version

Summary of GGGACCC (All List)

Organism Arabidopsis thaliana
PPDB Motif GGGACCC
Description function unknown
Total Entry Count 684

Entry Sequences (684 entries)

LocusGene modelSequenceDescription
AT1G01080AT1G01080.1TGACCCGACCCG33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT1G01080.2TGACCCGACCCG33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: CP33; RNA binding (TAIR:AT3G52380.1); Has 17909 Blast hits to 11804 proteins in 598 species: Archae - 16; Bacteria - 1315; Metazoa - 10536; Fungi - 1741; Plants - 2530; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink).
AT1G01090AT1G01090.1GTGGGTCCpyruvate dehydrogenase E1 alpha subunit
AT1G01140AT1G01140.1GGGACCCACEncodes a CBL-interacting protein kinase with similarity to SOS2
AT1G01140.2GGGACCCACEncodes a CBL-interacting protein kinase with similarity to SOS2
AT1G01140.3GGGACCCACEncodes a CBL-interacting protein kinase with similarity to SOS2
AT1G01260AT1G01260.1GACCCGGTTTAAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT1G01260.2GACCCGGTTTAAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink).
AT1G02660AT1G02660.1GTGGGTCCCACGTGGGlipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT3G62590.1); Has 601 Blast hits to 595 proteins in 116 species: Archae - 0; Bacteria - 17; Metazoa - 188; Fungi - 136; Plants - 92; Viruses - 14; Other Eukaryotes - 154 (source: NCBI BLink).
AT1G02850AT1G02850.1GGACCCACBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.1GTGGGTCCBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.2GGACCCACBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.2GTGGGTCCBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.3GGACCCACBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.3GTGGGTCCBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.4GGACCCACBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.4GTGGGTCCBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.5GGACCCACBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G02850.5GTGGGTCCBETA GLUCOSIDASE 11 (BGLU11); FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 1 (InterPro:IPR001360), Glycoside hydrolase, family 1, active site (InterPro:IPR018120), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BGLU3 (BETA GLUCOSIDASE 2); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G22100.1); Has 582 Blast hits to 531 proteins in 116 species: Archae - 3; Bacteria - 338; Metazoa - 157; Fungi - 24; Plants - 52; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT1G03560AT1G03560.1GGTCCCACpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 22539 Blast hits to 6065 proteins in 191 species: Archae - 3; Bacteria - 41; Metazoa - 565; Fungi - 536; Plants - 20393; Viruses - 0; Other Eukaryotes - 1001 (source: NCBI BLink).
AT1G04310AT1G04310.1TGGGTCCCACencodes an ethylene receptor related to bacterial two-component histidine kinases.
AT1G04550AT1G04550.1TGGGTCCCAIAA12/BDL plays a role in auxin-mediated processes of apical-basal patterning in the embryo. bdl mutants lack a primary root meristem
AT1G04550.2TGGGTCCCAIAA12/BDL plays a role in auxin-mediated processes of apical-basal patterning in the embryo. bdl mutants lack a primary root meristem
AT1G04910AT1G04910.1GACCCGACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22460.1); Has 440 Blast hits to 425 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 440; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G05230AT1G05230.1GTGGGTCCEncodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT1G05230.2GTGGGTCCEncodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT1G05230.3GTGGGTCCEncodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT1G05260AT1G05260.1GGACCCACEncodes a cold-inducible cationic peroxidase that is involved in the stress response. In response to low temperature, RCI3 transcripts accumulate in the aerial part and in roots of etiolated seedlings but only in roots of light-grown seedlings.
AT1G05410AT1G05410.1CCGACCCGACCCGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G05410.1GGACCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G05410.2CCGACCCGACCCGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G05410.2GGACCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22520.1); Has 112 Blast hits to 109 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 3; Fungi - 8; Plants - 96; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT1G06040AT1G06040.1GTGGGACCCEncodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.
AT1G06040.2GTGGGACCCEncodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.
AT1G06220AT1G06220.1GACCCGACCCEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.
AT1G06220.2GACCCGACCCEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS.
AT1G06390AT1G06390.1GTGGGTCCencodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts.
AT1G06390.2GTGGGTCCencodes a GSK3/shaggy-like protein kinase. Gene expression is induced by NaCl and ABA but not KCl, suggesting that this gene may be involved in response to osmotic stress. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts.
AT1G07400AT1G07400.1TGGGACCC17.8 kDa class I heat shock protein (HSP17.8-CI); INVOLVED IN: response to oxidative stress, response to heat; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: 17.6 kDa class I heat shock protein (HSP17.6A-CI) (TAIR:AT1G59860.1); Has 4521 Blast hits to 4521 proteins in 968 species: Archae - 130; Bacteria - 2463; Metazoa - 119; Fungi - 227; Plants - 1004; Viruses - 0; Other Eukaryotes - 578 (source: NCBI BLink).
AT1G07970AT1G07970.1GTGGGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 164 Blast hits to 163 proteins in 58 species: Archae - 0; Bacteria - 2; Metazoa - 113; Fungi - 15; Plants - 20; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT1G08720AT1G08720.1GTGGGTCCCenhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum
AT1G09100AT1G09100.1CCCGGGTCEncodes RPT5b (Regulatory Particle 5b), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype.
AT1G10430AT1G10430.1AAACCGAACCTTAACCGGGTCEncodes one of two isoforms of the catalytic subunit of protein phosphatase 2A.
AT1G10500AT1G10500.1ACCGGGTCGAInvolved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues.
AT1G10500.1TGACCCGACInvolved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues.
AT1G10510AT1G10510.1GTCGGGTCAembryo defective 2004 (emb2004); INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: RANGAP1 (RAN GTPASE ACTIVATING PROTEIN 1); RAN GTPase activator/ protein binding (TAIR:AT3G63130.1); Has 17671 Blast hits to 5431 proteins in 235 species: Archae - 0; Bacteria - 744; Metazoa - 8658; Fungi - 337; Plants - 531; Viruses - 0; Other Eukaryotes - 7401 (source: NCBI BLink).
AT1G10510.1TCGACCCGGTembryo defective 2004 (emb2004); INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: RANGAP1 (RAN GTPASE ACTIVATING PROTEIN 1); RAN GTPase activator/ protein binding (TAIR:AT3G63130.1); Has 17671 Blast hits to 5431 proteins in 235 species: Archae - 0; Bacteria - 744; Metazoa - 8658; Fungi - 337; Plants - 531; Viruses - 0; Other Eukaryotes - 7401 (source: NCBI BLink).
AT1G10940AT1G10940.1GTGGGTCCCEncodes a plant protein kinase similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Kinase activity of its homolog in tobacco is induced by hyperosmotic condition within 1 minute.
AT1G10960AT1G10960.1GTGGGACCFERREDOXIN 1 (ATFD1); FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding, 2 iron, 2 sulfur cluster binding; INVOLVED IN: electron transport chain; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2Fe-2S ferredoxin, iron-sulphur binding site (InterPro:IPR006058), Ferredoxin (InterPro:IPR001041), Ferredoxin [2Fe-2S], plant (InterPro:IPR010241), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: FED A; 2 iron, 2 sulfur cluster binding / electron carrier/ iron-sulfur cluster binding (TAIR:AT1G60950.1); Has 5347 Blast hits to 5345 proteins in 903 species: Archae - 63; Bacteria - 3637; Metazoa - 8; Fungi - 9; Plants - 447; Viruses - 2; Other Eukaryotes - 1181 (source: NCBI BLink).
AT1G11940AT1G11940.1GTGGGTCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF266, plant (InterPro:IPR004949); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62305.1); Has 329 Blast hits to 329 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 304; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).
AT1G12230AT1G12230.1GGGACCCACtransaldolase, putative; FUNCTIONS IN: transaldolase activity, catalytic activity; INVOLVED IN: glucose catabolic process to lactate and acetate, 5-phosphoribose 1-diphosphate biosynthetic process, carbohydrate metabolic process, metabolic process, pentose-phosphate shunt, non-oxidative branch; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Transaldolase (InterPro:IPR001585); Has 4687 Blast hits to 4687 proteins in 1248 species: Archae - 40; Bacteria - 2981; Metazoa - 141; Fungi - 151; Plants - 60; Viruses - 7; Other Eukaryotes - 1307 (source: NCBI BLink).
AT1G12360AT1G12360.1ACCGGTTCGGGTCAencodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis.
AT1G12770AT1G12770.1GACCCGGTTembryo defective 1586 (EMB1586); FUNCTIONS IN: helicase activity, ATP binding, nucleic acid binding, ATP-dependent helicase activity; INVOLVED IN: embryonic development ending in seed dormancy; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 4A, putative / eIF-4A, putative / DEAD box RNA helicase, putative (TAIR:AT3G19760.1); Has 25549 Blast hits to 25020 proteins in 1695 species: Archae - 449; Bacteria - 9955; Metazoa - 4809; Fungi - 3113; Plants - 1343; Viruses - 12; Other Eukaryotes - 5868 (source: NCBI BLink).
AT1G14230AT1G14230.1AACCCGACCCGGTnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).
AT1G14230.1TGACCCGAAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14250.1); Has 1089 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 22; Metazoa - 528; Fungi - 214; Plants - 198; Viruses - 0; Other Eukaryotes - 127 (source: NCBI BLink).
AT1G14290AT1G14290.1TGGGTCCCACEncodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth.
AT1G14850AT1G14850.1AACCCGACCCGGGEncodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport
AT1G14850.1TCGACCCGACEncodes a protein similar to nucleoporin, a a major component of the nuclear pore complex (NPC) involved in cellular nucleo-cytoplasmic transport
AT1G15740AT1G15740.1GTGGGACCleucine-rich repeat family protein; FUNCTIONS IN: protein binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT4G23840.1); Has 25965 Blast hits to 13594 proteins in 578 species: Archae - 6; Bacteria - 5108; Metazoa - 10615; Fungi - 448; Plants - 7228; Viruses - 79; Other Eukaryotes - 2481 (source: NCBI BLink).
AT1G16020AT1G16020.1AACCCGACCCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G16020.2AACCCGACCCGGTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80910.1); Has 143 Blast hits to 143 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 118; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).
AT1G16740AT1G16740.1CGACCCGACCCGATCGACCCGGribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink).
AT1G17120AT1G17120.1GTGGGTCCEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs.
AT1G17120.1GTGGGTCCCEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs.
AT1G17130AT1G17130.1CGACCCGGTTAAcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink).
AT1G17130.2CGACCCGGTTAAcell cycle control protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF572 (InterPro:IPR007590); BEST Arabidopsis thaliana protein match is: cell cycle control protein-related (TAIR:AT2G32050.1); Has 1133 Blast hits to 1063 proteins in 189 species: Archae - 3; Bacteria - 33; Metazoa - 413; Fungi - 249; Plants - 84; Viruses - 5; Other Eukaryotes - 346 (source: NCBI BLink).
AT1G17680AT1G17680.1GACCCGGGtranscription factor-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 5115 Blast hits to 2913 proteins in 387 species: Archae - 48; Bacteria - 954; Metazoa - 1578; Fungi - 711; Plants - 242; Viruses - 52; Other Eukaryotes - 1530 (source: NCBI BLink).
AT1G17680.2GACCCGGGtranscription factor-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 5115 Blast hits to 2913 proteins in 387 species: Archae - 48; Bacteria - 954; Metazoa - 1578; Fungi - 711; Plants - 242; Viruses - 52; Other Eukaryotes - 1530 (source: NCBI BLink).
AT1G18150AT1G18150.1CAAACCGGGTCGATMPK8,
AT1G18150.2CAAACCGGGTCGATMPK8,
AT1G18440AT1G18440.1GACCCGGGpeptidyl-tRNA hydrolase family protein; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, conserved site (InterPro:IPR018171), Peptidyl-tRNA hydrolase (InterPro:IPR001328); BEST Arabidopsis thaliana protein match is: peptidyl-tRNA hydrolase family protein (TAIR:AT5G16140.2); Has 5517 Blast hits to 5515 proteins in 1423 species: Archae - 0; Bacteria - 2880; Metazoa - 37; Fungi - 63; Plants - 75; Viruses - 0; Other Eukaryotes - 2462 (source: NCBI BLink).
AT1G19330AT1G19330.1GGGTCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G19330.2GGGTCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75060.1); Has 85 Blast hits to 85 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 32; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G19350AT1G19350.1GGACCCACEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.3GGACCCACEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.4GGACCCACEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.5GGACCCACEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19350.6GGACCCACEncodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes
AT1G19830AT1G19830.1GACCCGGTauxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT1G75580.1); Has 651 Blast hits to 640 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 650; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G20460AT1G20460.1AACCCGACCCGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20770AT1G20770.1ATAACCGGTTTGACCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 37 Blast hits to 37 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 19; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G20780AT1G20780.1TTCGGGTCAAACCGGTTATEncodes a protein containing a U-box and an ARM domain.
AT1G20880AT1G20880.1GTGGGACCCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G76460.1); Has 11636 Blast hits to 9514 proteins in 483 species: Archae - 0; Bacteria - 541; Metazoa - 6778; Fungi - 1119; Plants - 2221; Viruses - 0; Other Eukaryotes - 977 (source: NCBI BLink).
AT1G21600AT1G21600.1TTCGGGTCGGGTCGGGTCGGPresent in transcriptionally active plastid chromosomes. Involved in plastid gene expression.
AT1G21600.2TTCGGGTCGGGTCGGGTCGGPresent in transcriptionally active plastid chromosomes. Involved in plastid gene expression.
AT1G22040AT1G22040.1GACCCGGTTTACkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT1G55270.1); Has 8530 Blast hits to 4244 proteins in 221 species: Archae - 18; Bacteria - 386; Metazoa - 6931; Fungi - 33; Plants - 777; Viruses - 68; Other Eukaryotes - 317 (source: NCBI BLink).
AT1G22065AT1G22065.1GGACCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G22530AT1G22530.1TGGGACCCPATELLIN 2 (PATL2); FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: plasma membrane, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: PATL1 (PATELLIN 1); transporter (TAIR:AT1G72150.1); Has 52283 Blast hits to 28572 proteins in 1631 species: Archae - 214; Bacteria - 8910; Metazoa - 20172; Fungi - 6486; Plants - 2360; Viruses - 305; Other Eukaryotes - 13836 (source: NCBI BLink).
AT1G23090AT1G23090.1CCGACCCGAAEncodes AST91 mRNA for sulfate transporter.
AT1G24160AT1G24160.1GGTCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: guard cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70100.3); Has 4520 Blast hits to 3464 proteins in 329 species: Archae - 12; Bacteria - 317; Metazoa - 1888; Fungi - 343; Plants - 154; Viruses - 31; Other Eukaryotes - 1775 (source: NCBI BLink).
AT1G24706AT1G24706.1CTTAACCGGACCCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 25479 Blast hits to 15950 proteins in 654 species: Archae - 12; Bacteria - 897; Metazoa - 14432; Fungi - 3233; Plants - 1262; Viruses - 124; Other Eukaryotes - 5519 (source: NCBI BLink).
AT1G25440AT1G25440.1TGGGTCCCzinc finger (B-box type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: membrane; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: CCT domain (InterPro:IPR010402), Zinc finger, B-box (InterPro:IPR000315); BEST Arabidopsis thaliana protein match is: zinc finger (B-box type) family protein (TAIR:AT1G68520.1); Has 2116 Blast hits to 1317 proteins in 89 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 2049; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT1G25520AT1G25520.1TGGGTCCCACunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0016 (InterPro:IPR001727); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G68650.1); Has 1239 Blast hits to 1181 proteins in 440 species: Archae - 13; Bacteria - 667; Metazoa - 131; Fungi - 99; Plants - 104; Viruses - 0; Other Eukaryotes - 225 (source: NCBI BLink).
AT1G27290AT1G27290.1TGGGTCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27290.2TGGGTCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G27460AT1G27460.1GTGGGACCencodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits.
AT1G27470AT1G27470.1TATGGCCCAATGGGTCGGGTCGACCCGACCtransducin-related / WD-40 repeat protein-related; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), Cytochrome cd1-nitrite reductase-like, C-terminal haem d1 (InterPro:IPR011048), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G07410.1); Has 6753 Blast hits to 4580 proteins in 346 species: Archae - 8; Bacteria - 2018; Metazoa - 1907; Fungi - 1463; Plants - 459; Viruses - 0; Other Eukaryotes - 898 (source: NCBI BLink).
AT1G27480AT1G27480.1GGTCGGGTCGACCCGACCCATTGGGCCATAlecithin:cholesterol acyltransferase family protein / LACT family protein; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); Has 852 Blast hits to 847 proteins in 171 species: Archae - 0; Bacteria - 22; Metazoa - 582; Fungi - 0; Plants - 127; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).
AT1G28400AT1G28400.1GGACCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33850.1); Has 44658 Blast hits to 17636 proteins in 467 species: Archae - 50; Bacteria - 837; Metazoa - 1245; Fungi - 895; Plants - 135; Viruses - 63; Other Eukaryotes - 41433 (source: NCBI BLink).
AT1G29450AT1G29450.1TGGGACCCauxin-responsive protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT1G29500.1); Has 339 Blast hits to 329 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 339; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G29510AT1G29510.1TGGGACCCSMALL AUXIN UPREGULATED 68 (SAUR68); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G29440.1); Has 358 Blast hits to 348 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 358; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G29670AT1G29670.1GGACCCACGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: apoplast, cell wall, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT1G29660.1); Has 1995 Blast hits to 1979 proteins in 221 species: Archae - 0; Bacteria - 342; Metazoa - 1; Fungi - 54; Plants - 1578; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT1G29700AT1G29700.1GTAAACCGGGTCCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 321 Blast hits to 321 proteins in 85 species: Archae - 0; Bacteria - 142; Metazoa - 0; Fungi - 2; Plants - 20; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink).
