version

Summary of ACGT (All List)

Organism Oryza sativa
PPDB Motif ACGT
Description bZIP-binding motif, environmental responses
Total Entry Count 16071

Entry Sequences (16071 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09ACGTGGCGTGNONE
015-011-E06ACGTGGCGTGNONE
016-083-H11ACGTGGCGTGNONE
AK100002ACGTGGCGTGConserved hypothetical protein.
J065063K05ACGTGGCGTGNONE
J065191H24ACGTGGCGTGNONE
J100079N16ACGTGGCGTGNONE
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein.
J013000E05CACGTGGGGCCCGCANONE
J013027D08CACGTGGGGCCCGCANONE
J013045K12CACGTGGGGCCCGCANONE
J023119M03CACGTGGGGCCCGCANONE
J065081F02CACGTGGGGCCCGCANONE
J065180C08CACGTGGGGCCCGCANONE
J065211M06CACGTGGGGCCCGCANONE
J075073J06CACGTGGGGCCCGCANONE
J075123A18CACGTGGGGCCCGCANONE
J075124A07CACGTGGGGCCCGCANONE
J075187B05CACGTGGGGCCCGCANONE
Os01g0103600006-072-A01GCCACGTCGGCCCATTNONE
009-148-C12GCCACGTCGGCCCATTNONE
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein.
AK102848GCCACGTCGGCCCATTNONE
J033036P20GCCACGTCGGCCCATTNONE
J065171N21GCCACGTCGGCCCATTNONE
J065209M02GCCACGTCGGCCCATTNONE
J075067A03GCCACGTCGGCCCATTNONE
J075110C09GCCACGTCGGCCCATTNONE
Os01g0104900012-050-A08GGACACGTNONE
AK121535GGACACGTTransferase family protein.
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein.
Os01g0138500AK073435CACGTGTCCProtein of unknown function DUF789 family protein.
AK073435GGTGACGTProtein of unknown function DUF789 family protein.
J023118K18CACGTGTCCNONE
J023118K18GGTGACGTNONE
J033039C22CACGTGTCCNONE
J033039C22GGTGACGTNONE
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein.
Os01g0140100AK068990GTGACGTGPeptidase A1, pepsin family protein.
J065163I12GTGACGTGNONE
J075003M22GTGACGTGNONE
Os01g0144100006-118-E08GACGTGGCGNONE
AK058909GACGTGGCGSimilar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15).
AK068113GACGTGGCGNONE
AK104051GACGTGGCGNONE
J065163E12GACGTGGCGNONE
Os01g0149800009-003-D05GCCACGTGTNONE
009-075-F04GCCACGTGTNONE
009-164-H05GCCACGTGTNONE
J013021G22GCCACGTGTNONE
J013026A08GCCACGTGTNONE
J013055B05GCCACGTGTNONE
J013064G22GCCACGTGTNONE
J013105C09GCCACGTGTNONE
J013129K15GCCACGTGTNONE
J023129B01GCCACGTGTNONE
J033036H01GCCACGTGTNONE
J033057B09GCCACGTGTNONE
J043037E20GCCACGTGTNONE
J043039C11GCCACGTGTNONE
J043039D02GCCACGTGTNONE
J043039G15GCCACGTGTNONE
J043040L16GCCACGTGTNONE
J053034B13GCCACGTGTNONE
J053061F14GCCACGTGTNONE
J053097D22GCCACGTGTNONE
J065032N05GCCACGTGTNONE
J065050F21GCCACGTGTNONE
J065052D11GCCACGTGTNONE
J065097I08GCCACGTGTNONE
J065109M12GCCACGTGTNONE
J065162C19GCCACGTGTNONE
J065162C20GCCACGTGTNONE
J065171G23GCCACGTGTNONE
J065206I03GCCACGTGTNONE
J065218O18GCCACGTGTNONE
J080020M17GCCACGTGTNONE
J080030J11GCCACGTGTNONE
J080032A22GCCACGTGTNONE
J080036E19GCCACGTGTNONE
J080037I16GCCACGTGTNONE
J080051D03GCCACGTGTNONE
J080051D05GCCACGTGTNONE
J080054K06GCCACGTGTNONE
J080076G01GCCACGTGTNONE
J080077P08GCCACGTGTNONE
J080085E13GCCACGTGTNONE
J080087A22GCCACGTGTNONE
J080310A13GCCACGTGTNONE
J090080A15GCCACGTGTNONE
J090087N14GCCACGTGTNONE
J100017E03GCCACGTGTNONE
J100024B10GCCACGTGTNONE
J100025A07GCCACGTGTNONE
J100026G16GCCACGTGTNONE
J100030A10GCCACGTGTNONE
J100030M18GCCACGTGTNONE
J100044D08GCCACGTGTNONE
J100045F20GCCACGTGTNONE
J100046L06GCCACGTGTNONE
J100050J10GCCACGTGTNONE
J100054E07GCCACGTGTNONE
J100054G22GCCACGTGTNONE
J100054L21GCCACGTGTNONE
J100058A12GCCACGTGTNONE
J100064O14GCCACGTGTNONE
J100069M10GCCACGTGTNONE
J100073C18GCCACGTGTNONE
J100077H21GCCACGTGTNONE
J100078A09GCCACGTGTNONE
J100081F01GCCACGTGTNONE
J100082H17GCCACGTGTNONE
J100090C20GCCACGTGTNONE
U43530GCCACGTGTMetallothionein-like protein type 2.
Os01g0151600AK063435GCCGGCCCGCCACGTGTConserved hypothetical protein.
J065010E12GCCGGCCCGCCACGTGTNONE
J065067D06GCCGGCCCGCCACGTGTNONE
J090043F21GCCGGCCCGCCACGTGTNONE
Os01g0155600006-048-F03GCCACGTCNONE
AK060171GCCACGTCNONE
AK071635GCCACGTCSimilar to Splicing factor RSZ33.
J023080A03GCCACGTCNONE
J023100L15GCCACGTCNONE
J033075I17GCCACGTCNONE
J033085O09GCCACGTCNONE
J033105E15GCCACGTCNONE
J033132N10GCCACGTCNONE
J033132P12GCCACGTCNONE
J033149H12GCCACGTCNONE
J043026M03GCCACGTCNONE
J080305J10GCCACGTCNONE
J080308K03GCCACGTCNONE
J090023M04GCCACGTCNONE
J090078F24GCCACGTCNONE
J100066P05GCCACGTCNONE
Os01g0155800J065061I19GACGTGGCConserved hypothetical protein.
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein.
Os01g0164700013-037-D07CACGTCACNONE
AK066699CACGTCACProtein of unknown function DUF410 family protein.
J013073F20CACGTCACNONE
J033091F23CACGTCACNONE
J065056C14CACGTCACNONE
Os01g0167100009-183-G08GCCACGTCNONE
AK063153GCCACGTCNONE
J065154C02GCCACGTCNONE
Os01g0171200AK107515ACGTGGGCCTTGNONE
AK109475ACGTGGGCCTTGConserved hypothetical protein.
Os01g0173900AK121690ACGTGGGGSimilar to MRP-like ABC transporter.
J033071F24ACGTGGGGNONE
J043016E04ACGTGGGGNONE
J043026D02ACGTGGGGNONE
J065169H14ACGTGGGGNONE
J100032P06ACGTGGGGNONE
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein.
J023088B10CGCCACGTGTCCNONE
J065122H15CGCCACGTGTCCNONE
J065140B19CGCCACGTGTCCNONE
J100031E12CGCCACGTGTCCNONE
J100068J03CGCCACGTGTCCNONE
J100083E12CGCCACGTGTCCNONE
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein.
Os01g0180300AK120377ACACGTGGCGLipoprotein, type 6 family protein.
J013071N06ACACGTGGCGNONE
J023088F12ACACGTGGCGNONE
J100027H24ACACGTGGCGNONE
J100053K15ACACGTGGCGNONE
J100082M15ACACGTGGCGNONE
Os01g0184800AK073377GGGACCCACGTGPhosducin family protein.
AK102544GGGACCCACGTGNONE
J023047L21GGGACCCACGTGNONE
J023135I09GGGACCCACGTGNONE
J033028G17GGGACCCACGTGNONE
J065164L07GGGACCCACGTGNONE
J065193F22GGGACCCACGTGNONE
J075035I10GGGACCCACGTGNONE
J075168H15GGGACCCACGTGNONE
Os01g0184900AF503585CACGTGGGTCCCNONE
AK066832CACGTGGGTCCCSimilar to SSRP1 protein.
AK068959CACGTGGGTCCCNONE
J013055F18CACGTGGGTCCCNONE
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE
015-007-B11CGTGTGGGGCCCACGTGNONE
015-062-F05CGTGTGGGGCCCACGTGNONE
015-078-C11CGTGTGGGGCCCACGTGNONE
016-068-F07CGTGTGGGGCCCACGTGNONE
016-074-F08CGTGTGGGGCCCACGTGNONE
AK065131CGTGTGGGGCCCACGTGTransferase family protein.
AK098922CGTGTGGGGCCCACGTGNONE
J013000G12CGTGTGGGGCCCACGTGNONE
J013001P14CGTGTGGGGCCCACGTGNONE
J013002O23CGTGTGGGGCCCACGTGNONE
J013096L23CGTGTGGGGCCCACGTGNONE
J013097F24CGTGTGGGGCCCACGTGNONE
J013120N24CGTGTGGGGCCCACGTGNONE
J023007C15CGTGTGGGGCCCACGTGNONE
J023119O12CGTGTGGGGCCCACGTGNONE
J033039O11CGTGTGGGGCCCACGTGNONE
J033043L11CGTGTGGGGCCCACGTGNONE
J033061A07CGTGTGGGGCCCACGTGNONE
J033076M13CGTGTGGGGCCCACGTGNONE
J033082B04CGTGTGGGGCCCACGTGNONE
J033143H15CGTGTGGGGCCCACGTGNONE
J043013A02CGTGTGGGGCCCACGTGNONE
J043036N21CGTGTGGGGCCCACGTGNONE
J065013M09CGTGTGGGGCCCACGTGNONE
J065082E22CGTGTGGGGCCCACGTGNONE
J065093G01CGTGTGGGGCCCACGTGNONE
J065120L06CGTGTGGGGCCCACGTGNONE
J065135D03CGTGTGGGGCCCACGTGNONE
J065197C10CGTGTGGGGCCCACGTGNONE
J100024J10CGTGTGGGGCCCACGTGNONE
J100042M22CGTGTGGGGCCCACGTGNONE
J100077E12CGTGTGGGGCCCACGTGNONE
J100084P03CGTGTGGGGCCCACGTGNONE
Os01g0186900013-032-B12CACGTCACCNONE
013-032-B12GAGACGTGNONE
013-069-C11CACGTCACCNONE
013-069-C11GAGACGTGNONE
AK105323CACGTCACCNONE
AK105323GAGACGTGNONE
AK105331CACGTCACCConserved hypothetical protein.
AK105331GAGACGTGConserved hypothetical protein.
AK106168CACGTCACCNONE
AK106168GAGACGTGNONE
J065023I10CACGTCACCNONE
J065023I10GAGACGTGNONE
J065182I03CACGTCACCNONE
J065182I03GAGACGTGNONE
J075116O22CACGTCACCNONE
J075116O22GAGACGTGNONE
J090082G13CACGTCACCNONE
J090082G13GAGACGTGNONE
J100060H12CACGTCACCNONE
J100060H12GAGACGTGNONE
Os01g0187700AK101445GCCACGTGGCGConserved hypothetical protein.
J033039I17GCCACGTGGCGNONE
Os01g0188400AK072842CACGTCACNONE
AK121770CACGTCACNONE
D16499CACGTCACNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME).
J100053F23CACGTCACNONE
J100060J17CACGTCACNONE
Os01g0198100AK119908CGACACGTGGCConserved hypothetical protein.
Os01g0206600J065041P19CACGTGTCConserved hypothetical protein.
J065041P19GCCACGTCConserved hypothetical protein.
Os01g0212700AK108311CACGTCACCZinc finger, RING-type domain containing protein.
Os01g0218700AK064992GGACACGTGTCCABC transporter, transmembrane region, type 1 domain containing protein.
Os01g0219100J065130F20CCCACGTGNONE
J065208O10CCCACGTGSFT2-like family protein.
Os01g0219500AK106863CCCACGTGNONE
AK109524CCCACGTGPlant lipid transfer protein/Par allergen family protein.
J075053J18CCCACGTGNONE
J080023G09CCCACGTGNONE
J080051F19CCCACGTGNONE
J080085H15CCCACGTGNONE
Os01g0222700012-011-E01GAGACGTGACGTGNONE
012-011-E01GAGGCCCACGTNONE
AK068883GAGACGTGACGTGNONE
AK068883GAGGCCCACGTNONE
AK101946GAGACGTGACGTGZinc finger, BED-type predicted domain containing protein.
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein.
J033075C16GAGACGTGACGTGNONE
J033075C16GAGGCCCACGTNONE
J043013D08GAGACGTGACGTGNONE
J043013D08GAGGCCCACGTNONE
J065089G19GAGACGTGACGTGNONE
J065089G19GAGGCCCACGTNONE
J065197K19GAGACGTGACGTGNONE
J065197K19GAGGCCCACGTNONE
J075161L21GAGACGTGACGTGNONE
J075161L21GAGGCCCACGTNONE
Os01g0223900AK101712ACGTGGGCCurculin-like (mannose-binding) lectin domain containing protein.
J033060M08ACGTGGGCNONE
Os01g0226400AK102301AGCCCACGTAAA ATPase domain containing protein.
Os01g0227300006-106-E11CCACGTGTNONE
AK059958CCACGTGTNONE
AK070320CCACGTGTSimilar to RAB7D.
J023052D24CCACGTGTNONE
J033040I05CCACGTGTNONE
J090072O16CCACGTGTNONE
J090075F16CCACGTGTNONE
Os01g0229100006-113-G08ACGTGGGCCGAAANONE
006-113-G08ACGTGGGCCTCNONE
011-075-E08ACGTGGGCCGAAANONE
011-075-E08ACGTGGGCCTCNONE
AK061285ACGTGGGCCGAAANONE
AK061285ACGTGGGCCTCNONE
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein.
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein.
J013059F08ACGTGGGCCGAAANONE
J013059F08ACGTGGGCCTCNONE
J013059G08ACGTGGGCCGAAANONE
J013059G08ACGTGGGCCTCNONE
J013059G09ACGTGGGCCGAAANONE
J013059G09ACGTGGGCCTCNONE
J013069M12ACGTGGGCCGAAANONE
J013069M12ACGTGGGCCTCNONE
J013105A19ACGTGGGCCGAAANONE
J013105A19ACGTGGGCCTCNONE
J013149F07ACGTGGGCCGAAANONE
J013149F07ACGTGGGCCTCNONE
J023073J07ACGTGGGCCGAAANONE
J023073J07ACGTGGGCCTCNONE
J023130F24ACGTGGGCCGAAANONE
J023130F24ACGTGGGCCTCNONE
J023147J08ACGTGGGCCGAAANONE
J023147J08ACGTGGGCCTCNONE
J033028F13ACGTGGGCCGAAANONE
J033028F13ACGTGGGCCTCNONE
J033115A16ACGTGGGCCGAAANONE
J033115A16ACGTGGGCCTCNONE
J033135F02ACGTGGGCCGAAANONE
J033135F02ACGTGGGCCTCNONE
J065031G16ACGTGGGCCGAAANONE
J065031G16ACGTGGGCCTCNONE
J065058A09ACGTGGGCCGAAANONE
J065058A09ACGTGGGCCTCNONE
J065089N15ACGTGGGCCGAAANONE
J065089N15ACGTGGGCCTCNONE
J065130I09ACGTGGGCCGAAANONE
J065130I09ACGTGGGCCTCNONE
J065191P09ACGTGGGCCGAAANONE
J065191P09ACGTGGGCCTCNONE
J065197P14ACGTGGGCCGAAANONE
J065197P14ACGTGGGCCTCNONE
J080306D15ACGTGGGCCGAAANONE
J080306D15ACGTGGGCCTCNONE
J080308M06ACGTGGGCCGAAANONE
J080308M06ACGTGGGCCTCNONE
J080315A03ACGTGGGCCGAAANONE
J080315A03ACGTGGGCCTCNONE
J080315N11ACGTGGGCCGAAANONE
J080315N11ACGTGGGCCTCNONE
J090046E14ACGTGGGCCGAAANONE
J090046E14ACGTGGGCCTCNONE
J090058G09ACGTGGGCCGAAANONE
J090058G09ACGTGGGCCTCNONE
J090077H05ACGTGGGCCGAAANONE
J090077H05ACGTGGGCCTCNONE
J090087O20ACGTGGGCCGAAANONE
J090087O20ACGTGGGCCTCNONE
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein.
