version

Summary of ACGGGC (All List)

Organism Arabidopsis thaliana
PPDB Motif ACGGGC
Description function unknown
Total Entry Count 160

Entry Sequences (160 entries)

LocusGene modelSequenceDescription
AT1G03475AT1G03475.1GCCCGTTAEncodes coproporphyrinogen III oxidase, a key enzyme in the biosynthetic pathway of chlorophyll and heme, a tetrapyrrole pathway. Mutants express cytological and molecular markers associated with the defense responses, usually activated by pathogen infection.
AT1G04070AT1G04070.1GGCCCGTTASubunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.
AT1G04080AT1G04080.1TAACGGGCCPRP39; FUNCTIONS IN: binding; INVOLVED IN: regulation of timing of transition from vegetative to reproductive phase; LOCATED IN: intracellular; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990); BEST Arabidopsis thaliana protein match is: PRP39-2 (TAIR:AT5G46400.1); Has 3312 Blast hits to 2661 proteins in 380 species: Archae - 0; Bacteria - 496; Metazoa - 1500; Fungi - 623; Plants - 264; Viruses - 71; Other Eukaryotes - 358 (source: NCBI BLink).
AT1G05300AT1G05300.1ACGGGCCTAGmember of Fe(II) transporter isolog family
AT1G05300.2ACGGGCCTAGmember of Fe(II) transporter isolog family
AT1G09590AT1G09590.1ACAGGCCCGTTA60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink).
AT1G10910AT1G10910.1TATGGCCCGTTAINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT1G12760AT1G12760.1ACGGGCCTTTTprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).
AT1G12760.2ACGGGCCTTTTprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink).
AT1G13220AT1G13220.1TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G13220.2TAACGGGCCEncodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure.
AT1G14650AT1G14650.1GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G14650.2GCCCGTTAAAGGCCCATTAASWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: protein modification process, RNA processing; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: SWAP (Suppressor-of-White-APricot)/surp domain-containing protein (TAIR:AT1G14640.1); Has 33373 Blast hits to 19493 proteins in 943 species: Archae - 38; Bacteria - 3212; Metazoa - 15688; Fungi - 4389; Plants - 5098; Viruses - 859; Other Eukaryotes - 4089 (source: NCBI BLink).
AT1G15270AT1G15270.1TTTAACGGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink).
AT1G15280AT1G15280.1TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G15280.2TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink).
AT1G16030AT1G16030.1ACGGGCCTACheat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink).
AT1G16040AT1G16040.1GTAGGCCCGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G17760AT1G17760.1CTAGGCCCGTEncodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit.
AT1G25260AT1G25260.1AACGGGCCacidic ribosomal protein P0-related; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 809 Blast hits to 807 proteins in 249 species: Archae - 78; Bacteria - 0; Metazoa - 294; Fungi - 172; Plants - 102; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink).
AT1G27310AT1G27310.1TAACGGGCCCAACTEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport.
AT1G29060AT1G29060.1ATCGGCCCGTTAAAAAAGCCCATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Target SNARE coiled-coil region (InterPro:IPR000727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14600.1); Has 95 Blast hits to 95 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 28; Fungi - 15; Plants - 47; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G32310AT1G32310.1ACGGGCCTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 12 Blast hits to 12 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G32410AT1G32410.1GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.2GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.3GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.4GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G32410.5GCCCGTTAvacuolar protein sorting 55 family protein / VPS55 family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Vacuolar protein sorting 55 (InterPro:IPR007262); BEST Arabidopsis thaliana protein match is: vacuolar protein sorting 55 family protein / VPS55 family protein (TAIR:AT3G11530.2); Has 303 Blast hits to 303 proteins in 114 species: Archae - 0; Bacteria - 0; Metazoa - 147; Fungi - 86; Plants - 47; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT1G33120AT1G33120.1TTTAACGGGCCATGGGCTTAT60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink).
