version

Summary of ACCCCT (All List)

Organism Arabidopsis thaliana
PPDB Motif ACCCCT
Description function unknown
Total Entry Count 279

Entry Sequences (279 entries)

LocusGene modelSequenceDescription
AT1G01260AT1G01260.1TAAGGGGTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT1G01260.2TAAGGGGTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT1G01370AT1G01370.1AGGGGTAAEncodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells.
AT1G01370.2AGGGGTAAEncodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells.
AT1G02450AT1G02450.1TTACCCCTNIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression.
AT1G02750AT1G02750.1ACCCCTGAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03080AT1G03080.1TCAGGGGTAAATGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin (InterPro:IPR009053), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 169162 Blast hits to 69460 proteins in 2232 species: Archae - 2114; Bacteria - 24914; Metazoa - 82448; Fungi - 11850; Plants - 6375; Viruses - 760; Other Eukaryotes - 40701 (source: NCBI BLink).
AT1G03200AT1G03200.1GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03240.1); Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G03470AT1G03470.1TAAGGGGTkinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G03470.2TAAGGGGTkinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G04570AT1G04570.1ACCCCTTAintegral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Biopterin transport-related protein BT1 (InterPro:IPR004324), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT2G33280.1); Has 457 Blast hits to 455 proteins in 149 species: Archae - 6; Bacteria - 186; Metazoa - 0; Fungi - 8; Plants - 126; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).
AT1G04590AT1G04590.1TTACCCCTFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04590.2TTACCCCTFUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G18975.3); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT1G04810AT1G04810.1GGGGTATT26S proteasome regulatory subunit, putative; FUNCTIONS IN: enzyme regulator activity, binding; INVOLVED IN: protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, base subcomplex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-like helical (InterPro:IPR011989), Proteasome/cyclosome, regulatory subunit (InterPro:IPR002015), Armadillo-type fold (InterPro:IPR016024), 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit (InterPro:IPR016642); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (TAIR:AT2G32730.1); Has 813 Blast hits to 749 proteins in 190 species: Archae - 12; Bacteria - 25; Metazoa - 307; Fungi - 211; Plants - 86; Viruses - 0; Other Eukaryotes - 172 (source: NCBI BLink).
AT1G04990AT1G04990.1AGGGGTAAzinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: ZFN2 (ZINC FINGER NUCLEASE 2); DNA binding / nuclease/ nucleic acid binding (TAIR:AT2G32930.1); Has 1255 Blast hits to 799 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 533; Fungi - 168; Plants - 432; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink).
AT1G04990.2AGGGGTAAzinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: ZFN2 (ZINC FINGER NUCLEASE 2); DNA binding / nuclease/ nucleic acid binding (TAIR:AT2G32930.1); Has 1255 Blast hits to 799 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 533; Fungi - 168; Plants - 432; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink).
AT1G05510AT1G05510.1TAAGGGGTProtein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT1G07700AT1G07700.1ACCCCTGAthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).
AT1G07700.2ACCCCTGAthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).
AT1G07700.3ACCCCTGAthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink).
AT1G10550AT1G10550.1TTACCCCTEncodes a membrane-localized protein that is predicted to function during cell wall modification.Overexpression of XTH33 results in abnormal cell morphology. It's expression is under epigenetic control by ATX1.
AT1G11480AT1G11480.1AATACCCCeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G11480.2AATACCCCeukaryotic translation initiation factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 308 Blast hits to 286 proteins in 90 species: Archae - 0; Bacteria - 15; Metazoa - 157; Fungi - 47; Plants - 34; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT1G16900AT1G16900.1GGGGTATTTcurculin-like (mannose-binding) lectin family protein, very low similarity to Ser Thr protein kinase GI:2598067 from (Zea mays); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein
AT1G17520AT1G17520.1TTTGACCCCTTADNA-binding protein, putative; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 6 processes; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Histone H1/H5 (InterPro:IPR005818), Homeodomain-related (InterPro:IPR012287), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / histone H1/H5 family protein (TAIR:AT1G72740.1); Has 615 Blast hits to 611 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 63; Plants - 394; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT1G17530AT1G17530.1TAAGGGGTCAAAEncodes a translocase of inner mitochondrial membrane.
AT1G17730AT1G17730.1TCAGGGGTCAAAVACUOLAR PROTEIN SORTING 46.1 (VPS46.1); INVOLVED IN: vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Snf7 (InterPro:IPR005024); BEST Arabidopsis thaliana protein match is: VPS46.2 (TAIR:AT1G73030.1); Has 975 Blast hits to 975 proteins in 162 species: Archae - 2; Bacteria - 0; Metazoa - 421; Fungi - 185; Plants - 220; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).
AT1G17860AT1G17860.1TCAGGGGTtrypsin and protease inhibitor family protein / Kunitz family protein; FUNCTIONS IN: endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I3, Kunitz legume (InterPro:IPR002160), Kunitz inhibitor ST1-like (InterPro:IPR011065); BEST Arabidopsis thaliana protein match is: trypsin and protease inhibitor family protein / Kunitz family protein (TAIR:AT1G73260.1); Has 508 Blast hits to 508 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 507; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G19730AT1G19730.1AGGGGTAAencodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells.
AT1G19740AT1G19740.1TTACCCCTATP-dependent protease La (LON) domain-containing protein; FUNCTIONS IN: ATP-dependent peptidase activity; INVOLVED IN: ATP-dependent proteolysis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S16, lon N-terminal (InterPro:IPR003111); BEST Arabidopsis thaliana protein match is: ATP-dependent protease La (LON) domain-containing protein (TAIR:AT1G75460.1); Has 2910 Blast hits to 2910 proteins in 574 species: Archae - 0; Bacteria - 1078; Metazoa - 141; Fungi - 27; Plants - 64; Viruses - 0; Other Eukaryotes - 1600 (source: NCBI BLink).
AT1G19830AT1G19830.1AAATACCCCauxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT1G75580.1); Has 651 Blast hits to 640 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 650; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G20810AT1G20810.1AGGGGTAAimmunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid lumen, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT3G10060.1); Has 1226 Blast hits to 1216 proteins in 397 species: Archae - 0; Bacteria - 652; Metazoa - 72; Fungi - 47; Plants - 158; Viruses - 0; Other Eukaryotes - 297 (source: NCBI BLink).
AT1G22050AT1G22050.1AGGGGTAAMEMBRANE-ANCHORED UBIQUITIN-FOLD PROTEIN 6 PRECURSOR (MUB6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-anchored ubiquitin-fold protein, HCG-1 (InterPro:IPR017000), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: MUB5 (MEMBRANE-ANCHORED UBIQUITIN-FOLD PROTEIN 5 PRECURSOR) (TAIR:AT1G77870.1); Has 98 Blast hits to 98 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22930AT1G22930.1GGGGTATTT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink).
AT1G22930.2GGGGTATTT-complex protein 11; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT4G09150.1); Has 8706 Blast hits to 5954 proteins in 561 species: Archae - 13; Bacteria - 948; Metazoa - 3901; Fungi - 587; Plants - 246; Viruses - 12; Other Eukaryotes - 2999 (source: NCBI BLink).
AT1G23490AT1G23490.1GGGGTATTGene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.