AK066024TTTCGGCCCACGTVHS domain containing protein.
Os01g0229400AB029508GCCCCACGTGSmall GTP-binding protein OsRac1.
J013111C23GCCCCACGTGNONE
J023077H07GCCCCACGTGNONE
J100039H15GCCCCACGTGNONE
Os01g0246400009-143-G05CACTGACACGTGGCNONE
009-143-G05GACGTGGCNONE
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
AK062972GACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
Os01g0253500J100088F12CGGGCCCCACGTConserved hypothetical protein.
Os01g0254000006-037-A11GACGTGGCGNONE
006-059-H09GACGTGGCGNONE
006-088-D11GACGTGGCGNONE
006-112-B06GACGTGGCGNONE
006-120-E12GACGTGGCGNONE
AK111904GACGTGGCGNONE
AK111979GACGTGGCGNONE
AK119548GACGTGGCGNONE
AY620417GACGTGGCGSimilar to NTGB2 (Fragment).
J023112F13GACGTGGCGNONE
J053066C19GACGTGGCGNONE
J065006L12GACGTGGCGNONE
J065019L17GACGTGGCGNONE
J065081J05GACGTGGCGNONE
J065085D02GACGTGGCGNONE
J065203D03GACGTGGCGNONE
J065210O20GACGTGGCGNONE
J090062P06GACGTGGCGNONE
J090063N07GACGTGGCGNONE
J100061H24GACGTGGCGNONE
Os01g0257100J100030B03CGCCACGTCACCNONE
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein.
Os01g0258600J075028F17ACACGTGGGTCCNONE
J075028F17GCCACGTCNONE
J075061L04ACACGTGGGTCCConserved hypothetical protein.
J075061L04GCCACGTCConserved hypothetical protein.
J075071B09ACACGTGGGTCCNONE
J075071B09GCCACGTCNONE
J075093E04ACACGTGGGTCCNONE
J075093E04GCCACGTCNONE
J100033B11ACACGTGGGTCCNONE
J100033B11GCCACGTCNONE
Os01g0261500J033071B09GCCACGTCNONE
J090095O22GCCACGTCNONE
Os01g0266600AK058396CGCCACGTCNONE
AK069749CGCCACGTCRedoxin domain containing protein.
J023030N01CGCCACGTCNONE
J065065E03CGCCACGTCNONE
J075006N11CGCCACGTCNONE
J075017G04CGCCACGTCNONE
J075023L15CGCCACGTCNONE
J075126F05CGCCACGTCNONE
Os01g0270100006-096-H09CGCCACGTGTNONE
009-009-C10CGCCACGTGTNONE
009-054-E06CGCCACGTGTNONE
014-085-F09CGCCACGTGTNONE
AK073275CGCCACGTGTNONE
AK104155CGCCACGTGTNONE
AK119511CGCCACGTGTSimilar to Cysteine protease inhibitor.
J033025K21CGCCACGTGTNONE
J075065H10CGCCACGTGTNONE
J075143G10CGCCACGTGTNONE
J100059J02CGCCACGTGTNONE
Os01g0271700J065184P16AGGGCCCACGTNONE
J075182E21AGGGCCCACGTNONE
J075191M19AGGGCCCACGTNONE
J090021E22AGGGCCCACGTNONE
Os01g0276300AK108165ACGTGTCCSimilar to Group 3 late embryogenesis abundant protein (Fragment).
Os01g0276500006-030-E04ACGTGGGCCGTANONE
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)].
AK099335ACGTGGGCCGTANONE
Os01g0280200J065103B05GCCACGTGNONE
J065103B05GCCACGTGTNONE
J065183G15GCCACGTGConserved hypothetical protein.
J065183G15GCCACGTGTConserved hypothetical protein.
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein.
AK109672GTGACGTGTGGCGTGConserved hypothetical protein.
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE
J065013K07GTGACGTGTGGCGTGNONE
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE
J065040E15GTGACGTGTGGCGTGNONE
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE
J065127F12GTGACGTGTGGCGTGNONE
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE
J075155K23GTGACGTGTGGCGTGNONE
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE
009-084-B05ACAGCCCACGTGGCNONE
009-100-E07ACAGCCCACGTGGCNONE
009-133-B03ACAGCCCACGTGGCNONE
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment).
AK066266ACAGCCCACGTGGCNONE
AK102013ACAGCCCACGTGGCNONE
J065001I21ACAGCCCACGTGGCNONE
J065025D22ACAGCCCACGTGGCNONE
J065098M18ACAGCCCACGTGGCNONE
J065105O22ACAGCCCACGTGGCNONE
J065121F07ACAGCCCACGTGGCNONE
J065181F03ACAGCCCACGTGGCNONE
J075020M03ACAGCCCACGTGGCNONE
J075028O06ACAGCCCACGTGGCNONE
J075032F15ACAGCCCACGTGGCNONE
J075033H07ACAGCCCACGTGGCNONE
J075062F22ACAGCCCACGTGGCNONE
J075083P19ACAGCCCACGTGGCNONE
J075097J16ACAGCCCACGTGGCNONE
J075099A15ACAGCCCACGTGGCNONE
J075104P03ACAGCCCACGTGGCNONE
J075118K12ACAGCCCACGTGGCNONE
J075125H01ACAGCCCACGTGGCNONE
J075127K12ACAGCCCACGTGGCNONE
J075128F24ACAGCCCACGTGGCNONE
J075151P06ACAGCCCACGTGGCNONE
J075169K22ACAGCCCACGTGGCNONE
J075170K24ACAGCCCACGTGGCNONE
J075182A01ACAGCCCACGTGGCNONE
J075199H16ACAGCCCACGTGGCNONE
J080010O12ACAGCCCACGTGGCNONE
J080013A02ACAGCCCACGTGGCNONE
J080013F09ACAGCCCACGTGGCNONE
J080017C19ACAGCCCACGTGGCNONE
J080017G05ACAGCCCACGTGGCNONE
J080022L04ACAGCCCACGTGGCNONE
J080025B17ACAGCCCACGTGGCNONE
J080029A08ACAGCCCACGTGGCNONE
J080037C12ACAGCCCACGTGGCNONE
J080037L14ACAGCCCACGTGGCNONE
J080037M24ACAGCCCACGTGGCNONE
J080038M21ACAGCCCACGTGGCNONE
J080039E06ACAGCCCACGTGGCNONE
J080039I10ACAGCCCACGTGGCNONE
J080042H01ACAGCCCACGTGGCNONE
J080042L18ACAGCCCACGTGGCNONE
J080042N21ACAGCCCACGTGGCNONE
J080043E01ACAGCCCACGTGGCNONE
J080044H05ACAGCCCACGTGGCNONE
J080047H10ACAGCCCACGTGGCNONE
J080050H03ACAGCCCACGTGGCNONE
J080060N21ACAGCCCACGTGGCNONE
J080061M09ACAGCCCACGTGGCNONE
J080062D15ACAGCCCACGTGGCNONE
J080062I18ACAGCCCACGTGGCNONE
J080063G05ACAGCCCACGTGGCNONE
J080063H16ACAGCCCACGTGGCNONE
J080067G16ACAGCCCACGTGGCNONE
J080067M07ACAGCCCACGTGGCNONE
J080068M13ACAGCCCACGTGGCNONE
J080069A19ACAGCCCACGTGGCNONE
J080069G14ACAGCCCACGTGGCNONE
J080070F04ACAGCCCACGTGGCNONE
J080070K15ACAGCCCACGTGGCNONE
J080072O20ACAGCCCACGTGGCNONE
J080075L02ACAGCCCACGTGGCNONE
J080077I10ACAGCCCACGTGGCNONE
J080077P03ACAGCCCACGTGGCNONE
J080078F14ACAGCCCACGTGGCNONE
J080092H15ACAGCCCACGTGGCNONE
J080097J15ACAGCCCACGTGGCNONE
J080305C10ACAGCCCACGTGGCNONE
Os01g0303300J053035N19GCCCCCACACACGTGGCNONE
J053035N19GGACACGTNONE
J075042F02GCCCCCACACACGTGGCNONE
J075042F02GGACACGTNONE
J075068E10GCCCCCACACACGTGGCNONE
J075068E10GGACACGTNONE
J075116E19GCCCCCACACACGTGGCNONE
J075116E19GGACACGTNONE
J075131C10GCCCCCACACACGTGGCNONE
J075131C10GGACACGTNONE
J075145J11GCCCCCACACACGTGGCNONE
J075145J11GGACACGTNONE
J075157P20GCCCCCACACACGTGGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J075157P20GGACACGTMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J075164G12GCCCCCACACACGTGGCNONE
J075164G12GGACACGTNONE
Os01g0305900Os01g0305900CCCACGTGTCSimilar to A-type R2R3 Myb protein (Fragment).
Os01g0314000015-084-B08ACACGTGGNONE
AK106418ACACGTGGNONE
Os01g0314300AK073419GCCACGTCUncharacterized domain 2 containing protein.
AK104939GCCACGTCNONE
J033044B03GCCACGTCNONE
J033060E12GCCACGTCNONE
J043037E21GCCACGTCNONE
J065019O18GCCACGTCNONE
J065025P22GCCACGTCNONE
J065042P06GCCACGTCNONE
J065074C19GCCACGTCNONE
J065074E13GCCACGTCNONE
J065094E05GCCACGTCNONE
J065108N08GCCACGTCNONE
J065134L13GCCACGTCNONE
J065152N24GCCACGTCNONE
J065162N24GCCACGTCNONE
J065170P16GCCACGTCNONE
J065177M20GCCACGTCNONE
J065187N01GCCACGTCNONE
J075012N12GCCACGTCNONE
J075046C17GCCACGTCNONE
J075055N06GCCACGTCNONE
J075141H03GCCACGTCNONE
J075150M11GCCACGTCNONE
J090005B16GCCACGTCNONE
J090079L11GCCACGTCNONE
J100039F16GCCACGTCNONE
Os01g0314800AF323612ACACGTGGCGLate embryogenesis abundant protein 3 family protein.
AF323612GCCACGTCLate embryogenesis abundant protein 3 family protein.
J043003O18ACACGTGGCGNONE
J043003O18GCCACGTCNONE
J065105K07ACACGTGGCGNONE
J065105K07GCCACGTCNONE
J065123H16ACACGTGGCGNONE
J065123H16GCCACGTCNONE
J065198K17ACACGTGGCGNONE
J065198K17GCCACGTCNONE
J100027C20ACACGTGGCGNONE
J100027C20GCCACGTCNONE
Os01g0321800AK064712ACGTCACCGas vesicle protein GvpC repeat containing protein.
J075175N03ACGTCACCNONE
Os01g0324400AK102854GCCACGTGGGNONE
AK111299GCCACGTGGGNONE
J033032A11GCCACGTGGGNONE
J033110L02GCCACGTGGGNONE
Os01g0328300AK064025GAGACGTGNONE
Os01g0331900013-026-D04GCCACGTCGGATNONE
013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE
AK064784GCCACGTCGGATNONE
AK064784GTGTGGGGCCCACGTGGGTCCCANONE
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein.
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein.
J013000B15GCCACGTCGGATNONE
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE
J033090D07GCCACGTCGGATNONE
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE
J090006L21GCCACGTCGGATNONE
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE
Os01g0337600AK099595ACGTGGGCATPase, F1 complex, gamma subunit family protein.
AK119468ACGTGGGCNONE
Os01g0348700009-125-H02GGTGACGTNONE
009-156-F08GGTGACGTNONE
009-177-A11GGTGACGTNONE
009-195-D02GGTGACGTNONE
013-040-B06GGTGACGTNONE
013-051-B09GGTGACGTNONE
AK120842GGTGACGTSimilar to 60S ribosomal protein L23a (L25).
J013071O22GGTGACGTNONE
J023022J07GGTGACGTNONE
J033028J08GGTGACGTNONE
J033109M11GGTGACGTNONE
J043022K15GGTGACGTNONE
J043031N11GGTGACGTNONE
J053023I10GGTGACGTNONE
J053045F16GGTGACGTNONE
J053054F22GGTGACGTNONE
J053094P15GGTGACGTNONE
J065048F01GGTGACGTNONE
J075012F16GGTGACGTNONE
J075089C09GGTGACGTNONE
J075179J20GGTGACGTNONE
J080305E19GGTGACGTNONE
J080309B21GGTGACGTNONE
J090017L05GGTGACGTNONE
J090058B11GGTGACGTNONE
Os01g0349000AK108540GCCACGTCConserved hypothetical protein.
AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein.
J065059M15GCCACGTCNONE
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE
Os01g0372100J075029A10GACGTGGCConserved hypothetical protein.
Os01g0372400AK108314CGACACGTGlutathione S-transferase, N-terminal domain containing protein.
Os01g0373400AK110973CCACGTGTHomeodomain-like containing protein.
Os01g0379400016-006-B06GCCACGTCNONE
AK064420GCCACGTCNONE
AK102388GCCACGTCNONE
AK110939GCCACGTCCyclin-like F-box domain containing protein.
J033092D18GCCACGTCNONE
J065070N09GCCACGTCNONE
J065078L01GCCACGTCNONE
J065083G15GCCACGTCNONE
Os01g0382450J065084M05GCCACGTGGCHypothetical protein.
J065084M05GCCACGTGTCCHypothetical protein.