AT1G30690AT1G30690.1GTGGGACCSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G30690.2GTGGGACCSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: cytosol, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Cellular retinaldehyde binding/alpha-tocopherol transport (InterPro:IPR001071), GOLD (InterPro:IPR009038), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G09160.1); Has 52659 Blast hits to 27496 proteins in 1404 species: Archae - 277; Bacteria - 6323; Metazoa - 18776; Fungi - 4501; Plants - 1964; Viruses - 383; Other Eukaryotes - 20435 (source: NCBI BLink).
AT1G31320AT1G31320.1TGGGTCCCACLOB DOMAIN-CONTAINING PROTEIN 4 (LBD4); INVOLVED IN: biological_process unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: ASL5; DNA binding / protein binding (TAIR:AT2G30130.1); Has 595 Blast hits to 592 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 595; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G31920AT1G31920.1GGGTCCCApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G66520.1); Has 13708 Blast hits to 5114 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 82; Fungi - 70; Plants - 13274; Viruses - 0; Other Eukaryotes - 282 (source: NCBI BLink).
AT1G31930AT1G31930.1GTGGGTCCEncodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses.
AT1G31930.2GTGGGTCCEncodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses.
AT1G32870AT1G32870.1CCGACCCGAAAAAACGACGTCArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT1G32870.2CCGACCCGAAAAAACGACGTCArabidopsis thaliana NAC domain protein 13 (ANAC13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, response to UV-B, response to red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1601 Blast hits to 1599 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 1578; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink).
AT1G33420AT1G33420.1GGGACCCACPHD finger family protein; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: MMD1 (MALE MEIOCYTE DEATH 1); DNA binding / protein binding / zinc ion binding (TAIR:AT1G66170.1); Has 482 Blast hits to 477 proteins in 106 species: Archae - 0; Bacteria - 0; Metazoa - 203; Fungi - 172; Plants - 97; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G33490AT1G33490.1ACCGGGTCGACCCGGTTTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT1G33500AT1G33500.1CTAAACCGGGTCGACCCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink).
AT1G33520AT1G33520.1GACCCGGTTTGGHas single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4;
AT1G48420AT1G48420.1CCAAACCGACCCGACCCGAEncodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity.
AT1G49200AT1G49200.1TGGGTCCCAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G49210.1); Has 5860 Blast hits to 5841 proteins in 212 species: Archae - 0; Bacteria - 0; Metazoa - 1984; Fungi - 368; Plants - 2596; Viruses - 40; Other Eukaryotes - 872 (source: NCBI BLink).
AT1G49210AT1G49210.1TGGGTCCCAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.10 ten leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G49200.1); Has 5874 Blast hits to 5856 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 2008; Fungi - 350; Plants - 2603; Viruses - 38; Other Eukaryotes - 875 (source: NCBI BLink).
AT1G52740AT1G52740.1GTGGGTCCEncodes HTA9, a histone H2A protein.
AT1G53165AT1G53165.1GGTCGGGTCGGGTCGGGTCGATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink).
AT1G53165.2GGTCGGGTCGGGTCGGGTCGATMAP4K ALPHA1; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, hyperosmotic response, response to wounding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT3G15220.1); Has 96724 Blast hits to 95040 proteins in 2970 species: Archae - 80; Bacteria - 8655; Metazoa - 42218; Fungi - 8499; Plants - 18630; Viruses - 533; Other Eukaryotes - 18109 (source: NCBI BLink).
AT1G55630AT1G55630.1GTCGGGTCGGpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G60050.1); Has 18827 Blast hits to 5565 proteins in 174 species: Archae - 4; Bacteria - 21; Metazoa - 383; Fungi - 322; Plants - 17397; Viruses - 0; Other Eukaryotes - 700 (source: NCBI BLink).
AT1G56220AT1G56220.1GGGTCCCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.2GGGTCCCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.3GGGTCCCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56220.4GGGTCCCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT1G56440AT1G56440.1GGGCCTGACCCGGTserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).
AT1G56440.1TGACCCGACCserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).
AT1G56440.1TTTGACCCGACCserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink).
AT1G56450AT1G56450.1ACCGGGTCAGGCCC20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds
AT1G56450.1GGTCGGGTCA20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds
AT1G56450.1GGTCGGGTCAAA20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds
AT1G59700AT1G59700.1GACCCGGGTCEncodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G60940AT1G60940.1GGTCCCACencodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress.
AT1G60940.2GGTCCCACencodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress.
AT1G62290AT1G62290.1GTGGGTCCCACaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).
AT1G62290.2GTGGGTCCCACaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis, lipid metabolic process; LOCATED IN: vacuole; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, seedling growth, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Saposin-like (InterPro:IPR011001), Peptidase aspartic, catalytic (InterPro:IPR009007), Saposin-like type B, 1 (InterPro:IPR007856), Saposin-like type B, 2 (InterPro:IPR008138), Saposin B (InterPro:IPR008139), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT1G11910.1); Has 5754 Blast hits to 3941 proteins in 342 species: Archae - 0; Bacteria - 4; Metazoa - 3397; Fungi - 1194; Plants - 356; Viruses - 0; Other Eukaryotes - 803 (source: NCBI BLink).
AT1G65040AT1G65040.2TTCGGGTCGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).
AT1G65040.3TTCGGGTCGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G16090.1); Has 5419 Blast hits to 5405 proteins in 205 species: Archae - 0; Bacteria - 0; Metazoa - 2047; Fungi - 486; Plants - 1935; Viruses - 24; Other Eukaryotes - 927 (source: NCBI BLink).
AT1G65540AT1G65540.1CGGACCCGACCCGAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: calcium-binding mitochondrial protein-related (TAIR:AT3G59820.1); Has 5986 Blast hits to 5091 proteins in 515 species: Archae - 39; Bacteria - 659; Metazoa - 2946; Fungi - 435; Plants - 306; Viruses - 24; Other Eukaryotes - 1577 (source: NCBI BLink).
AT1G65540.1TCGACCCGACCCGAAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), LETM1-like (InterPro:IPR011685); BEST Arabidopsis thaliana protein match is: calcium-binding mitochondrial protein-related (TAIR:AT3G59820.1); Has 5986 Blast hits to 5091 proteins in 515 species: Archae - 39; Bacteria - 659; Metazoa - 2946; Fungi - 435; Plants - 306; Viruses - 24; Other Eukaryotes - 1577 (source: NCBI BLink).
AT1G65930AT1G65930.1GTGGGACCCisocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, copper ion binding; INVOLVED IN: response to cadmium ion, response to salt stress, metabolic process; LOCATED IN: apoplast, plasma membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: ICDH (ISOCITRATE DEHYDROGENASE); isocitrate dehydrogenase (NADP+)/ oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor (TAIR:AT1G54340.1); Has 4101 Blast hits to 4085 proteins in 611 species: Archae - 17; Bacteria - 632; Metazoa - 448; Fungi - 160; Plants - 247; Viruses - 0; Other Eukaryotes - 2597 (source: NCBI BLink).
AT1G67750AT1G67750.1GTGGGTCCpectate lyase family protein; FUNCTIONS IN: pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT4G24780.1); Has 983 Blast hits to 980 proteins in 166 species: Archae - 0; Bacteria - 418; Metazoa - 0; Fungi - 154; Plants - 399; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT1G68740AT1G68740.1GGTCCCACEncodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation.
AT1G68780AT1G68780.1GGGTCCCAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G25670.1); Has 48682 Blast hits to 17905 proteins in 741 species: Archae - 22; Bacteria - 2819; Metazoa - 13948; Fungi - 544; Plants - 28561; Viruses - 2; Other Eukaryotes - 2786 (source: NCBI BLink).
AT1G69120AT1G69120.1GACCCGACFloral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24.
AT1G69230AT1G69230.1TGGGTCCCSPIRAL1-LIKE2 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root and organ growth as a result of defective anisotropic cell expansion.
AT1G69230.2TGGGTCCCSPIRAL1-LIKE2 belongs to a six-member gene family in Arabidopsis; all members share a high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root and organ growth as a result of defective anisotropic cell expansion.
AT1G70760AT1G70760.1GTGGGACCa subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity.
AT1G70980AT1G70980.1ACCGGGTCSYNC3; FUNCTIONS IN: in 6 functions; INVOLVED IN: asparaginyl-tRNA aminoacylation, aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Asparaginyl-tRNA synthetase, class IIb (InterPro:IPR004522), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: SYNC1; ATP binding / aminoacyl-tRNA ligase/ asparagine-tRNA ligase/ aspartate-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT5G56680.1); Has 10794 Blast hits to 8026 proteins in 1494 species: Archae - 413; Bacteria - 7139; Metazoa - 538; Fungi - 533; Plants - 135; Viruses - 0; Other Eukaryotes - 2036 (source: NCBI BLink).
AT1G70980.1GACCCGAASYNC3; FUNCTIONS IN: in 6 functions; INVOLVED IN: asparaginyl-tRNA aminoacylation, aspartyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Asparaginyl-tRNA synthetase, class IIb (InterPro:IPR004522), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: SYNC1; ATP binding / aminoacyl-tRNA ligase/ asparagine-tRNA ligase/ aspartate-tRNA ligase/ nucleic acid binding / nucleotide binding (TAIR:AT5G56680.1); Has 10794 Blast hits to 8026 proteins in 1494 species: Archae - 413; Bacteria - 7139; Metazoa - 538; Fungi - 533; Plants - 135; Viruses - 0; Other Eukaryotes - 2036 (source: NCBI BLink).
AT1G71030AT1G71030.1GTGGGACCEncodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves.
AT1G71750AT1G71750.1ACCGGGTCphosphoribosyltransferase family protein; FUNCTIONS IN: transferase activity, hypoxanthine phosphoribosyltransferase activity; INVOLVED IN: nucleoside metabolic process, purine ribonucleoside salvage; LOCATED IN: cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoribosyltransferase (InterPro:IPR000836), Hypoxanthine phosphoribosyl transferase (InterPro:IPR005904); Has 3239 Blast hits to 3239 proteins in 1142 species: Archae - 35; Bacteria - 2162; Metazoa - 212; Fungi - 2; Plants - 19; Viruses - 0; Other Eukaryotes - 809 (source: NCBI BLink).
AT1G72090AT1G72090.1TCGACCCGACCCAGGCCCATTAradical SAM domain-containing protein / TRAM domain-containing protein; FUNCTIONS IN: iron-sulfur cluster binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0004 (InterPro:IPR005839), Aldolase-type TIM barrel (InterPro:IPR013785), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Uncharacterised protein family UPF0004, N-terminal (InterPro:IPR013848), Radical SAM (InterPro:IPR007197), Deoxyribonuclease/rho motif-related TRAM (InterPro:IPR002792), MiaB-like tRNA modifying enzyme, archaeal-type (InterPro:IPR006466); BEST Arabidopsis thaliana protein match is: radical SAM domain-containing protein / TRAM domain-containing protein (TAIR:AT4G36390.1); Has 10341 Blast hits to 10323 proteins in 1298 species: Archae - 269; Bacteria - 4639; Metazoa - 269; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 5110 (source: NCBI BLink).
AT1G72175AT1G72175.1GGGTCCCACzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1232 (InterPro:IPR010652), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G22510.1); Has 591 Blast hits to 591 proteins in 84 species: Archae - 0; Bacteria - 8; Metazoa - 474; Fungi - 32; Plants - 29; Viruses - 2; Other Eukaryotes - 46 (source: NCBI BLink).
AT1G72330AT1G72330.1ATATTGGGACCCEncodes for alanine aminotransferase ALAAT2.
AT1G72330.2ATATTGGGACCCEncodes for alanine aminotransferase ALAAT2.
AT1G73885AT1G73885.1GGTCGGGTCGGGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT1G74230AT1G74230.1TTTAACCGGGTCencodes a glycine-rich RNA binding protein.
AT1G74890AT1G74890.1TGGGTCCCEncodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment.
AT1G75020AT1G75020.1CCGACCCGAALYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink).
AT1G75020.2CCGACCCGAALYSOPHOSPHATIDYL ACYLTRANSFERASE 4 (LPAT4); FUNCTIONS IN: acyltransferase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipid/glycerol acyltransferase (InterPro:IPR002123); BEST Arabidopsis thaliana protein match is: LPAT5; acyltransferase (TAIR:AT3G18850.4); Has 1540 Blast hits to 1538 proteins in 412 species: Archae - 0; Bacteria - 617; Metazoa - 462; Fungi - 118; Plants - 77; Viruses - 4; Other Eukaryotes - 262 (source: NCBI BLink).
AT1G75440AT1G75440.1GGTCCCACubiquitin-conjugating enzyme 16 (UBC16); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC18 (ubiquitin-conjugating enzyme 18); small conjugating protein ligase/ ubiquitin-protein ligase (TAIR:AT5G42990.1); Has 6497 Blast hits to 6496 proteins in 295 species: Archae - 0; Bacteria - 2; Metazoa - 3150; Fungi - 1284; Plants - 976; Viruses - 16; Other Eukaryotes - 1069 (source: NCBI BLink).
AT1G75510AT1G75510.1CGGGTCGGGTCAtranscription initiation factor IIF beta subunit (TFIIF-beta) family protein; FUNCTIONS IN: RNA polymerase II transcription factor activity, general RNA polymerase II transcription factor activity, catalytic activity, ATP binding, ATP-dependent helicase activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIF complex, mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), Transcription Factor IIF, Rap30/Rap74, interaction (InterPro:IPR011039), Transcription initiation factor IIF, beta subunit (InterPro:IPR003196), Transcription initiation factor IIF, beta subunit, subgroup (InterPro:IPR016640); BEST Arabidopsis thaliana protein match is: ATP binding / RNA polymerase II transcription factor (TAIR:AT3G52270.1); Has 230 Blast hits to 230 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 84; Plants - 32; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT1G75560AT1G75560.1GACCCGGGzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).
AT1G75560.2GACCCGGGzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink).
AT1G75660AT1G75660.1GACCCGGGEncodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products.
AT1G76160AT1G76160.1GTGGGTCCSKU5 Similar 5 (sks5); FUNCTIONS IN: oxidoreductase activity, copper ion binding; LOCATED IN: apoplast, cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707), Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: SKS6 (SKU5-SIMILAR 6); pectinesterase (TAIR:AT1G41830.1); Has 3613 Blast hits to 3566 proteins in 612 species: Archae - 8; Bacteria - 911; Metazoa - 254; Fungi - 1504; Plants - 791; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).
AT1G76630AT1G76630.1CAAACCGGGTCtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: SEC (secret agent); transferase, transferring glycosyl groups (TAIR:AT3G04240.1); Has 5924 Blast hits to 3836 proteins in 536 species: Archae - 384; Bacteria - 2298; Metazoa - 901; Fungi - 281; Plants - 131; Viruses - 0; Other Eukaryotes - 1929 (source: NCBI BLink).
AT1G77420AT1G77420.1TTCGGGTCAhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G16120.2); Has 2683 Blast hits to 2679 proteins in 755 species: Archae - 29; Bacteria - 1623; Metazoa - 110; Fungi - 139; Plants - 254; Viruses - 40; Other Eukaryotes - 488 (source: NCBI BLink).
AT1G77760AT1G77760.1GTGGGTCCCEncodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin.
AT1G78900AT1G78900.1GGACCCACTTATTGGGCCGTAEncodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.
AT1G78900.2GGACCCACTTATTGGGCCGTAEncodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology.
AT1G79200AT1G79200.1GACCCGACCCGACCCGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; Has 3292 Blast hits to 2186 proteins in 154 species: Archae - 0; Bacteria - 21; Metazoa - 1599; Fungi - 418; Plants - 200; Viruses - 0; Other Eukaryotes - 1054 (source: NCBI BLink).
AT1G80080AT1G80080.1GGACCCACEncodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development.
AT1G80080.1GTCGGGTCEncodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development.
AT1G80550AT1G80550.1TTCGGGTCApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).
AT1G80550.1TTCGGGTCAAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink).
AT1G80670AT1G80670.1ACCCGACCCGAACCGAThis gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT2G01150AT2G01150.1ATAATGGGTCCCACAACACGTGGCEncodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils.
AT2G01180AT2G01180.1GTGGGACCEncodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.
AT2G01180.2GTGGGACCEncodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.
AT2G01470AT2G01470.1TGAACCGGGTCSec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER.
AT2G01860AT2G01860.1ACCGGGTCGGEMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT2G01860.1CAATTGGGTCGGGTCAEMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT2G01860.1TTCGGGTCGEMBRYO DEFECTIVE 975 (EMB975); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G38420.1); Has 2464 Blast hits to 1412 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 8; Plants - 2414; Viruses - 0; Other Eukaryotes - 42 (source: NCBI BLink).
AT2G02480AT2G02480.1GACCCGAASTICHEL mutant shows trichomes with fewer than normal branches.
AT2G03140AT2G03140.1TGACCCGACCCAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G50790.1); Has 23018 Blast hits to 13463 proteins in 1126 species: Archae - 80; Bacteria - 6803; Metazoa - 6863; Fungi - 2179; Plants - 631; Viruses - 123; Other Eukaryotes - 6339 (source: NCBI BLink).