AT1G24240AT1G24240.1TCAGGGGTribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT4G11630.1); Has 5360 Blast hits to 5360 proteins in 1482 species: Archae - 0; Bacteria - 2918; Metazoa - 87; Fungi - 39; Plants - 95; Viruses - 0; Other Eukaryotes - 2221 (source: NCBI BLink).
AT1G24530AT1G24530.1GGGGTATTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G24130.1); Has 34934 Blast hits to 16363 proteins in 585 species: Archae - 32; Bacteria - 4633; Metazoa - 14827; Fungi - 7171; Plants - 3064; Viruses - 0; Other Eukaryotes - 5207 (source: NCBI BLink).
AT1G26250AT1G26250.1TAAGGGGTproline-rich extensin, putative; FUNCTIONS IN: structural constituent of cell wall; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Extensin-like region (InterPro:IPR006706); Has 254179 Blast hits to 36300 proteins in 1345 species: Archae - 786; Bacteria - 38672; Metazoa - 98390; Fungi - 32269; Plants - 40660; Viruses - 7285; Other Eukaryotes - 36117 (source: NCBI BLink).
AT1G26470AT1G26470.1ACCCCTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, H4/H2A histone acetyltransferase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CT20 (InterPro:IPR012423); Has 39 Blast hits to 39 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G28580AT1G28580.2GGGGTATTTGDSL-motif lipase, putative; FUNCTIONS IN: lipase activity, hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase, putative (TAIR:AT1G28570.1); Has 1868 Blast hits to 1834 proteins in 164 species: Archae - 0; Bacteria - 265; Metazoa - 1; Fungi - 5; Plants - 1584; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT1G29460AT1G29460.1AATACCCCauxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: mitochondrion; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29440.1); Has 389 Blast hits to 380 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 389; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G31320AT1G31320.1TAAGGGGTAALOB DOMAIN-CONTAINING PROTEIN 4 (LBD4); INVOLVED IN: biological_process unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: ASL5; DNA binding / protein binding (TAIR:AT2G30130.1); Has 595 Blast hits to 592 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 595; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G33250AT1G33250.1ACCCCTGAAAAGTCAAfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G49180AT1G49180.1TTACCCCTprotein kinase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G37840.1); Has 95086 Blast hits to 93483 proteins in 3039 species: Archae - 69; Bacteria - 8399; Metazoa - 40703; Fungi - 8597; Plants - 18649; Viruses - 499; Other Eukaryotes - 18170 (source: NCBI BLink).
AT1G49340AT1G49340.1TTACCCCTEncodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots.
AT1G49340.2TTACCCCTEncodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots.
AT1G49670AT1G49670.1ACCCCTTAmolecular function has not been defined. Was shown involved in oxidative stress tolerance.
AT1G52320AT1G52320.2ATCCACGTCATTACCCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF630 (InterPro:IPR006868), Protein of unknown function DUF632 (InterPro:IPR006867); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25590.1); Has 8111 Blast hits to 6764 proteins in 511 species: Archae - 9; Bacteria - 475; Metazoa - 3444; Fungi - 1217; Plants - 1004; Viruses - 207; Other Eukaryotes - 1755 (source: NCBI BLink).
AT1G52590AT1G52590.1TTACCCCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink).
AT1G52600AT1G52600.1AGGGGTAAsignal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT1G55675AT1G55675.1AGGGGTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G57660AT1G57660.1AGGGGTAA60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G61360AT1G61360.2AGGGGTAAS-locus lectin protein kinase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), Protein kinase, ATP binding site (InterPro:IPR017441), PAN-like, type 2 (InterPro:IPR013227), Apple-like (InterPro:IPR003609), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858), EGF (InterPro:IPR006210); BEST Arabidopsis thaliana protein match is: SD1-29 (S-DOMAIN-1 29); carbohydrate binding / kinase/ protein kinase (TAIR:AT1G61380.1); Has 90844 Blast hits to 89410 proteins in 3263 species: Archae - 63; Bacteria - 7784; Metazoa - 39638; Fungi - 7233; Plants - 20141; Viruses - 449; Other Eukaryotes - 15536 (source: NCBI BLink).
AT1G61570AT1G61570.1ACCCCTGAEncodes a putative small zinc finger-like protein (TIM13); nucleus-encoded gene whose product is found in the mitochondrial inner membrane space.
AT1G63720AT1G63720.1TTACCCCTEXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 406 Blast hits to 313 proteins in 78 species: Archae - 0; Bacteria - 2; Metazoa - 123; Fungi - 81; Plants - 111; Viruses - 14; Other Eukaryotes - 75 (source: NCBI BLink).
AT1G64640AT1G64640.1TCAGGGGTplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT3G20570.1); Has 733 Blast hits to 725 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 733; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G65840AT1G65840.1AGGGGTAAencodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes.
AT1G67360AT1G67360.1AATACCCCrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G67360.2AATACCCCrubber elongation factor (REF) family protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rubber elongation factor (InterPro:IPR008802); BEST Arabidopsis thaliana protein match is: rubber elongation factor (REF) protein-related (TAIR:AT2G47780.1); Has 76 Blast hits to 76 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 76; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G69870AT1G69870.1ACCCCTTAproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: response to salt stress, oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: NRT1.6 (NITRATE TRANSPORTER 1.6); low affinity nitrate transmembrane transporter/ transporter (TAIR:AT1G27080.1); Has 2739 Blast hits to 2630 proteins in 509 species: Archae - 0; Bacteria - 693; Metazoa - 468; Fungi - 272; Plants - 1130; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink).
AT1G70530AT1G70530.1AATACCCCprotein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Protein of unknown function DUF26 (InterPro:IPR002902), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G40380.1); Has 86025 Blast hits to 84934 proteins in 3436 species: Archae - 55; Bacteria - 7756; Metazoa - 37741; Fungi - 6539; Plants - 18862; Viruses - 424; Other Eukaryotes - 14648 (source: NCBI BLink).
AT1G71692AT1G71692.1ACCCCTTAEncodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots.
AT1G72140AT1G72140.1AGGGGTAAproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport, response to nematode; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT1G22540.1); Has 4291 Blast hits to 4187 proteins in 759 species: Archae - 0; Bacteria - 1913; Metazoa - 527; Fungi - 296; Plants - 1112; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink).
AT1G78040AT1G78040.1AAATACCCCpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78040.2AAATACCCCpollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G78700AT1G78700.1AGGGGTAAbrassinosteroid signalling positive regulator-related; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: brassinosteroid signalling positive regulator-related (TAIR:AT4G18890.1); Has 3132 Blast hits to 468 proteins in 84 species: Archae - 0; Bacteria - 18; Metazoa - 271; Fungi - 99; Plants - 190; Viruses - 0; Other Eukaryotes - 2554 (source: NCBI BLink).
AT1G79060AT1G79060.1ACCCCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56020.1); Has 3270 Blast hits to 887 proteins in 158 species: Archae - 0; Bacteria - 617; Metazoa - 634; Fungi - 189; Plants - 72; Viruses - 8; Other Eukaryotes - 1750 (source: NCBI BLink).
AT1G79200AT1G79200.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; Has 3292 Blast hits to 2186 proteins in 154 species: Archae - 0; Bacteria - 21; Metazoa - 1599; Fungi - 418; Plants - 200; Viruses - 0; Other Eukaryotes - 1054 (source: NCBI BLink).