AT1G50450AT1G50450.1ACGGGCCTTATbinding / catalytic; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saccharopine dehydrogenase (InterPro:IPR005097), NAD(P)-binding (InterPro:IPR016040); Has 934 Blast hits to 931 proteins in 259 species: Archae - 13; Bacteria - 434; Metazoa - 33; Fungi - 62; Plants - 25; Viruses - 0; Other Eukaryotes - 367 (source: NCBI BLink).
AT1G54130AT1G54130.1TTTAACGGGCRELA/SPOT HOMOLOG 3 (RSH3); FUNCTIONS IN: GTP diphosphokinase activity; INVOLVED IN: guanosine tetraphosphate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Metal-dependent phosphohydrolase, HD region, subdomain (InterPro:IPR006674), Metal-dependent phosphohydrolase, HD region (InterPro:IPR003607), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH2 (RELA-SPOT HOMOLOG 2); GTP diphosphokinase (TAIR:AT3G14050.1); Has 8993 Blast hits to 8061 proteins in 1317 species: Archae - 2; Bacteria - 4486; Metazoa - 300; Fungi - 18; Plants - 129; Viruses - 2; Other Eukaryotes - 4056 (source: NCBI BLink).
AT1G56440AT1G56440.1AACGGGCCGGTTTATserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).
AT1G56450AT1G56450.1ATAAACCGGCCCGTT20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds
AT1G64510AT1G64510.1AACGGGCCTTTAACAGGCCCAATAAribosomal protein S6 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: thylakoid, chloroplast thylakoid membrane, ribosome, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Ribosomal protein S6 (InterPro:IPR000529); Has 978 Blast hits to 978 proteins in 282 species: Archae - 0; Bacteria - 578; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 375 (source: NCBI BLink).
AT1G64520AT1G64520.1TTATTGGGCCTGTTAAAGGCCCGTTRegulatory Particle non-ATPase 12a (RPN12a); FUNCTIONS IN: peptidase activity; INVOLVED IN: in 14 processes; LOCATED IN: proteasome complex, nucleus, proteasome regulatory particle, lid subcomplex, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 26S proteasome non-ATPase regulatory subunit Rpn12 (InterPro:IPR006746), SAC3/GANP/Nin1/mts3/eIF-3 p25 (InterPro:IPR005062); BEST Arabidopsis thaliana protein match is: RPN12b (Regulatory Particle Non-ATPase 12b); peptidase (TAIR:AT5G42040.1); Has 353 Blast hits to 353 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 84; Plants - 39; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink).
AT1G64628AT1G64628.1GCCCGTTAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF57 represents a conserved upstream opening reading frame relative to major ORF AT1G64630.1
AT1G64630AT1G64630.1GCCCGTTAWITH NO LYSINE KINASE 10 (WNK10); FUNCTIONS IN: transcription factor activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: WNK8 (WITH NO LYSINE (K) KINASE 8); kinase/ protein kinase (TAIR:AT5G41990.1); Has 77185 Blast hits to 76497 proteins in 1905 species: Archae - 28; Bacteria - 5972; Metazoa - 32664; Fungi - 6701; Plants - 16849; Viruses - 382; Other Eukaryotes - 14589 (source: NCBI BLink).
AT1G64680AT1G64680.1AACGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03055.1); Has 64 Blast hits to 64 proteins in 14 species: Archae - 0; Bacteria - 5; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G65150AT1G65150.1TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G65150.2TTTAGGCCCGTTAmeprin and TRAF homology domain-containing protein / MATH domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TRAF-like (InterPro:IPR008974), MATH (InterPro:IPR002083); BEST Arabidopsis thaliana protein match is: meprin and TRAF homology domain-containing protein / MATH domain-containing protein (TAIR:AT1G65050.1); Has 254 Blast hits to 212 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 241; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT1G65280AT1G65280.1GGGCCTAAACGGGCCTTTAheat shock protein binding; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G22080.1); Has 22647 Blast hits to 16088 proteins in 1412 species: Archae - 102; Bacteria - 2761; Metazoa - 9875; Fungi - 2142; Plants - 1453; Viruses - 33; Other Eukaryotes - 6281 (source: NCBI BLink).