AT2G04630AT2G04630.1CCGAACCGAACCCGACCCGAAOne of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.
AT2G04630.1CCGACCCGACCCTGACCCGAAOne of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.
AT2G04630.1CGGACCCGAAOne of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940.
AT2G04880AT2G04880.1TGGGTCCCACEncodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.
AT2G04880.2TGGGTCCCACEncodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1.
AT2G05220AT2G05220.1TCGGTTCGGGTCAGTTCGGTT40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT2G05220.2TCGGTTCGGGTCAGTTCGGTT40S ribosomal protein S17 (RPS17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein S17e (InterPro:IPR001210), Ribosomal protein S17e, conserved site (InterPro:IPR018273); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S17 (RPS17D) (TAIR:AT5G04800.4); Has 726 Blast hits to 726 proteins in 256 species: Archae - 117; Bacteria - 0; Metazoa - 270; Fungi - 97; Plants - 83; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT2G05380AT2G05380.1GACCCGACglycine-rich protein 3 short isoform (GRP3S) mRNA, complete
AT2G05380.2GACCCGACglycine-rich protein 3 short isoform (GRP3S) mRNA, complete
AT2G07718AT2G07718.1GGACCCACcytochrome b, putative; FUNCTIONS IN: electron carrier activity, oxidoreductase activity; INVOLVED IN: respiratory electron transport chain; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Cytochrome b/b6 (InterPro:IPR016175), Cytochrome b/b6, N-terminal (InterPro:IPR005797); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATMG00590.1); Has 22999 Blast hits to 22998 proteins in 3944 species: Archae - 0; Bacteria - 28; Metazoa - 21735; Fungi - 0; Plants - 517; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink).
AT2G14460AT2G14460.1TCGGTTCGGGTCGGTTCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G15230AT2G15230.1TGACCCGAALipase active on medium and short chain triacylglycerols, but not on phospho- or galactolipids. Active between pH4 and 7 with an optimum at pH6. Knock-out mutant has not obvious phenotype. Predicted to be extracellular.
AT2G15790AT2G15790.1GTGGGTCCSQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot.
AT2G16500AT2G16500.1TTCGGGTCGGGTCGGGTCGencodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements.
AT2G17190AT2G17190.1GACCCGACCCGGCCCAATubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17200.1); Has 8273 Blast hits to 4684 proteins in 635 species: Archae - 6; Bacteria - 189; Metazoa - 3590; Fungi - 1163; Plants - 1579; Viruses - 154; Other Eukaryotes - 1592 (source: NCBI BLink).
AT2G17200AT2G17200.1TTTGACCCGACCCGGTubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink).
AT2G17380AT2G17380.1CCGACCCGGGEncodes clathrin assembly protein AP19.
AT2G17380.1CCGACCCGGGTCEncodes clathrin assembly protein AP19.
AT2G20060AT2G20060.1GACCCGACCCGribosomal protein L4 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4 (InterPro:IPR015498), Ribosomal protein L4/L1e, bacterial-type (InterPro:IPR013005), Ribosomal protein L4/L1e (InterPro:IPR002136); BEST Arabidopsis thaliana protein match is: RPL4; poly(U) binding / structural constituent of ribosome (TAIR:AT1G07320.4); Has 5451 Blast hits to 5451 proteins in 1497 species: Archae - 63; Bacteria - 2944; Metazoa - 100; Fungi - 82; Plants - 60; Viruses - 0; Other Eukaryotes - 2202 (source: NCBI BLink).
AT2G21840AT2G21840.1TGACCCGACCCGAAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21850.1); Has 2278 Blast hits to 530 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 2227; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT2G23980AT2G23980.1GTGGGACCCGACmember of Cyclic nucleotide gated channel family
AT2G24650AT2G24650.2GTAAACCGACCCGAADNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: apoplast; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: MEE45 (maternal effect embryo arrest 45); DNA binding / transcription factor (TAIR:AT4G00260.1); Has 527 Blast hits to 125 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 525; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G25260AT2G25260.1GTGGGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25265.1); Has 110 Blast hits to 96 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink).
AT2G25520AT2G25520.1GGGTCCCACphosphate translocator-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: phosphate translocator-related (TAIR:AT4G32390.1); Has 1588 Blast hits to 1588 proteins in 185 species: Archae - 0; Bacteria - 8; Metazoa - 446; Fungi - 283; Plants - 685; Viruses - 0; Other Eukaryotes - 166 (source: NCBI BLink).
AT2G26690AT2G26690.1TGGGACCCAnitrate transporter (NTP2); FUNCTIONS IN: transporter activity; INVOLVED IN: response to jasmonic acid stimulus, response to wounding; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: NRT1.1; nitrate transmembrane transporter/ transporter (TAIR:AT1G12110.1); Has 4204 Blast hits to 4131 proteins in 765 species: Archae - 0; Bacteria - 1892; Metazoa - 433; Fungi - 280; Plants - 1124; Viruses - 0; Other Eukaryotes - 475 (source: NCBI BLink).
AT2G28830AT2G28830.1CCGACCCGAAbinding / structural constituent of ribosome / ubiquitin-protein ligase; FUNCTIONS IN: ubiquitin-protein ligase activity, structural constituent of ribosome, binding; INVOLVED IN: response to chitin; LOCATED IN: ubiquitin ligase complex, ribosome, intracellular; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: U box (InterPro:IPR003613), Armadillo-like helical (InterPro:IPR011989), Ribosomal protein L10e/L16 (InterPro:IPR016180), Armadillo (InterPro:IPR000225), Ribosomal protein L16 (InterPro:IPR000114), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: PUB13 (PLANT U-BOX 13); ubiquitin-protein ligase (TAIR:AT3G46510.1); Has 4249 Blast hits to 3154 proteins in 216 species: Archae - 0; Bacteria - 22; Metazoa - 1271; Fungi - 546; Plants - 1890; Viruses - 3; Other Eukaryotes - 517 (source: NCBI BLink).
AT2G28900AT2G28900.1GTGGGTCCEncodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment.
AT2G30000AT2G30000.1ACCGGGTCLOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G30000.1GGACCCACLOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PHF5-like (InterPro:IPR005345); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G07170.2); Has 292 Blast hits to 292 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 110; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G30170AT2G30170.2CCCGGGTCcatalytic; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932); BEST Arabidopsis thaliana protein match is: 5-azacytidine resistance protein -related (TAIR:AT5G66720.2); Has 637 Blast hits to 627 proteins in 184 species: Archae - 2; Bacteria - 71; Metazoa - 153; Fungi - 150; Plants - 121; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).
AT2G30170.2GGACCCACcatalytic; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932); BEST Arabidopsis thaliana protein match is: 5-azacytidine resistance protein -related (TAIR:AT5G66720.2); Has 637 Blast hits to 627 proteins in 184 species: Archae - 2; Bacteria - 71; Metazoa - 153; Fungi - 150; Plants - 121; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink).
AT2G30520AT2G30520.1GGGACCCAlight inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis
AT2G30520.2GGGACCCAlight inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis
AT2G30520.3GGGACCCAlight inducible root phototropism 2 encoding a signal transducer of the phototropic response in Arabidopsis
AT2G30590AT2G30590.1GGACCCACEncodes WRKY DNA-binding protein 21 (WRKY21).
AT2G32235AT2G32235.1ACCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 10; Fungi - 9; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT2G33220AT2G33220.1TTTGACCCGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT2G33280AT2G33280.1GTGGGTCCCAintegral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: endomembrane system, membrane; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT1G04570.1); Has 372 Blast hits to 365 proteins in 86 species: Archae - 4; Bacteria - 66; Metazoa - 0; Fungi - 4; Plants - 130; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink).
AT2G34400AT2G34400.1TCGACCCGAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G22410.1); Has 14623 Blast hits to 5296 proteins in 169 species: Archae - 0; Bacteria - 4; Metazoa - 195; Fungi - 114; Plants - 13938; Viruses - 0; Other Eukaryotes - 372 (source: NCBI BLink).
AT2G35060AT2G35060.1GGACCCACpotassium transporter
AT2G35060.2GGACCCACpotassium transporter
AT2G35110AT2G35110.1GACCCGAAComponent of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs.
AT2G35110.2GACCCGAAComponent of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs.
AT2G35190AT2G35190.1CGATGTCGTGGCGGGTCCCACplant-specific SNARE located in cell plate of dividing cells. cofractionates with the cytokinesis-specific syntaxin, KNOLLE, which is required for the formation of the cell plate.
AT2G35410AT2G35410.1GACCCGGTTCA33 kDa ribonucleoprotein, chloroplast, putative / RNA-binding protein cp33, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; LOCATED IN: thylakoid, chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT4G09040.2); Has 19540 Blast hits to 13531 proteins in 594 species: Archae - 12; Bacteria - 1397; Metazoa - 10397; Fungi - 2454; Plants - 3010; Viruses - 0; Other Eukaryotes - 2270 (source: NCBI BLink).
AT2G35605AT2G35605.1GTCGGGTCASWIB complex BAF60b domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SWIB/MDM2 (InterPro:IPR003121); BEST Arabidopsis thaliana protein match is: SWIB complex BAF60b domain-containing protein (TAIR:AT1G31760.1); Has 726 Blast hits to 687 proteins in 149 species: Archae - 0; Bacteria - 129; Metazoa - 56; Fungi - 126; Plants - 201; Viruses - 8; Other Eukaryotes - 206 (source: NCBI BLink).
AT2G36290AT2G36290.1TTCGGGTChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G74300.1); Has 557 Blast hits to 555 proteins in 128 species: Archae - 11; Bacteria - 242; Metazoa - 0; Fungi - 39; Plants - 185; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink).
AT2G38000AT2G38000.1GACCCGGTTchaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT2G38000.1TGACCCGACCCGAchaperone protein dnaJ-related; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 643 Blast hits to 619 proteins in 228 species: Archae - 19; Bacteria - 379; Metazoa - 79; Fungi - 4; Plants - 29; Viruses - 0; Other Eukaryotes - 133 (source: NCBI BLink).
AT2G38040AT2G38040.1GACCCGGGencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis
AT2G38040.2GACCCGGGencodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis
AT2G39570AT2G39570.1AGACACGTAGGTCCCACACT domain-containing protein; FUNCTIONS IN: amino acid binding; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: ACT domain-containing protein (TAIR:AT2G36840.1); Has 256 Blast hits to 222 proteins in 28 species: Archae - 0; Bacteria - 28; Metazoa - 0; Fungi - 0; Plants - 199; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).
AT2G39805AT2G39805.1TTCGGGTCAAAintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G39805.1TTCGGGTCAAAintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G39805.2TTCGGGTCAAAintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G39805.2TTCGGGTCAAAintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).
AT2G40800AT2G40800.1GTGGGTCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G40800.1TGACCCGACCCGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G56430.1); Has 21 Blast hits to 21 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G41630AT2G41630.1GGTCCCACEncodes the transcription factor TFIIB.
AT2G41770AT2G41770.1GTGGGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF288 (InterPro:IPR005049); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G57420.1); Has 153 Blast hits to 153 proteins in 20 species: Archae - 2; Bacteria - 7; Metazoa - 47; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT2G42790AT2G42790.1GTGGGTCCCACEncodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development.
AT2G43360AT2G43360.1GGTCCCACCatalyzes the conversion of dethiobiotin to biotin.
AT2G43370AT2G43370.1GTGGGACCU1 small nuclear ribonucleoprotein 70 kDa, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: U1-70K (U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K); RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G50670.1); Has 15940 Blast hits to 13539 proteins in 557 species: Archae - 10; Bacteria - 827; Metazoa - 9526; Fungi - 1771; Plants - 2091; Viruses - 3; Other Eukaryotes - 1712 (source: NCBI BLink).
AT2G45430AT2G45430.1GGACCCACDNA-binding protein-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT3G60870.1); Has 474 Blast hits to 471 proteins in 35 species: Archae - 0; Bacteria - 4; Metazoa - 34; Fungi - 10; Plants - 424; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT2G46020AT2G46020.1GTGGGACCEncodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.
AT2G46020.2GTGGGACCEncodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.
AT2G46180AT2G46180.1TGACCCGACThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein.
AT2G46540AT2G46540.1ATTTGGGCCCAGTAACCCGACCCGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT2G46800AT2G46800.1GGGACCCAEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis.
AT2G46800.2GGGACCCAEncodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis.
AT2G47180AT2G47180.1GGTCCCACArabidopsis thaliana galactinol synthase 1 (AtGolS1); FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: response to high light intensity, response to hydrogen peroxide, carbohydrate biosynthetic process, response to heat; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 8 (InterPro:IPR002495); BEST Arabidopsis thaliana protein match is: AtGolS2 (Arabidopsis thaliana galactinol synthase 2); transferase, transferring glycosyl groups / transferase, transferring hexosyl groups (TAIR:AT1G56600.1); Has 818 Blast hits to 817 proteins in 194 species: Archae - 0; Bacteria - 56; Metazoa - 224; Fungi - 185; Plants - 235; Viruses - 68; Other Eukaryotes - 50 (source: NCBI BLink).
AT3G01310AT3G01310.1GTGGGTCCacid phosphatase/ oxidoreductase/ transition metal ion binding; FUNCTIONS IN: oxidoreductase activity, transition metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078); BEST Arabidopsis thaliana protein match is: acid phosphatase/ oxidoreductase/ transition metal ion binding (TAIR:AT5G15070.1); Has 471 Blast hits to 374 proteins in 140 species: Archae - 0; Bacteria - 2; Metazoa - 201; Fungi - 125; Plants - 35; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT3G01310.2GTGGGTCCacid phosphatase/ oxidoreductase/ transition metal ion binding; FUNCTIONS IN: oxidoreductase activity, transition metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histidine acid phosphatase (InterPro:IPR000560), Ferritin/ribonucleotide reductase-like (InterPro:IPR009078); BEST Arabidopsis thaliana protein match is: acid phosphatase/ oxidoreductase/ transition metal ion binding (TAIR:AT5G15070.1); Has 471 Blast hits to 374 proteins in 140 species: Archae - 0; Bacteria - 2; Metazoa - 201; Fungi - 125; Plants - 35; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink).
AT3G01370AT3G01370.1CCGACCCGACCCGAAEncodes a protein containing a CRM domain that is involved in group I and group II intron splicing.
AT3G01450AT3G01450.1TGGGTCCCbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G14790.1); Has 188 Blast hits to 188 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 6; Plants - 61; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT3G01850AT3G01850.1TAAATGGGTCGGGTCGribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).
AT3G01850.2TAAATGGGTCGGGTCGribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink).
AT3G02820AT3G02820.1ATAAACCGGGTCAAAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink).
AT3G03320AT3G03320.1TTCGGGTCCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ProFAR isomerase-like (InterPro:IPR010759), ASCH domain (InterPro:IPR007374); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G43465.1); Has 65 Blast hits to 65 proteins in 18 species: Archae - 31; Bacteria - 2; Metazoa - 1; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT3G03600AT3G03600.1CCGACCCGACCCGACStructural component of the mitochondrial ribosome small subunit
AT3G03600.1CGACCCGGTTTGStructural component of the mitochondrial ribosome small subunit
AT3G03610AT3G03610.1CAAACCGGGTCGphagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).
AT3G03610.1GTCGGGTCGGGTCGGphagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink).
AT3G04830AT3G04830.1GACCCGGTTATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G04830.2GACCCGGTTATbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G28220.1); Has 403 Blast hits to 397 proteins in 158 species: Archae - 23; Bacteria - 36; Metazoa - 173; Fungi - 71; Plants - 23; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT3G06110AT3G06110.1CCCGGGTCEncodes a nuclear-localized MAP kinase phosphatase. Plants with reduced levels of MKP2 transcripts are hypersensitive to ozone and ozone-mediated activation of MPK3 and MPK6 is prolonged in these plants.
AT3G06110.2CCCGGGTCEncodes a nuclear-localized MAP kinase phosphatase. Plants with reduced levels of MKP2 transcripts are hypersensitive to ozone and ozone-mediated activation of MPK3 and MPK6 is prolonged in these plants.
AT3G06240AT3G06240.1GACCCGGTTTGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G23880.1); Has 1173 Blast hits to 1161 proteins in 42 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1171; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G06270AT3G06270.1ACCCGACCCGAAprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: ATP binding / cAMP-dependent protein kinase regulator/ catalytic/ protein kinase/ protein serine/threonine phosphatase (TAIR:AT2G20050.1); Has 3686 Blast hits to 3670 proteins in 257 species: Archae - 2; Bacteria - 83; Metazoa - 1132; Fungi - 383; Plants - 1219; Viruses - 4; Other Eukaryotes - 863 (source: NCBI BLink).
AT3G06470AT3G06470.1TGGGACCCACGNS1/SUR4 membrane family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GNS1/SUR4 membrane protein (InterPro:IPR002076); BEST Arabidopsis thaliana protein match is: GNS1/SUR4 membrane family protein (TAIR:AT3G06460.1); Has 1723 Blast hits to 1718 proteins in 184 species: Archae - 0; Bacteria - 0; Metazoa - 1179; Fungi - 248; Plants - 58; Viruses - 13; Other Eukaryotes - 225 (source: NCBI BLink).
AT3G06910AT3G06910.1CCCGGGTCEncodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. In vitro assays suggest that this enzyme is active against SUMO1 and SUMO2. It has weak activity with SUMO3 and cannot act on SUMO5. The N-terminal regulatory region of this protein is required for full activity.