AT2G06510AT2G06510.1TAAGGGGTEncodes a homolog of Replication Protein A that is involved in meiosis I in pollen mother cells. rpa1a mutants have a reduced number of class I crossovers. The protein is located in chromatin-associated foci in early leptotene and can be detected in these foci until late pachytene of meiosis I.
AT2G06510.2TAAGGGGTEncodes a homolog of Replication Protein A that is involved in meiosis I in pollen mother cells. rpa1a mutants have a reduced number of class I crossovers. The protein is located in chromatin-associated foci in early leptotene and can be detected in these foci until late pachytene of meiosis I.
AT2G15910AT2G15910.1AGGGGTAACSL zinc finger domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, DPH-type (InterPro:IPR007872); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G44150.1); Has 316 Blast hits to 314 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 111; Fungi - 93; Plants - 69; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink).
AT2G19720AT2G19720.1AAATACCCCribosomal protein S15A B (rps15ab); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8 (InterPro:IPR000630); BEST Arabidopsis thaliana protein match is: rps15ae (ribosomal protein S15A E); structural constituent of ribosome (TAIR:AT4G29430.1); Has 2238 Blast hits to 2238 proteins in 697 species: Archae - 184; Bacteria - 769; Metazoa - 322; Fungi - 129; Plants - 201; Viruses - 0; Other Eukaryotes - 633 (source: NCBI BLink).
AT2G19730AT2G19730.1GGGGTATTT60S ribosomal protein L28 (RPL28A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28e (InterPro:IPR002672); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L28 (RPL28C) (TAIR:AT4G29410.2); Has 369 Blast hits to 369 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 59; Plants - 72; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT2G19730.2GGGGTATTT60S ribosomal protein L28 (RPL28A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28e (InterPro:IPR002672); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L28 (RPL28C) (TAIR:AT4G29410.2); Has 369 Blast hits to 369 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 59; Plants - 72; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT2G19730.3GGGGTATTT60S ribosomal protein L28 (RPL28A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L28e (InterPro:IPR002672); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L28 (RPL28C) (TAIR:AT4G29410.2); Has 369 Blast hits to 369 proteins in 167 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 59; Plants - 72; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink).
AT2G21640AT2G21640.1TAAGGGGTCAAAEncodes a protein of unknown function that is a marker for oxidative stress response.
AT2G28290AT2G28290.1CAAGGCCCATTAAGGGGTEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.
AT2G28290.2CAAGGCCCATTAAGGGGTEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.
AT2G28290.3CAAGGCCCATTAAGGGGTEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity.
AT2G28620AT2G28620.1TAAGGGGTkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT3G45850.1); Has 38255 Blast hits to 26694 proteins in 1178 species: Archae - 315; Bacteria - 3865; Metazoa - 19131; Fungi - 3066; Plants - 1862; Viruses - 111; Other Eukaryotes - 9905 (source: NCBI BLink).
AT2G30470AT2G30470.1AATACCCCHSI2 is a member of a novel family of B3 domain proteins with a sequence similar to the ERF-associated amphiphilic repression (EAR) motif. It functions as an active repressor of the Spo minimal promoter (derived from a gene for sweet potato sporamin A1) through the EAR motif. It contains a plant-specific B3 DNA-binding domain. The Arabidopsis genome contains 42 genes with B3 domains which could be classified into three families that are represented by ABI3, ARF1 and RAV1. HSI2 belongs to the ABI3 family. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50µM ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain.
AT2G32800AT2G32800.1TAAGGGGTAP4.3A; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: lectin protein kinase, putative (TAIR:AT3G53810.1); Has 111168 Blast hits to 73136 proteins in 2997 species: Archae - 51; Bacteria - 9911; Metazoa - 45746; Fungi - 7567; Plants - 30942; Viruses - 390; Other Eukaryotes - 16561 (source: NCBI BLink).
AT2G33250AT2G33250.1TTACCCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G33540AT2G33540.1AAATACCCCC-TERMINAL DOMAIN PHOSPHATASE-LIKE 3 (CPL3); FUNCTIONS IN: phosphoprotein phosphatase activity, CTD phosphatase activity; INVOLVED IN: response to salt stress; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: FCP1-like phosphatase, phosphatase domain (InterPro:IPR011947), NLI interacting factor (InterPro:IPR004274), BRCT (InterPro:IPR001357); BEST Arabidopsis thaliana protein match is: CPL4 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 4); phosphoprotein phosphatase (TAIR:AT5G58003.1); Has 1270 Blast hits to 886 proteins in 180 species: Archae - 0; Bacteria - 80; Metazoa - 438; Fungi - 191; Plants - 138; Viruses - 2; Other Eukaryotes - 421 (source: NCBI BLink).
AT2G34470AT2G34470.1GGGGTATTEncodes a urease accessory protein which is essential for the activation of plant urease.
AT2G34470.2GGGGTATTEncodes a urease accessory protein which is essential for the activation of plant urease.
AT2G34650AT2G34650.1AAATACCCCEncodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID.
AT2G34730AT2G34730.1AGGGGTAAmyosin heavy chain-related; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: CIP1 (COP1-INTERACTIVE PROTEIN 1); protein binding (TAIR:AT5G41790.1); Has 62301 Blast hits to 34781 proteins in 1535 species: Archae - 852; Bacteria - 6591; Metazoa - 32389; Fungi - 4577; Plants - 2292; Viruses - 390; Other Eukaryotes - 15210 (source: NCBI BLink).
AT2G36390AT2G36390.1AGGGGTAAEncodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues.
AT2G39650AT2G39650.1TTACCCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 215 Blast hits to 215 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 213; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G40800AT2G40800.1TTACCCCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G42500AT2G42500.1GGGGTATTencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A.
AT2G42500.2GGGGTATTencodes the fourth isoform of the catalytic subunit of protein phosphatase 2A.
AT2G42840AT2G42840.1GGGGTATTAAATGGGEncodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of vegetative, inflorescence and floral meristems and the protoderm of organ primordia.
AT2G44520AT2G44520.1ACCCCTGAcytochrome c oxidase 10 (COX10); FUNCTIONS IN: protoheme IX farnesyltransferase activity, prenyltransferase activity; INVOLVED IN: heme biosynthetic process; LOCATED IN: integral to membrane, mitochondrial membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protohaem IX farnesyltransferase, mitochondria (InterPro:IPR016315), Protohaem IX farnesyltransferase (InterPro:IPR006369), UbiA prenyltransferase (InterPro:IPR000537); Has 6172 Blast hits to 6172 proteins in 1140 species: Archae - 109; Bacteria - 2789; Metazoa - 160; Fungi - 121; Plants - 40; Viruses - 0; Other Eukaryotes - 2953 (source: NCBI BLink).
AT2G47110AT2G47110.1AGGGGTAATTACGpolyubiquitin gene
AT3G01340AT3G01340.1GGGGTATTprotein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink).
AT3G01340.2GGGGTATTprotein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink).
AT3G01345AT3G01345.1AATACCCCExpressed protein; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28919.1); Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G02350AT3G02350.1TAAGGGGTEncodes a protein with putative galacturonosyltransferase activity.