AT1G75870AT1G75870.1AAAAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G76940AT1G76940.1AACGGGCCGGGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G76940.1GCCCGTTAATCCAACGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT1G80500AT1G80500.1GCCCGTTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sedlin (InterPro:IPR006722), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20930.1); Has 437 Blast hits to 435 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 248; Fungi - 75; Plants - 53; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT2G01090AT2G01090.1TAACGGGCubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase hinge (InterPro:IPR003422); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 7.8 kDa protein, putative / mitochondrial hinge protein, putative (TAIR:AT1G15120.1); Has 95 Blast hits to 95 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 2; Plants - 49; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT2G02910AT2G02910.1TAACGGGCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 191 Blast hits to 191 proteins in 22 species: Archae - 6; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink).
AT2G03150AT2G03150.1AACGGGCCTATAembryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink).
AT2G03150.1TAACGGGCCembryo defective 1579 (emb1579); FUNCTIONS IN: binding, calcium ion binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); Has 125920 Blast hits to 56296 proteins in 2267 species: Archae - 286; Bacteria - 11325; Metazoa - 58503; Fungi - 14640; Plants - 5579; Viruses - 940; Other Eukaryotes - 34647 (source: NCBI BLink).
AT2G03430AT2G03430.1AAAAGGCCCATAAACGGGCCCAATATankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink).
AT2G04410AT2G04410.1TAACGGGCCCATTAAGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defence response, Rin4 (InterPro:IPR008700); BEST Arabidopsis thaliana protein match is: NOI (TAIR:AT5G55850.1); Has 141 Blast hits to 140 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 139; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G23090AT2G23090.1TTTAACGGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1909 (InterPro:IPR015023); Has 104 Blast hits to 104 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 33; Plants - 46; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT2G27020AT2G27020.1ATAAAGCCCGTTAEncodes 20S proteasome subunit PAG1 (PAG1).
AT2G35750AT2G35750.1AAAAGGCCCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G37660AT2G37660.1TCAGGCCCGTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, apoplast, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 1711 Blast hits to 1685 proteins in 445 species: Archae - 20; Bacteria - 1147; Metazoa - 3; Fungi - 23; Plants - 245; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink).
AT2G44920AT2G44920.1AACGGGCCTTTTthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink).
AT2G44920.2AACGGGCCTTTTthylakoid lumenal 15 kDa protein, chloroplast; FUNCTIONS IN: molecular_function unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentapeptide repeat (InterPro:IPR001646); BEST Arabidopsis thaliana protein match is: thylakoid lumenal protein-related (TAIR:AT1G12250.2); Has 11947 Blast hits to 4967 proteins in 589 species: Archae - 251; Bacteria - 8237; Metazoa - 244; Fungi - 2; Plants - 139; Viruses - 34; Other Eukaryotes - 3040 (source: NCBI BLink).
AT2G47250AT2G47250.1TAACGGGCCTTGRNA helicase, putative; FUNCTIONS IN: in 7 functions; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT3G62310.1); Has 7386 Blast hits to 6689 proteins in 1000 species: Archae - 0; Bacteria - 1927; Metazoa - 2123; Fungi - 842; Plants - 395; Viruses - 601; Other Eukaryotes - 1498 (source: NCBI BLink).
AT3G02660AT3G02660.1TTTAACGGGCCGTAEMBRYO DEFECTIVE 2768 (emb2768); FUNCTIONS IN: RNA binding, tyrosine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class I, conserved site (InterPro:IPR001412), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial (InterPro:IPR002307), RNA-binding S4 (InterPro:IPR002942), Aminoacyl-tRNA synthetase, class Ib (InterPro:IPR002305); Has 6358 Blast hits to 6354 proteins in 1524 species: Archae - 11; Bacteria - 2982; Metazoa - 99; Fungi - 101; Plants - 19; Viruses - 0; Other Eukaryotes - 3146 (source: NCBI BLink).