AT3G07050AT3G07050.1TTCGGGTCAGTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP-binding (InterPro:IPR005289), Small GTP-binding protein (InterPro:IPR005225), GTP1/OBG (InterPro:IPR006073), GTP-binding protein, HSR1-related (InterPro:IPR002917), GNL3L/Grn1 putative GTPase (InterPro:IPR014813); BEST Arabidopsis thaliana protein match is: GTP-binding family protein (TAIR:AT1G52980.1); Has 8737 Blast hits to 6941 proteins in 1045 species: Archae - 97; Bacteria - 2936; Metazoa - 2440; Fungi - 644; Plants - 338; Viruses - 29; Other Eukaryotes - 2253 (source: NCBI BLink).
AT3G07100AT3G07100.1TTCGGGTCAprotein transport protein Sec24, putative; FUNCTIONS IN: protein binding, transporter activity, zinc ion binding; INVOLVED IN: intracellular protein transport, transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 74720 Blast hits to 37673 proteins in 1279 species: Archae - 56; Bacteria - 8492; Metazoa - 38339; Fungi - 10824; Plants - 6948; Viruses - 1820; Other Eukaryotes - 8241 (source: NCBI BLink).
AT3G07170AT3G07170.1TCGACCCGACCCGACCCGsterile alpha motif (SAM) domain-containing protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Sterile alpha motif homology (InterPro:IPR010993); BEST Arabidopsis thaliana protein match is: sterile alpha motif (SAM) domain-containing protein (TAIR:AT5G48680.1); Has 396 Blast hits to 395 proteins in 57 species: Archae - 0; Bacteria - 4; Metazoa - 293; Fungi - 2; Plants - 89; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT3G07300AT3G07300.1TGGGTCCCAeukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).
AT3G07300.2TGGGTCCCAeukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).
AT3G07300.3TGGGTCCCAeukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink).
AT3G07650AT3G07650.1GGGACCCACAATACCCTThis gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO.
AT3G07650.2GGGACCCACAATACCCTThis gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO.
AT3G07650.3GGGACCCACAATACCCTThis gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO.
AT3G07650.4GGGACCCACAATACCCTThis gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO.
AT3G09405AT3G09405.1TTCGGGTCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Pectinacetylesterase (InterPro:IPR004963); BEST Arabidopsis thaliana protein match is: pectinacetylesterase family protein (TAIR:AT3G09410.1).
AT3G09920AT3G09920.1GTGGGACCPHOSPHATIDYL INOSITOL MONOPHOSPHATE 5 KINASE (PIP5K9); FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: amino acid metabolic process, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G60890.1); Has 21682 Blast hits to 6213 proteins in 379 species: Archae - 0; Bacteria - 2219; Metazoa - 3466; Fungi - 306; Plants - 724; Viruses - 0; Other Eukaryotes - 14967 (source: NCBI BLink).
AT3G09920.2GTGGGACCPHOSPHATIDYL INOSITOL MONOPHOSPHATE 5 KINASE (PIP5K9); FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: amino acid metabolic process, carbohydrate metabolic process; LOCATED IN: cytosol, nucleus, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G60890.1); Has 21682 Blast hits to 6213 proteins in 379 species: Archae - 0; Bacteria - 2219; Metazoa - 3466; Fungi - 306; Plants - 724; Viruses - 0; Other Eukaryotes - 14967 (source: NCBI BLink).
AT3G10410AT3G10410.1TGGGACCCACserine carboxypeptidase-like 49 (scpl49); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2453 Blast hits to 2354 proteins in 260 species: Archae - 0; Bacteria - 98; Metazoa - 602; Fungi - 570; Plants - 872; Viruses - 0; Other Eukaryotes - 311 (source: NCBI BLink).
AT3G10985AT3G10985.1GGTCCCACA senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis.
AT3G11130AT3G11130.1TCGACCCGAAclathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: male gametophyte, guard cell, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G08530.1); Has 1310 Blast hits to 1193 proteins in 365 species: Archae - 0; Bacteria - 34; Metazoa - 776; Fungi - 123; Plants - 60; Viruses - 0; Other Eukaryotes - 317 (source: NCBI BLink).
AT3G11780AT3G11780.1GGACCCACMD-2-related lipid recognition domain-containing protein / ML domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Immunoglobulin E-set (InterPro:IPR014756), MD-2-related lipid-recognition (InterPro:IPR003172); BEST Arabidopsis thaliana protein match is: MD-2-related lipid recognition domain-containing protein / ML domain-containing protein (TAIR:AT5G06480.1); Has 141 Blast hits to 141 proteins in 55 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 76; Plants - 53; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT3G12685AT3G12685.1GGTCCCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24350.1); Has 607 Blast hits to 607 proteins in 199 species: Archae - 0; Bacteria - 356; Metazoa - 0; Fungi - 0; Plants - 100; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink).
AT3G13050AT3G13050.1TGGGTCCCtransporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtOCT4 (Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER4); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G20660.1); Has 24061 Blast hits to 23627 proteins in 1387 species: Archae - 383; Bacteria - 12067; Metazoa - 4488; Fungi - 4369; Plants - 1324; Viruses - 0; Other Eukaryotes - 1430 (source: NCBI BLink).
AT3G13360AT3G13360.1GTGGGTCCCACWPP-domain Interacting Protein 3 (WIP3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nuclear envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: WIP1 (WPP-DOMAIN INTERACTING PROTEIN 1); protein heterodimerization/ protein homodimerization (TAIR:AT4G26455.1); Has 130 Blast hits to 126 proteins in 35 species: Archae - 0; Bacteria - 7; Metazoa - 18; Fungi - 8; Plants - 43; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink).
AT3G13677AT3G13677.1CCCGGGTCGGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13677.2CCCGGGTCGGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 11 Blast hits to 11 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G13750AT3G13750.1GGTCCCACbeta-galactosidase, glycosyl hydrolase family 35
AT3G13750.1GTGGGACCCAbeta-galactosidase, glycosyl hydrolase family 35
AT3G14410AT3G14410.1GTGGGACCCACtransporter-related; FUNCTIONS IN: organic anion transmembrane transporter activity; LOCATED IN: cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: organic anion transmembrane transporter (TAIR:AT1G53660.1); Has 1496 Blast hits to 1495 proteins in 199 species: Archae - 4; Bacteria - 38; Metazoa - 438; Fungi - 259; Plants - 598; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).
AT3G14415AT3G14415.1GTGGGTCCCAC(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: cotyledon, fruit, guard cell, juvenile leaf, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14420.2); Has 8872 Blast hits to 8856 proteins in 1094 species: Archae - 112; Bacteria - 3084; Metazoa - 295; Fungi - 423; Plants - 161; Viruses - 0; Other Eukaryotes - 4797 (source: NCBI BLink).
AT3G14590AT3G14590.1GTGGGACCNTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT3G14590.2GTGGGACCNTMC2T6.2; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: NTMC2T6.1 (TAIR:AT1G53590.1); Has 3086 Blast hits to 2715 proteins in 189 species: Archae - 0; Bacteria - 2; Metazoa - 1924; Fungi - 336; Plants - 571; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).
AT3G14930AT3G14930.1GTGGGTCCHEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).
AT3G14930.2GTGGGTCCHEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).
AT3G14930.3GTGGGTCCHEME1; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME2; uroporphyrinogen decarboxylase (TAIR:AT2G40490.1); Has 5476 Blast hits to 5476 proteins in 1181 species: Archae - 81; Bacteria - 2274; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2761 (source: NCBI BLink).
AT3G14960AT3G14960.1CCGACCCGAAgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G53290.1); Has 932 Blast hits to 929 proteins in 77 species: Archae - 0; Bacteria - 2; Metazoa - 607; Fungi - 2; Plants - 303; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT3G15220AT3G15220.1GGGACCCACprotein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: spindle, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATMAP4K ALPHA1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G53165.2); Has 97460 Blast hits to 95819 proteins in 3033 species: Archae - 88; Bacteria - 8614; Metazoa - 42541; Fungi - 8570; Plants - 18723; Viruses - 614; Other Eukaryotes - 18310 (source: NCBI BLink).
AT3G15356AT3G15356.1GTGGGTCClegume lectin family protein; FUNCTIONS IN: carbohydrate binding, sugar binding; INVOLVED IN: biological_process unknown; LOCATED IN: apoplast, cell wall; EXPRESSED IN: 7 plant structures; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), L-type lectin, plant (InterPro:IPR016363); BEST Arabidopsis thaliana protein match is: legume lectin family protein (TAIR:AT3G16530.1); Has 1383 Blast hits to 1370 proteins in 111 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 1349; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT3G15500AT3G15500.1GTGGGACCCEncodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3.
AT3G15580AT3G15580.1ATGACGTGGGACCCAEncodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition.
AT3G15590AT3G15590.1TTTGACCCGAADNA-binding protein, putative; FUNCTIONS IN: DNA binding; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT1G80270.3); Has 4141 Blast hits to 2233 proteins in 120 species: Archae - 0; Bacteria - 9; Metazoa - 154; Fungi - 32; Plants - 3825; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).
AT3G16240AT3G16240.1TTCGGGTCDelta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane.
AT3G16640AT3G16640.1CCGACCCGAAEncodes a protein homologous to translationally controlled tumor protein (TCTP) from Drosophila. In flies, TCTP functions guanine nucleotide exchange factor in the TOR signaling pathway. TCTP is expressed throughout the plant with highest levels seen in meristematic regions of the shoot and root. Loss of function alleles are not transmitted through the male gametophyte due to defects in pollen tube growth. Hypomorphs, generated through RNAi, are dwarf and have smaller cells. These plants also have defects in lateral and primary root growth as well as root hair growth. The phenotypes are similar to TOR mutants suggesting that TCTP functions in the is pathway in Arabidopsis as well.
AT3G16650AT3G16650.1TTCGGGTCGGPP1/PP2A phosphatases pleiotropic regulator 2 (PRL2); FUNCTIONS IN: nucleotide binding; INVOLVED IN: response to salt stress; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: PRL1 (PLEIOTROPIC REGULATORY LOCUS 1); basal transcription repressor/ nucleotide binding / protein binding (TAIR:AT4G15900.1); Has 58179 Blast hits to 24123 proteins in 639 species: Archae - 64; Bacteria - 6308; Metazoa - 27345; Fungi - 10914; Plants - 5200; Viruses - 0; Other Eukaryotes - 8348 (source: NCBI BLink).
AT3G17611AT3G17611.1GTGGGTCCCACARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink).
AT3G17611.2GTGGGTCCCACARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink).
AT3G17611.3GTGGGTCCCACARABIDOPSIS RHOMBOID-LIKE PROTEIN 14 (ATRBL14); FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane, intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S54, rhomboid (InterPro:IPR002610), Zinc finger, RanBP2-type (InterPro:IPR001876); BEST Arabidopsis thaliana protein match is: ATRBL15 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 15) (TAIR:AT3G58460.1); Has 479 Blast hits to 479 proteins in 160 species: Archae - 8; Bacteria - 189; Metazoa - 73; Fungi - 28; Plants - 84; Viruses - 3; Other Eukaryotes - 94 (source: NCBI BLink).
AT3G18165AT3G18165.1TAGGGCCCTAGAAGCCCAAGGCCCAATAAAACCGGGTCGGEncodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity.
AT3G18250AT3G18250.1ATAAACCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.02 two leaves visible, petal differentiation and expansion stage; Has 20 Blast hits to 20 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 2; Plants - 12; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G18270AT3G18270.1GACCCGAAa cytochrome P450 pseudogene. the second half of the gene overlaps perfectly with the other gene model.
AT3G18390AT3G18390.1GACCCGACembryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink).
AT3G18630AT3G18630.1GACCCGAAuracil DNA glycosylase family protein; FUNCTIONS IN: uracil DNA N-glycosylase activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Uracil-DNA glycosylase (InterPro:IPR002043), Uracil-DNA glycosylase-like (InterPro:IPR005122); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G10550.1); Has 3474 Blast hits to 3474 proteins in 1242 species: Archae - 0; Bacteria - 2123; Metazoa - 111; Fungi - 87; Plants - 30; Viruses - 206; Other Eukaryotes - 917 (source: NCBI BLink).
AT3G18640AT3G18640.1GTGGGACCzinc finger protein-related; FUNCTIONS IN: zinc ion binding, nucleic acid binding; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G26850.2); Has 2001 Blast hits to 1797 proteins in 176 species: Archae - 1; Bacteria - 29; Metazoa - 857; Fungi - 186; Plants - 139; Viruses - 45; Other Eukaryotes - 744 (source: NCBI BLink).
AT3G18890AT3G18890.1GTGGGTCCCAbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: flavin reductase-related (TAIR:AT2G34460.1); Has 22640 Blast hits to 13883 proteins in 1103 species: Archae - 75; Bacteria - 3686; Metazoa - 9197; Fungi - 3839; Plants - 1321; Viruses - 607; Other Eukaryotes - 3915 (source: NCBI BLink).
AT3G19010AT3G19010.1TGACCCGACCCoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: flavonol synthase activity, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19000.1); Has 6168 Blast hits to 6134 proteins in 688 species: Archae - 0; Bacteria - 727; Metazoa - 131; Fungi - 671; Plants - 3106; Viruses - 0; Other Eukaryotes - 1533 (source: NCBI BLink).
AT3G19010.2TGACCCGACCCoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: flavonol synthase activity, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G19000.1); Has 6168 Blast hits to 6134 proteins in 688 species: Archae - 0; Bacteria - 727; Metazoa - 131; Fungi - 671; Plants - 3106; Viruses - 0; Other Eukaryotes - 1533 (source: NCBI BLink).
AT3G19520AT3G19520.1CCGACCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G19520.2CCGACCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28500.1); Has 77 Blast hits to 76 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G20080AT3G20080.1GGTCCCACmember of CYP705A
AT3G20080.2GGTCCCACmember of CYP705A
AT3G20080.3GGTCCCACmember of CYP705A
AT3G20870AT3G20870.1TTCGGGTCAmetal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G08650.2); Has 2198 Blast hits to 2183 proteins in 642 species: Archae - 78; Bacteria - 1120; Metazoa - 489; Fungi - 73; Plants - 72; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink).
AT3G21220AT3G21220.1GACCCGACCEncodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4.In plants with both MKK5 and MKK6 levels reduced by RNAi plants, floral organs do not abscise suggestion a role for both proteins in mediating floral organ abscission.
AT3G21290AT3G21290.1TTCGGGTCGGGTTdentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Occludin and RNA polymerase II elongation factor ELL domain (InterPro:IPR010844); Has 15416 Blast hits to 7392 proteins in 559 species: Archae - 48; Bacteria - 5567; Metazoa - 4037; Fungi - 1335; Plants - 339; Viruses - 108; Other Eukaryotes - 3982 (source: NCBI BLink).
AT3G22460AT3G22460.1GTCGGGTCAAAEncodes a member of a family of genes with O-acetylserine(thiol)lyase activity.
AT3G22680AT3G22680.1CCGGGTCGGGTCGGTTCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1950 (InterPro:IPR015270); Has 12 Blast hits to 12 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G23150AT3G23150.1GTGGGACCInvolved in ethylene perception in Arabidopsis
AT3G24200AT3G24200.1GACCCGAAFAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).
AT3G24200.2GACCCGAAFAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink).
AT3G24520AT3G24520.1GGTCCCACmember of Heat Stress Transcription Factor (Hsf) family
AT3G26340AT3G26340.1TGACCCGAA20S proteasome beta subunit E, putative; FUNCTIONS IN: endopeptidase activity, threonine-type endopeptidase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome core complex; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Proteasome, beta-type subunit, conserved site (InterPro:IPR016050), Peptidase T1A, proteasome beta-subunit (InterPro:IPR000243), 20S proteasome, A and B subunits (InterPro:IPR001353); BEST Arabidopsis thaliana protein match is: PBE1; endopeptidase/ peptidase/ threonine-type endopeptidase (TAIR:AT1G13060.1); Has 4428 Blast hits to 4424 proteins in 409 species: Archae - 476; Bacteria - 181; Metazoa - 1589; Fungi - 914; Plants - 555; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink).
AT3G26511AT3G26511.1GTGGCCCACGTGATAATGGGTCCCunknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink).
AT3G27210AT3G27210.1GTGGGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40860.1); Has 132 Blast hits to 70 proteins in 18 species: Archae - 0; Bacteria - 6; Metazoa - 65; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT3G27350AT3G27350.1GTGGGACCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40700.1); Has 156 Blast hits to 128 proteins in 29 species: Archae - 0; Bacteria - 3; Metazoa - 69; Fungi - 4; Plants - 63; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink).
AT3G27416AT3G27416.1GACCCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 389 Blast hits to 362 proteins in 51 species: Archae - 0; Bacteria - 37; Metazoa - 207; Fungi - 19; Plants - 4; Viruses - 0; Other Eukaryotes - 122 (source: NCBI BLink).
AT3G27550AT3G27550.1CCCGGGTCgroup II intron splicing factor CRS1-related; FUNCTIONS IN: RNA binding; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: group II intron splicing factor CRS1-related (TAIR:AT4G13070.1); Has 9126 Blast hits to 4840 proteins in 369 species: Archae - 10; Bacteria - 3168; Metazoa - 2761; Fungi - 870; Plants - 511; Viruses - 93; Other Eukaryotes - 1713 (source: NCBI BLink).
