TAAACGGCGTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.2TAAACGGCGTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.3TAAACGGCGTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G02890.4TAAACGGCGTPolyubiquitin gene containing 4 ubiquitin repeats.
AT4G03080AT4G03080.1AAAACGCCBRI1 SUPPRESSOR 1 (BSU1)-LIKE 1 (BSL1); FUNCTIONS IN: hydrolase activity, manganese ion binding, protein serine/threonine phosphatase activity, iron ion binding, phosphoprotein phosphatase activity; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Metallophosphoesterase (InterPro:IPR004843), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Serine/threonine protein phosphatase, BSU1 (InterPro:IPR012391), Kelch-type beta propeller (InterPro:IPR015915), Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase (InterPro:IPR006186); BEST Arabidopsis thaliana protein match is: kelch repeat-containing serine/threonine phosphoesterase family protein (TAIR:AT2G27210.1); Has 8464 Blast hits to 6996 proteins in 403 species: Archae - 49; Bacteria - 206; Metazoa - 3422; Fungi - 1329; Plants - 1405; Viruses - 5; Other Eukaryotes - 2048 (source: NCBI BLink).
AT4G03280AT4G03280.1ATTGGCCCGTTEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.
AT4G03280.2ATTGGCCCGTTEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.
AT4G03560AT4G03560.1AAAACGGCGEncodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress.
AT4G04320AT4G04320.1GACGCCGTTTTAAAAGCCmalonyl-CoA decarboxylase family protein; FUNCTIONS IN: malonyl-CoA decarboxylase activity; INVOLVED IN: fatty acid biosynthetic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Malonyl-CoA decarboxylase (InterPro:IPR007956); Has 994 Blast hits to 911 proteins in 148 species: Archae - 0; Bacteria - 242; Metazoa - 65; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 667 (source: NCBI BLink).
AT4G04320.2GACGCCGTTTTAAAAGCCmalonyl-CoA decarboxylase family protein; FUNCTIONS IN: malonyl-CoA decarboxylase activity; INVOLVED IN: fatty acid biosynthetic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Malonyl-CoA decarboxylase (InterPro:IPR007956); Has 994 Blast hits to 911 proteins in 148 species: Archae - 0; Bacteria - 242; Metazoa - 65; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 667 (source: NCBI BLink).
AT4G04340AT4G04340.1TCAAAACGearly-responsive to dehydration protein-related / ERD protein-related; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT4G22120.5); Has 937 Blast hits to 829 proteins in 136 species: Archae - 0; Bacteria - 2; Metazoa - 161; Fungi - 457; Plants - 259; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).
AT4G04340.2TCAAAACGearly-responsive to dehydration protein-related / ERD protein-related; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT4G22120.5); Has 937 Blast hits to 829 proteins in 136 species: Archae - 0; Bacteria - 2; Metazoa - 161; Fungi - 457; Plants - 259; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).
AT4G04340.3TCAAAACGearly-responsive to dehydration protein-related / ERD protein-related; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: early-responsive to dehydration protein-related / ERD protein-related (TAIR:AT4G22120.5); Has 937 Blast hits to 829 proteins in 136 species: Archae - 0; Bacteria - 2; Metazoa - 161; Fungi - 457; Plants - 259; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).
AT4G04350AT4G04350.1AACGGCGTCGTTTCEMBRYO DEFECTIVE 2369 (EMB2369); FUNCTIONS IN: aminoacyl-tRNA ligase activity, nucleotide binding, leucine-tRNA ligase activity, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Leucyl-tRNA synthetase, class Ia, bacterial/mitochondrial (InterPro:IPR002302), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (InterPro:IPR013155), Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing (InterPro:IPR009008), Aminoacyl-tRNA synthetase, class Ia (InterPro:IPR002300), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: OVA2 (ovule abortion 2); ATP binding / aminoacyl-tRNA ligase/ isoleucine-tRNA ligase/ nucleotide binding (TAIR:AT5G49030.2); Has 28364 Blast hits to 26241 proteins in 1865 species: Archae - 900; Bacteria - 12390; Metazoa - 742; Fungi - 524; Plants - 168; Viruses - 3; Other Eukaryotes - 13637 (source: NCBI BLink).
AT4G04885AT4G04885.1TCAAAACGEncodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time.
AT4G04920AT4G04920.1GGCGTTTTEncodes a nuclear targeted protein that plays a role in the CBF pathway -downstream of CBF translation. Mutants have impaired cold responses, reduced levels of cold induced RNA transcripts, are sensitive to osmotic stress.
AT4G05320AT4G05320.1TAAACGGCGTCOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.2TAAACGGCGTCOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.3TAAACGGCGTCOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.4TAAACGGCGTCOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.5TAAACGGCGTCOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05320.6TAAACGGCGTCOne of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid.
AT4G05410AT4G05410.1TTAAAGGCCCAAGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink).
AT4G06746AT4G06746.1GCCGTTTATTAAACCGencodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.9). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1 and RAP2.10.
AT4G07390AT4G07390.1TAAACGGCCCAATPQ-loop repeat family protein / transmembrane family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Mannose-P-dolichol utilization defect 1 protein (InterPro:IPR016817); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT5G59470.1); Has 451 Blast hits to 449 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 81; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).
AT4G08500AT4G08500.1AAAACGCCMember of MAP Kinase Kinase gene family. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates AtMEK1.
AT4G08590AT4G08590.1TAAAACGCGORTHRUS-LIKE (ORTHL); FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: protein ubiquitination; LOCATED IN: cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SRA-YDG (InterPro:IPR003105), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: VIM1 (VARIANT IN METHYLATION 1); DNA binding / chromatin binding / double-stranded methylated DNA binding / histone binding / methyl-CpG binding / methyl-CpNpG binding / methyl-CpNpN binding / ubiquitin-protein ligase (TAIR:AT1G57820.2); Has 2130 Blast hits to 2080 proteins in 171 species: Archae - 0; Bacteria - 8; Metazoa - 1503; Fungi - 96; Plants - 328; Viruses - 5; Other Eukaryotes - 190 (source: NCBI BLink).