AT3G05060AT3G05060.1AACGGGCCSAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein
AT3G05070AT3G05070.1GGCCCGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink).
AT3G06680AT3G06680.1AACGGGCCTAAG60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).
AT3G06680.2AACGGGCCTAAG60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink).
AT3G08780AT3G08780.1TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G08780.2TAACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G11410AT3G11410.1GCCCGTTAATTACGEncodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA.
AT3G12110AT3G12110.1ACGGGCCTATTEncodes an actin that is expressed predominantly during reproductive development.
AT3G14290AT3G14290.1TTAAGGCCCGTTEncodes 20S proteasome subunit PAE2 (PAE2).
AT3G15280AT3G15280.1AACGGGCCunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: L mature pollen stage, 4 anthesis, petal differentiation and expansion stage; Has 19 Blast hits to 19 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G15290AT3G15290.1GGCCCGTT3-hydroxybutyryl-CoA dehydrogenase, putative; FUNCTIONS IN: coenzyme binding, oxidoreductase activity, 3-hydroxybutyryl-CoA dehydrogenase activity, binding, catalytic activity; INVOLVED IN: fatty acid metabolic process, metabolic process; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 3-hydroxyacyl-CoA dehydrogenase, conserved site (InterPro:IPR006180), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyacyl-CoA dehydrogenase, NAD binding (InterPro:IPR006176), 3-hydroxyacyl-CoA dehydrogenase, C-terminal (InterPro:IPR006108); BEST Arabidopsis thaliana protein match is: AIM1 (ABNORMAL INFLORESCENCE MERISTEM); enoyl-CoA hydratase (TAIR:AT4G29010.1); Has 10012 Blast hits to 9491 proteins in 1060 species: Archae - 201; Bacteria - 5136; Metazoa - 507; Fungi - 164; Plants - 85; Viruses - 0; Other Eukaryotes - 3919 (source: NCBI BLink).
AT3G18100AT3G18100.1CCCGGCCCGTTMember of the R2R3 transcription factor gene family.
AT3G25800AT3G25800.1TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit
AT3G25800.2TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit
AT3G28455AT3G28455.1AACGGGCCCATATMember of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.
AT3G46020AT3G46020.1GCCCGTTAAARNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink).
AT3G46030AT3G46030.1GCCCGTTAAAHTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink).
AT3G46040AT3G46040.1TTTAACGGGCRegulated by TCP20.
AT3G47610AT3G47610.1TTTAGGCCCGTTtranscription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT3G48930AT3G48930.1CTAAGGCCCGTAATTAAAGGCCCAATAAembryo defective 1080 (EMB1080); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: RPS11-BETA (RIBOSOMAL PROTEIN S11-BETA); structural constituent of ribosome (TAIR:AT5G23740.1); Has 956 Blast hits to 954 proteins in 334 species: Archae - 160; Bacteria - 168; Metazoa - 241; Fungi - 98; Plants - 94; Viruses - 0; Other Eukaryotes - 195 (source: NCBI BLink).
AT3G53370AT3G53370.1ACGGGCCTAACDNA-binding S1FA family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA binding protein S1FA (InterPro:IPR006779); Has 54 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G53970AT3G53970.1TTAAGGCCCGTTproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).
AT3G53970.2TTAAGGCCCGTTproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).
AT3G55850AT3G55850.1TAACGGGCTTTAEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.
AT3G59010AT3G59010.1TAACGGGCpectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: ATPMEPCRD; enzyme inhibitor/ pectinesterase (TAIR:AT2G43050.1); Has 1273 Blast hits to 1240 proteins in 183 species: Archae - 0; Bacteria - 250; Metazoa - 1; Fungi - 133; Plants - 888; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G63370AT3G63370.1AACGGGCCCTApentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink).