AT3G27770AT3G27770.1GGTCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G27770.2GGTCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62960.1); Has 94 Blast hits to 93 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 13; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT3G27820AT3G27820.1GGTCCCACEncodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2
AT3G28920AT3G28920.1GGTCCCACARABIDOPSIS THALIANA HOMEOBOX PROTEIN 34 (AtHB34); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox domain, ZF-HD class (InterPro:IPR006455), ZF-HD homeobox protein Cys/His-rich dimerisation region (InterPro:IPR006456), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: AtHB23 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 23); DNA binding / transcription factor (TAIR:AT5G39760.1); Has 369 Blast hits to 363 proteins in 70 species: Archae - 0; Bacteria - 8; Metazoa - 31; Fungi - 30; Plants - 274; Viruses - 5; Other Eukaryotes - 21 (source: NCBI BLink).
AT3G42790AT3G42790.1TGACCCGACCCGAACCAAL3 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA.
AT3G46600AT3G46600.1GGACCCACscarecrow transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: scarecrow-like transcription factor 11 (SCL11) (TAIR:AT5G59450.1); Has 1351 Blast hits to 1311 proteins in 188 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 1346; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G46600.2GGACCCACscarecrow transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: scarecrow-like transcription factor 11 (SCL11) (TAIR:AT5G59450.1); Has 1351 Blast hits to 1311 proteins in 188 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 1346; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G46600.3GGACCCACscarecrow transcription factor family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to chitin, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GRAS transcription factor (InterPro:IPR005202); BEST Arabidopsis thaliana protein match is: scarecrow-like transcription factor 11 (SCL11) (TAIR:AT5G59450.1); Has 1351 Blast hits to 1311 proteins in 188 species: Archae - 0; Bacteria - 3; Metazoa - 2; Fungi - 0; Plants - 1346; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G46620AT3G46620.1GGTCCCACzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: response to chitin; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Protein of unknown function DUF1117 (InterPro:IPR010543); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G59550.1); Has 5953 Blast hits to 5931 proteins in 209 species: Archae - 0; Bacteria - 6; Metazoa - 2088; Fungi - 498; Plants - 2518; Viruses - 31; Other Eukaryotes - 812 (source: NCBI BLink).
AT3G47120AT3G47120.1AACCGAACCGACCCGAARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink).
AT3G47470AT3G47470.1GACCCGACEncodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins.
AT3G47500AT3G47500.1AACCCGACAACCCGACCCGGTDof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions.
AT3G48360AT3G48360.1GGACCCACencodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development.
AT3G48730AT3G48730.1ACCGGGTCglutamate-1-semialdehyde 2,1-aminomutase 2 (GSA2); FUNCTIONS IN: glutamate-1-semialdehyde 2,1-aminomutase activity, pyridoxal phosphate binding, transaminase activity, catalytic activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase class-III (InterPro:IPR005814), Tetrapyrrole biosynthesis, glutamate-1-semialdehyde aminotransferase (InterPro:IPR004639), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: GSA1 (GLUTAMATE-1-SEMIALDEHYDE-2,1-AMINOMUTASE); glutamate-1-semialdehyde 2,1-aminomutase (TAIR:AT5G63570.1); Has 22952 Blast hits to 22949 proteins in 1683 species: Archae - 419; Bacteria - 12643; Metazoa - 453; Fungi - 515; Plants - 232; Viruses - 10; Other Eukaryotes - 8680 (source: NCBI BLink).
AT3G50340AT3G50340.1GGACCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G67020.1); Has 59 Blast hits to 59 proteins in 21 species: Archae - 0; Bacteria - 23; Metazoa - 0; Fungi - 3; Plants - 32; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT3G50690AT3G50690.1AACCCGACCCGAACCGAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink).
AT3G51140AT3G51140.1CCCGGGTCINVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast inner membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: CDF1 (CELL GROWTH DEFECT FACTOR 1) (TAIR:AT5G23040.1); Has 133 Blast hits to 133 proteins in 42 species: Archae - 0; Bacteria - 60; Metazoa - 0; Fungi - 0; Plants - 57; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT3G51270AT3G51270.1CCCGGGTCATP binding / catalytic/ protein serine/threonine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RIO-like kinase (InterPro:IPR018934), RIO kinase (InterPro:IPR000687), Protein kinase-like (InterPro:IPR011009), RIO2 kinase, winged helix, N-terminal (InterPro:IPR015285); BEST Arabidopsis thaliana protein match is: RIO1 family protein (TAIR:AT5G37350.1); Has 12154 Blast hits to 7675 proteins in 577 species: Archae - 256; Bacteria - 1067; Metazoa - 4621; Fungi - 1373; Plants - 446; Viruses - 297; Other Eukaryotes - 4094 (source: NCBI BLink).
AT3G51840AT3G51840.1CCGACTTAACCGGGTCGGEncodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis.
AT3G52180AT3G52180.1GGGTCCCAATTGEncodes a plant-specific protein phosphatase that contains a protein tyrosine phosphatase (PTP) catalytic domain and a kinase interaction sequence (KIS) domain. This protein interacts with the plant SnRK AKIN11. Binds starch. Localized in the chloroplast.
AT3G52180.2GGGTCCCAATTGEncodes a plant-specific protein phosphatase that contains a protein tyrosine phosphatase (PTP) catalytic domain and a kinase interaction sequence (KIS) domain. This protein interacts with the plant SnRK AKIN11. Binds starch. Localized in the chloroplast.
AT3G52840AT3G52840.1GGGTCCCATTATbeta-galactosidase 2 (BGAL2); FUNCTIONS IN: cation binding, beta-galactosidase activity, catalytic activity; INVOLVED IN: lactose catabolic process, using glucoside 3-dehydrogenase, carbohydrate metabolic process, lactose catabolic process via UDP-galactose, lactose catabolic process; LOCATED IN: apoplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: BGAL12 (beta-galactosidase 12); beta-galactosidase/ catalytic/ cation binding (TAIR:AT4G26140.1); Has 1237 Blast hits to 1164 proteins in 255 species: Archae - 11; Bacteria - 346; Metazoa - 335; Fungi - 120; Plants - 370; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).
AT3G53470AT3G53470.1TGGGTCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G53470.2TGGGTCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G53620AT3G53620.1TTCGGGTCCGEncodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.
AT3G53800AT3G53800.1GGTCCCACarmadillo/beta-catenin repeat family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: armadillo/beta-catenin repeat family protein (TAIR:AT3G09350.1); Has 461 Blast hits to 458 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 169; Fungi - 134; Plants - 93; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink).
AT3G53970AT3G53970.1GACCCGGGproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).
AT3G53970.2GACCCGGGproteasome inhibitor-related; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PI31 proteasome regulator (InterPro:IPR013886); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G48530.1); Has 3642 Blast hits to 2517 proteins in 204 species: Archae - 2; Bacteria - 191; Metazoa - 2796; Fungi - 315; Plants - 64; Viruses - 13; Other Eukaryotes - 261 (source: NCBI BLink).
AT3G54000AT3G54000.1GGTCCCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G54000.2GGTCCCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G54000.3GGTCCCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G55850AT3G55850.1GTGGGACCCAEncodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.
AT3G56440AT3G56440.1GGGCCGGGTCGGGTCGGGTCGAtATG18d; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: AtATG18c (TAIR:AT2G40810.2); Has 1093 Blast hits to 1046 proteins in 176 species: Archae - 0; Bacteria - 24; Metazoa - 508; Fungi - 305; Plants - 110; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink).
AT3G56800AT3G56800.1CCCGGGTCGGencodes a calmodulin
AT3G58460AT3G58460.1CCGACCCGGTTARABIDOPSIS RHOMBOID-LIKE PROTEIN 15 (ATRBL15); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Peptidase S54, rhomboid (InterPro:IPR002610), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ATRBL14 (ARABIDOPSIS RHOMBOID-LIKE PROTEIN 14); zinc ion binding (TAIR:AT3G17611.1); Has 1918 Blast hits to 1918 proteins in 675 species: Archae - 50; Bacteria - 1104; Metazoa - 148; Fungi - 104; Plants - 162; Viruses - 3; Other Eukaryotes - 347 (source: NCBI BLink).
AT3G60370AT3G60370.1GTGGGTCCEncodes an immunophilin, FKBP20-2, that belongs to the FK-506 binding protein (FKBP) subfamily functioning as peptidyl-prolyl isomerases (PPIases) in protein folding. FKBP20-2 has a unique pair of cysteines at the C terminus and was found to be reduced by thioredoxin (Trx) (itself reduced by NADPH by means of NADP-Trx reductase). The FKBP20-2 protein, which contains only two of the five amino acids required for catalysis, showed a low level of PPIase activity that was unaffected on reduction by Trx. Genetic disruption of the FKBP20-2 gene provide evidence that FKBP20-2 participates specifically in the accumulation of the PSII supercomplex in the chloroplast thylakoid lumen by means of a mechanism that has yet to be determined.
AT3G60870AT3G60870.1TGGGTCCCADNA-binding protein-related; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF296 (InterPro:IPR005175), Predicted AT-hook DNA-binding (InterPro:IPR014476); BEST Arabidopsis thaliana protein match is: DNA-binding protein-related (TAIR:AT2G45430.1); Has 421 Blast hits to 420 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 419; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G61060AT3G61060.1AACCCGACCCGACCCGAArabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G61060.2AACCCGACCCGACCCGAArabidopsis thaliana phloem protein 2-A13 (AtPP2-A13); FUNCTIONS IN: carbohydrate binding; INVOLVED IN: response to wounding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: AtPP2-A12 (Phloem protein 2-A12); carbohydrate binding (TAIR:AT1G12710.1); Has 238 Blast hits to 236 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 238; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT3G61710AT3G61710.1CCCGGGTCautophagy protein Apg6 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy protein 6 (InterPro:IPR007243); Has 715 Blast hits to 685 proteins in 216 species: Archae - 7; Bacteria - 81; Metazoa - 283; Fungi - 103; Plants - 61; Viruses - 12; Other Eukaryotes - 168 (source: NCBI BLink).
AT3G61710.2CCCGGGTCautophagy protein Apg6 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy protein 6 (InterPro:IPR007243); Has 715 Blast hits to 685 proteins in 216 species: Archae - 7; Bacteria - 81; Metazoa - 283; Fungi - 103; Plants - 61; Viruses - 12; Other Eukaryotes - 168 (source: NCBI BLink).
AT3G61710.3CCCGGGTCautophagy protein Apg6 family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Autophagy protein 6 (InterPro:IPR007243); Has 715 Blast hits to 685 proteins in 216 species: Archae - 7; Bacteria - 81; Metazoa - 283; Fungi - 103; Plants - 61; Viruses - 12; Other Eukaryotes - 168 (source: NCBI BLink).
AT3G61990AT3G61990.1GGGTCCCAO-methyltransferase family 3 protein; FUNCTIONS IN: O-methyltransferase activity; LOCATED IN: cytosol; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 3 protein (TAIR:AT3G62000.1); Has 3681 Blast hits to 3679 proteins in 779 species: Archae - 35; Bacteria - 1538; Metazoa - 234; Fungi - 104; Plants - 444; Viruses - 0; Other Eukaryotes - 1326 (source: NCBI BLink).
AT3G62000AT3G62000.1TTTGACCCGACCCGGTTO-methyltransferase family 3 protein; FUNCTIONS IN: O-methyltransferase activity; LOCATED IN: cytosol; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: O-methyltransferase family 3 protein (TAIR:AT3G61990.1); Has 3642 Blast hits to 3640 proteins in 775 species: Archae - 31; Bacteria - 1513; Metazoa - 236; Fungi - 112; Plants - 446; Viruses - 0; Other Eukaryotes - 1304 (source: NCBI BLink).
AT3G62220AT3G62220.1GTGGGTCCCserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: serine/threonine protein kinase, putative (TAIR:AT2G47060.2); Has 82520 Blast hits to 81517 proteins in 3289 species: Archae - 50; Bacteria - 7570; Metazoa - 36328; Fungi - 6173; Plants - 18156; Viruses - 365; Other Eukaryotes - 13878 (source: NCBI BLink).
AT3G63010AT3G63010.1GTGGGACCCACEncodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4.
AT3G63150AT3G63150.1TCACGTGTCGGGTCAACCCGGTTEncodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response.
AT3G63370AT3G63370.1TGACCCGAApentatricopeptide (PPR) repeat-containing protein; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16480 Blast hits to 4859 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 42; Fungi - 46; Plants - 16142; Viruses - 0; Other Eukaryotes - 250 (source: NCBI BLink).
AT3G66658AT3G66658.1GTCGGGTCAAAEncodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures.
AT3G66658.2GTCGGGTCAAAEncodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures.
AT4G00090AT4G00090.1AACCCGACCCGACCCGGTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink).
AT4G00355AT4G00355.1GACCCGAACCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G00355.2GACCCGAACCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G00355.3GACCCGAACCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G00355.4GACCCGAACCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G45980.1); Has 59 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G00500AT4G00500.1CCGACCCGACCCGACCCGACCCGACCCGAClipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT4G00500.2CCGACCCGACCCGACCCGACCCGACCCGAClipase class 3 family protein / calmodulin-binding heat-shock protein-related; FUNCTIONS IN: triacylglycerol lipase activity, calmodulin binding; INVOLVED IN: lipid catabolic process, lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921), Mono- and diacylglycerol lipase, N-terminal (InterPro:IPR005592); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein / calmodulin-binding heat-shock protein, putative (TAIR:AT3G49050.1); Has 376 Blast hits to 375 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 145; Fungi - 42; Plants - 130; Viruses - 0; Other Eukaryotes - 59 (source: NCBI BLink).
AT4G00520AT4G00520.2GTCGGGTCGGGTCGGGTCGGGTCGGGTCGGacyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).
AT4G00520.3GTCGGGTCGGGTCGGGTCGGGTCGGGTCGGacyl-CoA thioesterase family protein; FUNCTIONS IN: acyl-CoA thioesterase activity; INVOLVED IN: acyl-CoA metabolic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclic nucleotide-binding (InterPro:IPR000595), Cyclic nucleotide-binding-like (InterPro:IPR018490), Acyl-CoA thioesterase (InterPro:IPR003703), RmlC-like jelly roll fold (InterPro:IPR014710); BEST Arabidopsis thaliana protein match is: acyl-CoA thioesterase family protein (TAIR:AT1G01710.1); Has 2409 Blast hits to 2399 proteins in 576 species: Archae - 0; Bacteria - 1072; Metazoa - 364; Fungi - 190; Plants - 32; Viruses - 0; Other Eukaryotes - 751 (source: NCBI BLink).
AT4G01090AT4G01090.1GACCCGGTextra-large G-protein-related; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: extra-large G-protein-related (TAIR:AT1G01440.1); Has 1293 Blast hits to 1199 proteins in 189 species: Archae - 0; Bacteria - 45; Metazoa - 453; Fungi - 263; Plants - 305; Viruses - 2; Other Eukaryotes - 225 (source: NCBI BLink).
AT4G01330AT4G01330.1GGTCCCACATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G01540.2); Has 62408 Blast hits to 61982 proteins in 2735 species: Archae - 19; Bacteria - 4713; Metazoa - 27742; Fungi - 4275; Plants - 16191; Viruses - 174; Other Eukaryotes - 9294 (source: NCBI BLink).
AT4G02060AT4G02060.1GACCCGGGMember of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin.
AT4G02700AT4G02700.1GTGGGTCCsulfate transporter 3;2 (SULTR3;2); FUNCTIONS IN: sulfate transmembrane transporter activity; INVOLVED IN: sulfate transport, transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sulphate transporter (InterPro:IPR011547), Sulphate transporter/antisigma-factor antagonist STAS (InterPro:IPR002645), Sulphate anion transporter, conserved site (InterPro:IPR018045), Sulphate anion transporter (InterPro:IPR001902); BEST Arabidopsis thaliana protein match is: SULTR3;1 (SULFATE TRANSPORTER 3;1); secondary active sulfate transmembrane transporter/ sulfate transmembrane transporter/ transporter (TAIR:AT3G51895.1); Has 6707 Blast hits to 6650 proteins in 1091 species: Archae - 34; Bacteria - 3425; Metazoa - 985; Fungi - 298; Plants - 324; Viruses - 0; Other Eukaryotes - 1641 (source: NCBI BLink).
AT4G03390AT4G03390.1CGGTTTAGACCCGGTTAASTRUBBELIG-RECEPTOR FAMILY 3 (SRF3); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF1 (strubbelig receptor family 1); kinase (TAIR:AT2G20850.1); Has 104562 Blast hits to 78934 proteins in 2893 species: Archae - 52; Bacteria - 7276; Metazoa - 35203; Fungi - 5374; Plants - 43078; Viruses - 296; Other Eukaryotes - 13283 (source: NCBI BLink).
AT4G03390.1GGTCCCACSTRUBBELIG-RECEPTOR FAMILY 3 (SRF3); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: SRF1 (strubbelig receptor family 1); kinase (TAIR:AT2G20850.1); Has 104562 Blast hits to 78934 proteins in 2893 species: Archae - 52; Bacteria - 7276; Metazoa - 35203; Fungi - 5374; Plants - 43078; Viruses - 296; Other Eukaryotes - 13283 (source: NCBI BLink).
AT4G04190AT4G04190.1GTGGGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G04190.2GTGGGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 13 growth stages; Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G07410AT4G07410.1GGTCGGGTCGAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink).
AT4G07410.2GGTCGGGTCGAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin-related / WD-40 repeat protein-related (TAIR:AT1G27470.1); Has 7930 Blast hits to 5136 proteins in 341 species: Archae - 14; Bacteria - 2432; Metazoa - 2063; Fungi - 1810; Plants - 493; Viruses - 0; Other Eukaryotes - 1118 (source: NCBI BLink).