J065155G18GCCACGTGGCNONE
J065155G18GCCACGTGTCCNONE
Os01g0390400AK067433ACGTGTCGCGACGCGNONE
AK106834ACGTGTCGCGACGCGNONE
J033069B09ACGTGTCGCGACGCGNONE
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE
Os01g0501800006-021-B07GACGTGGCNONE
006-021-B07GCCACGTCNONE
006-021-E12GACGTGGCNONE
006-021-E12GCCACGTCNONE
006-022-B08GACGTGGCNONE
006-022-B08GCCACGTCNONE
006-022-C09GACGTGGCNONE
006-022-C09GCCACGTCNONE
006-022-C12GACGTGGCNONE
006-022-C12GCCACGTCNONE
006-022-F10GACGTGGCNONE
006-022-F10GCCACGTCNONE
006-023-A09GACGTGGCNONE
006-023-A09GCCACGTCNONE
006-023-D02GACGTGGCNONE
006-023-D02GCCACGTCNONE
006-023-E06GACGTGGCNONE
006-023-E06GCCACGTCNONE
006-023-E11GACGTGGCNONE
006-023-E11GCCACGTCNONE
006-025-A01GACGTGGCNONE
006-025-A01GCCACGTCNONE
006-025-B07GACGTGGCNONE
006-025-B07GCCACGTCNONE
006-025-F04GACGTGGCNONE
006-025-F04GCCACGTCNONE
006-025-F11GACGTGGCNONE
006-025-F11GCCACGTCNONE
006-027-F05GACGTGGCNONE
006-027-F05GCCACGTCNONE
006-028-C02GACGTGGCNONE
006-028-C02GCCACGTCNONE
006-029-B01GACGTGGCNONE
006-029-B01GCCACGTCNONE
006-029-D09GACGTGGCNONE
006-029-D09GCCACGTCNONE
006-029-G02GACGTGGCNONE
006-029-G02GCCACGTCNONE
006-029-H08GACGTGGCNONE
006-029-H08GCCACGTCNONE
006-030-A02GACGTGGCNONE
006-030-A02GCCACGTCNONE
006-030-B05GACGTGGCNONE
006-030-B05GCCACGTCNONE
006-031-A01GACGTGGCNONE
006-031-A01GCCACGTCNONE
006-032-E09GACGTGGCNONE
006-032-E09GCCACGTCNONE
006-032-G10GACGTGGCNONE
006-032-G10GCCACGTCNONE
006-032-H11GACGTGGCNONE
006-032-H11GCCACGTCNONE
006-033-B08GACGTGGCNONE
006-033-B08GCCACGTCNONE
006-033-E11GACGTGGCNONE
006-033-E11GCCACGTCNONE
006-034-H01GACGTGGCNONE
006-034-H01GCCACGTCNONE
006-035-B09GACGTGGCNONE
006-035-B09GCCACGTCNONE
006-035-D08GACGTGGCNONE
006-035-D08GCCACGTCNONE
006-036-F01GACGTGGCNONE
006-036-F01GCCACGTCNONE
006-036-G01GACGTGGCNONE
006-036-G01GCCACGTCNONE
006-037-E12GACGTGGCNONE
006-037-E12GCCACGTCNONE
006-039-D07GACGTGGCNONE
006-039-D07GCCACGTCNONE
006-040-A03GACGTGGCNONE
006-040-A03GCCACGTCNONE
006-042-G11GACGTGGCNONE
006-042-G11GCCACGTCNONE
006-044-F11GACGTGGCNONE
006-044-F11GCCACGTCNONE
006-045-H04GACGTGGCNONE
006-045-H04GCCACGTCNONE
006-046-A09GACGTGGCNONE
006-046-A09GCCACGTCNONE
006-046-C12GACGTGGCNONE
006-046-C12GCCACGTCNONE
006-046-F10GACGTGGCNONE
006-046-F10GCCACGTCNONE
006-046-H08GACGTGGCNONE
006-046-H08GCCACGTCNONE
006-047-G05GACGTGGCNONE
006-047-G05GCCACGTCNONE
006-047-G06GACGTGGCNONE
006-047-G06GCCACGTCNONE
006-048-C05GACGTGGCNONE
006-048-C05GCCACGTCNONE
006-049-A07GACGTGGCNONE
006-049-A07GCCACGTCNONE
006-049-E03GACGTGGCNONE
006-049-E03GCCACGTCNONE
006-050-D08GACGTGGCNONE
006-050-D08GCCACGTCNONE
006-050-E02GACGTGGCNONE
006-050-E02GCCACGTCNONE
006-050-E07GACGTGGCNONE
006-050-E07GCCACGTCNONE
006-050-F11GACGTGGCNONE
006-050-F11GCCACGTCNONE
006-051-D04GACGTGGCNONE
006-051-D04GCCACGTCNONE
006-051-G07GACGTGGCNONE
006-051-G07GCCACGTCNONE
006-052-B06GACGTGGCNONE
006-052-B06GCCACGTCNONE
006-052-B11GACGTGGCNONE
006-052-B11GCCACGTCNONE
006-052-C06GACGTGGCNONE
006-052-C06GCCACGTCNONE
006-053-G03GACGTGGCNONE
006-053-G03GCCACGTCNONE
006-054-C01GACGTGGCNONE
006-054-C01GCCACGTCNONE
006-054-D09GACGTGGCNONE
006-054-D09GCCACGTCNONE
006-056-B11GACGTGGCNONE
006-056-B11GCCACGTCNONE
006-056-C07GACGTGGCNONE
006-056-C07GCCACGTCNONE
006-056-C12GACGTGGCNONE
006-056-C12GCCACGTCNONE
006-057-C05GACGTGGCNONE
006-057-C05GCCACGTCNONE
006-057-E08GACGTGGCNONE
006-057-E08GCCACGTCNONE
006-058-F03GACGTGGCNONE
006-058-F03GCCACGTCNONE
006-059-A03GACGTGGCNONE
006-059-A03GCCACGTCNONE
006-059-C12GACGTGGCNONE
006-059-C12GCCACGTCNONE
006-062-A06GACGTGGCNONE
006-062-A06GCCACGTCNONE
006-062-H04GACGTGGCNONE
006-062-H04GCCACGTCNONE
006-063-B08GACGTGGCNONE
006-063-B08GCCACGTCNONE
006-063-B10GACGTGGCNONE
006-063-B10GCCACGTCNONE
006-063-D11GACGTGGCNONE
006-063-D11GCCACGTCNONE
006-063-H07GACGTGGCNONE
006-063-H07GCCACGTCNONE
006-065-F08GACGTGGCNONE
006-065-F08GCCACGTCNONE
006-067-F07GACGTGGCNONE
006-067-F07GCCACGTCNONE
006-067-G04GACGTGGCNONE
006-067-G04GCCACGTCNONE
006-067-G12GACGTGGCNONE
006-067-G12GCCACGTCNONE
006-068-A12GACGTGGCNONE
006-068-A12GCCACGTCNONE
006-068-E08GACGTGGCNONE
006-068-E08GCCACGTCNONE
006-068-H01GACGTGGCNONE
006-068-H01GCCACGTCNONE
006-069-C01GACGTGGCNONE
006-069-C01GCCACGTCNONE
006-069-E08GACGTGGCNONE
006-069-E08GCCACGTCNONE
006-070-D05GACGTGGCNONE
006-070-D05GCCACGTCNONE
006-070-E10GACGTGGCNONE
006-070-E10GCCACGTCNONE
006-071-A02GACGTGGCNONE
006-071-A02GCCACGTCNONE
006-072-C01GACGTGGCNONE
006-072-C01GCCACGTCNONE
006-073-B07GACGTGGCNONE
006-073-B07GCCACGTCNONE
006-073-D02GACGTGGCNONE
006-073-D02GCCACGTCNONE
006-073-F06GACGTGGCNONE
006-073-F06GCCACGTCNONE
006-075-B10GACGTGGCNONE
006-075-B10GCCACGTCNONE
006-075-C01GACGTGGCNONE
006-075-C01GCCACGTCNONE
006-076-E10GACGTGGCNONE
006-076-E10GCCACGTCNONE
006-076-H12GACGTGGCNONE
006-076-H12GCCACGTCNONE
006-077-B10GACGTGGCNONE
006-077-B10GCCACGTCNONE
006-077-F12GACGTGGCNONE
006-077-F12GCCACGTCNONE
006-078-C04GACGTGGCNONE
006-078-C04GCCACGTCNONE
006-078-C10GACGTGGCNONE
006-078-C10GCCACGTCNONE
006-078-H11GACGTGGCNONE
006-078-H11GCCACGTCNONE
006-079-A05GACGTGGCNONE
006-079-A05GCCACGTCNONE
006-079-C01GACGTGGCNONE
006-079-C01GCCACGTCNONE
006-079-E04GACGTGGCNONE
006-079-E04GCCACGTCNONE
006-079-H06GACGTGGCNONE
006-079-H06GCCACGTCNONE
006-080-G05GACGTGGCNONE
006-080-G05GCCACGTCNONE
006-081-C07GACGTGGCNONE
006-081-C07GCCACGTCNONE
006-081-H07GACGTGGCNONE
006-081-H07GCCACGTCNONE
006-082-A09GACGTGGCNONE
006-082-A09GCCACGTCNONE
006-082-D02GACGTGGCNONE
006-082-D02GCCACGTCNONE
006-084-B11GACGTGGCNONE
006-084-B11GCCACGTCNONE
006-085-G10GACGTGGCNONE
006-085-G10GCCACGTCNONE
006-086-A05GACGTGGCNONE
006-086-A05GCCACGTCNONE
006-086-B05GACGTGGCNONE
006-086-B05GCCACGTCNONE
006-086-F09GACGTGGCNONE
006-086-F09GCCACGTCNONE
006-088-B09GACGTGGCNONE
006-088-B09GCCACGTCNONE
006-088-D02GACGTGGCNONE
006-088-D02GCCACGTCNONE
006-088-D10GACGTGGCNONE
006-088-D10GCCACGTCNONE
006-088-F05GACGTGGCNONE
006-088-F05GCCACGTCNONE
006-089-C06GACGTGGCNONE
006-089-C06GCCACGTCNONE
006-092-C07GACGTGGCNONE
006-092-C07GCCACGTCNONE
006-092-C08GACGTGGCNONE
006-092-C08GCCACGTCNONE
006-092-G09GACGTGGCNONE
006-092-G09GCCACGTCNONE
006-093-D12GACGTGGCNONE
006-093-D12GCCACGTCNONE
006-093-H10GACGTGGCNONE
006-093-H10GCCACGTCNONE
006-094-E07GACGTGGCNONE
006-094-E07GCCACGTCNONE
006-095-G01GACGTGGCNONE
006-095-G01GCCACGTCNONE
006-096-A10GACGTGGCNONE
006-096-A10GCCACGTCNONE
006-097-B06GACGTGGCNONE
006-097-B06GCCACGTCNONE
006-097-H12GACGTGGCNONE
006-097-H12GCCACGTCNONE
006-098-A08GACGTGGCNONE
006-098-A08GCCACGTCNONE
006-098-A10GACGTGGCNONE
006-098-A10GCCACGTCNONE
006-098-C10GACGTGGCNONE
006-098-C10GCCACGTCNONE
006-098-D02GACGTGGCNONE
006-098-D02GCCACGTCNONE
006-098-F10GACGTGGCNONE
006-098-F10GCCACGTCNONE
006-099-B08GACGTGGCNONE
006-099-B08GCCACGTCNONE
006-099-D02GACGTGGCNONE
006-099-D02GCCACGTCNONE
006-099-D05GACGTGGCNONE
006-099-D05GCCACGTCNONE
006-099-G10GACGTGGCNONE
006-099-G10GCCACGTCNONE
006-100-G06GACGTGGCNONE
006-100-G06GCCACGTCNONE
006-102-G09GACGTGGCNONE
006-102-G09GCCACGTCNONE
006-104-F06GACGTGGCNONE
006-104-F06GCCACGTCNONE
006-105-A12GACGTGGCNONE
006-105-A12GCCACGTCNONE
006-105-D04GACGTGGCNONE
006-105-D04GCCACGTCNONE
006-105-F05GACGTGGCNONE
006-105-F05GCCACGTCNONE
006-106-B01GACGTGGCNONE
006-106-B01GCCACGTCNONE
006-106-D05GACGTGGCNONE
006-106-D05GCCACGTCNONE
006-107-B01GACGTGGCNONE
006-107-B01GCCACGTCNONE
006-107-C02GACGTGGCNONE
006-107-C02GCCACGTCNONE
006-107-E01GACGTGGCNONE
006-107-E01GCCACGTCNONE
006-107-G03GACGTGGCNONE
006-107-G03GCCACGTCNONE
006-108-D09GACGTGGCNONE
006-108-D09GCCACGTCNONE
006-109-G01GACGTGGCNONE
006-109-G01GCCACGTCNONE
006-109-H07GACGTGGCNONE
006-109-H07GCCACGTCNONE
006-110-C04GACGTGGCNONE
006-110-C04GCCACGTCNONE
006-111-B11GACGTGGCNONE
006-111-B11GCCACGTCNONE
006-112-A02GACGTGGCNONE
006-112-A02GCCACGTCNONE
006-112-E03GACGTGGCNONE
006-112-E03GCCACGTCNONE
006-112-H04GACGTGGCNONE
006-112-H04GCCACGTCNONE
006-113-B07GACGTGGCNONE
006-113-B07GCCACGTCNONE
006-113-C08GACGTGGCNONE
006-113-C08GCCACGTCNONE
006-114-C12GACGTGGCNONE
006-114-C12GCCACGTCNONE
006-114-D06GACGTGGCNONE
006-114-D06GCCACGTCNONE
006-115-B06GACGTGGCNONE
006-115-B06GCCACGTCNONE
006-116-B01GACGTGGCNONE
006-116-B01GCCACGTCNONE
006-116-C02GACGTGGCNONE
006-116-C02GCCACGTCNONE
006-117-B05GACGTGGCNONE
006-117-B05GCCACGTCNONE
006-117-C06GACGTGGCNONE
006-117-C06GCCACGTCNONE
006-117-D10GACGTGGCNONE
006-117-D10GCCACGTCNONE
006-118-D04GACGTGGCNONE
006-118-D04GCCACGTCNONE
006-118-E12GACGTGGCNONE
006-118-E12GCCACGTCNONE
006-119-A06GACGTGGCNONE
006-119-A06GCCACGTCNONE
006-119-A09GACGTGGCNONE
006-119-A09GCCACGTCNONE
006-119-D02GACGTGGCNONE
006-119-D02GCCACGTCNONE
006-119-G07GACGTGGCNONE
006-119-G07GCCACGTCNONE
006-120-B03GACGTGGCNONE
006-120-B03GCCACGTCNONE
006-120-B07GACGTGGCNONE
006-120-B07GCCACGTCNONE
006-120-C01GACGTGGCNONE
006-120-C01GCCACGTCNONE
006-120-E04GACGTGGCNONE
006-120-E04GCCACGTCNONE
006-120-F11GACGTGGCNONE
006-120-F11GCCACGTCNONE
009-014-E11GACGTGGCNONE
009-014-E11GCCACGTCNONE
009-079-C06GACGTGGCNONE
009-079-C06GCCACGTCNONE
009-101-H06GACGTGGCNONE
009-101-H06GCCACGTCNONE
009-113-F07GACGTGGCNONE
009-113-F07GCCACGTCNONE
009-126-G04GACGTGGCNONE
009-126-G04GCCACGTCNONE
009-138-F01GACGTGGCNONE
009-138-F01GCCACGTCNONE
009-147-H02GACGTGGCNONE
009-147-H02GCCACGTCNONE
009-198-B08GACGTGGCNONE
009-198-B08GCCACGTCNONE
011-011-H03GACGTGGCNONE
011-011-H03GCCACGTCNONE
013-053-A06GACGTGGCNONE
013-053-A06GCCACGTCNONE
AK060886GACGTGGCNONE
AK060886GCCACGTCNONE
AK067715GACGTGGCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment).
AK067715GCCACGTCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment).