AT3G02620AT3G02620.1AGGGGTAAacyl-(acyl-carrier-protein) desaturase, putative / stearoyl-ACP desaturase, putative; FUNCTIONS IN: acyl-[acyl-carrier-protein] desaturase activity, oxidoreductase activity, transition metal ion binding; INVOLVED IN: fatty acid metabolic process, fatty acid biosynthetic process; CONTAINS InterPro DOMAIN/s: Ribonucleotide reductase-related (InterPro:IPR012348), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078), Fatty acid desaturase, type 2 (InterPro:IPR005067); BEST Arabidopsis thaliana protein match is: acyl-[acyl-carrier-protein] desaturase/ oxidoreductase/ transition metal ion binding (TAIR:AT3G02610.1); Has 576 Blast hits to 573 proteins in 126 species: Archae - 0; Bacteria - 209; Metazoa - 2; Fungi - 0; Plants - 312; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink).
AT3G04600AT3G04600.1AGGGGTAAtRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink).
AT3G04600.2AGGGGTAAtRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink).
AT3G04600.3AGGGGTAAtRNA synthetase class I (W and Y) family protein; FUNCTIONS IN: tryptophan-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: tryptophanyl-tRNA aminoacylation, tRNA aminoacylation for protein translation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tryptophanyl-tRNA synthetase, class Ib (InterPro:IPR002306), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 1506 Blast hits to 1455 proteins in 455 species: Archae - 300; Bacteria - 400; Metazoa - 288; Fungi - 155; Plants - 31; Viruses - 5; Other Eukaryotes - 327 (source: NCBI BLink).
AT3G05060AT3G05060.1AAATACCCCTTASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein
AT3G05070AT3G05070.1TAAGGGGTATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink).
AT3G05270AT3G05270.1GGGGTATTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF869, plant (InterPro:IPR008587); BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT1G77580.2); Has 97002 Blast hits to 49715 proteins in 2003 species: Archae - 1158; Bacteria - 12418; Metazoa - 49297; Fungi - 7501; Plants - 3801; Viruses - 453; Other Eukaryotes - 22374 (source: NCBI BLink).
AT3G05270.2GGGGTATTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF869, plant (InterPro:IPR008587); BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT1G77580.2); Has 97002 Blast hits to 49715 proteins in 2003 species: Archae - 1158; Bacteria - 12418; Metazoa - 49297; Fungi - 7501; Plants - 3801; Viruses - 453; Other Eukaryotes - 22374 (source: NCBI BLink).
AT3G06150AT3G06150.1TCAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19060.1); Has 18 Blast hits to 18 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G11880AT3G11880.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70770.1); Has 64 Blast hits to 63 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G12250AT3G12250.1AGGGGTAAbasic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT3G12250.2AGGGGTAAbasic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT3G12250.4AGGGGTAAbasic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT3G12560AT3G12560.1TAAGGGGTEncodes a telomeric DNA-binding protein.
AT3G13235AT3G13235.1TCAGGGGTubiquitin family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: response to cadmium ion; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Peptidase A2A, retrovirus, catalytic (InterPro:IPR001995), Peptidase aspartic, catalytic (InterPro:IPR009007), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); Has 6366 Blast hits to 3177 proteins in 509 species: Archae - 0; Bacteria - 2; Metazoa - 2716; Fungi - 819; Plants - 1543; Viruses - 81; Other Eukaryotes - 1205 (source: NCBI BLink).
AT3G13920AT3G13920.1AGGGGTAAAACCGGAAAeukaryotic translation initiation factor 4A-1
AT3G13920.2AGGGGTAAAACCGGAAAeukaryotic translation initiation factor 4A-1
AT3G13920.3AGGGGTAAAACCGGAAAeukaryotic translation initiation factor 4A-1
AT3G14172AT3G14172.1TTACCCCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 2665 Blast hits to 1956 proteins in 215 species: Archae - 2; Bacteria - 189; Metazoa - 878; Fungi - 141; Plants - 132; Viruses - 5; Other Eukaryotes - 1318 (source: NCBI BLink).
AT3G14180AT3G14180.1TTACCCCTtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT3G14180.1TTACCCCTAAACCGAtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT3G14240AT3G14240.1GGGGTATTTsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: SLP2; serine-type peptidase (TAIR:AT4G34980.1); Has 5240 Blast hits to 4507 proteins in 782 species: Archae - 159; Bacteria - 2860; Metazoa - 145; Fungi - 483; Plants - 911; Viruses - 0; Other Eukaryotes - 682 (source: NCBI BLink).
AT3G14660AT3G14660.1TCAGGGGTputative cytochrome P450
AT3G14680AT3G14680.1TCAGGGGTputative cytochrome P450
AT3G14760AT3G14760.1AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.04 four leaves visible, LP.02 two leaves visible; Has 31 Blast hits to 31 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G15095AT3G15095.1GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink).
AT3G15095.2GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink).
AT3G15095.3GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9532 Blast hits to 5756 proteins in 534 species: Archae - 60; Bacteria - 889; Metazoa - 3753; Fungi - 648; Plants - 278; Viruses - 137; Other Eukaryotes - 3767 (source: NCBI BLink).
AT3G17910AT3G17910.1AATACCCCSurfeit 1 (SURF1) mRNA. Similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly.
AT3G19540AT3G19540.1ACCCCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF620 (InterPro:IPR006873); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G49840.1); Has 153 Blast hits to 150 proteins in 31 species: Archae - 0; Bacteria - 3; Metazoa - 14; Fungi - 12; Plants - 117; Viruses - 5; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G22630AT3G22630.1AAATACCCCTGAEncodes 20S proteasome beta subunit PBD1 (PBD1).
AT3G23290AT3G23290.2AAATACCCCTTALIGHT SENSITIVE HYPOCOTYLS 4 (LSH4); EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH3 (LIGHT SENSITIVE HYPOCOTYLS 3) (TAIR:AT2G31160.1); Has 185 Blast hits to 185 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G23460AT3G23460.1GGGGTATTcyclopropane fatty acid synthase-related; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity; INVOLVED IN: lipid biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: male gametophyte, sepal, carpel; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: cyclopropane fatty acid synthase, putative / CPA-FA synthase, putative (TAIR:AT3G23510.1); Has 5948 Blast hits to 4401 proteins in 639 species: Archae - 0; Bacteria - 2541; Metazoa - 5; Fungi - 55; Plants - 84; Viruses - 0; Other Eukaryotes - 3263 (source: NCBI BLink).
AT3G23910AT3G23910.1TCAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G24255.2); Has 456 Blast hits to 427 proteins in 106 species: Archae - 19; Bacteria - 37; Metazoa - 146; Fungi - 47; Plants - 55; Viruses - 6; Other Eukaryotes - 146 (source: NCBI BLink).
AT3G24530AT3G24530.1AGGGGTAAAAA-type ATPase family protein / ankyrin repeat family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; INVOLVED IN: protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, core (InterPro:IPR003959), CbxX/CfqX (InterPro:IPR000641), Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 51244 Blast hits to 21153 proteins in 1023 species: Archae - 234; Bacteria - 4272; Metazoa - 26202; Fungi - 3227; Plants - 1610; Viruses - 559; Other Eukaryotes - 15140 (source: NCBI BLink).
AT3G26120AT3G26120.1GGGGTATTSimilar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins.