AT4G08590.2TAAAACGCGORTHRUS-LIKE (ORTHL); FUNCTIONS IN: ubiquitin-protein ligase activity, zinc ion binding; INVOLVED IN: protein ubiquitination; LOCATED IN: cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SRA-YDG (InterPro:IPR003105), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: VIM1 (VARIANT IN METHYLATION 1); DNA binding / chromatin binding / double-stranded methylated DNA binding / histone binding / methyl-CpG binding / methyl-CpNpG binding / methyl-CpNpN binding / ubiquitin-protein ligase (TAIR:AT1G57820.2); Has 2130 Blast hits to 2080 proteins in 171 species: Archae - 0; Bacteria - 8; Metazoa - 1503; Fungi - 96; Plants - 328; Viruses - 5; Other Eukaryotes - 190 (source: NCBI BLink).
AT4G08850AT4G08850.1TAAACGGCkinase; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase, active site (InterPro:IPR008266), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT1G35710.1); Has 186964 Blast hits to 105464 proteins in 3465 species: Archae - 121; Bacteria - 14363; Metazoa - 83128; Fungi - 7708; Plants - 58474; Viruses - 412; Other Eukaryotes - 22758 (source: NCBI BLink).
AT4G08850.2TAAACGGCkinase; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase, active site (InterPro:IPR008266), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: leucine-rich repeat transmembrane protein kinase, putative (TAIR:AT1G35710.1); Has 186964 Blast hits to 105464 proteins in 3465 species: Archae - 121; Bacteria - 14363; Metazoa - 83128; Fungi - 7708; Plants - 58474; Viruses - 412; Other Eukaryotes - 22758 (source: NCBI BLink).
AT4G09580AT4G09580.1CGCAGCGTTTINVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G71940.1); Has 2023 Blast hits to 2023 proteins in 496 species: Archae - 2; Bacteria - 1014; Metazoa - 198; Fungi - 27; Plants - 131; Viruses - 0; Other Eukaryotes - 651 (source: NCBI BLink).
AT4G09680AT4G09680.1TAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G09680.2TAAACGGCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G10250AT4G10250.1TTAAAGGCColumbia endomembrane-localized small heat shock protein
AT4G10970AT4G10970.1CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).
AT4G10970.2CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).
AT4G10970.3CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).
AT4G10970.4CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).
AT4G10970.5CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).
AT4G10970.6CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23910.1).
AT4G11380AT4G11380.1ATCGGCCCGTTAbeta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink).
AT4G11670AT4G11670.1TCAAAACGACATCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Munc13 homology 1 (InterPro:IPR014770), Protein of unknown function DUF810 (InterPro:IPR008528), Munc13 homology 2 (InterPro:IPR014772); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06970.1); Has 147 Blast hits to 87 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 138; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G12830AT4G12830.1TAAAACGCAGCGTTTTAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT1G52510.2); Has 8452 Blast hits to 8450 proteins in 913 species: Archae - 58; Bacteria - 5118; Metazoa - 591; Fungi - 124; Plants - 417; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink).
AT4G12880AT4G12880.1TAAAACGCplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: apoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT5G15350.1); Has 714 Blast hits to 705 proteins in 45 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 714; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G13590AT4G13590.1TGCCGTTTunknown protein; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64150.1); Has 1187 Blast hits to 1119 proteins in 441 species: Archae - 10; Bacteria - 644; Metazoa - 134; Fungi - 113; Plants - 109; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).
AT4G13940AT4G13940.1GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.2GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.3GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.4GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G14240AT4G14240.1TGCCGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein-related (TAIR:AT4G14230.1); Has 6770 Blast hits to 6657 proteins in 1347 species: Archae - 62; Bacteria - 4461; Metazoa - 254; Fungi - 179; Plants - 121; Viruses - 0; Other Eukaryotes - 1693 (source: NCBI BLink).
AT4G14240.2TGCCGTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein-related (TAIR:AT4G14230.1); Has 6770 Blast hits to 6657 proteins in 1347 species: Archae - 62; Bacteria - 4461; Metazoa - 254; Fungi - 179; Plants - 121; Viruses - 0; Other Eukaryotes - 1693 (source: NCBI BLink).
AT4G14315AT4G14315.1CGCAGCGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G14315.1TAAAACGCTGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G14320AT4G14320.1TAAACGGC60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink).
AT4G14330AT4G14330.1GCCGTTTAphragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink).
AT4G14365AT4G14365.1CGCGTTTTzinc finger (C3HC4-type RING finger) family protein / ankyrin repeat family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein / ankyrin repeat family protein (TAIR:AT3G23280.1); Has 25331 Blast hits to 12607 proteins in 594 species: Archae - 31; Bacteria - 1429; Metazoa - 13411; Fungi - 969; Plants - 625; Viruses - 441; Other Eukaryotes - 8425 (source: NCBI BLink).
AT4G14370AT4G14370.1ACGCGTTTTphosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction, defense response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat 3 (InterPro:IPR011713), Toll-Interleukin receptor (InterPro:IPR000157); BEST Arabidopsis thaliana protein match is: disease resistance protein (TIR-NBS-LRR class), putative (TAIR:AT2G16870.1); Has 29829 Blast hits to 16420 proteins in 692 species: Archae - 56; Bacteria - 2443; Metazoa - 8792; Fungi - 770; Plants - 11893; Viruses - 63; Other Eukaryotes - 5812 (source: NCBI BLink).
AT4G14420AT4G14420.1CGCGTTTTAlesion inducing protein-related; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: HR-like lesion-inducer (InterPro:IPR008637); BEST Arabidopsis thaliana protein match is: lesion inducing protein-related (TAIR:AT1G04340.1); Has 95 Blast hits to 95 proteins in 17 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G14600AT4G14600.1TAAAACGCAGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29060.1); Has 95 Blast hits to 95 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 27; Fungi - 19; Plants - 44; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G14880AT4G14880.1CGCGTTTTEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA.
AT4G14880.2CGCGTTTTEncodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA.
AT4G14940AT4G14940.1GCCGTTTAatao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development.
AT4G15010AT4G15010.1TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink).
AT4G15010.2TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink).
AT4G15010.3TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink).