AK103920GACGTGGCNONE
AK103920GCCACGTCNONE
AK103937GACGTGGCNONE
AK103937GCCACGTCNONE
AK104080GACGTGGCNONE
AK104080GCCACGTCNONE
AK104649GACGTGGCNONE
AK104649GCCACGTCNONE
AK104760GACGTGGCNONE
AK104760GCCACGTCNONE
AK119163GACGTGGCNONE
AK119163GCCACGTCNONE
AK119188GACGTGGCNONE
AK119188GCCACGTCNONE
AK119515GACGTGGCNONE
AK119515GCCACGTCNONE
J013071M07GACGTGGCNONE
J013071M07GCCACGTCNONE
J013098E19GACGTGGCNONE
J013098E19GCCACGTCNONE
J013119C03GACGTGGCNONE
J013119C03GCCACGTCNONE
J013135O08GACGTGGCNONE
J013135O08GCCACGTCNONE
J023060H14GACGTGGCNONE
J023060H14GCCACGTCNONE
J023075M20GACGTGGCNONE
J023075M20GCCACGTCNONE
J023098P12GACGTGGCNONE
J023098P12GCCACGTCNONE
J053061C24GACGTGGCNONE
J053061C24GCCACGTCNONE
J053065C19GACGTGGCNONE
J053065C19GCCACGTCNONE
J053094K19GACGTGGCNONE
J053094K19GCCACGTCNONE
J075047M15GACGTGGCNONE
J075047M15GCCACGTCNONE
J075083H07GACGTGGCNONE
J075083H07GCCACGTCNONE
J075108K14GACGTGGCNONE
J075108K14GCCACGTCNONE
J075112B16GACGTGGCNONE
J075112B16GCCACGTCNONE
J075169L16GACGTGGCNONE
J075169L16GCCACGTCNONE
J075180P05GACGTGGCNONE
J075180P05GCCACGTCNONE
J075194D02GACGTGGCNONE
J075194D02GCCACGTCNONE
J080013D18GACGTGGCNONE
J080013D18GCCACGTCNONE
J080016G20GACGTGGCNONE
J080016G20GCCACGTCNONE
J080017E18GACGTGGCNONE
J080017E18GCCACGTCNONE
J080018J18GACGTGGCNONE
J080018J18GCCACGTCNONE
J080018N18GACGTGGCNONE
J080018N18GCCACGTCNONE
J080036G23GACGTGGCNONE
J080036G23GCCACGTCNONE
J080038O04GACGTGGCNONE
J080038O04GCCACGTCNONE
J080038P09GACGTGGCNONE
J080038P09GCCACGTCNONE
J080039N23GACGTGGCNONE
J080039N23GCCACGTCNONE
J080043F01GACGTGGCNONE
J080043F01GCCACGTCNONE
J080064J05GACGTGGCNONE
J080064J05GCCACGTCNONE
J080067C16GACGTGGCNONE
J080067C16GCCACGTCNONE
J080069B15GACGTGGCNONE
J080069B15GCCACGTCNONE
J080071H03GACGTGGCNONE
J080071H03GCCACGTCNONE
J080086L16GACGTGGCNONE
J080086L16GCCACGTCNONE
J080088H01GACGTGGCNONE
J080088H01GCCACGTCNONE
J080089B09GACGTGGCNONE
J080089B09GCCACGTCNONE
J080090K14GACGTGGCNONE
J080090K14GCCACGTCNONE
J080090N19GACGTGGCNONE
J080090N19GCCACGTCNONE
J080093H07GACGTGGCNONE
J080093H07GCCACGTCNONE
J080097B17GACGTGGCNONE
J080097B17GCCACGTCNONE
J080301J11GACGTGGCNONE
J080301J11GCCACGTCNONE
J080301K18GACGTGGCNONE
J080301K18GCCACGTCNONE
J080305K22GACGTGGCNONE
J080305K22GCCACGTCNONE
J090008D23GACGTGGCNONE
J090008D23GCCACGTCNONE
J090013H02GACGTGGCNONE
J090013H02GCCACGTCNONE
J090031N19GACGTGGCNONE
J090031N19GCCACGTCNONE
J090053G01GACGTGGCNONE
J090053G01GCCACGTCNONE
Os01g0511100013-100-E04GCCACGTGGCNONE
AK070914GCCACGTGGCUniversal stress protein (Usp) family protein.
J065068H19GCCACGTGGCNONE
J065186L22GCCACGTGGCNONE
J075039N04GCCACGTGGCNONE
J075040L20GCCACGTGGCNONE
J075040P08GCCACGTGGCNONE
J075094I09GCCACGTGGCNONE
J075097P08GCCACGTGGCNONE
J075115O17GCCACGTGGCNONE
J075132J24GCCACGTGGCNONE
J075148P21GCCACGTGGCNONE
J075166G18GCCACGTGGCNONE
J075172M15GCCACGTGGCNONE
J075187L14GCCACGTGGCNONE
Os01g0514300AK121086ACGTGTCCLissencephaly type-1-like homology motif domain containing protein.
Os01g0528800AK059305GGTGACGTNONE
AK068824GGTGACGTSimilar to Cinnamyl alcohol dehydrogenase.
Os01g0530500012-044-D12ACGTGGCGNONE
AK105280ACGTGGCGProtein of unknown function DUF295 family protein.
J065042N01ACGTGGCGNONE
Os01g0533400AK119447GCCCACGTGTGlycoside hydrolase, family 35 protein.
Os01g0541600Os01g0541600GCCACGTGConserved hypothetical protein.
Os01g0549250J065045M13CACGTGGCConserved hypothetical protein.
Os01g0557100Os01g0557100CACGTGGGAlpha/beta hydrolase family protein.
Os01g0558600006-120-G12GAGACGTGNONE
J013100N20GAGACGTGNONE
J033043P09GAGACGTGNONE
J033125M18GAGACGTGNONE
J053043N11GAGACGTGNONE
J065008E07GAGACGTGNONE
J065080O16GAGACGTGNONE
J075002G24GAGACGTGNONE
J075123C09GAGACGTGNONE
S66160GAGACGTGRas-related protein RIC1.
Os01g0559000006-032-B11GAGACGTGGCGNONE
AK061456GAGACGTGGCGProtein of unknown function DUF1000 family protein.
Os01g0564400J013160K14GCCACGTCACNONE
J065063D15GCCACGTCACNONE
J065162D09GCCACGTCACNONE
J075006C23GCCACGTCACNONE
J075112F15GCCACGTCACNONE
Os01g0571000AK066090CCCCCACGTMitochondrial substrate carrier family protein.
AK121334CCCCCACGTNONE
Os01g0571700AK120410ACACGTGGCNucleic acid-binding, OB-fold domain containing protein.
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein.
Os01g0579000AK064700CGCCACGTConserved hypothetical protein.
J075082F24CGCCACGTNONE
J075165I24CGCCACGTNONE
J080309M20CGCCACGTNONE
Os01g0581300AK066182CGCCACGTGSimilar to Lycopene epsilon-cyclase (Fragment).
AK072015CGCCACGTGNONE
Os01g0584900AK108522GAGACGTGWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77).
AY341846GAGACGTGNONE
J065161G19GAGACGTGNONE
J065193D14GAGACGTGNONE
J065193L05GAGACGTGNONE
J065196K16GAGACGTGNONE
Os01g0588700AK066951CGACACGTProtein of unknown function DUF572 family protein.
AK071911CGACACGTNONE
J013059D18CGACACGTNONE
J013090C12CGACACGTNONE
J090043F17CGACACGTNONE
Os01g0597600J075191I06CACGTCTCAmino acid/polyamine transporter II family protein.
Os01g0604100AK099765CCCACGTGGACCUspA domain containing protein.
J013094O21CCCACGTGGACCNONE
Os01g0607000009-020-G09CACGTCACNONE
AK105136CACGTCACGlutelin family protein.
Os01g0612600004-008-D07CACGTCACNONE
004-008-D07CACGTCACNONE
004-008-D07GACGTGGCGNONE
009-057-C09CACGTCACNONE
009-057-C09CACGTCACNONE
009-057-C09GACGTGGCGNONE
009-130-C01CACGTCACNONE
009-130-C01CACGTCACNONE
009-130-C01GACGTGGCGNONE
AK062906CACGTCACNONE
AK062906CACGTCACNONE
AK062906GACGTGGCGNONE
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561GACGTGGCGProtein of unknown function DUF1644 family protein.
J013065E14CACGTCACNONE
J013065E14CACGTCACNONE
J013065E14GACGTGGCGNONE
J013073D14CACGTCACNONE
J013073D14CACGTCACNONE
J013073D14GACGTGGCGNONE
J023014A21CACGTCACNONE
J023014A21CACGTCACNONE
J023014A21GACGTGGCGNONE
J023073M13CACGTCACNONE
J023073M13CACGTCACNONE
J023073M13GACGTGGCGNONE
J023079F02CACGTCACNONE
J023079F02CACGTCACNONE
J023079F02GACGTGGCGNONE
J023083B16CACGTCACNONE
J023083B16CACGTCACNONE
J023083B16GACGTGGCGNONE
J023090G19CACGTCACNONE
J023090G19CACGTCACNONE
J023090G19GACGTGGCGNONE
J023095F15CACGTCACNONE
J023095F15CACGTCACNONE
J023095F15GACGTGGCGNONE
J023119H11CACGTCACNONE
J023119H11CACGTCACNONE
J023119H11GACGTGGCGNONE
J033040B01CACGTCACNONE
J033040B01CACGTCACNONE
J033040B01GACGTGGCGNONE
J033044F13CACGTCACNONE
J033044F13CACGTCACNONE
J033044F13GACGTGGCGNONE
J033081E23CACGTCACNONE
J033081E23CACGTCACNONE
J033081E23GACGTGGCGNONE
J033121K07CACGTCACNONE
J033121K07CACGTCACNONE
J033121K07GACGTGGCGNONE
J033124D11CACGTCACNONE
J033124D11CACGTCACNONE
J033124D11GACGTGGCGNONE
J033131N22CACGTCACNONE
J033131N22CACGTCACNONE
J033131N22GACGTGGCGNONE
J065179E10CACGTCACNONE
J065179E10CACGTCACNONE
J065179E10GACGTGGCGNONE
J090020A13CACGTCACNONE
J090020A13CACGTCACNONE
J090020A13GACGTGGCGNONE
J090045K17CACGTCACNONE
J090045K17CACGTCACNONE
J090045K17GACGTGGCGNONE
J090047M24CACGTCACNONE
J090047M24CACGTCACNONE
J090047M24GACGTGGCGNONE
J090064G23CACGTCACNONE
J090064G23CACGTCACNONE
J090064G23GACGTGGCGNONE
J090084G08CACGTCACNONE
J090084G08CACGTCACNONE
J090084G08GACGTGGCGNONE
J090086F18CACGTCACNONE
J090086F18CACGTCACNONE
J090086F18GACGTGGCGNONE
J100032D09CACGTCACNONE
J100032D09CACGTCACNONE
J100032D09GACGTGGCGNONE
J100037O18CACGTCACNONE
J100037O18CACGTCACNONE
J100037O18GACGTGGCGNONE
J100042B03CACGTCACNONE
J100042B03CACGTCACNONE
J100042B03GACGTGGCGNONE
J100061D06CACGTCACNONE
J100061D06CACGTCACNONE
J100061D06GACGTGGCGNONE
J100061I03CACGTCACNONE
J100061I03CACGTCACNONE
J100061I03GACGTGGCGNONE
J100063B17CACGTCACNONE
J100063B17CACGTCACNONE
J100063B17GACGTGGCGNONE
Os01g0613900014-018-D04GCCACGTGNONE
AK119181GCCACGTGProtein of unknown function UPF0052 and CofD family protein.
J023119M14GCCACGTGNONE
J065019A15GCCACGTGNONE
J075090J10GCCACGTGNONE
J075195H12GCCACGTGNONE
Os01g0620800AK108846CCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os01g0627400015-100-E08ACGTGGCGNONE
AK074025ACGTGGCGSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment).
J033041C10ACGTGGCGNONE
J033076L02ACGTGGCGNONE
J053046G11ACGTGGCGNONE
Os01g0633400AK108988GACGTGGCTGGGCCBS domain containing protein.
Os01g0639600005-018-A02CACGTCTCNONE
005-018-A02GTGACGTGNONE
AK067056CACGTCTCProtein of unknown function DUF1645 family protein.
AK067056GTGACGTGProtein of unknown function DUF1645 family protein.
J013066M03CACGTCTCNONE
J013066M03GTGACGTGNONE
J013066O05CACGTCTCNONE
J013066O05GTGACGTGNONE
J013088M21CACGTCTCNONE
J013088M21GTGACGTGNONE
J065045F04CACGTCTCNONE
J065045F04GTGACGTGNONE
J080018F22CACGTCTCNONE
J080018F22GTGACGTGNONE
J080037B10CACGTCTCNONE
J080037B10GTGACGTGNONE
J080042G23CACGTCTCNONE
J080042G23GTGACGTGNONE
J080052B21CACGTCTCNONE
J080052B21GTGACGTGNONE
J080060H13CACGTCTCNONE
J080060H13GTGACGTGNONE
J100024A05CACGTCTCNONE
J100024A05GTGACGTGNONE
J100071A09CACGTCTCNONE
J100071A09GTGACGTGNONE
J100080K14CACGTCTCNONE
J100080K14GTGACGTGNONE
Os01g0643900AK108288ACGTGGGCOleosin family protein.
Os01g0644200014-007-H12CACGTGTCGNONE
014-007-H12GCCCCACGTNONE
AK063634CACGTGTCGConserved hypothetical protein.
AK063634GCCCCACGTConserved hypothetical protein.
AY549310CACGTGTCGNONE
AY549310GCCCCACGTNONE
J075068F10CACGTGTCGNONE
J075068F10GCCCCACGTNONE
J075082A11CACGTGTCGNONE
J075082A11GCCCCACGTNONE
Os01g0644900AK106910ACGTGTCCConserved hypothetical protein.
J100038B07ACGTGTCCNONE
J100044M17ACGTGTCCNONE
Os01g0646300AY464568ACGTGTCCSimilar to RGA2 protein.
AY464568CCACGTGTSimilar to RGA2 protein.
J080011P15ACGTGTCCNONE
J080011P15CCACGTGTNONE
J080017D01ACGTGTCCNONE
J080017D01CCACGTGTNONE
J080017H05ACGTGTCCNONE
J080017H05CCACGTGTNONE
J080027A16ACGTGTCCNONE
J080027A16CCACGTGTNONE
J080039F17ACGTGTCCNONE
J080039F17CCACGTGTNONE
J080063E23ACGTGTCCNONE
J080063E23CCACGTGTNONE
J080067L23ACGTGTCCNONE
J080067L23CCACGTGTNONE
J080068H01ACGTGTCCNONE
J080068H01CCACGTGTNONE
J080071F01ACGTGTCCNONE
J080071F01CCACGTGTNONE
J080076J05ACGTGTCCNONE
J080076J05CCACGTGTNONE
J080092L17ACGTGTCCNONE
J080092L17CCACGTGTNONE
Os01g0649000AK073564ACGTGGGGWD40-like domain containing protein.
Os01g0653700011-003-E09CGCCACGTGNONE
AK073990CGCCACGTGCyclin-like F-box domain containing protein.
AK120129CGCCACGTGNONE
J033036F18CGCCACGTGNONE
J033072D10CGCCACGTGNONE
J033089B18CGCCACGTGNONE
J033089J09CGCCACGTGNONE
J033136J11CGCCACGTGNONE
J065065E24CGCCACGTGNONE
J090065L03CGCCACGTGNONE
Os01g0654400Os01g0654400CGCCACGTConserved hypothetical protein.
Os01g0662600009-056-E10CGCCACGTNONE
AK062234CGCCACGTNONE
AK098887CGCCACGTNONE
AK099656CGCCACGTNONE
AK119723CGCCACGTSimilar to NifU-like protein.
J013001K01CGCCACGTNONE
J013090F20CGCCACGTNONE
J013119A14CGCCACGTNONE
J013121P12CGCCACGTNONE
J033132I15CGCCACGTNONE
J075023F22CGCCACGTNONE
J075023M13CGCCACGTNONE
J100024D10CGCCACGTNONE
J100024N01CGCCACGTNONE
J100026H09CGCCACGTNONE
J100027H07CGCCACGTNONE
J100045K07CGCCACGTNONE
J100057K18CGCCACGTNONE
J100085C22CGCCACGTNONE
Os01g0664500J075157K10GACACGTGTCCNONE
J100023K08GACACGTGTCCNONE
J100052N02GACACGTGTCCNONE
Os01g0667100Os01g0667100GCCCCACGTConserved hypothetical protein.