AT3G27090AT3G27090.1GGGGTATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Development and cell death domain (InterPro:IPR013989), Kelch related (InterPro:IPR013089); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42050.1); Has 642 Blast hits to 564 proteins in 35 species: Archae - 0; Bacteria - 2; Metazoa - 12; Fungi - 0; Plants - 155; Viruses - 0; Other Eukaryotes - 473 (source: NCBI BLink).
AT3G27830AT3G27830.1AAATACCCC50S ribosomal protein L12-A
AT3G27850AT3G27850.1AAATACCCCTTA50S ribosomal protein L12-C
AT3G46830AT3G46830.1AATACCCCARABIDOPSIS RAB GTPASE HOMOLOG A2C (ATRABA2C); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: endosome, plasma membrane, cell plate; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: ATRABA2D (HOARABIDOPSIS RAB GTPASE HOMOLOG A2D); GTP binding (TAIR:AT5G59150.1); Has 23118 Blast hits to 23078 proteins in 640 species: Archae - 19; Bacteria - 105; Metazoa - 12740; Fungi - 3037; Plants - 2133; Viruses - 19; Other Eukaryotes - 5065 (source: NCBI BLink).
AT3G48185AT3G48185.1TTACCCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G49530AT3G49530.1TTACCCCTArabidopsis NAC domain containing protein 62 (anac062); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to chitin; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: TIP (TCV-INTERACTING PROTEIN); transcription coactivator/ transcription factor (TAIR:AT5G24590.2); Has 1568 Blast hits to 1566 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1568; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G51160AT3G51160.1AAATACCCCCatalyzes the first step in the de novo synthesis of GDP-L-fucose.
AT3G52930AT3G52930.1TAAGGGGTfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, response to salt stress, pentose-phosphate shunt; LOCATED IN: in 7 components; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4403 Blast hits to 4398 proteins in 740 species: Archae - 0; Bacteria - 427; Metazoa - 1257; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2378 (source: NCBI BLink).
AT3G52930.1TTACCCCTfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, response to salt stress, pentose-phosphate shunt; LOCATED IN: in 7 components; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4403 Blast hits to 4398 proteins in 740 species: Archae - 0; Bacteria - 427; Metazoa - 1257; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2378 (source: NCBI BLink).
AT3G53370AT3G53370.1TAAGGGGTDNA-binding S1FA family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA binding protein S1FA (InterPro:IPR006779); Has 54 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G54190AT3G54190.1ACCCCTTAAACGCTGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink).
AT3G54340AT3G54340.1AGGGGTAAFloral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA.
AT3G56860AT3G56860.1AGGGGTAAencodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.
AT3G56860.2AGGGGTAAencodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.
AT3G56860.3AGGGGTAAencodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus.
AT3G59540AT3G59540.1TTAATGGGCCTAAGGGGT60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink).
AT3G60240AT3G60240.2TTACCCCTprotein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication.
AT3G60240.3TTACCCCTprotein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication.
AT3G60240.4TTACCCCTprotein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication.
AT3G62550AT3G62550.1ACCCCTGAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: ethylene-responsive protein, putative (TAIR:AT1G09740.1); Has 1616 Blast hits to 1599 proteins in 385 species: Archae - 141; Bacteria - 962; Metazoa - 41; Fungi - 11; Plants - 403; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).
AT3G62680AT3G62680.1AATACCCCProline-rich protein
AT3G63210AT3G63210.1TAAGGGGTAAencodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102
AT4G00370AT4G00370.1AATACCCCEncodes an inorganic phosphate transporter (PHT4;4).
AT4G01040AT4G01040.1AGGGGTAAglycosyl hydrolase family 18 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, chitinase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Chitinase II (InterPro:IPR011583), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); Has 455 Blast hits to 452 proteins in 165 species: Archae - 0; Bacteria - 244; Metazoa - 167; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT4G02620AT4G02620.1TCAGGGGTAAvacuolar ATPase subunit F family protein; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V1 complex, subunit F, eukaryotic (InterPro:IPR005772), ATPase, V1/A1 complex, subunit F (InterPro:IPR008218); Has 383 Blast hits to 383 proteins in 165 species: Archae - 24; Bacteria - 0; Metazoa - 178; Fungi - 84; Plants - 34; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).
AT4G04790AT4G04790.1TTACCCCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G21880.1); Has 8701 Blast hits to 4047 proteins in 142 species: Archae - 4; Bacteria - 18; Metazoa - 161; Fungi - 114; Plants - 8118; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink).
AT4G08685AT4G08685.1ATCCACGTCATCAAATACCCCEncodes a protein, expressed in leaves, with similarity to pollen allergens.
AT4G10270AT4G10270.1CCCAATATTACCCCTTAwound-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: wound-responsive protein, putative (TAIR:AT4G10265.1); Has 110 Blast hits to 109 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G11380AT4G11380.1AGGGGTAAbeta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink).
AT4G11980AT4G11980.1ACCCCTTAARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 14 (ATNUDX14); FUNCTIONS IN: hydrolase activity, ADP-sugar diphosphatase activity, ADP-ribose pyrophosphohydrolase activity, ADP-glucose pyrophosphohydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 845 Blast hits to 845 proteins in 388 species: Archae - 4; Bacteria - 636; Metazoa - 8; Fungi - 51; Plants - 17; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).
AT4G12040AT4G12040.1TTACCCCTzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G22820.2); Has 767 Blast hits to 766 proteins in 111 species: Archae - 2; Bacteria - 0; Metazoa - 379; Fungi - 2; Plants - 271; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink).
AT4G12040.2TTACCCCTzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G22820.2); Has 767 Blast hits to 766 proteins in 111 species: Archae - 2; Bacteria - 0; Metazoa - 379; Fungi - 2; Plants - 271; Viruses - 6; Other Eukaryotes - 107 (source: NCBI BLink).
AT4G12450AT4G12450.1AGGGGTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22560.1); Has 107 Blast hits to 107 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 2; Plants - 103; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT4G13010AT4G13010.1TTACCCCTTAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink).
AT4G14800AT4G14800.1AAATACCCCTGAEncodes 20S proteasome beta subunit PBD2 (PBD2).
AT4G16370AT4G16370.1AGGGGTAAEncodes an oligopeptide transporter involved in metal homeostasis.
AT4G18205AT4G18205.1GGGGTATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: PUP7 (PURINE PERMEASE 7); purine transmembrane transporter (TAIR:AT4G18197.1); Has 282 Blast hits to 276 proteins in 29 species: Archae - 0; Bacteria - 8; Metazoa - 0; Fungi - 22; Plants - 229; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT4G18730AT4G18730.1TCAGGGGTencodes a cytosolic ribosomal protein L16, which is a constituent of 60S large ribosomal complex. Gene is expressed in root and shoot apical meristems and in lateral root primordia. Expression in lateral root primordia is induced by auxin.
AT4G18800AT4G18800.1ACCCCTGAARABIDOPSIS RAB GTPASE HOMOLOG A1D (ATRABA1D); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1c (Arabidopsis Rab GTPase homolog A1c); GTP binding (TAIR:AT5G45750.1); Has 22463 Blast hits to 22423 proteins in 614 species: Archae - 17; Bacteria - 112; Metazoa - 12475; Fungi - 2938; Plants - 1917; Viruses - 19; Other Eukaryotes - 4985 (source: NCBI BLink).