AT4G09680AT4G09680.1AACCCGGTCGGGTCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G09680.1TTCGGGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G09680.2AACCCGGTCGGGTCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G09680.2TTCGGGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G11010AT4G11010.1AACCCGACCCGAAnucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria
AT4G12005AT4G12005.1GACCCGGTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 2 Blast hits to 2 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 2; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G12700AT4G12700.1CCCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G04280.1); Has 77 Blast hits to 77 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G12870AT4G12870.1GGACCCACGTGgamma interferon responsive lysosomal thiol reductase family protein / GILT family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Gamma interferon inducible lysosomal thiol reductase GILT (InterPro:IPR004911); BEST Arabidopsis thaliana protein match is: gamma interferon responsive lysosomal thiol reductase family protein / GILT family protein (TAIR:AT4G12900.1); Has 343 Blast hits to 340 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink).
AT4G14740AT4G14740.3TGGGTCCCphosphoinositide binding; FUNCTIONS IN: phosphoinositide binding; INVOLVED IN: signal transduction; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Pleckstrin-like, plant (InterPro:IPR013666), Protein of unknown function DUF828, plant (InterPro:IPR008546); BEST Arabidopsis thaliana protein match is: phosphoinositide binding (TAIR:AT3G22810.1); Has 435 Blast hits to 313 proteins in 75 species: Archae - 0; Bacteria - 60; Metazoa - 80; Fungi - 18; Plants - 135; Viruses - 9; Other Eukaryotes - 133 (source: NCBI BLink).
AT4G15910AT4G15910.1GTGGGTCCencodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants.
AT4G16260AT4G16260.1TGACCCGACcatalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: cell wall, plasma membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: BG1 (BETA-1,3-GLUCANASE 1); catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT3G57270.1); Has 1374 Blast hits to 1365 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1371; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G16450AT4G16450.1TAAATGGGCTCATTCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 25; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G17340AT4G17340.1GTGGGACCTONOPLAST INTRINSIC PROTEIN 2;2 (TIP2;2); FUNCTIONS IN: water channel activity; INVOLVED IN: transport, response to salt stress; LOCATED IN: plasma membrane, chloroplast, vacuole, membrane; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aquaporin (InterPro:IPR012269), Major intrinsic protein (InterPro:IPR000425); BEST Arabidopsis thaliana protein match is: AtTIP2;3; ammonia transporter/ methylammonium transmembrane transporter/ water channel (TAIR:AT5G47450.1); Has 6879 Blast hits to 6845 proteins in 1255 species: Archae - 57; Bacteria - 2652; Metazoa - 1285; Fungi - 264; Plants - 1472; Viruses - 2; Other Eukaryotes - 1147 (source: NCBI BLink).
AT4G17720AT4G17720.1GGTCCCACRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: oxidoreductase activity, nucleotide binding, nucleic acid binding; INVOLVED IN: oxidation reduction; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G46870.1); Has 381 Blast hits to 361 proteins in 83 species: Archae - 2; Bacteria - 16; Metazoa - 30; Fungi - 84; Plants - 147; Viruses - 12; Other Eukaryotes - 90 (source: NCBI BLink).
AT4G18060AT4G18060.1TCGACCCGACCCGclathrin binding; FUNCTIONS IN: clathrin binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Neutrophil cytosol factor 2 (InterPro:IPR000108), Src homology-3 domain (InterPro:IPR001452); BEST Arabidopsis thaliana protein match is: SH3 domain-containing protein 2 (SH3P2) (TAIR:AT4G34660.1); Has 2031 Blast hits to 1692 proteins in 137 species: Archae - 0; Bacteria - 6; Metazoa - 1668; Fungi - 93; Plants - 91; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).
AT4G18460AT4G18460.1TTCGGGTCD-Tyr-tRNA(Tyr) deacylase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: D-amino acid catabolic process; LOCATED IN: cytoplasm; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-tyrosyl-tRNA(Tyr) deacylase (InterPro:IPR003732); Has 3035 Blast hits to 3034 proteins in 1108 species: Archae - 3; Bacteria - 2050; Metazoa - 120; Fungi - 93; Plants - 20; Viruses - 0; Other Eukaryotes - 749 (source: NCBI BLink).
AT4G18465AT4G18465.1GACCCGAARNA helicase, putative; FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 7224 Blast hits to 6791 proteins in 1024 species: Archae - 6; Bacteria - 1974; Metazoa - 1905; Fungi - 796; Plants - 374; Viruses - 693; Other Eukaryotes - 1476 (source: NCBI BLink).
AT4G18730AT4G18730.1GACCCGGGencodes a cytosolic ribosomal protein L16, which is a constituent of 60S large ribosomal complex. Gene is expressed in root and shoot apical meristems and in lateral root primordia. Expression in lateral root primordia is induced by auxin.
AT4G18780AT4G18780.1AACCCGACCCGAATAAACCGGATEncodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling.
AT4G18810AT4G18810.1GACCCGGGbinding / catalytic/ transcription repressor; FUNCTIONS IN: transcription repressor activity, binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, metabolic process; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), NADH:ubiquinone oxidoreductase complex I intermediate-associated protein 30 (InterPro:IPR013857), NmrA-like (InterPro:IPR008030); BEST Arabidopsis thaliana protein match is: HCF173 (high chlorophyll fluorescence phenotype 173); binding / catalytic/ transcription repressor (TAIR:AT1G16720.1); Has 1715 Blast hits to 1540 proteins in 261 species: Archae - 12; Bacteria - 728; Metazoa - 8; Fungi - 25; Plants - 255; Viruses - 0; Other Eukaryotes - 687 (source: NCBI BLink).
AT4G18880AT4G18880.1ACCGGGTCmember of Heat Stress Transcription Factor (Hsf) family
AT4G19120AT4G19120.1TGGGTCCCAAAACGCCearly-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT4G19120.2TGGGTCCCAAAACGCCearly-responsive to dehydration 3 (ERD3); INVOLVED IN: response to water deprivation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein, putative (TAIR:AT1G31850.3); Has 578 Blast hits to 564 proteins in 56 species: Archae - 4; Bacteria - 67; Metazoa - 0; Fungi - 3; Plants - 484; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).
AT4G19600AT4G19600.1TTCGGGTCAEncodes a cyclin T partner CYCT1;4. Plays important roles in infection with Cauliflower mosaic virus (CaMV).
AT4G20070AT4G20070.1TGGGTCCCAThe gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis.
AT4G20860AT4G20860.1TTTGACCCGAAFAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; INVOLVED IN: response to cyclopentenone; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, LP.10 ten leaves visible, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Oxygen oxidoreductase covalent FAD-binding site (InterPro:IPR006093), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT5G44360.1); Has 3032 Blast hits to 2927 proteins in 504 species: Archae - 28; Bacteria - 1241; Metazoa - 4; Fungi - 1147; Plants - 342; Viruses - 0; Other Eukaryotes - 270 (source: NCBI BLink).
AT4G20930AT4G20930.1TGGGTCCCAC3-hydroxyisobutyrate dehydrogenase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, valine catabolic process, metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), 3-hydroxyisobutyrate dehydrogenase (InterPro:IPR011548), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: GLYR2 (GLYOXYLATE REDUCTASE 2); glyoxylate reductase (NADP)/ phosphogluconate dehydrogenase (decarboxylating) (TAIR:AT1G17650.1); Has 10362 Blast hits to 10344 proteins in 1053 species: Archae - 94; Bacteria - 4661; Metazoa - 269; Fungi - 232; Plants - 134; Viruses - 2; Other Eukaryotes - 4970 (source: NCBI BLink).
AT4G20940AT4G20940.1TGGGACCCAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction, N-terminal protein myristoylation; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATP binding / protein binding / protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT2G27060.1); Has 81430 Blast hits to 31231 proteins in 1030 species: Archae - 46; Bacteria - 4321; Metazoa - 29495; Fungi - 1107; Plants - 40796; Viruses - 21; Other Eukaryotes - 5644 (source: NCBI BLink).
AT4G22200AT4G22200.1ATATTGGGACCCEncodes a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential.
AT4G22260AT4G22260.1CCCGGGTCGGSimilar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues.
AT4G22840AT4G22840.1GGGTCGGGTCbile acid:sodium symporter family protein; FUNCTIONS IN: transporter activity, bile acid:sodium symporter activity; INVOLVED IN: sodium ion transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bile acid:sodium symporter (InterPro:IPR002657); BEST Arabidopsis thaliana protein match is: bile acid:sodium symporter family protein (TAIR:AT4G12030.2); Has 2570 Blast hits to 2568 proteins in 443 species: Archae - 24; Bacteria - 852; Metazoa - 337; Fungi - 0; Plants - 149; Viruses - 0; Other Eukaryotes - 1208 (source: NCBI BLink).
AT4G22850AT4G22850.1AACCCGACCCGACCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).
AT4G22850.1TGGGACCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).
AT4G22850.2AACCCGACCCGACCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).
AT4G22850.2TGGGACCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SNARE associated Golgi protein (InterPro:IPR015414); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G12000.1); Has 1331 Blast hits to 1328 proteins in 349 species: Archae - 4; Bacteria - 600; Metazoa - 103; Fungi - 64; Plants - 162; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink).
AT4G23180AT4G23180.1GACCCGACEncodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307)
AT4G23660AT4G23660.1TGGGTCCCEncodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50).
AT4G23660.2TGGGTCCCEncodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50).
AT4G23930AT4G23930.1TCGACCCGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G23930.2TCGACCCGACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G24110AT4G24110.1TTTGACCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; Has 49 Blast hits to 49 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G24470AT4G24470.1GTCGGGTCGZIM is a putative transcription factor containing an atypical GATA-type zinc-finger motif.
AT4G24470.2GTCGGGTCGZIM is a putative transcription factor containing an atypical GATA-type zinc-finger motif.
AT4G24520AT4G24520.1GGACCCACEncodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism.
AT4G24780AT4G24780.1GTGGGACCpectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT5G63180.1); Has 863 Blast hits to 860 proteins in 162 species: Archae - 0; Bacteria - 350; Metazoa - 0; Fungi - 105; Plants - 397; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink).
AT4G25050AT4G25050.1GTGGGACCCACencodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light.
AT4G25070AT4G25070.1TGGGTCCCACunknown protein; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G48860.2); Has 11240 Blast hits to 8282 proteins in 751 species: Archae - 101; Bacteria - 1089; Metazoa - 6264; Fungi - 802; Plants - 358; Viruses - 71; Other Eukaryotes - 2555 (source: NCBI BLink).
AT4G25070.2TGGGTCCCACunknown protein; EXPRESSED IN: cultured cell; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G48860.2); Has 11240 Blast hits to 8282 proteins in 751 species: Archae - 101; Bacteria - 1089; Metazoa - 6264; Fungi - 802; Plants - 358; Viruses - 71; Other Eukaryotes - 2555 (source: NCBI BLink).
AT4G25080AT4G25080.1TGGGTCCCAEncodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope.
AT4G25080.2TGGGTCCCAEncodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope.
AT4G25080.3TGGGTCCCAEncodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope.
AT4G25080.4TGGGTCCCAEncodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope.
AT4G25260AT4G25260.1GGACCCACinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: shade avoidance; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein / DC 1.2 homolog (FL5-2I22) (TAIR:AT5G62350.1); Has 406 Blast hits to 401 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 406; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G25620AT4G25620.1AAGCGCGTGGGTCCAAACCGhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink).
AT4G25672AT4G25672.1GGACCCACUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF12 represents a conserved upstream opening reading frame relative to major ORF AT4G25670.1
AT4G26140AT4G26140.1TGGGTCCCACputative beta-galactosidase
AT4G26140.2TGGGTCCCACputative beta-galactosidase
AT4G26555AT4G26555.1GTGGGTCCCACimmunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin / FKBP-type peptidyl-prolyl cis-trans isomerase family protein (TAIR:AT4G19830.1); Has 2159 Blast hits to 2148 proteins in 673 species: Archae - 12; Bacteria - 1209; Metazoa - 160; Fungi - 145; Plants - 239; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink).
AT4G26690AT4G26690.1CCGACCCGACCGlycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development.
AT4G27370AT4G27370.1GTCGGGTCAmember of Myosin-like proteins
AT4G28250AT4G28250.1GTGGGTCCputative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT4G28250.2GTGGGTCCputative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT4G30010AT4G30010.1CCGACCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 26 Blast hits to 26 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G30190AT4G30190.1GGACCCACbelongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal dom
AT4G30190.1TGGGACCCACbelongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal dom
AT4G30780AT4G30780.1GTGGGACCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G24100.1); Has 52 Blast hits to 52 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink).
AT4G30940AT4G30940.1GGTCCCACpotassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT2G24240.1); Has 948 Blast hits to 933 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 800; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31150AT4G31150.1TGACCCGACCCGendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31150.2TGACCCGACCCGendonuclease V family protein; FUNCTIONS IN: endonuclease activity; INVOLVED IN: DNA repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease V (InterPro:IPR007581); Has 791 Blast hits to 791 proteins in 366 species: Archae - 97; Bacteria - 529; Metazoa - 66; Fungi - 5; Plants - 17; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink).
AT4G31200AT4G31200.1TTCGGGTCGGGTTSWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).
AT4G31200.2TTCGGGTCGGGTTSWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).
AT4G31200.3TTCGGGTCGGGTTSWAP (Suppressor-of-White-APricot)/surp domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SWAP/Surp (InterPro:IPR000061), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569); Has 14318 Blast hits to 9470 proteins in 529 species: Archae - 6; Bacteria - 561; Metazoa - 6216; Fungi - 2574; Plants - 2742; Viruses - 216; Other Eukaryotes - 2003 (source: NCBI BLink).
AT4G31210AT4G31210.1AACCCGACCCGAADNA topoisomerase family protein; FUNCTIONS IN: DNA topoisomerase activity, DNA topoisomerase type I activity, DNA binding, nucleic acid binding; INVOLVED IN: DNA topological change, DNA unwinding during replication, DNA metabolic process; LOCATED IN: chromosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA topoisomerase, type IA, zn finger (InterPro:IPR013498), DNA topoisomerase, type IA, core (InterPro:IPR000380), DNA topoisomerase, type IA, DNA-binding (InterPro:IPR003602), DNA topoisomerase, type IA, domain 2 (InterPro:IPR003601), DNA topoisomerase, type IA, central (InterPro:IPR013497), DNA topoisomerase, type IA, central region, subdomain 3 (InterPro:IPR013826), DNA topoisomerase I, bacterial-type (InterPro:IPR005733), Toprim subdomain (InterPro:IPR006154), DNA topoisomerase, type IA, central region, subdomain 1 (InterPro:IPR013824), TOPRIM (InterPro:IPR006171); BEST Arabidopsis thaliana protein match is: DNA topoisomerase III alpha, putative (TAIR:AT5G63920.1); Has 15959 Blast hits to 13205 proteins in 1711 species: Archae - 250; Bacteria - 5099; Metazoa - 1724; Fungi - 605; Plants - 147; Viruses - 34; Other Eukaryotes - 8100 (source: NCBI BLink).
AT4G31560AT4G31560.1TCGGGTCGGGTCAEncodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane.
AT4G32030AT4G32030.1TGGGTCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 35 Blast hits to 33 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT4G32030.2TGGGTCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; Has 35 Blast hits to 33 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT4G32470AT4G32470.1CCCGGGTCubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G32470.2CCCGGGTCubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink).
AT4G34050AT4G34050.1GGGACCCACcaffeoyl-CoA 3-O-methyltransferase, putative; FUNCTIONS IN: caffeoyl-CoA O-methyltransferase activity; INVOLVED IN: coumarin biosynthetic process, response to cadmium ion; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: caffeoyl-CoA 3-O-methyltransferase, putative (TAIR:AT4G26220.1); Has 3455 Blast hits to 3452 proteins in 740 species: Archae - 19; Bacteria - 1446; Metazoa - 216; Fungi - 70; Plants - 444; Viruses - 0; Other Eukaryotes - 1260 (source: NCBI BLink).
AT4G34050.2GGGACCCACcaffeoyl-CoA 3-O-methyltransferase, putative; FUNCTIONS IN: caffeoyl-CoA O-methyltransferase activity; INVOLVED IN: coumarin biosynthetic process, response to cadmium ion; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: O-methyltransferase, family 3 (InterPro:IPR002935); BEST Arabidopsis thaliana protein match is: caffeoyl-CoA 3-O-methyltransferase, putative (TAIR:AT4G26220.1); Has 3455 Blast hits to 3452 proteins in 740 species: Archae - 19; Bacteria - 1446; Metazoa - 216; Fungi - 70; Plants - 444; Viruses - 0; Other Eukaryotes - 1260 (source: NCBI BLink).
AT4G34090AT4G34090.1GGCCTAACCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G34090.2GGCCTAACCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink).
AT4G34100AT4G34100.1GACCCGGTTAGGCCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink).
AT4G34100.2GACCCGGTTAGGCCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink).
AT4G34700AT4G34700.1GACCCGGGcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink).
AT4G34740AT4G34740.1GGGACCCACEncodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage.
AT4G34830AT4G34830.1CCGACCCGAALOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: EMB2745 (EMBRYO DEFECTIVE 2745) (TAIR:AT5G39710.1); Has 19818 Blast hits to 5849 proteins in 171 species: Archae - 3; Bacteria - 16; Metazoa - 570; Fungi - 397; Plants - 17732; Viruses - 0; Other Eukaryotes - 1100 (source: NCBI BLink).