AT4G00058AT4G00058.1CAATGGGCTCAAGCCCAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown.
AT4G01560AT4G01560.1GCCCGTTAmaternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink).
AT4G01570AT4G01570.1TAACGGGCpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink).
AT4G02460AT4G02460.1TAACGGGCEncodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination.
AT4G03280AT4G03280.1ATTGGCCCGTTEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.
AT4G03280.2ATTGGCCCGTTEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen.
AT4G11380AT4G11380.1ATCGGCCCGTTAbeta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink).
AT4G13940AT4G13940.1GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.2GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.3GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G13940.4GGCCCGTTAEncodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing.
AT4G15010AT4G15010.1TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink).
AT4G15010.2TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink).
AT4G15010.3TCGACCCGGCCCGTTmitochondrial substrate carrier family protein; FUNCTIONS IN: binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: endomembrane system, mitochondrial inner membrane, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108); Has 3824 Blast hits to 3539 proteins in 214 species: Archae - 0; Bacteria - 0; Metazoa - 1741; Fungi - 1051; Plants - 775; Viruses - 0; Other Eukaryotes - 257 (source: NCBI BLink).
AT4G15020AT4G15020.1AACGGGCCGGGTCGADNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT4G15020.2AACGGGCCGGGTCGADNA binding / protein dimerization; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G22220.2); Has 326 Blast hits to 324 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 323; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT4G17510AT4G17510.1CCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17510.1TCAGGCCCGTTAUBIQUITIN C-TERMINAL HYDROLASE 3 (UCH3); FUNCTIONS IN: ubiquitin thiolesterase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (InterPro:IPR001578); BEST Arabidopsis thaliana protein match is: UCH1; ubiquitin thiolesterase (TAIR:AT5G16310.1); Has 919 Blast hits to 915 proteins in 169 species: Archae - 0; Bacteria - 0; Metazoa - 504; Fungi - 219; Plants - 81; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink).
AT4G17520AT4G17520.1TAACGGGCCCGGCCCAATAAnuclear RNA-binding protein, putative; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Hyaluronan/mRNA binding protein (InterPro:IPR006861); BEST Arabidopsis thaliana protein match is: nuclear RNA-binding protein, putative (TAIR:AT5G47210.1); Has 13357 Blast hits to 8375 proteins in 750 species: Archae - 13; Bacteria - 2605; Metazoa - 5274; Fungi - 1340; Plants - 1789; Viruses - 136; Other Eukaryotes - 2200 (source: NCBI BLink).
AT4G22670AT4G22670.1TTATTGGGCCTTATTAACGGGCTTATArabidopsis thaliana Hsp70-interacting protein 1 (AtHip1); FUNCTIONS IN: binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: ATTDX (TETRATICOPEPTIDE DOMAIN-CONTAINING THIOREDOXIN); oxidoreductase, acting on sulfur group of donors, disulfide as acceptor / protein binding (TAIR:AT3G17880.2); Has 104992 Blast hits to 32574 proteins in 1569 species: Archae - 323; Bacteria - 31113; Metazoa - 46021; Fungi - 5704; Plants - 7149; Viruses - 884; Other Eukaryotes - 13798 (source: NCBI BLink).
AT4G23820AT4G23820.1TATGGCCCGTTglycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein; FUNCTIONS IN: polygalacturonase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), Glycoside hydrolase, family 28 (InterPro:IPR000743), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein (TAIR:AT5G41870.1); Has 2405 Blast hits to 2400 proteins in 312 species: Archae - 2; Bacteria - 563; Metazoa - 8; Fungi - 896; Plants - 841; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink).
AT4G23840AT4G23840.1AACGGGCCATAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT1G15740.1); Has 7635 Blast hits to 5145 proteins in 376 species: Archae - 2; Bacteria - 2863; Metazoa - 1987; Fungi - 78; Plants - 1868; Viruses - 40; Other Eukaryotes - 797 (source: NCBI BLink).