AT4G15020AT4G15020.1AACGGGCCGGGTCGADNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT4G15020.2AACGGGCCGGGTCGADNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT4G15470AT4G15470.1CAGCGTTTTAEXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT1G03070.1); Has 4000 Blast hits to 3999 proteins in 955 species: Archae - 0; Bacteria - 1775; Metazoa - 750; Fungi - 92; Plants - 143; Viruses - 77; Other Eukaryotes - 1163 (source: NCBI BLink).
AT4G15500AT4G15500.1TAAACGGCEncodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity.
AT4G15620AT4G15620.1GCGTTTTGintegral membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0497, trans-membrane plant (InterPro:IPR006702), Uncharacterised protein family UPF0497, trans-membrane plant subgroup (InterPro:IPR006459); BEST Arabidopsis thaliana protein match is: integral membrane family protein (TAIR:AT4G15630.1); Has 281 Blast hits to 281 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 281; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G15802AT4G15802.1CAGCGTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heat shock factor binding 1 (InterPro:IPR009643); Has 178 Blast hits to 178 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 122; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT4G15850AT4G15850.1AAACGGCGTplant DEAD box-like RNA helicase.
AT4G16210AT4G16210.1TGCCGTTTTENOYL-COA HYDRATASE/ISOMERASE A (ECHIA); FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Crotonase, core (InterPro:IPR001753); BEST Arabidopsis thaliana protein match is: ECHID (ENOYL-COA HYDRATASE/ISOMERASE D); catalytic/ naphthoate synthase (TAIR:AT1G60550.1); Has 25757 Blast hits to 25754 proteins in 1304 species: Archae - 201; Bacteria - 14217; Metazoa - 1423; Fungi - 585; Plants - 340; Viruses - 0; Other Eukaryotes - 8991 (source: NCBI BLink).
AT4G16330AT4G16330.1TAAACGGCGToxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G38240.1); Has 5424 Blast hits to 5410 proteins in 662 species: Archae - 0; Bacteria - 677; Metazoa - 111; Fungi - 490; Plants - 3015; Viruses - 0; Other Eukaryotes - 1131 (source: NCBI BLink).
AT4G16380AT4G16380.1AACACGTGTCAAAACGmetal ion binding; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT1G51090.1); Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G16380.2AACACGTGTCAAAACGmetal ion binding; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT1G51090.1); Has 21 Blast hits to 21 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G16563AT4G16563.1GCGTTTTGaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plant-type cell wall; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT5G45120.1); Has 1308 Blast hits to 1249 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 75; Plants - 1069; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT4G16710AT4G16710.1GGCGTTTTTCCGGTglycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT4G16710.1TAAACGACAGCGTTTglycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT4G16710.2GGCGTTTTTCCGGTglycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT4G16710.2TAAACGACAGCGTTTglycosyltransferase family protein 28; FUNCTIONS IN: transferase activity, transferring hexosyl groups, carbohydrate binding, transferase activity, transferring glycosyl groups; INVOLVED IN: lipid glycosylation, biosynthetic process, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 28, C-terminal (InterPro:IPR007235); Has 407 Blast hits to 406 proteins in 191 species: Archae - 8; Bacteria - 118; Metazoa - 104; Fungi - 82; Plants - 24; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT4G17070AT4G17070.1AAAACGACAGCGTTTpeptidyl-prolyl cis-trans isomerase; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: response to oxidative stress; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); Has 114 Blast hits to 110 proteins in 26 species: Archae - 0; Bacteria - 24; Metazoa - 9; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT4G17390AT4G17390.1GCGTTTTG60S ribosomal protein L15 (RPL15B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15e (InterPro:IPR000439), Ribosomal protein L23/L15e, core (InterPro:IPR012678); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L15 (RPL15A) (TAIR:AT4G16720.1); Has 971 Blast hits to 970 proteins in 319 species: Archae - 217; Bacteria - 0; Metazoa - 330; Fungi - 103; Plants - 125; Viruses - 0; Other Eukaryotes - 196 (source: NCBI BLink).
AT4G17500AT4G17500.1TAAAACGCACGTGTTEncodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
AT4G17510AT4G17510.1CCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17520AT4G17520.1TAACGGGCCCGGCCCAATAAnuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 13357 Blast hits to 8375 proteins in 750 species: Archae - 13; Bacteria - 2605; Metazoa - 5274; Fungi - 1340; Plants - 1789; Viruses - 136; Other Eukaryotes - 2200 (source: NCBI BLink).
AT4G17560AT4G17560.1AACGGCCCATAAribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink).
AT4G17620AT4G17620.1AAATGGGCCTTTAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).
AT4G17620.2AAATGGGCCTTTAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink).
AT4G18460AT4G18460.1CAAAACGCCD-Tyr-tRNA(Tyr) deacylase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: D-amino acid catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-tyrosyl-tRNA(Tyr) deacylase (InterPro:IPR003732); Has 3035 Blast hits to 3034 proteins in 1108 species: Archae - 3; Bacteria - 2050; Metazoa - 120; Fungi - 93; Plants - 20; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink).
AT4G18800AT4G18800.1CGCCGTTTAARABIDOPSIS RAB GTPASE HOMOLOG A1D (ATRABA1D); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1c (Arabidopsis Rab GTPase homolog A1c); GTP binding (TAIR:AT5G45750.1); Has 22463 Blast hits to 22423 proteins in 614 species: Archae - 17; Bacteria - 112; Metazoa - 12475; Fungi - 2938; Plants - 1917; Viruses - 19; Other Eukaryotes - 4985 (source: NCBI BLink).
AT4G18880AT4G18880.1ACGCGTTTTmember of Heat Stress Transcription Factor (Hsf) family
AT4G19003AT4G19003.1GCCTTTAAVPS25; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; CONTAINS InterPro DOMAIN/s: ESCRT-II complex, vps25 subunit, N-terminal winged helix (InterPro:IPR014041), ESCRT-II complex, vps25 subunit, C-terminal winged helix (InterPro:IPR014040), ESCRT-II complex, vps25 subunit (InterPro:IPR008570); Has 237 Blast hits to 237 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 79; Plants - 22; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT4G19003.2GCCTTTAAVPS25; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: ESCRT II complex; CONTAINS InterPro DOMAIN/s: ESCRT-II complex, vps25 subunit, N-terminal winged helix (InterPro:IPR014041), ESCRT-II complex, vps25 subunit, C-terminal winged helix (InterPro:IPR014040), ESCRT-II complex, vps25 subunit (InterPro:IPR008570); Has 237 Blast hits to 237 proteins in 110 species: Archae - 0; Bacteria - 0; Metazoa - 112; Fungi - 79; Plants - 22; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT4G19120AT4G19120.1TGGGTCCCAAAACGCCearly-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT4G19120.2TGGGTCCCAAAACGCCearly-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT4G19390AT4G19390.1TCAAAACGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022348 (InterPro:IPR016804), Uncharacterised protein family UPF0114 (InterPro:IPR005134); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13720.1); Has 553 Blast hits to 553 proteins in 219 species: Archae - 18; Bacteria - 407; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 74 (source: NCBI BLink).