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein.
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein.
Os01g0673500AK065017GCCCACGTGSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
AK069899GCCCACGTGNONE
Os01g0678100AK099717ACGTGGGCConserved hypothetical protein.
Os01g0685900AK064024CCCACGTGTCCNONE
AK102005CCCACGTGTCCSimilar to 65kD microtubule associated protein.
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein.
Os01g0698100AK100466GACACGTGTCSWAP/Surp domain containing protein.
AK106727GACACGTGTCNONE
J065021C07GACACGTGTCNONE
J065078F04GACACGTGTCNONE
J065184H18GACACGTGTCNONE
J065184L10GACACGTGTCNONE
J075073I11GACACGTGTCNONE
J075083E10GACACGTGTCNONE
J075090K24GACACGTGTCNONE
J075109B11GACACGTGTCNONE
J075123H04GACACGTGTCNONE
J075157O16GACACGTGTCNONE
J075173D06GACACGTGTCNONE
J075199A05GACACGTGTCNONE
J090029H18GACACGTGTCNONE
Os01g0698300AK100582CGCCACGTCZinc finger, BED-type predicted domain containing protein.
J023105O09CGCCACGTCNONE
J023119F15CGCCACGTCNONE
J075007N19CGCCACGTCNONE
J075010F10CGCCACGTCNONE
J075032M22CGCCACGTCNONE
J075038E01CGCCACGTCNONE
J075064J17CGCCACGTCNONE
J075109L20CGCCACGTCNONE
J075131O16CGCCACGTCNONE
J075176A17CGCCACGTCNONE
J075178N11CGCCACGTCNONE
J075181N15CGCCACGTCNONE
J090060I06CGCCACGTCNONE
J090097O21CGCCACGTCNONE
Os01g0701900AK066793GCCCACGTGGCSimilar to Phosphatidylinositol transfer-like protein III.
Os01g0703300AK069643ACGTGGGCZinc finger, RING-type domain containing protein.
J023027O19ACGTGGGCNONE
Os01g0705200011-075-B10CGACACGTGNONE
014-056-F05CGACACGTGNONE
014-072-F08CGACACGTGNONE
014-082-E10CGACACGTGNONE
014-085-E10CGACACGTGNONE
AK064074CGACACGTGLate embryogenesis abundant protein repeat containing protein.
AK073837CGACACGTGNONE
D26536CGACACGTGNONE
J033070H10CGACACGTGNONE
J065138A19CGACACGTGNONE
J065140A10CGACACGTGNONE
Os01g0708300AK060040GCCACGTCNONE
Os01g0718500AK111346ACACGTGGCConserved hypothetical protein.
Os01g0720700J033124M22ACGTGGGCCAGGCCCNONE
J033124M22ACGTGTCCNONE
J065006G21ACGTGGGCCAGGCCCNONE
J065006G21ACGTGTCCNONE
J065025M24ACGTGGGCCAGGCCCNONE
J065025M24ACGTGTCCNONE
J065041J02ACGTGGGCCAGGCCCNONE
J065041J02ACGTGTCCNONE
J065044B14ACGTGGGCCAGGCCCNONE
J065044B14ACGTGTCCNONE
J065061J06ACGTGGGCCAGGCCCNONE
J065061J06ACGTGTCCNONE
J065116L21ACGTGGGCCAGGCCCNONE
J065116L21ACGTGTCCNONE
J075030F18ACGTGGGCCAGGCCCNONE
J075030F18ACGTGTCCNONE
J075034K17ACGTGGGCCAGGCCCNONE
J075034K17ACGTGTCCNONE
J075063I02ACGTGGGCCAGGCCCNONE
J075063I02ACGTGTCCNONE
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase.
J075110D21ACGTGTCCSimilar to Serine acetyltransferase.
J075188L15ACGTGGGCCAGGCCCNONE
J075188L15ACGTGTCCNONE
J075197B17ACGTGGGCCAGGCCCNONE
J075197B17ACGTGTCCNONE
Os01g0727400AK065692GCCACGTCConserved hypothetical protein.
Os01g0728700AK108000GACACGTGProtein of unknown function DUF1264 family protein.
J065045G01GACACGTGNONE
J065082L05GACACGTGNONE
J065140O06GACACGTGNONE
J065180C21GACACGTGNONE
J075099B15GACACGTGNONE
J075099P12GACACGTGNONE
J075110I24GACACGTGNONE
J075178E23GACACGTGNONE
Os01g0733200AK066316CACGTCACSimilar to Heat shock transcription factor 29 (Fragment).
AK066316GCCACACGTGGCSimilar to Heat shock transcription factor 29 (Fragment).
AY344493CACGTCACNONE
AY344493GCCACACGTGGCNONE
J013066G03CACGTCACNONE
J013066G03GCCACACGTGGCNONE
J090034J08CACGTCACNONE
J090034J08GCCACACGTGGCNONE
Os01g0734600012-079-G06CCCACGTGGCNONE
AK065450CCCACGTGGCNONE
AK103129CCCACGTGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK119562CCCACGTGGCNONE
J075086F18CCCACGTGGCNONE
J075147G07CCCACGTGGCNONE
Os01g0736100011-091-H04CCCACGTGNONE
015-004-D10CCCACGTGNONE
AK064298CCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK099365CCCACGTGNONE
AK103355CCCACGTGNONE
J033044B20CCCACGTGNONE
J033094G06CCCACGTGNONE
J033111N02CCCACGTGNONE
J033111P10CCCACGTGNONE
J033126K03CCCACGTGNONE
J043034D12CCCACGTGNONE
Os01g0738400AK110661ACGTGTCGSimilar to Zn-finger transcription factor.
Os01g0738600AK073479GACACGTGENTH/VHS domain containing protein.
AK120616GACACGTGNONE
J013046M12GACACGTGNONE
J013152B11GACACGTGNONE
J023007A09GACACGTGNONE
J023007N03GACACGTGNONE
J023042A01GACACGTGNONE
J023059P06GACACGTGNONE
J023113A05GACACGTGNONE
J033044K11GACACGTGNONE
J033082E04GACACGTGNONE
J090033B13GACACGTGNONE
J090062H08GACACGTGNONE
J100086G23GACACGTGNONE
Os01g0739000AK069568CACGTGGGSimilar to Mitochondrial processing peptidase.
AK073810CACGTGGGNONE
J013042N17CACGTGGGNONE
J023128N16CACGTGGGNONE
J033024F18CACGTGGGNONE
J033037D09CACGTGGGNONE
J033050E17CACGTGGGNONE
J033065K22CACGTGGGNONE
J033070E13CACGTGGGNONE
J033087A13CACGTGGGNONE
Os01g0743400AK059177CGCCACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment).
AK059177GGACACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment).
AK069114CGCCACGTNONE
AK069114GGACACGTNONE
J065070E07CGCCACGTNONE
J065070E07GGACACGTNONE
J065152G11CGCCACGTNONE
J065152G11GGACACGTNONE
Os01g0745400AK107872CCCACGTGGCSec34-like protein family protein.
AK107872GACGTGGCGSec34-like protein family protein.
AK107872GACGTGGCGSec34-like protein family protein.
Os01g0748600AK104674ACGTGGGGNONE
Os01g0749400AK064990ACGTGGGCCCCNONE
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein.
AK103775ACGTGGGCCCCNONE
J023001B06ACGTGGGCCCCNONE
Os01g0750500006-028-G02CACGTGGCGNONE
006-105-B02CACGTGGCGNONE
006-117-D04CACGTGGCGNONE
013-066-D08CACGTGGCGNONE
015-058-C06CACGTGGCGNONE
AK067516CACGTGGCGProtein of unknown function DUF814 domain containing protein.
AK104228CACGTGGCGNONE
AK104728CACGTGGCGNONE
J013056K07CACGTGGCGNONE
J013073A21CACGTGGCGNONE
J013112J21CACGTGGCGNONE
J065034L03CACGTGGCGNONE
J100026F22CACGTGGCGNONE
J100073H05CACGTGGCGNONE
J100084P09CACGTGGCGNONE
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein.
J100042H18ACGTGGGCCTANONE
J100044L13ACGTGGGCCTANONE
Os01g0757200AB092485GGACACGTNONE
AK060666GGACACGTNONE
AK060714GGACACGTNONE
AK099350GGACACGTNONE
AK101713GGACACGTSimilar to GA 2-oxidase 4.
Os01g0762900014-046-H02ACACGTGGNONE
J065155C07ACACGTGGConserved hypothetical protein.
J075129E21ACACGTGGNONE
Os01g0763300009-022-H12CGCCACGTNONE
009-036-F10CGCCACGTNONE
009-113-G01CGCCACGTNONE
009-184-E02CGCCACGTNONE
014-023-A04CGCCACGTNONE
AK063778CGCCACGTConserved hypothetical protein.
AK122186CGCCACGTNONE
J023086N17CGCCACGTNONE
J033150K13CGCCACGTNONE
J065001D05CGCCACGTNONE
J065042H11CGCCACGTNONE
J065049J22CGCCACGTNONE
J065077E09CGCCACGTNONE
J065171I01CGCCACGTNONE
J090044K23CGCCACGTNONE
J100063M07CGCCACGTNONE
Os01g0764800AK102809GACGTGGCSimilar to Nt-gh3 deduced protein.
AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein.
Os01g0767100AK109493CACGTGTCACCCGCGCSimilar to Lysosomal Pro-X carboxypeptidase.
AK109493GCCCCCACGTSimilar to Lysosomal Pro-X carboxypeptidase.
Os01g0767600AK070672CCCACGTGGCConserved hypothetical protein.
J013131M12CCCACGTGGCNONE
J023027B15CCCACGTGGCNONE
J023059I06CCCACGTGGCNONE
J023095L05CCCACGTGGCNONE
J033033E20CCCACGTGGCNONE
J033105F24CCCACGTGGCNONE
J033148N05CCCACGTGGCNONE
J065060H14CCCACGTGGCNONE
J090093E17CCCACGTGGCNONE
Os01g0767700AK122168CACGTGGGCACGTGGCSimilar to DEIH-box RNA/DNA helicase.
Os01g0769900AK065563GCCACGTCConserved hypothetical protein.
J013034F04GCCACGTCNONE
J023014B14GCCACGTCNONE
J023077M21GCCACGTCNONE
J023150J16GCCACGTCNONE
J090023N16GCCACGTCNONE
J090088K13GCCACGTCNONE
Os01g0770400006-112-B08GGACACGTNONE
AK061253GGACACGTNONE
AK061585GGACACGTCyclin-like F-box domain containing protein.
Os01g0772200AK060471CACGTGGGTranscription initiation factor IIF, beta subunit family protein.
AK103491CACGTGGGNONE
J023093E05CACGTGGGNONE
J023101M03CACGTGGGNONE
J033130N17CACGTGGGNONE
J043021L02CACGTGGGNONE
J065001E22CACGTGGGNONE
J065070G06CACGTGGGNONE
J065081D15CACGTGGGNONE
J065123G09CACGTGGGNONE
J065170K04CACGTGGGNONE
J065187A01CACGTGGGNONE
J065210E10CACGTGGGNONE
J075172K06CACGTGGGNONE
Os01g0772500AK109736CACGTCTCGCGCGGlycosyl transferase, family 14 protein.
Os01g0787400006-097-H03CGCCACGTGTNONE
AK061223CGCCACGTGTConserved hypothetical protein.
J065011G11CGCCACGTGTNONE
J065161F18CGCCACGTGTNONE
Os01g0788400AK109763CACGTGGCSimilar to Pectinesterase (EC 3.1.1.11) (Fragment).
AK120977CACGTGGCNONE
Os01g0793900009-109-G11CACGTCTCNONE
009-109-G11GGCCGTCCACGTGGCNONE
009-125-A10CACGTCTCNONE
009-125-A10GGCCGTCCACGTGGCNONE
AK062811CACGTCTCConserved hypothetical protein.
AK062811GGCCGTCCACGTGGCConserved hypothetical protein.
Os01g0794100009-027-B12GCCCCCACGTNONE
AK062404GCCCCCACGTConserved hypothetical protein.
Os01g0800800AK108093CCACGTGTConserved hypothetical protein.
AK108093CGACACGTConserved hypothetical protein.
Os01g0803200006-057-A07GTGACGTGNONE
009-028-E02ACGTGTCGNONE
009-028-E02GTGACGTGNONE
AF435976ACGTGTCGNONE
AF435976GTGACGTGNONE
AK061770GTGACGTGCysteine proteinase inhibitor-I (Oryzacystatin-I).