AT4G25050AT4G25050.1AGATGGGCCCGTTencodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light.
AT4G25200AT4G25200.1GATGGGCCGTAGCCCGTTAAtHSP23.6-mito mRNA, nuclear gene encoding mitochondrial
AT4G25210AT4G25210.1GTTAGGCCCGTTtranscription regulator; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00130.1); Has 5777 Blast hits to 3070 proteins in 342 species: Archae - 2; Bacteria - 508; Metazoa - 1816; Fungi - 705; Plants - 351; Viruses - 71; Other Eukaryotes - 2324 (source: NCBI BLink).
AT4G28010AT4G28010.1TAACGGGCTTTApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62670.1); Has 27713 Blast hits to 6108 proteins in 193 species: Archae - 5; Bacteria - 29; Metazoa - 747; Fungi - 685; Plants - 24892; Viruses - 0; Other Eukaryotes - 1355 (source: NCBI BLink).
AT4G28360AT4G28360.1TAACGGGCTCGGCCCAAATribosomal protein L22 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22, bacterial-type (InterPro:IPR005727); BEST Arabidopsis thaliana protein match is: ribosomal protein L22 family protein (TAIR:AT1G52370.3); Has 5503 Blast hits to 5503 proteins in 1687 species: Archae - 0; Bacteria - 3089; Metazoa - 109; Fungi - 48; Plants - 431; Viruses - 0; Other Eukaryotes - 1826 (source: NCBI BLink).
AT4G32680AT4G32680.1ATTGGCCCGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G32690AT4G32690.1TAACGGGCCAATEncodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast.
AT4G34960AT4G34960.1TTTAGGCCCGTTApeptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP5 (CYCLOPHILIN 5); peptidyl-prolyl cis-trans isomerase (TAIR:AT2G29960.1); Has 11230 Blast hits to 11218 proteins in 1505 species: Archae - 82; Bacteria - 3582; Metazoa - 2365; Fungi - 952; Plants - 729; Viruses - 4; Other Eukaryotes - 3516 (source: NCBI BLink).
AT4G35300AT4G35300.1TATAGGCCCGTTONOPLAST MONOSACCHARIDE TRANSPORTER2 (TMT2); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity, nucleoside transmembrane transporter activity; INVOLVED IN: in 6 processes; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: TMT1 (TONOPLAST MONOSACCHARIDE TRANSPORTER1); carbohydrate transmembrane transporter/ nucleoside transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G20840.1); Has 31955 Blast hits to 24066 proteins in 1440 species: Archae - 414; Bacteria - 13999; Metazoa - 6075; Fungi - 7762; Plants - 2061; Viruses - 0; Other Eukaryotes - 1644 (source: NCBI BLink).
AT4G35300.2TATAGGCCCGTTONOPLAST MONOSACCHARIDE TRANSPORTER2 (TMT2); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity, nucleoside transmembrane transporter activity; INVOLVED IN: in 6 processes; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: TMT1 (TONOPLAST MONOSACCHARIDE TRANSPORTER1); carbohydrate transmembrane transporter/ nucleoside transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G20840.1); Has 31955 Blast hits to 24066 proteins in 1440 species: Archae - 414; Bacteria - 13999; Metazoa - 6075; Fungi - 7762; Plants - 2061; Viruses - 0; Other Eukaryotes - 1644 (source: NCBI BLink).
AT4G35300.3TATAGGCCCGTTONOPLAST MONOSACCHARIDE TRANSPORTER2 (TMT2); FUNCTIONS IN: carbohydrate transmembrane transporter activity, sugar:hydrogen symporter activity, nucleoside transmembrane transporter activity; INVOLVED IN: in 6 processes; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), General substrate transporter (InterPro:IPR005828), Sugar/inositol transporter (InterPro:IPR003663), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: TMT1 (TONOPLAST MONOSACCHARIDE TRANSPORTER1); carbohydrate transmembrane transporter/ nucleoside transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT1G20840.1); Has 31955 Blast hits to 24066 proteins in 1440 species: Archae - 414; Bacteria - 13999; Metazoa - 6075; Fungi - 7762; Plants - 2061; Viruses - 0; Other Eukaryotes - 1644 (source: NCBI BLink).