AT4G19500AT4G19500.1CGTTTTGAATP binding / nucleoside-triphosphatase/ nucleotide binding / protein binding / transmembrane receptor; FUNCTIONS IN: protein binding, transmembrane receptor activity, nucleoside-triphosphatase activity, nucleotide binding, ATP binding; INVOLVED IN: signal transduction, defense response, apoptosis, innate immune response; LOCATED IN: intrinsic to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), NB-ARC (InterPro:IPR002182), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat 3 (InterPro:IPR011713), Toll-Interleukin receptor (InterPro:IPR000157), Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: SNC1 (SUPPRESSOR OF NPR1-1, CONSTITUTIVE 1); nucleotide binding (TAIR:AT4G16890.1); Has 13999 Blast hits to 8175 proteins in 320 species: Archae - 7; Bacteria - 332; Metazoa - 274; Fungi - 32; Plants - 12934; Viruses - 4; Other Eukaryotes - 416 (source: NCBI BLink).
AT4G19710AT4G19710.1GGCCTTTAAEncodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.
AT4G19710.2GGCCTTTAAEncodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.
AT4G20300AT4G20300.1CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT4G20300.2CGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT4G20360AT4G20360.1TAAAACGCCACGARABIDOPSIS RAB GTPASE HOMOLOG E1B (ATRABE1B); FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; INVOLVED IN: peptidyl-cysteine S-nitrosylation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor Tu, putative / EF-Tu, putative (TAIR:AT4G02930.1); Has 60789 Blast hits to 60738 proteins in 12836 species: Archae - 775; Bacteria - 22875; Metazoa - 13447; Fungi - 6921; Plants - 1294; Viruses - 5; Other Eukaryotes - 15472 (source: NCBI BLink).
AT4G20860AT4G20860.1AAACGCGTFAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: response to cyclopentenone; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.10 ten leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Oxygen oxidoreductase covalent FAD-binding site (InterPro:IPR006093), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44360.1); Has 3032 Blast hits to 2927 proteins in 504 species: Archae - 28; Bacteria - 1241; Metazoa - 4; Fungi - 1147; Plants - 342; Viruses - 0; Other Eukaryotes - 270 (source: NCBI BLink).
AT4G20960AT4G20960.1GCGTTTTGencodes diaminohydroxyphosphoribosylaminopyrimidine deaminase catalyzing the second step in the riboflavin biosynthesis
AT4G21180AT4G21180.1CAAAACGCGJ domain protein localized in ER membrane.
AT4G21320AT4G21320.1GCGTTTTGAEncodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment.
AT4G21570AT4G21570.1CACGTGGTAAACGCGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11200.1); Has 590 Blast hits to 587 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 255; Fungi - 125; Plants - 125; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink).
AT4G21810AT4G21810.1AAAACGCCDERLIN-2.1 (DER2.1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 644 Blast hits to 643 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 293; Fungi - 119; Plants - 95; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).
AT4G21810.1AAACGCTGDERLIN-2.1 (DER2.1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 644 Blast hits to 643 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 293; Fungi - 119; Plants - 95; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).
AT4G21960AT4G21960.1GCCTTTAAEncodes AT4g21960 (AT4g21960/T8O5_170).
AT4G22080AT4G22080.1TGCCGTTTTpectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT4G22090.1); Has 936 Blast hits to 933 proteins in 167 species: Archae - 0; Bacteria - 401; Metazoa - 0; Fungi - 129; Plants - 398; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT4G22140AT4G22140.1TCAAAACGACADNA binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Bromo adjacent region (InterPro:IPR001025), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: bromo-adjacent homology (BAH) domain-containing protein (TAIR:AT4G04260.1); Has 1467 Blast hits to 1417 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 921; Fungi - 186; Plants - 236; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).
AT4G22140.2TCAAAACGACADNA binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Bromo adjacent region (InterPro:IPR001025), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: bromo-adjacent homology (BAH) domain-containing protein (TAIR:AT4G04260.1); Has 1467 Blast hits to 1417 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 921; Fungi - 186; Plants - 236; Viruses - 0; Other Eukaryotes - 124 (source: NCBI BLink).
AT4G22320AT4G22320.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55210.1); Has 9841 Blast hits to 5053 proteins in 396 species: Archae - 29; Bacteria - 556; Metazoa - 3805; Fungi - 755; Plants - 226; Viruses - 158; Other Eukaryotes - 4312 (source: NCBI BLink).
AT4G22350AT4G22350.1TTCACGCGTTTubiquitin carboxyl-terminal hydrolase family protein; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, UBP-type (InterPro:IPR001607), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394); BEST Arabidopsis thaliana protein match is: ubiquitin thiolesterase/ zinc ion binding (TAIR:AT4G22285.1); Has 2784 Blast hits to 2384 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 1738; Fungi - 374; Plants - 244; Viruses - 0; Other Eukaryotes - 428 (source: NCBI BLink).
AT4G22360AT4G22360.1AAACGCGTGAASWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121), DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT3G19080.1); Has 1341 Blast hits to 971 proteins in 185 species: Archae - 0; Bacteria - 229; Metazoa - 293; Fungi - 295; Plants - 306; Viruses - 0; Other Eukaryotes - 218 (source: NCBI BLink).
AT4G22720AT4G22720.1TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTAglycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink).
AT4G22720.2TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTAglycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink).