AT4G34840AT4G34840.1TTCGGGTCGGATMTN2; FUNCTIONS IN: methylthioadenosine nucleosidase activity; INVOLVED IN: nucleoside metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleoside phosphorylase (InterPro:IPR000845), Nucleoside phosphorylase, family 1 (InterPro:IPR018017); BEST Arabidopsis thaliana protein match is: ATMTN1; catalytic/ methylthioadenosine nucleosidase (TAIR:AT4G38800.1); Has 1301 Blast hits to 1301 proteins in 595 species: Archae - 0; Bacteria - 1215; Metazoa - 0; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink).
AT4G34860AT4G34860.1GTACACGTGGACCCACbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT4G34860.2GTACACGTGGACCCACbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: sucrose catabolic process, using beta-fructofuranosidase; LOCATED IN: cytosol; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT4G09510.1); Has 530 Blast hits to 529 proteins in 80 species: Archae - 0; Bacteria - 110; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).
AT4G35010AT4G35010.1GGGACCCAputative beta-galactosidase (BGAL11 gene)
AT4G35730AT4G35730.1GTGGGACCunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink).
AT4G35750AT4G35750.1GGACCCACRho-GTPase-activating protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10210.1); Has 313 Blast hits to 313 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 237; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).
AT4G35880AT4G35880.1GTGGGACCCAaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: anchored to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: aspartyl protease family protein (TAIR:AT2G17760.1); Has 1593 Blast hits to 1587 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 284; Fungi - 199; Plants - 1019; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink).
AT4G36040AT4G36040.1CCGACCCGACDNAJ heat shock N-terminal domain-containing protein (J11); FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock protein, putative (TAIR:AT2G17880.1); Has 12724 Blast hits to 12724 proteins in 1824 species: Archae - 85; Bacteria - 4544; Metazoa - 2505; Fungi - 1062; Plants - 954; Viruses - 5; Other Eukaryotes - 3569 (source: NCBI BLink).
AT4G36210AT4G36210.1GACCCGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT4G36210.2GACCCGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT4G36210.3GACCCGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF726 (InterPro:IPR007941); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18100.1); Has 517 Blast hits to 490 proteins in 158 species: Archae - 10; Bacteria - 78; Metazoa - 130; Fungi - 157; Plants - 42; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).
AT4G37390AT4G37390.1GTGGGTCCCEncodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity.
AT4G37610AT4G37610.1GTGGGTCCCABTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves.
AT4G37700AT4G37700.1GGGACCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65925.1); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT4G38825AT4G38825.1GGTCCCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT5G18030.1); Has 584 Blast hits to 581 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 583; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT4G38830AT4G38830.1GGTCCCACprotein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: stem, root; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Protein of unknown function DUF26 (InterPro:IPR002902), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT4G21410.1); Has 89734 Blast hits to 88617 proteins in 3182 species: Archae - 49; Bacteria - 7747; Metazoa - 38997; Fungi - 7320; Plants - 19858; Viruses - 404; Other Eukaryotes - 15359 (source: NCBI BLink).
AT4G38920AT4G38920.1GACCCGGGVACUOLAR-TYPE H(+)-ATPASE C3 (ATVHA-C3); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: AVA-P1; ATPase/ proton-transporting ATPase, rotational mechanism (TAIR:AT4G34720.1); Has 1818 Blast hits to 1637 proteins in 400 species: Archae - 127; Bacteria - 312; Metazoa - 519; Fungi - 315; Plants - 225; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink).
AT4G39350AT4G39350.1GGGACCCACEncodes a cellulose synthase isomer, related to CESA6.
AT4G39710AT4G39710.1GTGGGTCCCAimmunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6176 Blast hits to 5824 proteins in 1083 species: Archae - 68; Bacteria - 2849; Metazoa - 1385; Fungi - 335; Plants - 363; Viruses - 0; Other Eukaryotes - 1176 (source: NCBI BLink).
AT4G39770AT4G39770.1GGACCCACtrehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: catalytic/ trehalose-phosphatase (TAIR:AT2G22190.1); Has 1503 Blast hits to 1499 proteins in 531 species: Archae - 29; Bacteria - 768; Metazoa - 195; Fungi - 108; Plants - 274; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).
AT4G39800AT4G39800.1GTGGGACCCA** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT4G39990AT4G39990.1TGGGACCCGTP-binding protein ATGB3
AT5G01370AT5G01370.1GTGGGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 1409 Blast hits to 1156 proteins in 159 species: Archae - 0; Bacteria - 100; Metazoa - 453; Fungi - 138; Plants - 56; Viruses - 1; Other Eukaryotes - 661 (source: NCBI BLink).
AT5G01650AT5G01650.1TTCGGGTCmacrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).
AT5G01650.2TTCGGGTCmacrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1).
AT5G01760AT5G01760.1GTGGGACCVHS domain-containing protein / GAT domain-containing protein; FUNCTIONS IN: protein transporter activity; INVOLVED IN: intracellular protein transport, intra-Golgi vesicle-mediated transport; LOCATED IN: Golgi stack, intracellular; CONTAINS InterPro DOMAIN/s: VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS subgroup (InterPro:IPR018205), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: VHS domain-containing protein / GAT domain-containing protein (TAIR:AT2G38410.1); Has 1339 Blast hits to 1327 proteins in 151 species: Archae - 0; Bacteria - 8; Metazoa - 746; Fungi - 331; Plants - 152; Viruses - 2; Other Eukaryotes - 100 (source: NCBI BLink).
AT5G02580AT5G02580.1TTCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G02580.2TTCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP01589, plant (InterPro:IPR006476); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G55240.1); Has 107 Blast hits to 107 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).
AT5G03560AT5G03560.1GACCCGAAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2).
AT5G03560.2GACCCGAAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2).
AT5G03630AT5G03630.1ACCGGGTCAAAATMDAR2; FUNCTIONS IN: monodehydroascorbate reductase (NADH) activity; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: cytosol; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), FAD/NAD-linked reductase, dimerisation (InterPro:IPR016156); BEST Arabidopsis thaliana protein match is: MDHAR (MONODEHYDROASCORBATE REDUCTASE); monodehydroascorbate reductase (NADH) (TAIR:AT3G09940.1); Has 15548 Blast hits to 15528 proteins in 1711 species: Archae - 317; Bacteria - 10742; Metazoa - 673; Fungi - 378; Plants - 332; Viruses - 0; Other Eukaryotes - 3106 (source: NCBI BLink).
AT5G04750AT5G04750.1ACCCGACCCGGTF1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G04750.1CGGACCCGAAF1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G04750.2ACCCGACCCGGTF1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G04750.2CGGACCCGAAF1F0-ATPase inhibitor protein, putative; FUNCTIONS IN: ATPase inhibitor activity; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 33 Blast hits to 33 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G05950AT5G05950.1GACCCGGGmaternal effect embryo arrest 60 (MEE60); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46890.1); Has 64 Blast hits to 64 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 64; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G06410AT5G06410.1GACCCGGTTGACCCGGTDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: protein binding, heat shock protein binding, chaperone binding; INVOLVED IN: protein folding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock cognate protein B, C-terminal oligomerisation (InterPro:IPR009073), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Co-chaperone Hsc20 (InterPro:IPR004640); Has 1232 Blast hits to 1232 proteins in 576 species: Archae - 0; Bacteria - 899; Metazoa - 98; Fungi - 66; Plants - 20; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink).
AT5G06850AT5G06850.1TTCGGGTCGC2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT5G48060.1); Has 1175 Blast hits to 999 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 573; Fungi - 10; Plants - 560; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).
AT5G07120AT5G07120.1CGGACCCGGTSORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).
AT5G07120.1CGGGTCGGGTCAAASORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).
AT5G07120.1TGACCCGAASORTING NEXIN 2b (SNX2b); FUNCTIONS IN: protein binding, phosphoinositide binding; INVOLVED IN: intracellular signaling cascade, cell communication; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Vps5 C-terminal (InterPro:IPR015404), Phox-like (InterPro:IPR001683); BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 1877 Blast hits to 1867 proteins in 192 species: Archae - 11; Bacteria - 46; Metazoa - 1184; Fungi - 380; Plants - 83; Viruses - 0; Other Eukaryotes - 173 (source: NCBI BLink).
AT5G07890AT5G07890.1TTTGACCCGAACCGACCCGACCmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).
AT5G07890.2TTTGACCCGAACCGACCCGACCmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).
AT5G07890.3TTTGACCCGAACCGACCCGACCmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink).
AT5G07900AT5G07900.1GGTCGGGTCGGTTCGGGTCAAAmitochondrial transcription termination factor family protein / mTERF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G21150.1); Has 434 Blast hits to 369 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).
AT5G07970AT5G07970.1CGGACCCGAAdentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G07980.1); Has 597 Blast hits to 418 proteins in 73 species: Archae - 0; Bacteria - 68; Metazoa - 170; Fungi - 26; Plants - 66; Viruses - 0; Other Eukaryotes - 267 (source: NCBI BLink).
AT5G07970.1GACCCGAAdentin sialophosphoprotein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G07980.1); Has 597 Blast hits to 418 proteins in 73 species: Archae - 0; Bacteria - 68; Metazoa - 170; Fungi - 26; Plants - 66; Viruses - 0; Other Eukaryotes - 267 (source: NCBI BLink).
AT5G08330AT5G08330.1GTGGGACCCTCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G23280.1); Has 741 Blast hits to 732 proteins in 146 species: Archae - 0; Bacteria - 2; Metazoa - 30; Fungi - 0; Plants - 703; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).
AT5G10100AT5G10100.1CCCATTATTAGGCCCAGTAGGTCCCACtrehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: embryo, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT5G65140.1); Has 1468 Blast hits to 1466 proteins in 515 species: Archae - 29; Bacteria - 765; Metazoa - 195; Fungi - 100; Plants - 258; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).
AT5G10110AT5G10110.1GTGGGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G10740AT5G10740.1GGACCCACGTGprotein phosphatase 2C-related / PP2C-related; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT5G24940.1); Has 5631 Blast hits to 5529 proteins in 624 species: Archae - 9; Bacteria - 1045; Metazoa - 1489; Fungi - 552; Plants - 1360; Viruses - 11; Other Eukaryotes - 1165 (source: NCBI BLink).
AT5G10745AT5G10745.1CACGTGGGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G10780AT5G10780.1GACCCGACCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT5G10780.2GACCCGACCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink).
AT5G12240AT5G12240.1CCCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; Has 22 Blast hits to 20 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G13280AT5G13280.1GACCCGAAAsp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH).
AT5G13640AT5G13640.1GGTCGGGTCarabidopsis phospholipid:diacylglycerol acyltransferase (PDAT)
AT5G13680AT5G13680.1ATAAACCGGGTCA subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1–ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate.
AT5G13690AT5G13690.1GACCCGGTTTATalpha-N-acetylglucosaminidase family / NAGLU family; FUNCTIONS IN: alpha-N-acetylglucosaminidase activity; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha-N-acetylglucosaminidase (InterPro:IPR007781); Has 254 Blast hits to 246 proteins in 93 species: Archae - 0; Bacteria - 100; Metazoa - 87; Fungi - 20; Plants - 23; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).
AT5G14170AT5G14170.1CGGGTCGGGTCCHC1 is predicted to encode a protein that belongs to the chromodomain remodeling complex. Two RNAi knock-down lines have a dwarf phenotype and reduced rates of Agrobacterium-mediated transformation. The low rate of root-mediated transformation rate may result from altered root morphology or reduced root growth rates.
AT5G15130AT5G15130.1TGGGTCCCmember of WRKY Transcription Factor; Group II-b
AT5G15700AT5G15700.1CCCGGGTCGGGTDNA-directed RNA polymerase (RPOT2); FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: DNA-directed RNA polymerase, bacteriophage type (InterPro:IPR002092); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, mitochondrial (RPOMT) (TAIR:AT1G68990.1); Has 1079 Blast hits to 1064 proteins in 245 species: Archae - 0; Bacteria - 22; Metazoa - 122; Fungi - 163; Plants - 126; Viruses - 102; Other Eukaryotes - 544 (source: NCBI BLink).
AT5G15760AT5G15760.1CCGACCCGACCCGACCplastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast, plastid; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, PSRP-3/Ycf65 (InterPro:IPR006924); BEST Arabidopsis thaliana protein match is: plastid-specific 30S ribosomal protein 3, putative / PSRP-3, putative (TAIR:AT1G68590.2); Has 330 Blast hits to 330 proteins in 86 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 175 (source: NCBI BLink).
AT5G15820AT5G15820.1GACCCGGGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT3G02340.1); Has 5714 Blast hits to 5705 proteins in 197 species: Archae - 0; Bacteria - 6; Metazoa - 2140; Fungi - 398; Plants - 2247; Viruses - 17; Other Eukaryotes - 906 (source: NCBI BLink).
AT5G15840AT5G15840.1GGGTCCCAEncodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1.
AT5G15840.2GGGTCCCAEncodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1.
AT5G16220AT5G16220.1ACCCGACCCGGTTocticosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT5G16290AT5G16290.1TGACCCGAAacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink).
AT5G16290.2TGACCCGAAacetolactate synthase small subunit, putative; FUNCTIONS IN: acetolactate synthase activity, amino acid binding; INVOLVED IN: branched chain family amino acid biosynthetic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Acetolactate synthase, small subunit (InterPro:IPR004789), Amino acid-binding ACT (InterPro:IPR002912); BEST Arabidopsis thaliana protein match is: acetolactate synthase small subunit, putative (TAIR:AT2G31810.1); Has 8740 Blast hits to 4517 proteins in 1096 species: Archae - 146; Bacteria - 4272; Metazoa - 0; Fungi - 172; Plants - 55; Viruses - 0; Other Eukaryotes - 4095 (source: NCBI BLink).
AT5G16930AT5G16930.1TTCGGGTCAAAA-type ATPase family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding (TAIR:AT3G03060.1); Has 38698 Blast hits to 27302 proteins in 1845 species: Archae - 846; Bacteria - 8730; Metazoa - 11396; Fungi - 3984; Plants - 1702; Viruses - 176; Other Eukaryotes - 11864 (source: NCBI BLink).
AT5G17070AT5G17070.1GTCGGGTCGGGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; Has 156 Blast hits to 156 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 14; Plants - 18; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT5G18130AT5G18130.1GTGGGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03870.2); Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G18130.2GTGGGTCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03870.2); Has 26 Blast hits to 26 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G18590AT5G18590.1TGGGACCCACkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: ACBP4 (ACYL-COA BINDING PROTEIN 4); acyl-CoA binding (TAIR:AT3G05420.2); Has 6904 Blast hits to 3522 proteins in 233 species: Archae - 14; Bacteria - 240; Metazoa - 3345; Fungi - 666; Plants - 992; Viruses - 6; Other Eukaryotes - 1641 (source: NCBI BLink).
AT5G18590.2TGGGACCCACkelch repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: ACBP4 (ACYL-COA BINDING PROTEIN 4); acyl-CoA binding (TAIR:AT3G05420.2); Has 6904 Blast hits to 3522 proteins in 233 species: Archae - 14; Bacteria - 240; Metazoa - 3345; Fungi - 666; Plants - 992; Viruses - 6; Other Eukaryotes - 1641 (source: NCBI BLink).
AT5G19140AT5G19140.1GGTCCCACAILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink).
AT5G19140.2GGTCCCACAILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink).
AT5G19390AT5G19390.1GACCCGACCCGEncodes a protein with similarity to REN1, a Rho GTPase activating protein.
AT5G19390.2GACCCGACCCGEncodes a protein with similarity to REN1, a Rho GTPase activating protein.
AT5G19390.3GACCCGACCCGEncodes a protein with similarity to REN1, a Rho GTPase activating protein.
AT5G19390.4GACCCGACCCGEncodes a protein with similarity to REN1, a Rho GTPase activating protein.
AT5G19570AT5G19570.1TTCGGGTCCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0546 (InterPro:IPR018908); Has 152 Blast hits to 152 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 35; Plants - 9; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT5G19570.1TTCGGGTCGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0546 (InterPro:IPR018908); Has 152 Blast hits to 152 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 35; Plants - 9; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).
AT5G19740AT5G19740.1TGGGACCCApeptidase M28 family protein; FUNCTIONS IN: dipeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Transferrin receptor-like, dimerisation (InterPro:IPR007365), Peptidase M28 (InterPro:IPR007484); BEST Arabidopsis thaliana protein match is: AMP1 (ALTERED MERISTEM PROGRAM 1); carboxypeptidase/ dipeptidase (TAIR:AT3G54720.1); Has 2509 Blast hits to 2472 proteins in 344 species: Archae - 16; Bacteria - 796; Metazoa - 572; Fungi - 328; Plants - 72; Viruses - 0; Other Eukaryotes - 725 (source: NCBI BLink).
AT5G19780AT5G19780.1GTGGGACCCAEncodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication.
AT5G20380AT5G20380.1GGGACCCACEncodes an inorganic phosphate transporter (PHT4;5).
AT5G20720AT5G20720.1CGACCCGACCCGACCEncodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES.
AT5G20720.2CGACCCGACCCGACCEncodes a chloroplast co-chaperonin with similarity to CPN21 from spinach, E.coli GroES.