AT4G20260AT4G20260.1AGGGGTAAEncodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.
AT4G20260.2AGGGGTAAEncodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.
AT4G20260.3AGGGGTAAEncodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.
AT4G20260.4AGGGGTAAEncodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels.
AT4G20930AT4G20930.1TAAGGGGT3-hydroxyisobutyrate dehydrogenase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, valine catabolic process, metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), 3-hydroxyisobutyrate dehydrogenase (InterPro:IPR011548), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: GLYR2 (GLYOXYLATE REDUCTASE 2); glyoxylate reductase (NADP)/ phosphogluconate dehydrogenase (decarboxylating) (TAIR:AT1G17650.1); Has 10362 Blast hits to 10344 proteins in 1053 species: Archae - 94; Bacteria - 4661; Metazoa - 269; Fungi - 232; Plants - 134; Viruses - 2; Other Eukaryotes - 4970 (source: NCBI BLink).
AT4G22320AT4G22320.1TCAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55210.1); Has 9841 Blast hits to 5053 proteins in 396 species: Archae - 29; Bacteria - 556; Metazoa - 3805; Fungi - 755; Plants - 226; Viruses - 158; Other Eukaryotes - 4312 (source: NCBI BLink).
AT4G22330AT4G22330.1AATACCCCEncodes AtCES1 for Acyl-CoA independent ceramide synthase.
AT4G24840AT4G24840.1TAAGGGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).
AT4G25670AT4G25670.1TAAGGGGTunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25690.2); Has 46 Blast hits to 40 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 38; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT4G27270AT4G27270.1TTACCCCTquinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: FQR1 (FLAVODOXIN-LIKE QUINONE REDUCTASE 1); FMN binding / oxidoreductase, acting on NADH or NADPH, quinone or similar compound as acceptor (TAIR:AT5G54500.1); Has 2198 Blast hits to 2196 proteins in 677 species: Archae - 49; Bacteria - 1577; Metazoa - 2; Fungi - 180; Plants - 120; Viruses - 1; Other Eukaryotes - 269 (source: NCBI BLink).
AT4G27280AT4G27280.1TTACCCCTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: PBP1 (PINOID-BINDING PROTEIN 1); calcium ion binding / protein binding (TAIR:AT5G54490.1); Has 486 Blast hits to 485 proteins in 125 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 30; Plants - 142; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).
AT4G27840AT4G27840.1GGGGTATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: vesicle-associated membrane protein-related (TAIR:AT5G52990.1); Has 165 Blast hits to 165 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G28470AT4G28470.1AGGGGTAAencoding the RPN subunits of the 26S proteasome
AT4G29740AT4G29740.1TCAGGGGTIt encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.
AT4G29740.2TCAGGGGTIt encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.
AT4G30630AT4G30630.1AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57910.1); Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G31990AT4G31990.1TTACCCCTencodes a plastid-localized aspartate aminotransferase
AT4G31990.2TTACCCCTencodes a plastid-localized aspartate aminotransferase
AT4G31990.3TTACCCCTencodes a plastid-localized aspartate aminotransferase
AT4G32500AT4G32500.1TTACCCCTmember of Stelar K+ outward rectifying channel (SKOR) family
AT4G32600AT4G32600.1AGGGGTAAAGTCAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G80400.1); Has 7180 Blast hits to 7160 proteins in 223 species: Archae - 0; Bacteria - 6; Metazoa - 2398; Fungi - 545; Plants - 2870; Viruses - 33; Other Eukaryotes - 1328 (source: NCBI BLink).
AT4G33700AT4G33700.1GGGGTATTCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT2G14520.1); Has 8185 Blast hits to 8163 proteins in 1404 species: Archae - 64; Bacteria - 5471; Metazoa - 234; Fungi - 109; Plants - 119; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).
AT4G34200AT4G34200.1ACCCCTGAembryo sac development arrest 9 (EDA9); FUNCTIONS IN: ATP binding; INVOLVED IN: megagametogenesis; LOCATED IN: mitochondrion, chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-3-phosphoglycerate dehydrogenase (InterPro:IPR006236), D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), D-3-phosphogylcerate Dehydrogenase (InterPro:IPR015508), Amino acid-binding ACT (InterPro:IPR002912), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: D-3-phosphoglycerate dehydrogenase, putative / 3-PGDH, putative (TAIR:AT3G19480.1); Has 20829 Blast hits to 20828 proteins in 1560 species: Archae - 296; Bacteria - 9792; Metazoa - 668; Fungi - 756; Plants - 318; Viruses - 5; Other Eukaryotes - 8994 (source: NCBI BLink).
AT4G34480AT4G34480.1ACCCCTGAcatalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT2G16230.1); Has 1388 Blast hits to 1379 proteins in 112 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 5; Plants - 1380; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G36390AT4G36390.1TTACCCCTGAradical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), tRNA-i(6)A37 modification enzyme MiaB (InterPro:IPR006463), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT1G72090.1); Has 10307 Blast hits to 10292 proteins in 1299 species: Archae - 219; Bacteria - 4582; Metazoa - 258; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 5193 (source: NCBI BLink).
AT4G36400AT4G36400.1TCAGGGGTAAFAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink).
AT4G36400.2TCAGGGGTAAFAD linked oxidase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), FAD-linked oxidase, C-terminal (InterPro:IPR004113), FAD-linked oxidase-like, C-terminal (InterPro:IPR016164), FAD linked oxidase, N-terminal (InterPro:IPR006094), FAD-binding, type 2, subdomain 1 (InterPro:IPR016167); BEST Arabidopsis thaliana protein match is: FAD linked oxidase family protein (TAIR:AT5G06580.1); Has 12154 Blast hits to 12076 proteins in 1151 species: Archae - 141; Bacteria - 6321; Metazoa - 332; Fungi - 395; Plants - 69; Viruses - 0; Other Eukaryotes - 4896 (source: NCBI BLink).
AT4G39080AT4G39080.1AGGGGTAAVacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast.
AT4G39220AT4G39220.1TAAGGGGTKey player of retrieval of ER membrane proteins
AT4G39350AT4G39350.1TCAGGGGTEncodes a cellulose synthase isomer, related to CESA6.
AT4G39980AT4G39980.1AAATACCCCEncodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae.
AT5G02530AT5G02530.1TCAGGGGTRNA and export factor-binding protein, putative; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA and export factor-binding protein, putative (TAIR:AT5G59950.4); Has 10734 Blast hits to 7876 proteins in 597 species: Archae - 2; Bacteria - 1111; Metazoa - 4776; Fungi - 1622; Plants - 1564; Viruses - 50; Other Eukaryotes - 1609 (source: NCBI BLink).
AT5G02580AT5G02580.1AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G02580.2AATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G04060AT5G04060.1AGGGGTAAdehydration-responsive protein-related; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT3G10200.1); Has 600 Blast hits to 593 proteins in 92 species: Archae - 0; Bacteria - 130; Metazoa - 3; Fungi - 4; Plants - 446; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT5G05730AT5G05730.1TAAGGGGTATTASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots.
AT5G06450AT5G06450.1ACCCCTTAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT3G11770.1); Has 41 Blast hits to 41 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G06700AT5G06700.1GGGGTATTTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF231, plant (InterPro:IPR004253); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12060.1); Has 17239 Blast hits to 5249 proteins in 395 species: Archae - 12; Bacteria - 1942; Metazoa - 4813; Fungi - 2412; Plants - 768; Viruses - 494; Other Eukaryotes - 6798 (source: NCBI BLink).