AT4G23610AT4G23610.1AAACGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G54200.1); Has 79 Blast hits to 78 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G23820AT4G23820.1TATGGCCCGTTglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G41870.1); Has 2405 Blast hits to 2400 proteins in 312 species: Archae - 2; Bacteria - 563; Metazoa - 8; Fungi - 896; Plants - 841; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).
AT4G23840AT4G23840.1AACGGGCCATAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G15740.1); Has 7635 Blast hits to 5145 proteins in 376 species: Archae - 2; Bacteria - 2863; Metazoa - 1987; Fungi - 78; Plants - 1868; Viruses - 40; Other Eukaryotes - 797 (source: NCBI BLink).
AT4G23900AT4G23900.1GCCTTTAAnucleoside diphosphate kinase 4 (NDK4); FUNCTIONS IN: nucleoside diphosphate kinase activity, ATP binding; INVOLVED IN: UTP biosynthetic process, GTP biosynthetic process, CTP biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside diphosphate kinase, core (InterPro:IPR001564); BEST Arabidopsis thaliana protein match is: NDPK3 (NUCLEOSIDE DIPHOSPHATE KINASE 3); ATP binding / nucleoside diphosphate kinase (TAIR:AT4G11010.1); Has 6327 Blast hits to 6229 proteins in 1550 species: Archae - 205; Bacteria - 2598; Metazoa - 838; Fungi - 116; Plants - 246; Viruses - 17; Other Eukaryotes - 2307 (source: NCBI BLink).
AT4G23980AT4G23980.1AACGGCGTEncodes auxin response factor 9 (ARF9).
AT4G23980.2AACGGCGTEncodes auxin response factor 9 (ARF9).
AT4G24050AT4G24050.1AAAACGGCAshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT1G64590.1); Has 39207 Blast hits to 39168 proteins in 1814 species: Archae - 246; Bacteria - 22794; Metazoa - 3354; Fungi - 2329; Plants - 968; Viruses - 0; Other Eukaryotes - 9516 (source: NCBI BLink).
AT4G24090AT4G24090.1TGCCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 95 Blast hits to 93 proteins in 48 species: Archae - 3; Bacteria - 45; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT4G24100AT4G24100.1CGCGTTTTGprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT4G10730.1); Has 91504 Blast hits to 90179 proteins in 3094 species: Archae - 51; Bacteria - 7936; Metazoa - 40188; Fungi - 8002; Plants - 18055; Viruses - 587; Other Eukaryotes - 16685 (source: NCBI BLink).
AT4G24240AT4G24240.1TCAAAACGCEncodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family.
AT4G24440AT4G24440.1GCCTTTAAtranscription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G24440.2GCCTTTAAtranscription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G24570AT4G24570.1ACACGCGTTTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial carrier protein (InterPro:IPR002067), Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: UCP5 (UNCOUPLING PROTEIN 5); binding (TAIR:AT2G22500.1); Has 15369 Blast hits to 9513 proteins in 356 species: Archae - 0; Bacteria - 0; Metazoa - 7655; Fungi - 4171; Plants - 2183; Viruses - 0; Other Eukaryotes - 1360 (source: NCBI BLink).
AT4G24730AT4G24730.1GGCGTTTTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: WR3 (WOUND-RESPONSIVE 3); nitrate transmembrane transporter (TAIR:AT5G50200.3); Has 243 Blast hits to 242 proteins in 66 species: Archae - 0; Bacteria - 73; Metazoa - 54; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT4G24730.2GGCGTTTTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: WR3 (WOUND-RESPONSIVE 3); nitrate transmembrane transporter (TAIR:AT5G50200.3); Has 243 Blast hits to 242 proteins in 66 species: Archae - 0; Bacteria - 73; Metazoa - 54; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT4G24730.3GGCGTTTTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metallophosphoesterase (InterPro:IPR004843); BEST Arabidopsis thaliana protein match is: WR3 (WOUND-RESPONSIVE 3); nitrate transmembrane transporter (TAIR:AT5G50200.3); Has 243 Blast hits to 242 proteins in 66 species: Archae - 0; Bacteria - 73; Metazoa - 54; Fungi - 0; Plants - 84; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT4G24770AT4G24770.1CGTTTTGAEncodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase).
AT4G24920AT4G24920.1GCCGTTTAAAATGGGCTTTGprotein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT5G50460.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).
AT4G24930AT4G24930.1GCGTTTTGAthylakoid lumenal 17.9 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G24990AT4G24990.1AAAACGACAGCGTTTgeranylgeranylated protein ATGP4
AT4G25000AT4G25000.1TCAAAACGTGACAPredicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830).
AT4G25050AT4G25050.1AGATGGGCCCGTTencodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light.
AT4G25130AT4G25130.1TAAAACGCpeptide methionine sulfoxide reductase, putative; FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity, oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; INVOLVED IN: protein modification process, protein metabolic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase A (InterPro:IPR002569); BEST Arabidopsis thaliana protein match is: PMSR1 (PEPTIDEMETHIONINE SULFOXIDE REDUCTASE 1); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / peptide-methionine-(S)-S-oxide reductase (TAIR:AT5G61640.1); Has 7185 Blast hits to 7183 proteins in 1356 species: Archae - 86; Bacteria - 3332; Metazoa - 164; Fungi - 91; Plants - 129; Viruses - 1; Other Eukaryotes - 3382 (source: NCBI BLink).
AT4G25140AT4G25140.1GCGTTTTAEncodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds.
AT4G25150AT4G25150.1TAAACGGCAacid phosphatase, putative; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase, putative (TAIR:AT5G51260.1); Has 559 Blast hits to 559 proteins in 162 species: Archae - 0; Bacteria - 269; Metazoa - 2; Fungi - 0; Plants - 241; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT4G25210AT4G25210.1GTTAGGCCCGTTtranscription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00130.1); Has 5777 Blast hits to 3070 proteins in 342 species: Archae - 2; Bacteria - 508; Metazoa - 1816; Fungi - 705; Plants - 351; Viruses - 71; Other Eukaryotes - 2324 (source: NCBI BLink).
AT4G25290AT4G25290.1ACGACGTCGTTTTGADNA photolyase; FUNCTIONS IN: DNA photolyase activity; INVOLVED IN: DNA repair; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), DNA photolyase, N-terminal (InterPro:IPR006050), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G36530.2); Has 4147 Blast hits to 4144 proteins in 685 species: Archae - 35; Bacteria - 2248; Metazoa - 244; Fungi - 30; Plants - 260; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink).