AT5G21430AT5G21430.1CCCGGGTCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Has 46 Blast hits to 46 proteins in 21 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT5G21430.2CCCGGGTCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: heat shock protein binding; LOCATED IN: chloroplast thylakoid membrane, chloroplast; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); Has 46 Blast hits to 46 proteins in 21 species: Archae - 0; Bacteria - 14; Metazoa - 2; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT5G22360AT5G22360.1TTCGGGTCGGMember of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.
AT5G23080AT5G23080.1GACCCGAACCAGGCCCAGAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.
AT5G23080.2GACCCGAACCAGGCCCAGAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.
AT5G23090AT5G23090.1TCTGGGCCTGGTTCGGGTCNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT5G23090.2TCTGGGCCTGGTTCGGGTCNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT5G23090.3TCTGGGCCTGGTTCGGGTCNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT5G23090.4TCTGGGCCTGGTTCGGGTCNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).
AT5G24080AT5G24080.1TGGGTCCCprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, stamen; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: S-locus lectin protein kinase family protein (TAIR:AT2G19130.1); Has 83012 Blast hits to 81933 proteins in 3234 species: Archae - 50; Bacteria - 7141; Metazoa - 37012; Fungi - 6145; Plants - 18411; Viruses - 299; Other Eukaryotes - 13954 (source: NCBI BLink).
AT5G24610AT5G24610.1GTGGGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49550.1); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G24610.1GTGGGACCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G49550.1); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G24760AT5G24760.1GTGGGACCalcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).
AT5G24760.2GTGGGACCalcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).
AT5G24760.3GTGGGACCalcohol dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-containing, conserved site (InterPro:IPR002328), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase (TAIR:AT1G77120.1); Has 21073 Blast hits to 21062 proteins in 1956 species: Archae - 365; Bacteria - 11675; Metazoa - 1131; Fungi - 1562; Plants - 3028; Viruses - 3; Other Eukaryotes - 3309 (source: NCBI BLink).
AT5G24810AT5G24810.1GTGGGTCCCAABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink).
AT5G25190AT5G25190.1GTGGGTCCencodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
AT5G25780AT5G25780.1TGACCCGACCCGACCCGTCCGAmember of eIF3b - eukaryotic initiation factor 3b
AT5G26030AT5G26030.1GGGACCCAATAAencodes ferrochelatase I located in plastids. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins
AT5G26030.2GGGACCCAATAAencodes ferrochelatase I located in plastids. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins
AT5G26160AT5G26160.1GGACCCACCGGAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G20610.1); Has 138 Blast hits to 117 proteins in 36 species: Archae - 0; Bacteria - 14; Metazoa - 25; Fungi - 15; Plants - 62; Viruses - 2; Other Eukaryotes - 20 (source: NCBI BLink).
AT5G27720AT5G27720.1CCCGGGTCembryo defective 1644 (emb1644); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 1164 Blast hits to 1156 proteins in 179 species: Archae - 0; Bacteria - 6; Metazoa - 536; Fungi - 265; Plants - 172; Viruses - 5; Other Eukaryotes - 180 (source: NCBI BLink).
AT5G27920AT5G27920.1GTGGGTCCCF-box family protein; FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype (InterPro:IPR006553); BEST Arabidopsis thaliana protein match is: F-box family protein (FBL3) (TAIR:AT5G01720.1); Has 10236 Blast hits to 3505 proteins in 207 species: Archae - 0; Bacteria - 631; Metazoa - 4869; Fungi - 921; Plants - 2316; Viruses - 19; Other Eukaryotes - 1480 (source: NCBI BLink).
AT5G38880AT5G38880.1TCGACCCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 379 Blast hits to 327 proteins in 103 species: Archae - 4; Bacteria - 53; Metazoa - 188; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).
AT5G41600AT5G41600.1GAGGCCCAGACCCGAAVIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 648; Fungi - 2; Plants - 271; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink).
AT5G41685AT5G41685.1TGACCCGAAmitochondrial import receptor subunit TOM7 / translocase of outer membrane 7 kDa subunit (TOM7.1); FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport; LOCATED IN: mitochondrial outer membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import translocase, subunit Tom7 (InterPro:IPR012621); BEST Arabidopsis thaliana protein match is: TOM7-2 (TRANSLOCASE OF OUTER MEMBRANE 7 KDA SUBUNIT 2); P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G64220.1); Has 39 Blast hits to 39 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 33; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G41960AT5G41960.1TGGGACCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 14 Blast hits to 14 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G42000AT5G42000.1CGGGTCGGGTCGGAAAACCGGTORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT5G42000.2CGGGTCGGGTCGGAAAACCGGTORMDL family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein folding; LOCATED IN: integral to membrane, endoplasmic reticulum; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203); BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT1G01230.1); Has 398 Blast hits to 398 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 101; Plants - 52; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).
AT5G42020AT5G42020.1TTCGGGTCAluminal binding protein (BiP)
AT5G42020.2TTCGGGTCAluminal binding protein (BiP)
AT5G43940AT5G43940.1CGACCCGACCCGACTCGACCCGGEncodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility.
AT5G44110AT5G44110.1GTGGGACCEncodes a member of the NAP subfamily of ABC transporters.
AT5G44110.2GTGGGACCEncodes a member of the NAP subfamily of ABC transporters.
AT5G44110.3GTGGGACCEncodes a member of the NAP subfamily of ABC transporters.
AT5G45010AT5G45010.1TTCGGGTCGGArabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT5G45010.1TTCGGGTCGGArabidopsis dss1 homolog on chromosome V (ATDSS1(V)); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DSS1/SEM1 (InterPro:IPR007834); BEST Arabidopsis thaliana protein match is: ATDSS1(I) (ARABIDOPSIS THALIANA DELETION OF SUV3 SUPRESSOR 1(I)) (TAIR:AT1G64750.2); Has 233 Blast hits to 233 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 57; Plants - 43; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).
AT5G45620AT5G45620.1CGGTTCGGGTCGGG26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink).
AT5G45620.1GCCGGTTCAACCGGTTCACCGGGTC26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink).
AT5G45620.2CGGTTCGGGTCGGG26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink).
AT5G45620.2GCCGGTTCAACCGGTTCACCGGGTC26S proteasome regulatory subunit, putative (RPN9); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome component region PCI (InterPro:IPR000717); BEST Arabidopsis thaliana protein match is: 26S proteasome regulatory subunit, putative (RPN9) (TAIR:AT4G19006.1); Has 757 Blast hits to 754 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 445; Fungi - 133; Plants - 83; Viruses - 0; Other Eukaryotes - 96 (source: NCBI BLink).
AT5G45750AT5G45750.1GACCCGGGArabidopsis Rab GTPase homolog A1c (AtRABA1c); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane, nucleus, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: ATRABA1D (ARABIDOPSIS RAB GTPASE HOMOLOG A1D); GTP binding (TAIR:AT4G18800.1); Has 22761 Blast hits to 22719 proteins in 630 species: Archae - 21; Bacteria - 114; Metazoa - 12574; Fungi - 2957; Plants - 2059; Viruses - 19; Other Eukaryotes - 5017 (source: NCBI BLink).
AT5G45900AT5G45900.1ATAAAGCCGACCCGACCCGGComponent of autophagy conjugation pathway. Required for proper senescence.
AT5G46210AT5G46210.1TCGGGTCGGGTCArabidopsis CULLIN4 (CUL4) forms an E3 ubiquitin ligase with the CDD complex and a common catalytic subunit RBX1 in mediating light control of development. This CUL4-based E3 ligase is essential for the repression of photomorphogenesis. The partial loss of CUL4 function resulted in a constitutive photomorphogenic phenotype with respect to morphogenesis and light-regulated gene expression. CUL4 exhibits a synergistic genetic interaction with COP10 and DET1.
AT5G46840AT5G46840.2AACCCGACCCGGTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink).
AT5G47200AT5G47200.1GTGGGTCCCATRAB1A; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1C; GTP binding (TAIR:AT4G17530.1); Has 23714 Blast hits to 23664 proteins in 649 species: Archae - 17; Bacteria - 107; Metazoa - 13262; Fungi - 2840; Plants - 2236; Viruses - 19; Other Eukaryotes - 5233 (source: NCBI BLink).
AT5G47970AT5G47970.1GTGGGTCCCnitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, tRNA processing, oxidation reduction, metabolic process; LOCATED IN: nucleus, phragmoplast, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G63510.1); Has 7166 Blast hits to 7164 proteins in 1353 species: Archae - 16; Bacteria - 3970; Metazoa - 102; Fungi - 62; Plants - 54; Viruses - 0; Other Eukaryotes - 2962 (source: NCBI BLink).
AT5G47970.2GTGGGTCCCnitrogen regulation family protein; FUNCTIONS IN: tRNA dihydrouridine synthase activity, FAD binding, catalytic activity; INVOLVED IN: regulation of nitrogen utilization, tRNA processing, oxidation reduction, metabolic process; LOCATED IN: nucleus, phragmoplast, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), tRNA-dihydrouridine synthase (InterPro:IPR001269), tRNA-dihydrouridine synthase, conserved site (InterPro:IPR018517); BEST Arabidopsis thaliana protein match is: FAD binding / catalytic/ tRNA dihydrouridine synthase (TAIR:AT3G63510.1); Has 7166 Blast hits to 7164 proteins in 1353 species: Archae - 16; Bacteria - 3970; Metazoa - 102; Fungi - 62; Plants - 54; Viruses - 0; Other Eukaryotes - 2962 (source: NCBI BLink).
AT5G49200AT5G49200.1GGACCCACWD-40 repeat family protein / zfwd4 protein (ZFWD4); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / zfwd3 protein (ZFWD3) (TAIR:AT5G40880.1); Has 25041 Blast hits to 14412 proteins in 471 species: Archae - 20; Bacteria - 3252; Metazoa - 10699; Fungi - 5302; Plants - 2300; Viruses - 0; Other Eukaryotes - 3468 (source: NCBI BLink).
AT5G50810AT5G50810.1TTAAACCGGTCGGGTCCGEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus.
AT5G51110AT5G51110.1AGTCGGTCCCAC4-alpha-hydroxytetrahydrobiopterin dehydratase; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: dehydratase family (TAIR:AT1G29810.1); Has 1563 Blast hits to 1563 proteins in 256 species: Archae - 17; Bacteria - 489; Metazoa - 0; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1013 (source: NCBI BLink).
AT5G51120AT5G51120.1GTGGGACCGACTEncodes a homolog of the protein PABN1, a polyadenylation factor subunit.
AT5G51340AT5G51340.1CGGGTCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 96 proteins in 39 species: Archae - 0; Bacteria - 2; Metazoa - 115; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink).
AT5G53880AT5G53880.1GTGGGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1379 Blast hits to 641 proteins in 104 species: Archae - 20; Bacteria - 31; Metazoa - 673; Fungi - 150; Plants - 69; Viruses - 10; Other Eukaryotes - 426 (source: NCBI BLink).
AT5G54960AT5G54960.1CGAACCGGGTCGGpyruvate decarboxylase-2
AT5G55180AT5G55180.1CACGTGGGTCCglycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1).
AT5G55180.2CACGTGGGTCCglycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds (TAIR:AT4G26830.1).
AT5G55230AT5G55230.1TGGGTCCCACBinds and bundles microtubules. Plays a role in stabilizing anti-parallel microtubules in the central spindle at anaphase to early cytokinesis but is not essential at the midline of the phragmoplast at later stages. The timing with which the MAP65-1 was targeted to the spindle appears to be regulated by a phosphorylation sensitive switch. Enhances microtubule polymerization, promotes nucleation and stabilizes microtubules against cold treatment and dilution.
AT5G55940AT5G55940.1TGACCCGAACCCGGTTTAGembryo defective 2731 (emb2731); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51620.3); Has 220 Blast hits to 219 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 10; Plants - 30; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink).
AT5G56460AT5G56460.1GTGGGACCCAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G01020.1); Has 80161 Blast hits to 79301 proteins in 2452 species: Archae - 44; Bacteria - 7377; Metazoa - 35060; Fungi - 5996; Plants - 18115; Viruses - 334; Other Eukaryotes - 13235 (source: NCBI BLink).
AT5G57300AT5G57300.1GGACCCACUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink).
AT5G57300.2GGACCCACUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT1G23360.1); Has 6140 Blast hits to 6134 proteins in 1292 species: Archae - 70; Bacteria - 2991; Metazoa - 110; Fungi - 84; Plants - 108; Viruses - 0; Other Eukaryotes - 2777 (source: NCBI BLink).
AT5G57360AT5G57360.1TGACCCGACEncodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1.
AT5G57360.2TGACCCGACEncodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1.
AT5G59540AT5G59540.1GGACCCACoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate-dependent dioxygenase, putative (TAIR:AT5G59530.1); Has 5683 Blast hits to 5661 proteins in 686 species: Archae - 0; Bacteria - 714; Metazoa - 123; Fungi - 539; Plants - 3068; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink).
AT5G59540.2GGACCCACoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate-dependent dioxygenase, putative (TAIR:AT5G59530.1); Has 5683 Blast hits to 5661 proteins in 686 species: Archae - 0; Bacteria - 714; Metazoa - 123; Fungi - 539; Plants - 3068; Viruses - 0; Other Eukaryotes - 1239 (source: NCBI BLink).
AT5G60860AT5G60860.1GACCCGAAArabidopsis Rab GTPase homolog A1f (AtRABA1f); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1g (Arabidopsis Rab GTPase homolog A1g); GTP binding (TAIR:AT3G15060.1); Has 21819 Blast hits to 21779 proteins in 607 species: Archae - 23; Bacteria - 103; Metazoa - 12072; Fungi - 2821; Plants - 1861; Viruses - 19; Other Eukaryotes - 4920 (source: NCBI BLink).
AT5G61020AT5G61020.1TTTGACCCGAAECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).
AT5G61020.2TTTGACCCGAAECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink).
AT5G61170AT5G61170.1GTGGGACC40S ribosomal protein S19 (RPS19C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 883 Blast hits to 883 proteins in 288 species: Archae - 134; Bacteria - 5; Metazoa - 345; Fungi - 97; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).
AT5G61440AT5G61440.1GGACCCACEncodes a member of the thioredoxin family protein. Located in the chloroplast.
AT5G61610AT5G61610.1GGACCCACINVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, endomembrane system, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); Has 6250 Blast hits to 2851 proteins in 405 species: Archae - 6; Bacteria - 1198; Metazoa - 1427; Fungi - 369; Plants - 513; Viruses - 103; Other Eukaryotes - 2634 (source: NCBI BLink).
AT5G61790AT5G61790.1ACCGGGTCcalnexin 1 (CNX1); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin, putative (TAIR:AT5G07340.1); Has 1344 Blast hits to 1252 proteins in 297 species: Archae - 2; Bacteria - 61; Metazoa - 623; Fungi - 137; Plants - 191; Viruses - 36; Other Eukaryotes - 294 (source: NCBI BLink).
AT5G61900AT5G61900.1GTGGGTCCCATTTAEncodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response.
AT5G61900.3GTGGGTCCCATTTAEncodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response.
AT5G62020AT5G62020.1GTGGGACCmember of Heat Stress Transcription Factor (Hsf) family
AT5G62200AT5G62200.1TTTGACCCGGTembryo-specific protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976), Embryo-specific 3 (InterPro:IPR010417); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G41475.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G62570AT5G62570.1GTGGGTCCCACcalmodulin-binding protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Calmodulin binding protein-like (InterPro:IPR012416); BEST Arabidopsis thaliana protein match is: calmodulin-binding protein (TAIR:AT4G25800.2); Has 164 Blast hits to 160 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 164; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).
AT5G63180AT5G63180.1GTGGGTCCpectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT4G24780.1); Has 922 Blast hits to 919 proteins in 165 species: Archae - 0; Bacteria - 401; Metazoa - 0; Fungi - 114; Plants - 397; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).
AT5G63400AT5G63400.1AACCCGACCCGGTencodes a protein similar to adenylate kinase.
AT5G63400.2AACCCGACCCGGTencodes a protein similar to adenylate kinase.
AT5G63570AT5G63570.1TTCGGGTCGGEncodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced.
AT5G63600AT5G63600.1GGACCCACencodes a protein whose sequence is similar to flavonol synthase
AT5G63600.2GGACCCACencodes a protein whose sequence is similar to flavonol synthase
AT5G64270AT5G64270.1TGACCCGAAsplicing factor, putative; FUNCTIONS IN: binding; INVOLVED IN: mRNA processing; LOCATED IN: chloroplast; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-like helical (InterPro:IPR011989), Splicing factor 3B subunit 1 (InterPro:IPR015016), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: RCN1 (ROOTS CURL IN NPA); protein phosphatase type 2A regulator (TAIR:AT1G25490.1); Has 1441 Blast hits to 1324 proteins in 270 species: Archae - 12; Bacteria - 198; Metazoa - 607; Fungi - 267; Plants - 142; Viruses - 10; Other Eukaryotes - 205 (source: NCBI BLink).
AT5G64740AT5G64740.1TTAATGGGTCCCACEncodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles.
AT5G66950AT5G66950.1TGGGTCCCAcatalytic/ pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: catalytic/ pyridoxal phosphate binding (TAIR:AT2G23520.1); Has 427 Blast hits to 373 proteins in 107 species: Archae - 10; Bacteria - 20; Metazoa - 115; Fungi - 84; Plants - 126; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink).
ATCG00750ATCG00750.1ACCGGGTC30S chloroplast ribosomal protein S11
ATCG00760ATCG00760.1ACCGGGTCencodes a chloroplast ribosomal protein L36, a constituent of the large subunit of the ribosomal complex


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.