AK072206ACGTGTCGNONE
AK072206GTGACGTGNONE
AK121632ACGTGTCGNONE
AK121632GTGACGTGNONE
D29717ACGTGTCGNONE
D29717GTGACGTGNONE
J013088C04ACGTGTCGNONE
J013088C04GTGACGTGNONE
J023110F17ACGTGTCGNONE
J023110F17GTGACGTGNONE
J033029J21ACGTGTCGNONE
J033029J21GTGACGTGNONE
J033050G08ACGTGTCGNONE
J033050G08GTGACGTGNONE
J033121L08ACGTGTCGNONE
J033121L08GTGACGTGNONE
J03469ACGTGTCGNONE
J03469GTGACGTGNONE
J043040J18ACGTGTCGNONE
J043040J18GTGACGTGNONE
J065009B11ACGTGTCGNONE
J065009B11GTGACGTGNONE
J065037D05ACGTGTCGNONE
J065037D05GTGACGTGNONE
J065046C08ACGTGTCGNONE
J065046C08GTGACGTGNONE
J065051M08ACGTGTCGNONE
J065051M08GTGACGTGNONE
J065059H24ACGTGTCGNONE
J065059H24GTGACGTGNONE
J065060A10ACGTGTCGNONE
J065060A10GTGACGTGNONE
J065066O10GTGACGTGNONE
J065075N07ACGTGTCGNONE
J065075N07GTGACGTGNONE
J065088G17ACGTGTCGNONE
J065088G17GTGACGTGNONE
J065101N07GTGACGTGNONE
J065111I03ACGTGTCGNONE
J065111I03GTGACGTGNONE
J065122A02ACGTGTCGNONE
J065122A02GTGACGTGNONE
J065128L10ACGTGTCGNONE
J065128L10GTGACGTGNONE
J065134A09ACGTGTCGNONE
J065134A09GTGACGTGNONE
J065162H09ACGTGTCGNONE
J065162H09GTGACGTGNONE
J065178F05ACGTGTCGNONE
J065178F05GTGACGTGNONE
J065209J08ACGTGTCGNONE
J065209J08GTGACGTGNONE
J065217F08ACGTGTCGNONE
J065217F08GTGACGTGNONE
J075023A10ACGTGTCGNONE
J075023A10GTGACGTGNONE
J075023H20ACGTGTCGNONE
J075023H20GTGACGTGNONE
J075048H09ACGTGTCGNONE
J075048H09GTGACGTGNONE
J075062K16ACGTGTCGNONE
J075062K16GTGACGTGNONE
J075074F03ACGTGTCGNONE
J075074F03GTGACGTGNONE
J075080G02ACGTGTCGNONE
J075080G02GTGACGTGNONE
J075125J09ACGTGTCGNONE
J075125J09GTGACGTGNONE
J075125L15ACGTGTCGNONE
J075125L15GTGACGTGNONE
J075152L15ACGTGTCGNONE
J075152L15GTGACGTGNONE
J075173B03ACGTGTCGNONE
J075173B03GTGACGTGNONE
J075177M22ACGTGTCGNONE
J075177M22GTGACGTGNONE
J080001B16ACGTGTCGNONE
J080001B16GTGACGTGNONE
J080005K01ACGTGTCGNONE
J080005K01GTGACGTGNONE
J080005L08ACGTGTCGNONE
J080005L08GTGACGTGNONE
J080005N22ACGTGTCGNONE
J080005N22GTGACGTGNONE
J080007B02ACGTGTCGNONE
J080007B02GTGACGTGNONE
J080008E24ACGTGTCGNONE
J080008E24GTGACGTGNONE
J080008L18ACGTGTCGNONE
J080008L18GTGACGTGNONE
J080009H13ACGTGTCGNONE
J080009H13GTGACGTGNONE
J080010E21ACGTGTCGNONE
J080010E21GTGACGTGNONE
J080011D21ACGTGTCGNONE
J080011D21GTGACGTGNONE
J080011P22ACGTGTCGNONE
J080011P22GTGACGTGNONE
J080013A16ACGTGTCGNONE
J080013A16GTGACGTGNONE
J080016M01ACGTGTCGNONE
J080016M01GTGACGTGNONE
J080017A09ACGTGTCGNONE
J080017A09GTGACGTGNONE
J080020A09ACGTGTCGNONE
J080020A09GTGACGTGNONE
J080023B21ACGTGTCGNONE
J080023B21GTGACGTGNONE
J080023L04ACGTGTCGNONE
J080023L04GTGACGTGNONE
J080023M10ACGTGTCGNONE
J080023M10GTGACGTGNONE
J080028B02ACGTGTCGNONE
J080028B02GTGACGTGNONE
J080031E01ACGTGTCGNONE
J080031E01GTGACGTGNONE
J080036N13ACGTGTCGNONE
J080036N13GTGACGTGNONE
J080036N17ACGTGTCGNONE
J080036N17GTGACGTGNONE
J080037M05ACGTGTCGNONE
J080037M05GTGACGTGNONE
J080043K21ACGTGTCGNONE
J080043K21GTGACGTGNONE
J080043M11ACGTGTCGNONE
J080043M11GTGACGTGNONE
J080044I08ACGTGTCGNONE
J080044I08GTGACGTGNONE
J080044N16ACGTGTCGNONE
J080044N16GTGACGTGNONE
J080049L02ACGTGTCGNONE
J080049L02GTGACGTGNONE
J080050H04ACGTGTCGNONE
J080050H04GTGACGTGNONE
J080054G17ACGTGTCGNONE
J080054G17GTGACGTGNONE
J080054G21ACGTGTCGNONE
J080054G21GTGACGTGNONE
J080057A13ACGTGTCGNONE
J080057A13GTGACGTGNONE
J080057G02ACGTGTCGNONE
J080057G02GTGACGTGNONE
J080057G23ACGTGTCGNONE
J080057G23GTGACGTGNONE
J080061A19ACGTGTCGNONE
J080061A19GTGACGTGNONE
J080062A13ACGTGTCGNONE
J080062A13GTGACGTGNONE
J080062J22ACGTGTCGNONE
J080062J22GTGACGTGNONE
J080063G15ACGTGTCGNONE
J080063G15GTGACGTGNONE
J080066A18ACGTGTCGNONE
J080066A18GTGACGTGNONE
J080066E03ACGTGTCGNONE
J080066E03GTGACGTGNONE
J080067E10ACGTGTCGNONE
J080067E10GTGACGTGNONE
J080069L14ACGTGTCGNONE
J080069L14GTGACGTGNONE
J080071I09ACGTGTCGNONE
J080071I09GTGACGTGNONE
J080076E22ACGTGTCGNONE
J080076E22GTGACGTGNONE
J080078L03ACGTGTCGNONE
J080078L03GTGACGTGNONE
J080078L15ACGTGTCGNONE
J080078L15GTGACGTGNONE
J080081G17ACGTGTCGNONE
J080081G17GTGACGTGNONE
J080083C20ACGTGTCGNONE
J080083C20GTGACGTGNONE
J080083J03ACGTGTCGNONE
J080083J03GTGACGTGNONE
J080086C02ACGTGTCGNONE
J080086C02GTGACGTGNONE
J080088E16ACGTGTCGNONE
J080088E16GTGACGTGNONE
J080090A03ACGTGTCGNONE
J080090A03GTGACGTGNONE
J080090C14ACGTGTCGNONE
J080090C14GTGACGTGNONE
J080090F11ACGTGTCGNONE
J080090F11GTGACGTGNONE
J080093N06ACGTGTCGNONE
J080093N06GTGACGTGNONE
J080094B22ACGTGTCGNONE
J080094B22GTGACGTGNONE
J080094C11ACGTGTCGNONE
J080094C11GTGACGTGNONE
J080096E22ACGTGTCGNONE
J080096E22GTGACGTGNONE
J080096F18ACGTGTCGNONE
J080096F18GTGACGTGNONE
J080301K11ACGTGTCGNONE
J080301K11GTGACGTGNONE
J080302C22ACGTGTCGNONE
J080302C22GTGACGTGNONE
J080304K12ACGTGTCGNONE
J080304K12GTGACGTGNONE
J080317G06ACGTGTCGNONE
J080317G06GTGACGTGNONE
J080318L23ACGTGTCGNONE
J080318L23GTGACGTGNONE
J090047A06ACGTGTCGNONE
J090047A06GTGACGTGNONE
J100025M24ACGTGTCGNONE
J100025M24GTGACGTGNONE
J100026O09ACGTGTCGNONE
J100026O09GTGACGTGNONE
J100027D03ACGTGTCGNONE
J100027D03GTGACGTGNONE
J100028C19ACGTGTCGNONE
J100028C19GTGACGTGNONE
J100028D07ACGTGTCGNONE
J100028D07GTGACGTGNONE
J100031H13ACGTGTCGNONE
J100031H13GTGACGTGNONE
J100053M24GTGACGTGNONE
J100054J03ACGTGTCGNONE
J100054J03GTGACGTGNONE
J100055D24ACGTGTCGNONE
J100055D24GTGACGTGNONE
J100059L24ACGTGTCGNONE
J100059L24GTGACGTGNONE
J100062D23ACGTGTCGNONE
J100062D23GTGACGTGNONE
J100062F02ACGTGTCGNONE
J100062F02GTGACGTGNONE
J100063G22ACGTGTCGNONE
J100063G22GTGACGTGNONE
J100064A04ACGTGTCGNONE
J100064A04GTGACGTGNONE
J100064P17ACGTGTCGNONE
J100064P17GTGACGTGNONE
J100065F17ACGTGTCGNONE
J100065F17GTGACGTGNONE
J100072F05ACGTGTCGNONE
J100072F05GTGACGTGNONE
J100077D21ACGTGTCGNONE
J100077D21GTGACGTGNONE
J100081B17ACGTGTCGNONE
J100081B17GTGACGTGNONE
J100087G09ACGTGTCGNONE
J100087G09GTGACGTGNONE
J100089C12GTGACGTGNONE
J100090G01ACGTGTCGNONE
J100090G01GTGACGTGNONE
U54702ACGTGTCGNONE
U54702GTGACGTGNONE
Os01g0805700AK069400ACGTGTCGConserved hypothetical protein.
AK101937ACGTGTCGNONE
J033074F22ACGTGTCGNONE
J090027K02ACGTGTCGNONE
J090033G03ACGTGTCGNONE
Os01g0806400Os01g0806400GAGACGTGTCCProtein of unknown function DUF617, plant family protein.
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein.
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE
Os01g0816700AK100654GACGTGGCGTGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase).
AK100654GGACACGTSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase).
Os01g0817700003-108-A10CACGTGGCGNONE
003-108-A10CCCACGTGNONE
AK060836CACGTGGCGNONE
AK060836CCCACGTGNONE
AK065059CACGTGGCGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I).
AK065059CCCACGTGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I).
J013001J10CACGTGGCGNONE
J013001J10CCCACGTGNONE
J013047D19CACGTGGCGNONE
J013047D19CCCACGTGNONE
J013056K09CACGTGGCGNONE
J013056K09CCCACGTGNONE
J013068P20CACGTGGCGNONE
J013068P20CCCACGTGNONE
J013108G18CACGTGGCGNONE
J013108G18CCCACGTGNONE
J023007N01CACGTGGCGNONE
J023007N01CCCACGTGNONE
J023008A22CACGTGGCGNONE
J023008A22CCCACGTGNONE
J023010B02CACGTGGCGNONE
J023010B02CCCACGTGNONE
J023029O13CACGTGGCGNONE
J023029O13CCCACGTGNONE
J023064F21CACGTGGCGNONE
J023064F21CCCACGTGNONE
J023073E22CACGTGGCGNONE
J023073E22CCCACGTGNONE
J023143E14CACGTGGCGNONE
J023143E14CCCACGTGNONE
J033027N20CACGTGGCGNONE
J033027N20CCCACGTGNONE
J033032G14CACGTGGCGNONE
J033032G14CCCACGTGNONE
J033037E03CACGTGGCGNONE
J033037E03CCCACGTGNONE
J033057N19CACGTGGCGNONE
J033057N19CCCACGTGNONE
J033065E16CACGTGGCGNONE
J033065E16CCCACGTGNONE
J033066B19CACGTGGCGNONE
J033066B19CCCACGTGNONE
J033069G01CACGTGGCGNONE
J033069G01CCCACGTGNONE
J033071B03CACGTGGCGNONE
J033071B03CCCACGTGNONE
J033080C12CACGTGGCGNONE
J033080C12CCCACGTGNONE
J033081K19CACGTGGCGNONE
J033081K19CCCACGTGNONE
J033096B19CACGTGGCGNONE
J033096B19CCCACGTGNONE
J033101E20CACGTGGCGNONE
J033101E20CCCACGTGNONE
J033135L21CACGTGGCGNONE
J033135L21CCCACGTGNONE
J033139I07CACGTGGCGNONE
J033139I07CCCACGTGNONE
J033150A21CACGTGGCGNONE
J033150A21CCCACGTGNONE
J043036J05CACGTGGCGNONE
J043036J05CCCACGTGNONE
J043039D03CACGTGGCGNONE
J043039D03CCCACGTGNONE
J043039F19CACGTGGCGNONE
J043039F19CCCACGTGNONE
J090006K04CACGTGGCGNONE
J090006K04CCCACGTGNONE
J090017G14CACGTGGCGNONE
J090017G14CCCACGTGNONE
J090034E23CACGTGGCGNONE
J090034E23CCCACGTGNONE
J090039D07CACGTGGCGNONE
J090039D07CCCACGTGNONE
J090039I09CACGTGGCGNONE
J090039I09CCCACGTGNONE
J090044F21CACGTGGCGNONE
J090044F21CCCACGTGNONE
J090049J12CACGTGGCGNONE
J090049J12CCCACGTGNONE
J090053A19CACGTGGCGNONE
J090053A19CCCACGTGNONE
J090061E23CACGTGGCGNONE
J090061E23CCCACGTGNONE
J090079K09CACGTGGCGNONE
J090079K09CCCACGTGNONE
J090092F21CACGTGGCGNONE
J090092F21CCCACGTGNONE
J100022E04CACGTGGCGNONE
J100022E04CCCACGTGNONE
J100038I01CACGTGGCGNONE
J100038I01CCCACGTGNONE
J100066C22CACGTGGCGNONE
J100066C22CCCACGTGNONE
J100067C11CACGTGGCGNONE
J100067C11CCCACGTGNONE
J100073F07CACGTGGCGNONE
J100073F07CCCACGTGNONE
J100084I24CACGTGGCGNONE
J100084I24CCCACGTGNONE
Os01g0818300AK063274GTGACGTGKH domain containing protein.
Os01g0819300AK107799GAGACGTGConserved hypothetical protein.
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment).
Os01g0825800009-072-E02ACGTGTCGNONE
AK064301ACGTGTCGNONE
J033087L14ACGTGTCGNONE
Os01g0833400006-112-A07CGCCACGTNONE
AK072813CGCCACGTConserved hypothetical protein.
AK106052CGCCACGTNONE
J065195G24CGCCACGTNONE
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein.
Os01g0836400AK068741GACGTGGCGNONE
AK073540ACGTGGGCCCCASAC3/GANP family protein.
AK073540GACGTGGCGSAC3/GANP family protein.
J023019D11ACGTGGGCCCCANONE
J023019D11GACGTGGCGNONE
J023139O22ACGTGGGCCCCANONE
J023139O22GACGTGGCGNONE
J033042J20ACGTGGGCCCCANONE
J033042J20GACGTGGCGNONE
J033046M18ACGTGGGCCCCANONE
J033046M18GACGTGGCGNONE
J033124J09ACGTGGGCCCCANONE
J033124J09GACGTGGCGNONE
J090015E05ACGTGGGCCCCANONE
J090015E05GACGTGGCGNONE
J090076J09ACGTGGGCCCCANONE
J090076J09GACGTGGCGNONE
Os01g0837600AK108007CCCACGTGConserved hypothetical protein 1589, plant family protein.
J065005C19CCCACGTGNONE
J065025H20CCCACGTGNONE
J065061E22CCCACGTGNONE
J065065F14CCCACGTGNONE
J065083O21CCCACGTGNONE
J065201G05CCCACGTGNONE
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein.
Os01g0841600006-045-E03GCCACGTGTNONE
AK059805GCCACGTGTSimilar to Triosephosphate isomerase, cytosolic (EC 5.3.1.1) (TIM) (Triose- phosphate isomerase).
AK099310GCCACGTGTNONE
AK100708GCCACGTGTNONE
AK104017GCCACGTGTNONE
AK104461GCCACGTGTNONE
J065211F22GCCACGTGTNONE
J090054P20GCCACGTGTNONE
Os01g0841800AK111196GCCACGTCRibonuclease II and R domain containing protein.
Os01g0843700J065093C02CACGTCACCConserved hypothetical protein.
J065207M23CACGTCACCNONE
Os01g0846300AK065949CACGTCACSimilar to Protein phosphatase 2C.
AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C.
Os01g0848550J065073P06GGTGACGTGConserved hypothetical protein.
Os01g0851300AK101770GACGTGGCGTGReticulon family protein.
J033064I03GACGTGGCGTGNONE
J100058A05GACGTGGCGTGNONE
Os01g0851400J065070P10GACGTGGCGMachado-Joseph disease protein MJD family protein.
J065153F01GACGTGGCGNONE
Os01g0858900AK107493CACGTGGCGlycosyl transferase, family 29 protein.
J065097H23CACGTGGCNONE
J100070A02CACGTGGCNONE
J100072M10CACGTGGCNONE
Os01g0860700009-026-D05CCACGTGTCGNONE
009-026-D05GACGTGGCGNONE
AK062402CCACGTGTCGConserved hypothetical protein.
AK062402GACGTGGCGConserved hypothetical protein.
Os01g0863166J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein.
Os01g0865100016-066-A05GGACACGTCACNONE
AK065779GGACACGTCACNONE
AK071410GGACACGTCACSimilar to Uricase (Fragment).
J013039E23GGACACGTCACNONE
J023024I07GGACACGTCACNONE
J065160J15GGACACGTCACNONE
J090052J17GGACACGTCACNONE
Os01g0866400AB007193CACGTCACCSimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment).
AF378183CACGTCACCNONE
AK070516CACGTCACCNONE
AK119536CACGTCACCNONE
J023057C24CACGTCACCNONE
J023078G07CACGTCACCNONE
J065015D23CACGTCACCNONE
J065050J17CACGTCACCNONE
J065058B03CACGTCACCNONE
J065119C16CACGTCACCNONE
J065134N01CACGTCACCNONE
J065174B10CACGTCACCNONE
J075046D04CACGTCACCNONE
J075172N05CACGTCACCNONE
Os01g0867900AK061366CACGCCACGTCProtein of unknown function DUF502 family protein.