AT4G25300AT4G25300.1TCAAAACGACGTCGToxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink).
AT4G25300.2TCAAAACGACGTCGToxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G25310.1); Has 5835 Blast hits to 5806 proteins in 680 species: Archae - 0; Bacteria - 700; Metazoa - 111; Fungi - 623; Plants - 3093; Viruses - 0; Other Eukaryotes - 1308 (source: NCBI BLink).
AT4G25580AT4G25580.1AAACGGCAstress-responsive protein-related; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CAP160 (InterPro:IPR012418); BEST Arabidopsis thaliana protein match is: LTI65 (LOW-TEMPERATURE-INDUCED 65) (TAIR:AT5G52300.2); Has 231 Blast hits to 195 proteins in 64 species: Archae - 0; Bacteria - 20; Metazoa - 63; Fungi - 26; Plants - 81; Viruses - 6; Other Eukaryotes - 35 (source: NCBI BLink).
AT4G25680AT4G25680.1AAACGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25660.1); Has 503 Blast hits to 503 proteins in 118 species: Archae - 0; Bacteria - 0; Metazoa - 175; Fungi - 41; Plants - 181; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink).
AT4G25730AT4G25730.1GGGCCGTTTAFtsJ-like methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: rRNA processing, rRNA methylation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spb1, C-terminal (InterPro:IPR012920), Ribosomal RNA methyltransferase J (InterPro:IPR015507), Ribosomal RNA methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST Arabidopsis thaliana protein match is: FtsJ-like methyltransferase family protein (TAIR:AT5G01230.1); Has 26567 Blast hits to 17790 proteins in 1345 species: Archae - 124; Bacteria - 5586; Metazoa - 8358; Fungi - 2488; Plants - 691; Viruses - 228; Other Eukaryotes - 9092 (source: NCBI BLink).
AT4G25780AT4G25780.1CTTATTGGCGTTTTpathogenesis-related protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, extracellular region; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Allergen V5/Tpx-1 related, conserved site (InterPro:IPR018244), Allergen V5/Tpx-1 related (InterPro:IPR001283), Ves allergen (InterPro:IPR002413), SCP-like extracellular (InterPro:IPR014044); BEST Arabidopsis thaliana protein match is: allergen V5/Tpx-1-related family protein (TAIR:AT5G57625.1); Has 2260 Blast hits to 2175 proteins in 289 species: Archae - 0; Bacteria - 50; Metazoa - 1347; Fungi - 217; Plants - 590; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT4G26160AT4G26160.1TCAAAACGEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT4G26210AT4G26210.1TTAAAGGCmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G26210.2TTAAAGGCmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrial proton-transporting ATP synthase complex, coupling factor F(o); EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT4G29480.1); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G26310AT4G26310.1AAAACGGCGelongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink).
AT4G26310.1AACGGCGTCelongation factor P (EF-P) family protein; FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor P/YeiP, conserved site (InterPro:IPR013852), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Translation elongation factor, KOW-like (InterPro:IPR013185), Translation protein SH3-like, subgroup (InterPro:IPR014722), Elongation factor P, C-terminal (InterPro:IPR015365), Translation protein SH3-like (InterPro:IPR008991), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Translation elongation factor P/YeiP, central (InterPro:IPR001059); BEST Arabidopsis thaliana protein match is: elongation factor P (EF-P) family protein (TAIR:AT3G08740.1); Has 6706 Blast hits to 6706 proteins in 1428 species: Archae - 6; Bacteria - 4287; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 2373 (source: NCBI BLink).
AT4G26430AT4G26430.1TAAAACGCone of two genes encoding subunit 6 of COP9 signalosome complex
AT4G26450AT4G26450.1GCTGACGTGGCGTTTTunknown protein; Has 2630 Blast hits to 1931 proteins in 274 species: Archae - 42; Bacteria - 240; Metazoa - 1048; Fungi - 174; Plants - 110; Viruses - 15; Other Eukaryotes - 1001 (source: NCBI BLink).
AT4G26520AT4G26520.1AACGGCCCAATTAfructose-bisphosphate aldolase, cytoplasmic; FUNCTIONS IN: fructose-bisphosphate aldolase activity; INVOLVED IN: pentose-phosphate shunt, response to hypoxia; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT4G26530.2); Has 4378 Blast hits to 4373 proteins in 736 species: Archae - 0; Bacteria - 421; Metazoa - 1256; Fungi - 2; Plants - 338; Viruses - 0; Other Eukaryotes - 2361 (source: NCBI BLink).
AT4G26540AT4G26540.1TCAAAACGkinase; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: inflorescence meristem; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: leucine-rich repeat protein kinase, putative (TAIR:AT5G56040.2); Has 146520 Blast hits to 84763 proteins in 2645 species: Archae - 97; Bacteria - 13340; Metazoa - 56291; Fungi - 5522; Plants - 53478; Viruses - 285; Other Eukaryotes - 17507 (source: NCBI BLink).
AT4G26550AT4G26550.1GAAACGACGCCGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SFT2-like (InterPro:IPR011691); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56020.1); Has 452 Blast hits to 452 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 198; Fungi - 89; Plants - 61; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink).
AT4G26860AT4G26860.1CGTTTTGAAAGGGTATpyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Predicted pyridoxal phosphate-dependent enzyme, YBL036C type (InterPro:IPR011078), Alanine racemase, N-terminal (InterPro:IPR001608); BEST Arabidopsis thaliana protein match is: alanine racemase family protein (TAIR:AT1G11930.2); Has 5001 Blast hits to 5001 proteins in 1281 species: Archae - 14; Bacteria - 2219; Metazoa - 109; Fungi - 88; Plants - 34; Viruses - 0; Other Eukaryotes - 2537 (source: NCBI BLink).
AT4G27090AT4G27090.1AAAACGACGCCGTTTT60S ribosomal protein L14 (RPL14B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14 (InterPro:IPR002784); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L14 (RPL14A) (TAIR:AT2G20450.1); Has 520 Blast hits to 520 proteins in 229 species: Archae - 47; Bacteria - 0; Metazoa - 210; Fungi - 93; Plants - 65; Viruses - 0; Other Eukaryotes - 105 (source: NCBI BLink).