AT5G07190AT5G07190.1TAAGGGGTGene is expressed preferentially in the embryo and encodes a unique protein of unknown function.
AT5G07190.2TAAGGGGTGene is expressed preferentially in the embryo and encodes a unique protein of unknown function.
AT5G07440AT5G07440.1TAAGGGGTAAEncodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells.
AT5G07440.2TAAGGGGTAAEncodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells.
AT5G07440.3TAAGGGGTAAEncodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells.
AT5G08380AT5G08380.1AGGGGTAAArabidopsis thaliana ALPHA-GALACTOSIDASE 1 (AtAGAL1); FUNCTIONS IN: alpha-galactosidase activity, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process, lactose catabolic process; LOCATED IN: apoplast, cell wall, plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Glycoside hydrolase, family 27 (InterPro:IPR002241), Glycoside hydrolase, clan GH-D (InterPro:IPR000111), Glycoside hydrolase, catalytic core (InterPro:IPR017853); BEST Arabidopsis thaliana protein match is: AtAGAL2 (Arabidopsis thaliana ALPHA-GALACTOSIDASE 2); alpha-galactosidase/ catalytic/ hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT5G08370.2); Has 933 Blast hits to 930 proteins in 207 species: Archae - 2; Bacteria - 240; Metazoa - 241; Fungi - 192; Plants - 105; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink).
AT5G10070AT5G10070.1AAATACCCCRNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).
AT5G10070.2AAATACCCCRNase L inhibitor protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF367 (InterPro:IPR007177), Possible metal-binding region in RNase L inhibitor, RLI (InterPro:IPR007209); Has 416 Blast hits to 416 proteins in 193 species: Archae - 104; Bacteria - 0; Metazoa - 89; Fungi - 88; Plants - 24; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).
AT5G11500AT5G11500.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF814 (InterPro:IPR008532); Has 474 Blast hits to 464 proteins in 164 species: Archae - 0; Bacteria - 62; Metazoa - 174; Fungi - 86; Plants - 37; Viruses - 1; Other Eukaryotes - 114 (source: NCBI BLink).
AT5G11610AT5G11610.1TAAGGGGTexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 809 Blast hits to 805 proteins in 87 species: Archae - 0; Bacteria - 10; Metazoa - 228; Fungi - 4; Plants - 492; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT5G11610.2TAAGGGGTexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 809 Blast hits to 805 proteins in 87 species: Archae - 0; Bacteria - 10; Metazoa - 228; Fungi - 4; Plants - 492; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT5G13460AT5G13460.1AGGGGTAAIQ-domain 11 (IQD11); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD12 (IQ-domain 12); calmodulin binding (TAIR:AT5G03960.1); Has 460 Blast hits to 453 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 14; Plants - 419; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT5G15710AT5G15710.1ACCCCTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), F-box associated type 1 (InterPro:IPR017451), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: UFO (UNUSUAL FLORAL ORGANS); transcription factor binding / ubiquitin-protein ligase (TAIR:AT1G30950.1); Has 767 Blast hits to 766 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 767; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G15948AT5G15948.1AGGGGTAAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF10 represents a conserved upstream opening reading frame relative to major ORF AT5G15950.1
AT5G15950AT5G15950.1AGGGGTAAadenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT5G15950.2AGGGGTAAadenosylmethionine decarboxylase family protein; FUNCTIONS IN: adenosylmethionine decarboxylase activity; INVOLVED IN: spermidine biosynthetic process, spermine biosynthetic process, polyamine biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: S-adenosylmethionine decarboxylase, core (InterPro:IPR016067), S-adenosylmethionine decarboxylase (InterPro:IPR001985), S-adenosylmethionine decarboxylase, conserved site (InterPro:IPR018166), S-adenosylmethionine decarboxylase subgroup (InterPro:IPR018167); BEST Arabidopsis thaliana protein match is: SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase (TAIR:AT3G02470.4); Has 830 Blast hits to 816 proteins in 205 species: Archae - 0; Bacteria - 50; Metazoa - 174; Fungi - 104; Plants - 446; Viruses - 0; Other Eukaryotes - 56 (source: NCBI BLink).
AT5G16540AT5G16540.1AGGGGTAAEncodes a zinc finger protein.
AT5G16540.2AGGGGTAAEncodes a zinc finger protein.
AT5G16540.3AGGGGTAAEncodes a zinc finger protein.
AT5G18840AT5G18840.1AGGGGTAAsugar transporter, putative; FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport, transmembrane transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: sugar transporter, putative (TAIR:AT2G48020.2); Has 17758 Blast hits to 17331 proteins in 1181 species: Archae - 248; Bacteria - 6545; Metazoa - 4355; Fungi - 4214; Plants - 1414; Viruses - 0; Other Eukaryotes - 982 (source: NCBI BLink).
AT5G19240AT5G19240.1AAATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19230.1); Has 42 Blast hits to 41 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 42; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G19330AT5G19330.1AAATACCCCTGAarmadillo/beta-catenin repeat family protein / BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding, binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), Armadillo-like helical (InterPro:IPR011989), BTB/POZ fold (InterPro:IPR011333), Armadillo (InterPro:IPR000225), BTB/POZ-like (InterPro:IPR000210), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ABAP1 (ARMADILLO BTB ARABIDOPSIS PROTEIN 1); protein binding (TAIR:AT5G13060.1); Has 13522 Blast hits to 10213 proteins in 289 species: Archae - 10; Bacteria - 57; Metazoa - 9428; Fungi - 689; Plants - 2320; Viruses - 84; Other Eukaryotes - 934 (source: NCBI BLink).
AT5G19330.2AAATACCCCTGAarmadillo/beta-catenin repeat family protein / BTB/POZ domain-containing protein; FUNCTIONS IN: protein binding, binding; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ (InterPro:IPR013069), Armadillo-like helical (InterPro:IPR011989), BTB/POZ fold (InterPro:IPR011333), Armadillo (InterPro:IPR000225), BTB/POZ-like (InterPro:IPR000210), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: ABAP1 (ARMADILLO BTB ARABIDOPSIS PROTEIN 1); protein binding (TAIR:AT5G13060.1); Has 13522 Blast hits to 10213 proteins in 289 species: Archae - 10; Bacteria - 57; Metazoa - 9428; Fungi - 689; Plants - 2320; Viruses - 84; Other Eukaryotes - 934 (source: NCBI BLink).
AT5G22070AT5G22070.1AAATACCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G52060.2); Has 333 Blast hits to 332 proteins in 16 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 305; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT5G22330AT5G22330.1ACCCCTTARESISTANCE TO PSEUDOMONAS SYRINGAE PV MACULICOLA INTERACTOR 1 (RIN1); FUNCTIONS IN: protein binding; INVOLVED IN: defense response to fungus, incompatible interaction, meristem development; LOCATED IN: nucleolus, nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TIP49, C-terminal (InterPro:IPR010339), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: DNA helicase, putative (TAIR:AT5G67630.1); Has 2675 Blast hits to 2634 proteins in 789 species: Archae - 254; Bacteria - 1222; Metazoa - 326; Fungi - 290; Plants - 78; Viruses - 0; Other Eukaryotes - 505 (source: NCBI BLink).