AK061366CGACACGTGProtein of unknown function DUF502 family protein.
AK061366GCCACGTGGCGGACGGCProtein of unknown function DUF502 family protein.
Os01g0868300AB004461GCCCACGTSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7).
Os01g0869800006-029-F03GAGACGTGGCNONE
006-067-H02GAGACGTGGCNONE
006-084-A06GAGACGTGGCNONE
AK058284GAGACGTGGCSimilar to Photosystem II subunit PsbS.
AK071827GAGACGTGGCNONE
AK104275GAGACGTGGCNONE
J013049J07GAGACGTGGCNONE
J033089F12GAGACGTGGCNONE
J090094I11GAGACGTGGCNONE
Os01g0871600AK103248GACACGTGTGF-beta receptor, type I/II extracellular region family protein.
Os01g0872100AK099405GCCCACGTTGF-beta receptor, type I/II extracellular region family protein.
J013001K17GCCCACGTNONE
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE
012-048-H01ACGTGGGCCCCACCNONE
012-094-B02ACGTGGGCCCCACCNONE
AK073077ACGTGGGCCCCACCNONE
AK105447ACGTGGGCCCCACCNONE
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein.
J100026G07ACGTGGGCCCCACCNONE
J100030F07ACGTGGGCCCCACCNONE
J100066J18ACGTGGGCCCCACCNONE
J100077G12ACGTGGGCCCCACCNONE
J100081K23ACGTGGGCCCCACCNONE
Os01g0879200AK109033CGACACGTConserved hypothetical protein.
J065017M17CGACACGTNONE
J065044O21CGACACGTNONE
Os01g0889000AK103621ACGTGGGCTTetratricopeptide-like helical domain containing protein.
Os01g0891300AK063674CATCCCCCCACGTSimilar to Allyl alcohol dehydrogenase.
AK063674CCCACGTGSimilar to Allyl alcohol dehydrogenase.
AK099151CATCCCCCCACGTNONE
AK099151CCCACGTGNONE
Os01g0891700AK105471CCACGTGTLeucine rich repeat, N-terminal domain containing protein.
Os01g0897600J065120F23CACGTGGGNONE
Os01g0900800009-086-C08CACGTCACCNONE
009-086-C08GACGTGGCNONE
AK068254CACGTCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK068254GACGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK105713CACGTCACCNONE
AK105713GACGTGGCNONE
J053025O10CACGTCACCNONE
J053025O10GACGTGGCNONE
J065063K24CACGTCACCNONE
J065063K24GACGTGGCNONE
J065167N21CACGTCACCNONE
J065167N21GACGTGGCNONE
J100060A20CACGTCACCNONE
J100060A20GACGTGGCNONE
J100079J03CACGTCACCNONE
J100079J03GACGTGGCNONE
J100087D11CACGTCACCNONE
J100087D11GACGTGGCNONE
J100089K10CACGTCACCNONE
J100089K10GACGTGGCNONE
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE
012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-088-G05CGCCACGTGTGGGCCGCANONE
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-099-A01CGCCACGTGTGGGCCGCANONE
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-009-H07CGCCACGTGTGGGCCGCANONE
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-035-H12CGCCACGTGTGGGCCGCANONE
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
016-054-G03CGCCACGTGTGGGCCGCANONE
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1.
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1.
AK105441CGCCACGTGTGGGCCGCANONE
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033069I02CGCCACGTGTGGGCCGCANONE
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033086K01CGCCACGTGTGGGCCGCANONE
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
Os01g0913300AK100698GTGACGTGTGF-beta receptor, type I/II extracellular region family protein.
J023030J07GTGACGTGNONE
J023102B09GTGACGTGNONE
J023102N03GTGACGTGNONE
J023114K11GTGACGTGNONE
J023140A21GTGACGTGNONE
J043017F23GTGACGTGNONE
J075058O15GTGACGTGNONE
Os01g0913400AK099881CGCCACGTCProtein prenyltransferase domain containing protein.
Os01g0914000AK101364ACGTCACCConserved hypothetical protein.
J080302O10ACGTCACCNONE
J080305G04ACGTCACCNONE
J080316B11ACGTCACCNONE
J090049A14ACGTCACCNONE
J090066O10ACGTCACCNONE
Os01g0914300009-174-C06CACGTCACNONE
014-073-B09CACGTCACNONE
AK103489CACGTCACNONE
AK105463CACGTCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
J033076A02CACGTCACNONE
J033130M24CACGTCACNONE
Os01g0915200AK121863ACGTGTCCSimilar to Cystatin.
Os01g0916300011-018-B12CCCCCACGTNONE
AK063922CCCCCACGTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein).
AK103107CCCCCACGTNONE
AK121061CCCCCACGTNONE
AK121997CCCCCACGTNONE
J033118P14CCCCCACGTNONE
J065002N16CCCCCACGTNONE
J065079B04CCCCCACGTNONE
J065102J07CCCCCACGTNONE
J065128F16CCCCCACGTNONE
J065184D11CCCCCACGTNONE
J065186A07CCCCCACGTNONE
J075115C07CCCCCACGTNONE
J075147C04CCCCCACGTNONE
Os01g0918200009-034-H02GGGGCCCACGTNONE
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3.
AK103092GGGGCCCACGTNONE
J065093P18GGGGCCCACGTNONE
J065137C15GGGGCCCACGTNONE
J065156G01GGGGCCCACGTNONE
J065206H16GGGGCCCACGTNONE
J065209D03GGGGCCCACGTNONE
J075073K05GGGGCCCACGTNONE
J075099B17GGGGCCCACGTNONE
J075166N04GGGGCCCACGTNONE
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
J013039J22CCCGGGCCCACGTGTCNONE
J013109E03CCCGGGCCCACGTGTCNONE
J023081J12CCCGGGCCCACGTGTCNONE
J023091E24CCCGGGCCCACGTGTCNONE
J033022A01CCCGGGCCCACGTGTCNONE
J033074C13CCCGGGCCCACGTGTCNONE
J065199E03CCCGGGCCCACGTGTCNONE
J075172O04CCCGGGCCCACGTGTCNONE
J090007G18CCCGGGCCCACGTGTCNONE
J090052B17CCCGGGCCCACGTGTCNONE
J090074H01CCCGGGCCCACGTGTCNONE
J100043J09CCCGGGCCCACGTGTCNONE
J100059J05CCCGGGCCCACGTGTCNONE
Os01g0922100AK110737ACGTGGCGConserved hypothetical protein.
AK110737GTGACGTGConserved hypothetical protein.
Os01g0923300AK067520CCCCACGTGTCBS domain containing protein.
AK067520GCCACGTGGCCBS domain containing protein.
Os01g0924000004-020-C09ACGTGGGCCGGANONE
004-020-C09AGCCCACGTNONE
004-020-C09CCCACGTGCTGGGCCGGCNONE
005-014-A06ACGTGGGCCGGANONE
005-014-A06AGCCCACGTNONE
005-014-A06CCCACGTGCTGGGCCGGCNONE
009-085-G12ACGTGGGCCGGANONE
009-085-G12AGCCCACGTNONE
009-085-G12CCCACGTGCTGGGCCGGCNONE
009-123-A08ACGTGGGCCGGANONE
009-123-A08AGCCCACGTNONE
009-123-A08CCCACGTGCTGGGCCGGCNONE
009-134-A05ACGTGGGCCGGANONE
009-134-A05AGCCCACGTNONE
009-134-A05CCCACGTGCTGGGCCGGCNONE
009-137-F06ACGTGGGCCGGANONE
009-137-F06AGCCCACGTNONE
009-137-F06CCCACGTGCTGGGCCGGCNONE
016-016-B08ACGTGGGCCGGANONE
016-016-B08AGCCCACGTNONE
016-016-B08CCCACGTGCTGGGCCGGCNONE
AF050674ACGTGGGCCGGANONE
AF050674AGCCCACGTNONE
AF050674CCCACGTGCTGGGCCGGCNONE
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK061690AGCCCACGTSimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK061690CCCACGTGCTGGGCCGGCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK120797ACGTGGGCCGGANONE
AK120797AGCCCACGTNONE
AK120797CCCACGTGCTGGGCCGGCNONE
J013040A15ACGTGGGCCGGANONE
J013040A15AGCCCACGTNONE
J013040A15CCCACGTGCTGGGCCGGCNONE
J013104L20ACGTGGGCCGGANONE
J013104L20AGCCCACGTNONE
J013104L20CCCACGTGCTGGGCCGGCNONE
J013127E12ACGTGGGCCGGANONE
J013127E12AGCCCACGTNONE
J013127E12CCCACGTGCTGGGCCGGCNONE
J013158O05ACGTGGGCCGGANONE
J013158O05AGCCCACGTNONE
J013158O05CCCACGTGCTGGGCCGGCNONE
J023012E09ACGTGGGCCGGANONE
J023012E09AGCCCACGTNONE
J023012E09CCCACGTGCTGGGCCGGCNONE
J023126L23ACGTGGGCCGGANONE
J023126L23AGCCCACGTNONE
J023126L23CCCACGTGCTGGGCCGGCNONE
J023143B03ACGTGGGCCGGANONE
J023143B03AGCCCACGTNONE
J023143B03CCCACGTGCTGGGCCGGCNONE
J065005B16ACGTGGGCCGGANONE
J065005B16AGCCCACGTNONE
J065005B16CCCACGTGCTGGGCCGGCNONE
J065101J15ACGTGGGCCGGANONE
J065101J15AGCCCACGTNONE
J065101J15CCCACGTGCTGGGCCGGCNONE
J065105K16ACGTGGGCCGGANONE
J065105K16AGCCCACGTNONE
J065105K16CCCACGTGCTGGGCCGGCNONE
J065155K16ACGTGGGCCGGANONE
J065155K16AGCCCACGTNONE
J065155K16CCCACGTGCTGGGCCGGCNONE
J065171M17ACGTGGGCCGGANONE
J065171M17AGCCCACGTNONE
J065171M17CCCACGTGCTGGGCCGGCNONE
J065182F07ACGTGGGCCGGANONE
J065182F07AGCCCACGTNONE
J065182F07CCCACGTGCTGGGCCGGCNONE
J065187D10ACGTGGGCCGGANONE
J065187D10AGCCCACGTNONE
J065187D10CCCACGTGCTGGGCCGGCNONE
J065194I24ACGTGGGCCGGANONE
J065194I24AGCCCACGTNONE
J065194I24CCCACGTGCTGGGCCGGCNONE
J065207E24ACGTGGGCCGGANONE
J065207E24AGCCCACGTNONE
J065207E24CCCACGTGCTGGGCCGGCNONE
J075001C24ACGTGGGCCGGANONE
J075001C24AGCCCACGTNONE
J075001C24CCCACGTGCTGGGCCGGCNONE
J075090O10ACGTGGGCCGGANONE
J075090O10AGCCCACGTNONE
J075090O10CCCACGTGCTGGGCCGGCNONE
J075095H17ACGTGGGCCGGANONE
J075095H17AGCCCACGTNONE
J075095H17CCCACGTGCTGGGCCGGCNONE
J075109M24ACGTGGGCCGGANONE
J075109M24AGCCCACGTNONE
J075109M24CCCACGTGCTGGGCCGGCNONE
J075123C18ACGTGGGCCGGANONE
J075123C18AGCCCACGTNONE
J075123C18CCCACGTGCTGGGCCGGCNONE
J075148G22ACGTGGGCCGGANONE
J075148G22AGCCCACGTNONE
J075148G22CCCACGTGCTGGGCCGGCNONE
J090009B09ACGTGGGCCGGANONE
J090009B09AGCCCACGTNONE
J090009B09CCCACGTGCTGGGCCGGCNONE
J090075K17ACGTGGGCCGGANONE
J090075K17AGCCCACGTNONE
J090075K17CCCACGTGCTGGGCCGGCNONE
J090081H23ACGTGGGCCGGANONE
J090081H23AGCCCACGTNONE
J090081H23CCCACGTGCTGGGCCGGCNONE
J090097H21ACGTGGGCCGGANONE
J090097H21AGCCCACGTNONE
J090097H21CCCACGTGCTGGGCCGGCNONE
J100063P14ACGTGGGCCGGANONE
J100063P14AGCCCACGTNONE
J100063P14CCCACGTGCTGGGCCGGCNONE
Os01g0930000009-174-C11GACGTGGCNONE
AK065852GACGTGGCConserved hypothetical protein.
Os01g0933600006-074-G12GCCACGTGNONE
012-065-H08GCCACGTGNONE
013-017-D11GCCACGTGNONE
013-046-C03GCCACGTGNONE
013-068-E06GCCACGTGNONE
015-084-F04GCCACGTGNONE
016-073-A05GCCACGTGNONE
AK067040GCCACGTGConserved hypothetical protein.
J013089P11GCCACGTGNONE
J013155O19GCCACGTGNONE
J023054B01GCCACGTGNONE
J033040D07GCCACGTGNONE
J053090I05GCCACGTGNONE
J065078G21GCCACGTGNONE
J075083B15GCCACGTGNONE
J090063L16GCCACGTGNONE
Os01g0935700AK069403AAAGCCCACGTSimilar to Cytochrome c1 (Fragment).
AK073125AAAGCCCACGTNONE
J023013M20AAAGCCCACGTNONE
Os01g0950900AK101121CACGTGTCGProtein of unknown function DUF221 domain containing protein.
AK101121CGCCACGTProtein of unknown function DUF221 domain containing protein.
AK101121CGCCACGTCProtein of unknown function DUF221 domain containing protein.
J023036H24CACGTGTCGNONE
J023036H24CGCCACGTNONE
J023036H24CGCCACGTCNONE
J023084G23CACGTGTCGNONE
J023084G23CGCCACGTNONE
J023084G23CGCCACGTCNONE
J033025J04CACGTGTCGNONE
J033025J04CGCCACGTNONE
J033025J04CGCCACGTCNONE
J033139J18CACGTGTCGNONE
J033139J18CGCCACGTNONE
J033139J18CGCCACGTCNONE
J090006A09CACGTGTCGNONE
J090006A09CGCCACGTNONE
J090006A09CGCCACGTCNONE
J090036D02CACGTGTCGNONE
J090036D02CGCCACGTNONE
J090036D02CGCCACGTCNONE
Os01g0952700AK103457GCCACGTGTMetallo-dependent hydrolase, composite domain containing protein.
Os01g0954100009-087-G12GTGACGTGNONE
AK062680GTGACGTGConserved hypothetical protein.
Os01g0954900AK110957CACGTCTCSimilar to Nucleoid DNA-binding-like protein.
Os01g0956200006-108-G08CACGTGTCACTNONE
AK068399CACGTGTCACTProtein of unknown function DUF563 family protein.
AK106051CACGTGTCACTNONE
J013149N20CACGTGTCACTNONE
J023085G19CACGTGTCACTNONE
J033070C20CACGTGTCACTNONE
J065080C11CACGTGTCACTNONE
J090038M06CACGTGTCACTNONE
J100038I20CACGTGTCACTNONE
J100039D17CACGTGTCACTNONE
Os01g0957600AK059235CGACACGTGSimilar to Elicitor-inducible cytochrome P450.
Os01g0962400AK059165GAGACGTGProtein of unknown function UPF0185 family protein.