AT4G35800AT4G35800.1AGGCCCGTTAEncodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit.
AT4G36800AT4G36800.1AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.
AT4G36800.2AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1.
AT4G39150AT4G39150.1GTGGGCCTAACGGGCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT2G21510.1); Has 15752 Blast hits to 15663 proteins in 1939 species: Archae - 106; Bacteria - 5221; Metazoa - 3289; Fungi - 1398; Plants - 1148; Viruses - 18; Other Eukaryotes - 4572 (source: NCBI BLink).
AT4G39200AT4G39200.1AGAGGCCCGT40S ribosomal protein S25 (RPS25E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25B) (TAIR:AT2G21580.2); Has 505 Blast hits to 505 proteins in 181 species: Archae - 8; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G39200.2AGAGGCCCGT40S ribosomal protein S25 (RPS25E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S25 (InterPro:IPR004977); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S25 (RPS25B) (TAIR:AT2G21580.2); Has 505 Blast hits to 505 proteins in 181 species: Archae - 8; Bacteria - 0; Metazoa - 227; Fungi - 100; Plants - 93; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT5G01510AT5G01510.1GCCCGTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink).
AT5G05370AT5G05370.1TTAAAGGCCCGTubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; LOCATED IN: mitochondrial respiratory chain complex III; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex ubiquinone-binding protein, putative / ubiquinol-cytochrome C reductase complex 8.2 kDa protein, putative (TAIR:AT3G10860.1); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G10630AT5G10630.1TATAGGCCCGTTAAAAGCCCAACAelongation factor 1-alpha, putative / EF-1-alpha, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Zinc finger, RanBP2-type (InterPro:IPR001876), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: EF-1-alpha-related GTP-binding protein, putative (TAIR:AT1G18070.2); Has 58110 Blast hits to 58057 proteins in 13368 species: Archae - 652; Bacteria - 20622; Metazoa - 14216; Fungi - 8620; Plants - 1274; Viruses - 3; Other Eukaryotes - 12723 (source: NCBI BLink).
AT5G11240AT5G11240.1ATAAGGCCCGTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Protein of unknown function NUC189, C-terminal (InterPro:IPR012979), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); Has 6246 Blast hits to 3792 proteins in 274 species: Archae - 28; Bacteria - 2331; Metazoa - 1477; Fungi - 1133; Plants - 291; Viruses - 0; Other Eukaryotes - 986 (source: NCBI BLink).
AT5G12170AT5G12170.2TAACGGGCunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G19380.1); Has 139 Blast hits to 139 proteins in 40 species: Archae - 0; Bacteria - 11; Metazoa - 7; Fungi - 0; Plants - 46; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).
AT5G13700AT5G13700.1TCAGGCCCGTEncodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants).
AT5G14220AT5G14220.1CAAAGGCCCGTTAEncodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development.
AT5G14680AT5G14680.1CAATGGGCCCGTTuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT3G01520.1); Has 1288 Blast hits to 1284 proteins in 330 species: Archae - 88; Bacteria - 759; Metazoa - 35; Fungi - 21; Plants - 361; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT5G15200AT5G15200.1TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT5G15200.2TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).
AT5G16550AT5G16550.1AACGGGCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT5G23290AT5G23290.1TAACGGGCPREFOLDIN 5 (PDF5); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin alpha subunit (InterPro:IPR011599); Has 365 Blast hits to 365 proteins in 170 species: Archae - 46; Bacteria - 3; Metazoa - 137; Fungi - 83; Plants - 26; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink).