AT5G22340AT5G22340.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G22340.2TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G23980AT5G23980.1TTACCCCTEncodes a ferric chelate reductase that is expressed at low levels in roots,shoots and cotyledons, but not flowers. Its transcription is regulated by FIT1.
AT5G24590AT5G24590.2TCAGGGGTAAMember of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV.
AT5G36230AT5G36230.1TAAGGGGTAAeIF4-gamma/eIF5/eIF2-epsilon domain-containing protein; FUNCTIONS IN: binding, translation initiation factor activity; INVOLVED IN: regulation of translational initiation; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: eIF4-gamma/eIF5/eIF2-epsilon (InterPro:IPR003307), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein (TAIR:AT1G65220.1); Has 758 Blast hits to 756 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 591; Fungi - 39; Plants - 97; Viruses - 3; Other Eukaryotes - 28 (source: NCBI BLink).
AT5G39590AT5G39590.1GGGGTATTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571); Has 144 Blast hits to 144 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 9; Plants - 26; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink).
AT5G43513AT5G43513.1ACCCCTTAEncodes a defensin-like (DEFL) family protein.
AT5G43830AT5G43830.1AGGGGTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22850.1); Has 497 Blast hits to 497 proteins in 168 species: Archae - 0; Bacteria - 238; Metazoa - 12; Fungi - 0; Plants - 192; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT5G45550AT5G45550.1TAAGGGGTmob1/phocein family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mob1/phocein (InterPro:IPR005301); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G19045.1); Has 961 Blast hits to 955 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 188; Plants - 65; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink).
AT5G45775AT5G45775.1AGGGGTAA60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).
AT5G45775.2AGGGGTAA60S ribosomal protein L11 (RPL11D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, vacuole; EXPRESSED IN: male gametophyte, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5 (InterPro:IPR002132); BEST Arabidopsis thaliana protein match is: RPL16B; structural constituent of ribosome (TAIR:AT4G18730.1); Has 5263 Blast hits to 5263 proteins in 1657 species: Archae - 218; Bacteria - 2825; Metazoa - 209; Fungi - 107; Plants - 188; Viruses - 0; Other Eukaryotes - 1716 (source: NCBI BLink).
AT5G47040AT5G47040.1AGGGGTAAEncodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins.
AT5G47080AT5G47080.1TTACCCCTRegulatory subunit beta of casein kinase II. purified CKB1 resulted in up 100-fold stimulation of casein kinase activity compared with the CKA1 activity alone. Forms a tetrameric complex with CKA1 (CKA1(2)CKB1(2)).
AT5G47080.2TTACCCCTRegulatory subunit beta of casein kinase II. purified CKB1 resulted in up 100-fold stimulation of casein kinase activity compared with the CKA1 activity alone. Forms a tetrameric complex with CKA1 (CKA1(2)CKB1(2)).
AT5G47080.3TTACCCCTRegulatory subunit beta of casein kinase II. purified CKB1 resulted in up 100-fold stimulation of casein kinase activity compared with the CKA1 activity alone. Forms a tetrameric complex with CKA1 (CKA1(2)CKB1(2)).
AT5G48760AT5G48760.1AAATACCCC60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink).
AT5G48760.2AAATACCCC60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink).
AT5G52990AT5G52990.1GGGGTATTvesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G53160AT5G53160.1AGGGGTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01360.1); Has 181 Blast hits to 181 proteins in 19 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G53160.2AGGGGTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G01360.1); Has 181 Blast hits to 181 proteins in 19 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 179; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G54840AT5G54840.1AGGGGTAAMonomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes.
AT5G54840.2AGGGGTAAMonomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes.
AT5G58030AT5G58030.1TTACCCCTtransport protein particle (TRAPP) component Bet3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ER to Golgi vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transport protein particle (TRAPP) component (InterPro:IPR007194), TRAPP I complex, Trs31 (InterPro:IPR016696); Has 400 Blast hits to 390 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 157; Fungi - 137; Plants - 31; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT5G58040AT5G58040.1AGGGGTAAEncodes a subunit of the polyadenylation apparatus that interacts with and stimulates the activity of poly(A) polymerase. Additionally , it interacts with several polyadenylation factor subunits and is an RNA-binding protein. It is suggested that this protein coordinates a number of polyadenylation factor subunits with PAP and with RNA.
AT5G58430AT5G58430.1TAAGGGGTA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G58640AT5G58640.1GGGGTATTTselenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT5G58640.2GGGGTATTTselenoprotein-related; FUNCTIONS IN: selenium binding; INVOLVED IN: cell redox homeostasis; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SelT/selW/selH selenoprotein (InterPro:IPR011893); BEST Arabidopsis thaliana protein match is: SELT (SELT-LIKE PROTEIN PRECURSOR); selenium binding (TAIR:AT3G47300.1); Has 171 Blast hits to 171 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 119; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT5G58960AT5G58960.2TCAGGGGTCAAAMutant plants display impaired light-regulation of the hypocotyl randomization response.
AT5G58960.3TCAGGGGTCAAAMutant plants display impaired light-regulation of the hypocotyl randomization response.
AT5G60490AT5G60490.1TTACCCCTFLA12; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: FAS1 domain (InterPro:IPR000782); BEST Arabidopsis thaliana protein match is: FLA11 (TAIR:AT5G03170.1); Has 973 Blast hits to 947 proteins in 200 species: Archae - 18; Bacteria - 347; Metazoa - 21; Fungi - 12; Plants - 475; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT5G60680AT5G60680.1GGGGTATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF584 (InterPro:IPR007608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G45210.1); Has 210 Blast hits to 210 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 0; Plants - 207; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G61110AT5G61110.1GGGGTATTprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: leaf whorl, sepal, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61100.1); Has 41 Blast hits to 36 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT5G65320AT5G65320.1AATACCCCTTAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (bHLH096) (TAIR:AT1G72210.1); Has 641 Blast hits to 636 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 18; Plants - 603; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G66100AT5G66100.1GGGGTATTTLa domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), RNA-binding protein Lupus La (InterPro:IPR006630); BEST Arabidopsis thaliana protein match is: La domain-containing protein (TAIR:AT4G35890.1); Has 14253 Blast hits to 4987 proteins in 345 species: Archae - 17; Bacteria - 1528; Metazoa - 3261; Fungi - 1497; Plants - 230; Viruses - 36; Other Eukaryotes - 7684 (source: NCBI BLink).
AT5G66570AT5G66570.1ACCCCTGAEncodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In <i>Arabidopsis thaliana</i> the PsbO proteins are encoded by two genes: <i>psbO1</i> and <i>psbO2</i>. PsbO1 is the major isoform in the wild-type.
AT5G66700AT5G66700.1TAAGGGGTEncodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development.
AT5G66760AT5G66760.1AGGGGTAAOne of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex.
AT5G66760.1GGGGTATTOne of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex.
ATCG00170ATCG00170.1TAAGGGGTRNA polymerase beta' subunit-2
ATCG00300ATCG00300.1TAAGGGGTencodes PsbZ, which is a subunit of photosystem II. In Chlamydomonas, this protein has been shown to be essential in the interaction between PS II and the light harvesting complex II.


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.