AT4G27270AT4G27270.1CGCCGTTTTquinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: FQR1 (FLAVODOXIN-LIKE QUINONE REDUCTASE 1); FMN binding / oxidoreductase, acting on NADH or NADPH, quinone or similar compound as acceptor (TAIR:AT5G54500.1); Has 2198 Blast hits to 2196 proteins in 677 species: Archae - 49; Bacteria - 1577; Metazoa - 2; Fungi - 180; Plants - 120; Viruses - 1; Other Eukaryotes - 269 (source: NCBI BLink).
AT4G27280AT4G27280.1CGCCGTTTTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: PBP1 (PINOID-BINDING PROTEIN 1); calcium ion binding / protein binding (TAIR:AT5G54490.1); Has 486 Blast hits to 485 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 30; Plants - 142; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).
AT4G27340AT4G27340.1CGTTTTGAMet-10+ like family protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function Met10 (InterPro:IPR003402); BEST Arabidopsis thaliana protein match is: Met-10+ like family protein (TAIR:AT3G56120.1); Has 1006 Blast hits to 996 proteins in 336 species: Archae - 244; Bacteria - 250; Metazoa - 158; Fungi - 92; Plants - 67; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink).
AT4G27390AT4G27390.1TAAACGACGCGTTTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 63 Blast hits to 63 proteins in 30 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G27630AT4G27630.2AAACGGCAEncodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG2 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG2 and may act to down-regulate GTG2 binding to ABA. GTG2 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG2 transcript levels do not appear to change in response to ABA or abiotic stresses.
AT4G27630.2TCTGGGCCGTTEncodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG2 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG2 and may act to down-regulate GTG2 binding to ABA. GTG2 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG2 transcript levels do not appear to change in response to ABA or abiotic stresses.
AT4G27680AT4G27680.1AGGCCTATTAAAGGCCCMSP1 protein, putative / intramitochondrial sorting protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: MSP1 protein, putative / intramitochondrial sorting protein, putative (TAIR:AT5G53540.1); Has 20791 Blast hits to 19084 proteins in 1738 species: Archae - 856; Bacteria - 5934; Metazoa - 4055; Fungi - 2306; Plants - 1353; Viruses - 23; Other Eukaryotes - 6264 (source: NCBI BLink).
AT4G27750AT4G27750.1TGCCGTTTAA genetic locus involved in sugar sensing and coordinating carbohydrate synthesis and utilization by the whole plant. Lines carrying mutations in this gene shows restricted carbohydrate allocation to plant growth and seed set, elevated chlorophyll levels, and reduced sugar induction of starch biosynthesis.
AT4G27780AT4G27780.1GCCTTTAAEncodes acyl-CoA-binding protein with ankyrin repeats
AT4G27840AT4G27840.1TTAAAGGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G27940AT4G27940.1CAAAACGCCmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); BEST Arabidopsis thaliana protein match is: mitochondrial substrate carrier family protein (TAIR:AT2G46320.1); Has 13258 Blast hits to 8472 proteins in 324 species: Archae - 0; Bacteria - 0; Metazoa - 6659; Fungi - 3535; Plants - 2092; Viruses - 0; Other Eukaryotes - 972 (source: NCBI BLink).
AT4G27970AT4G27970.1CGTTTTGATTCGGTTTEncodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane.
AT4G28010AT4G28010.1GCGTTTTGpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62670.1); Has 27713 Blast hits to 6108 proteins in 193 species: Archae - 5; Bacteria - 29; Metazoa - 747; Fungi - 685; Plants - 24892; Viruses - 0; Other Eukaryotes - 1355 (source: NCBI BLink).
AT4G28025AT4G28025.1AAACGACGACGTTTTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G28100AT4G28100.1GCGTTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18050.1); Has 35 Blast hits to 35 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G28730AT4G28730.1AAAACGCCCATTAGglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT2G20270.1); Has 3146 Blast hits to 3143 proteins in 777 species: Archae - 0; Bacteria - 1253; Metazoa - 362; Fungi - 221; Plants - 386; Viruses - 107; Other Eukaryotes - 817 (source: NCBI BLink).
AT4G29270AT4G29270.1AAACGCTGacid phosphatase class B family protein; FUNCTIONS IN: acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Acid phosphatase (Class B) (InterPro:IPR005519), Vegetative storage protein/acid phosphatase (InterPro:IPR014403), Acid phosphatase, plant (InterPro:IPR010028); BEST Arabidopsis thaliana protein match is: acid phosphatase class B family protein (TAIR:AT4G29260.1); Has 412 Blast hits to 412 proteins in 104 species: Archae - 0; Bacteria - 157; Metazoa - 0; Fungi - 0; Plants - 243; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT4G29480AT4G29480.1CAAAACGCTGTCGTTTTmitochondrial ATP synthase g subunit family protein; FUNCTIONS IN: hydrogen ion transmembrane transporter activity; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0 complex, subunit G, mitochondrial (InterPro:IPR006808); BEST Arabidopsis thaliana protein match is: mitochondrial ATP synthase g subunit family protein (TAIR:AT2G19680.2); Has 56 Blast hits to 56 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 53; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G29490AT4G29490.1AAAACGACAGCGTTTTGaminopeptidase/ manganese ion binding; FUNCTIONS IN: manganese ion binding, aminopeptidase activity; INVOLVED IN: cellular process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (InterPro:IPR007865), Peptidase M24, structural domain (InterPro:IPR000994); BEST Arabidopsis thaliana protein match is: metallopeptidase M24 family protein (TAIR:AT1G09300.2); Has 7096 Blast hits to 7089 proteins in 1383 species: Archae - 160; Bacteria - 3987; Metazoa - 333; Fungi - 234; Plants - 49; Viruses - 0; Other Eukaryotes - 2333 (source: NCBI BLink).
AT4G29670AT4G29670.1AAAACGCGTTTEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT4G29670.1CAAAACGCCEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT4G29670.2AAAACGCGTTTEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT4G29670.2CAAAACGCCEncodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase.