AT5G25475AT5G25475.1TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G25475.2TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G25475.3TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G25800AT5G25800.1GCCCGTTAexonuclease family protein; FUNCTIONS IN: exonuclease activity, nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: SDN1 (SMALL RNA DEGRADING NUCLEASE 1); 3'-5' exonuclease/ exonuclease (TAIR:AT3G50100.1); Has 1347 Blast hits to 1319 proteins in 179 species: Archae - 0; Bacteria - 4; Metazoa - 658; Fungi - 453; Plants - 109; Viruses - 2; Other Eukaryotes - 121 (source: NCBI BLink).
AT5G27710AT5G27710.1TAACGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G38830AT5G38830.1CTTAGGCCCGTTtRNA synthetase class I (C) family protein; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, cysteinyl-tRNA aminoacylation; LOCATED IN: cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT3G56300.1); Has 8148 Blast hits to 7899 proteins in 1622 species: Archae - 141; Bacteria - 3284; Metazoa - 371; Fungi - 182; Plants - 67; Viruses - 3; Other Eukaryotes - 4100 (source: NCBI BLink).
AT5G42590AT5G42590.1TTAAAGGCCCGTputative cytochrome P450
AT5G43600AT5G43600.1AACGGGCCTCTEncodes a protein that is 27% identical and 43% similar to the E. coli allantoate amidohydrolase. In vitro assays with purified protein and allantoate as a substrate do not show any increase in ammonium concentration, no AAH activity.
AT5G48375AT5G48375.1TAACGGGCCIs a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein.
AT5G48560AT5G48560.1GCCCGTTAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT3G07340.1); Has 1985 Blast hits to 1807 proteins in 161 species: Archae - 0; Bacteria - 13; Metazoa - 190; Fungi - 79; Plants - 1294; Viruses - 1; Other Eukaryotes - 408 (source: NCBI BLink).
AT5G51340AT5G51340.1AACGGGCCTAAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 96 proteins in 39 species: Archae - 0; Bacteria - 2; Metazoa - 115; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT5G51700AT5G51700.1ATTTGGGCCGAGGCCCGTTEncodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation.
AT5G53620AT5G53620.1TCAGCCCAATAGGCCCGTunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).
AT5G53620.2TCAGCCCAATAGGCCCGTunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).
AT5G53620.3TCAGCCCAATAGGCCCGTunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).
AT5G60840AT5G60840.1AGGCCCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 8 growth stages; Has 359 Blast hits to 315 proteins in 79 species: Archae - 2; Bacteria - 43; Metazoa - 176; Fungi - 34; Plants - 19; Viruses - 19; Other Eukaryotes - 66 (source: NCBI BLink).
AT5G63890AT5G63890.1GAATGGGCTTTACGGGCCTTAAEncodes histidinol dehydrogenase. Up-regulated in response to UV-B.
AT5G63890.2GAATGGGCTTTACGGGCCTTAAEncodes histidinol dehydrogenase. Up-regulated in response to UV-B.
AT5G64440AT5G64440.1TAACGGGCCAtFAAH (fatty acid amide hydrolase) modulates endogenous NAEs (N-Acylethanolamines) levels in plants by hydrolyzing NAEs to ethanolamine and their corresponding free fatty acids. NAE depletion likely participates in the regulation of plant growth.
AT5G65950AT5G65950.1CAAAGGCCCGTTAAAAGCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT5G65950.1TTAAAGGCCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1683, C-terminal (InterPro:IPR012880); Has 238 Blast hits to 212 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 129; Fungi - 62; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT5G66080AT5G66080.1TAACGGGCCATAprotein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3605 Blast hits to 3604 proteins in 217 species: Archae - 0; Bacteria - 11; Metazoa - 1260; Fungi - 366; Plants - 1225; Viruses - 5; Other Eukaryotes - 738 (source: NCBI BLink).
AT5G66090AT5G66090.1TATGGCCCGTTAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.