AT4G29730AT4G29730.1CAGCGTTTcell cycle-related repressor genes encoding WD-repeat proteins.
AT4G29730.1GCCTTTAAcell cycle-related repressor genes encoding WD-repeat proteins.
AT4G29770AT4G29770.1AAAACGGCGTCGTTarget of trans acting-siR480/255.
AT4G29850AT4G29850.1TGCCGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0414 (InterPro:IPR008590); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G19350.1); Has 188 Blast hits to 188 proteins in 50 species: Archae - 0; Bacteria - 0; Metazoa - 141; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G29860AT4G29860.1TGCCGTTTTEncodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development.
AT4G29870AT4G29870.1AAAACGGCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: membrane protein, putative (TAIR:AT2G19340.2); Has 163 Blast hits to 163 proteins in 56 species: Archae - 0; Bacteria - 0; Metazoa - 127; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT4G29905AT4G29905.1TCAAAACGunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 41 Blast hits to 41 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G30190AT4G30190.1AAAACGGCGbelongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal dom
AT4G30210AT4G30210.1AAACGCGTEncodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway.
AT4G30210.2AAACGCGTEncodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway.
AT4G30220AT4G30220.1TTAAAGGCSMALL NUCLEAR RIBONUCLEOPROTEIN F (RUXF); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small nuclear ribonucleoprotein SmF (InterPro:IPR016487), Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G14285.1); Has 865 Blast hits to 865 proteins in 209 species: Archae - 256; Bacteria - 0; Metazoa - 220; Fungi - 185; Plants - 64; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).
AT4G30390AT4G30390.1CCGCGTTACGCGTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 13 Blast hits to 13 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G30410AT4G30410.1TCAAAACGtranscription factor; FUNCTIONS IN: transcription factor activity; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57780.1); Has 76 Blast hits to 76 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT4G30410.2TCAAAACGtranscription factor; FUNCTIONS IN: transcription factor activity; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57780.1); Has 76 Blast hits to 76 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT4G30570AT4G30570.1TAAAACGCTGGDP-mannose pyrophosphorylase, putative; FUNCTIONS IN: transferase activity, nucleotidyltransferase activity; INVOLVED IN: biosynthetic process; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Trimeric LpxA-like (InterPro:IPR011004), Bacterial transferase hexapeptide repeat (InterPro:IPR001451), Nucleotidyl transferase (InterPro:IPR005835); BEST Arabidopsis thaliana protein match is: CYT1 (CYTOKINESIS DEFECTIVE 1); mannose-1-phosphate guanylyltransferase/ nucleotidyltransferase (TAIR:AT2G39770.1); Has 12903 Blast hits to 12895 proteins in 1604 species: Archae - 523; Bacteria - 7994; Metazoa - 333; Fungi - 194; Plants - 189; Viruses - 0; Other Eukaryotes - 3670 (source: NCBI BLink).
AT4G30580AT4G30580.1AAAACGGCAEncodes a plastidic lysophosphatidic acid acyltransferase (LPAAT). Is critical for chloroplasts phosphatidic acid biosynthesis. The null allele is embryo lethal.
AT4G30660AT4G30660.1TCAAAACGhydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT4G30660.2TCAAAACGhydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT4G30935AT4G30935.1CAAAACGCAGCGTTTmember of WRKY Transcription Factor; Group I
AT4G30996AT4G30996.1TCAAAACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1068 (InterPro:IPR010471); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24290.1); Has 51 Blast hits to 51 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT4G31010AT4G31010.1TTAAAGGCCRNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G31010.2TTAAAGGCCRNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G31150AT4G31150.1AAACGGCGendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31150.1ATAATGGGCCTTTTAAAGGCCCendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31150.2AAACGGCGendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31150.2ATAATGGGCCTTTTAAAGGCCCendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31180AT4G31180.1GGGTCAAAACGaspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink).
AT4G31180.2GGGTCAAAACGaspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, aspartyl-tRNA aminoacylation; LOCATED IN: chloroplast, cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G26870.1); Has 17233 Blast hits to 14062 proteins in 1714 species: Archae - 297; Bacteria - 9930; Metazoa - 655; Fungi - 618; Plants - 225; Viruses - 0; Other Eukaryotes - 5508 (source: NCBI BLink).
AT4G31290AT4G31290.1CGAACCGAAACGACGCCGTTChaC-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ChaC-like protein (InterPro:IPR006840); BEST Arabidopsis thaliana protein match is: ChaC-like family protein (TAIR:AT5G26220.1); Has 1092 Blast hits to 1086 proteins in 379 species: Archae - 0; Bacteria - 540; Metazoa - 194; Fungi - 85; Plants - 75; Viruses - 0; Other Eukaryotes - 198 (source: NCBI BLink).
AT4G31330AT4G31330.1AAAACGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10580.1); Has 252 Blast hits to 252 proteins in 85 species: Archae - 0; Bacteria - 139; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT4G31360AT4G31360.1CAGCGTTTselenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT4G31360.1GCGTTTTAselenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT4G31360.1TCAAAACGselenium binding; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: selenium binding (TAIR:AT2G24440.1); Has 199 Blast hits to 172 proteins in 52 species: Archae - 0; Bacteria - 2; Metazoa - 101; Fungi - 17; Plants - 36; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT4G31700AT4G31700.1AAAACGGCCCATATAEncodes a putative ribosomal protein S6 (rps6).
AT4G31700.2AAAACGGCCCATATAEncodes a putative ribosomal protein S6 (rps6).
AT4G31770AT4G31770.1CGCGTTTTcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, hydrolase activity, acting on ester bonds, protein serine/threonine phosphatase activity; INVOLVED IN: mRNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lariat debranching enzyme, C-terminal (InterPro:IPR007708), Metallophosphoesterase (InterPro:IPR004843); Has 452 Blast hits to 397 proteins in 153 species: Archae - 0; Bacteria - 12; Metazoa - 181; Fungi - 155; Plants - 28; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT4G31840AT4G31840.1TAAACGGCplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT2G25060.1); Has 804 Blast hits to 795 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 804; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G32060AT4G32060.1AAACGCGTTTTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT4G32060.2AAACGCGTTTTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); Has 902 Blast hits to 878 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 729; Fungi - 55; Plants - 46; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
AT4G32160