J013157N02GAGACGTGNONE
J065169F13GAGACGTGNONE
J065192L21GAGACGTGNONE
J075016P11GAGACGTGNONE
J075023M14GAGACGTGNONE
J075051K17GAGACGTGNONE
J075053O05GAGACGTGNONE
J075080D08GAGACGTGNONE
J075080P04GAGACGTGNONE
J075088B19GAGACGTGNONE
J075137L06GAGACGTGNONE
J100029C08GAGACGTGNONE
J100067J09GAGACGTGNONE
Os01g0964000AK073599ACACGTGGGCSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1).
AK104012ACACGTGGGCNONE
AK104190ACACGTGGGCNONE
Os01g0965500J075073G20CGCCACGTCNuclear protein SET domain containing protein.
Os01g0966200009-079-H11ACGTGGCGNONE
009-124-G10ACGTGGCGNONE
AK058564ACGTGGCGProtein of unknown function YGGT family protein.
AK098935ACGTGGCGNONE
Os01g0967800012-074-C04CGCCACGTNONE
012-100-F12CGCCACGTNONE
015-061-F12CGCCACGTNONE
AK064854CGCCACGTConserved hypothetical protein.
J013000H07CGCCACGTNONE
J013050A03CGCCACGTNONE
J013063M22CGCCACGTNONE
J013070I04CGCCACGTNONE
J013075C08CGCCACGTNONE
J013104B08CGCCACGTNONE
J013122F05CGCCACGTNONE
J013151F19CGCCACGTNONE
J023093A07CGCCACGTNONE
J023097E21CGCCACGTNONE
J023108P06CGCCACGTNONE
J023138O04CGCCACGTNONE
J033025A05CGCCACGTNONE
J033060A07CGCCACGTNONE
J033060M15CGCCACGTNONE
J033087J19CGCCACGTNONE
J033094F16CGCCACGTNONE
J043009J11CGCCACGTNONE
J043040A12CGCCACGTNONE
J090002D12CGCCACGTNONE
J090024D15CGCCACGTNONE
J090067C12CGCCACGTNONE
J090079G19CGCCACGTNONE
J090090N17CGCCACGTNONE
Os01g0970400AK069207GCCACGTCEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit).
AK099169GCCACGTCNONE
J023009L14GCCACGTCNONE
J075025G03GCCACGTCNONE
J075198E21GCCACGTCNONE
J090004B14GCCACGTCNONE
J090071P11GCCACGTCNONE
J100075A22GCCACGTCNONE
U34597GCCACGTCNONE
Os01g0978100005-013-E01GACGTGGCNONE
011-026-E02GACGTGGCNONE
011-064-C01GACGTGGCNONE
AK065007GACGTGGCNONE
AK065652GACGTGGCSimilar to Cysteine synthase, mitochondrial precursor (EC 2.5.1.47) (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C).
AK099217GACGTGGCNONE
AK104704GACGTGGCNONE
J013001E19GACGTGGCNONE
J013034J22GACGTGGCNONE
J013037A05GACGTGGCNONE
J013038D12GACGTGGCNONE
J013043A14GACGTGGCNONE
J013044E11GACGTGGCNONE
J013058F11GACGTGGCNONE
J013059C10GACGTGGCNONE
J013059E23GACGTGGCNONE
J013071O13GACGTGGCNONE
J013072D12GACGTGGCNONE
J013096G01GACGTGGCNONE
J013110E17GACGTGGCNONE
J013130A19GACGTGGCNONE
J013158G08GACGTGGCNONE
J023037H20GACGTGGCNONE
J023038G11GACGTGGCNONE
J023042A17GACGTGGCNONE
J023045C21GACGTGGCNONE
J023052H13GACGTGGCNONE
J023055O19GACGTGGCNONE
J023065I12GACGTGGCNONE
J023087I12GACGTGGCNONE
J023114D12GACGTGGCNONE
J023126P03GACGTGGCNONE
J023132E20GACGTGGCNONE
J023133N04GACGTGGCNONE
J023134C14GACGTGGCNONE
J033039O20GACGTGGCNONE
J033067L02GACGTGGCNONE
J033094O10GACGTGGCNONE
J043017P11GACGTGGCNONE
J043036C15GACGTGGCNONE
J053090I03GACGTGGCNONE
J065013F14GACGTGGCNONE
J065019J10GACGTGGCNONE
J065036E05GACGTGGCNONE
J065040L23GACGTGGCNONE
J065050A13GACGTGGCNONE
J065089D03GACGTGGCNONE
J065193N04GACGTGGCNONE
J080011O20GACGTGGCNONE
J080015K08GACGTGGCNONE
J080022G05GACGTGGCNONE
J080027N24GACGTGGCNONE
J080032G19GACGTGGCNONE
J080046A18GACGTGGCNONE
J080046B08GACGTGGCNONE
J080051L24GACGTGGCNONE
J080053C23GACGTGGCNONE
J080054I20GACGTGGCNONE
J080074J03GACGTGGCNONE
J080080M04GACGTGGCNONE
J080080P15GACGTGGCNONE
J080086L08GACGTGGCNONE
J090019O07GACGTGGCNONE
J090033L11GACGTGGCNONE
J090036M14GACGTGGCNONE
J100054D04GACGTGGCNONE
J100064M06GACGTGGCNONE
Os02g0103800006-046-H11GCCACGTCNONE
006-046-H11GTGGGTCCCACGTGNONE
006-060-B05GCCACGTCNONE
006-060-B05GTGGGTCCCACGTGNONE
006-097-A09GCCACGTCNONE
006-097-A09GTGGGTCCCACGTGNONE
006-102-A10GCCACGTCNONE
006-102-A10GTGGGTCCCACGTGNONE
006-104-E11GCCACGTCNONE
006-104-E11GTGGGTCCCACGTGNONE
006-112-D09GCCACGTCNONE
006-112-D09GTGGGTCCCACGTGNONE
AK061774GCCACGTCNONE
AK061774GTGGGTCCCACGTGNONE
AK065309GCCACGTCNONE
AK065309GTGGGTCCCACGTGNONE
AK106213GCCACGTCSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
AK106213GTGGGTCCCACGTGSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
J013002O13GCCACGTCNONE
J013002O13GTGGGTCCCACGTGNONE
J013026F06GCCACGTCNONE
J013026F06GTGGGTCCCACGTGNONE
J013037O14GCCACGTCNONE
J013037O14GTGGGTCCCACGTGNONE
J013066N06GCCACGTCNONE
J013066N06GTGGGTCCCACGTGNONE
J013108G22GCCACGTCNONE
J013108G22GTGGGTCCCACGTGNONE
J023050M15GCCACGTCNONE
J023050M15GTGGGTCCCACGTGNONE
J023054B21GCCACGTCNONE
J023054B21GTGGGTCCCACGTGNONE
J023073C23GCCACGTCNONE
J023073C23GTGGGTCCCACGTGNONE
J023086H17GCCACGTCNONE
J023086H17GTGGGTCCCACGTGNONE
J023105A20GCCACGTCNONE
J023105A20GTGGGTCCCACGTGNONE
J065019E16GCCACGTCNONE
J065019E16GTGGGTCCCACGTGNONE
J065064G10GCCACGTCNONE
J065064G10GTGGGTCCCACGTGNONE
J065071C18GCCACGTCNONE
J065071C18GTGGGTCCCACGTGNONE
J065103B02GCCACGTCNONE
J065103B02GTGGGTCCCACGTGNONE
J065153G06GCCACGTCNONE
J065153G06GTGGGTCCCACGTGNONE
J075152G24GCCACGTCNONE
J075152G24GTGGGTCCCACGTGNONE
J075166P04GCCACGTCNONE
J075166P04GTGGGTCCCACGTGNONE
J080001F02GCCACGTCNONE
J080001F02GTGGGTCCCACGTGNONE
J080001M07GCCACGTCNONE
J080001M07GTGGGTCCCACGTGNONE
J080001O05GCCACGTCNONE
J080001O05GTGGGTCCCACGTGNONE
J080003I19GCCACGTCNONE
J080003I19GTGGGTCCCACGTGNONE
J080004C12GCCACGTCNONE
J080004C12GTGGGTCCCACGTGNONE
J080008E17GCCACGTCNONE
J080008E17GTGGGTCCCACGTGNONE
J080008M08GCCACGTCNONE
J080008M08GTGGGTCCCACGTGNONE
J080010H21GCCACGTCNONE
J080010H21GTGGGTCCCACGTGNONE
J080011F22GCCACGTCNONE
J080011F22GTGGGTCCCACGTGNONE
J080012C16GCCACGTCNONE
J080012C16GTGGGTCCCACGTGNONE
J080013D20GCCACGTCNONE
J080013D20GTGGGTCCCACGTGNONE
J080018K15GCCACGTCNONE
J080018K15GTGGGTCCCACGTGNONE
J080020O14GCCACGTCNONE
J080020O14GTGGGTCCCACGTGNONE
J080020P21GCCACGTCNONE
J080020P21GTGGGTCCCACGTGNONE
J080021A07GCCACGTCNONE
J080021A07GTGGGTCCCACGTGNONE
J080021B06GCCACGTCNONE
J080021B06GTGGGTCCCACGTGNONE
J080022G21GCCACGTCNONE
J080022G21GTGGGTCCCACGTGNONE
J080022P14GCCACGTCNONE
J080022P14GTGGGTCCCACGTGNONE
J080023H24GCCACGTCNONE
J080023H24GTGGGTCCCACGTGNONE
J080023M08GCCACGTCNONE
J080023M08GTGGGTCCCACGTGNONE
J080027E08GCCACGTCNONE
J080027E08GTGGGTCCCACGTGNONE
J080027E18GCCACGTCNONE
J080027E18GTGGGTCCCACGTGNONE
J080027O16GCCACGTCNONE
J080027O16GTGGGTCCCACGTGNONE
J080029M22GCCACGTCNONE
J080029M22GTGGGTCCCACGTGNONE
J080034A17GCCACGTCNONE
J080034A17GTGGGTCCCACGTGNONE
J080038G04GCCACGTCNONE
J080038G04GTGGGTCCCACGTGNONE
J080040F13GCCACGTCNONE
J080040F13GTGGGTCCCACGTGNONE
J080040F22GCCACGTCNONE
J080040F22GTGGGTCCCACGTGNONE
J080041L15GCCACGTCNONE
J080041L15GTGGGTCCCACGTGNONE
J080042L04GCCACGTCNONE
J080042L04GTGGGTCCCACGTGNONE
J080042M14GCCACGTCNONE
J080042M14GTGGGTCCCACGTGNONE
J080043C22GCCACGTCNONE
J080043C22GTGGGTCCCACGTGNONE
J080043O09GCCACGTCNONE
J080043O09GTGGGTCCCACGTGNONE
J080045N17GCCACGTCNONE
J080045N17GTGGGTCCCACGTGNONE
J080046N08GCCACGTCNONE
J080046N08GTGGGTCCCACGTGNONE
J080047K11GCCACGTCNONE
J080047K11GTGGGTCCCACGTGNONE
J080047O06GCCACGTCNONE
J080047O06GTGGGTCCCACGTGNONE
J080048H10GCCACGTCNONE
J080048H10GTGGGTCCCACGTGNONE
J080048N03GCCACGTCNONE
J080048N03GTGGGTCCCACGTGNONE
J080050N02GCCACGTCNONE
J080050N02GTGGGTCCCACGTGNONE
J080051A05GCCACGTCNONE
J080051A05GTGGGTCCCACGTGNONE
J080052I20GCCACGTCNONE
J080052I20GTGGGTCCCACGTGNONE
J080053E08GCCACGTCNONE
J080053E08GTGGGTCCCACGTGNONE
J080055P05GCCACGTCNONE
J080055P05GTGGGTCCCACGTGNONE
J080056F15GCCACGTCNONE
J080056F15GTGGGTCCCACGTGNONE
J080056H07GCCACGTCNONE
J080056H07GTGGGTCCCACGTGNONE
J080057M20GCCACGTCNONE
J080057M20GTGGGTCCCACGTGNONE
J080059K09GCCACGTCNONE
J080059K09GTGGGTCCCACGTGNONE
J080059M10GCCACGTCNONE
J080059M10GTGGGTCCCACGTGNONE
J080060B12GCCACGTCNONE
J080060B12GTGGGTCCCACGTGNONE
J080061N09GCCACGTCNONE
J080061N09GTGGGTCCCACGTGNONE
J080062H11GCCACGTCNONE
J080062H11GTGGGTCCCACGTGNONE
J080062M13GCCACGTCNONE
J080062M13GTGGGTCCCACGTGNONE
J080063D14GCCACGTCNONE
J080063D14GTGGGTCCCACGTGNONE
J080063G10GCCACGTCNONE
J080063G10GTGGGTCCCACGTGNONE
J080063H18GCCACGTCNONE
J080063H18GTGGGTCCCACGTGNONE
J080066J23GCCACGTCNONE
J080066J23GTGGGTCCCACGTGNONE
J080067J06GCCACGTCNONE
J080067J06GTGGGTCCCACGTGNONE
J080069I11GCCACGTCNONE
J080069I11GTGGGTCCCACGTGNONE
J080069O22GCCACGTCNONE
J080069O22GTGGGTCCCACGTGNONE
J080070P11GCCACGTCNONE
J080070P11GTGGGTCCCACGTGNONE
J080072D06GCCACGTCNONE
J080072D06GTGGGTCCCACGTGNONE
J080072J22GCCACGTCNONE
J080072J22GTGGGTCCCACGTGNONE
J080075A20GCCACGTCNONE
J080075A20GTGGGTCCCACGTGNONE
J080076F11GCCACGTCNONE
J080076F11GTGGGTCCCACGTGNONE
J080076J24GCCACGTCNONE
J080076J24GTGGGTCCCACGTGNONE
J080076K05GCCACGTCNONE
J080076K05GTGGGTCCCACGTGNONE
J080077O10GCCACGTCNONE
J080077O10GTGGGTCCCACGTGNONE
J080078L19GCCACGTCNONE
J080078L19GTGGGTCCCACGTGNONE
J080080I08GCCACGTCNONE
J080080I08GTGGGTCCCACGTGNONE
J080081J23GCCACGTCNONE
J080081J23GTGGGTCCCACGTGNONE
J080083A17GCCACGTCNONE
J080083A17GTGGGTCCCACGTGNONE
J080085C05GCCACGTCNONE
J080085C05GTGGGTCCCACGTGNONE
J080086G24GCCACGTCNONE
J080086G24GTGGGTCCCACGTGNONE
J080087H02GCCACGTCNONE
J080087H02GTGGGTCCCACGTGNONE
J080089A13GCCACGTCNONE
J080089A13GTGGGTCCCACGTGNONE
J080090K08GCCACGTCNONE
J080090K08GTGGGTCCCACGTGNONE
J080092M01GCCACGTCNONE
J080092M01GTGGGTCCCACGTGNONE
J080095A19GCCACGTCNONE
J080095A19GTGGGTCCCACGTGNONE
J080095B20GCCACGTCNONE
J080095B20GTGGGTCCCACGTGNONE
J100028F13GCCACGTCNONE
J100028F13GTGGGTCCCACGTGNONE
J100040G22GCCACGTCNONE
J100040G22GTGGGTCCCACGTGNONE
Os02g0105500AK063929ACACGTGGCNONE
AK102953ACACGTGGCIQ calmodulin-binding region domain containing protein.
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase.
Os02g0109200AK108815GCGCGCGAGACGTGNONE
J100030O18GCGCGCGAGACGTGNONE
Os02g0110200009-041-B07ATGGCCCACGTNONE
AK100012ATGGCCCACGTNONE
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase.
Os02g0115900AF006825CCACGTGTCGNONE
AK065743CCACGTGTCGEndosperm lumenal binding protein.
AK119653CCACGTGTCGNONE
Os02g0118400012-047-C10GCCACGTCNONE
AK064002GCCACGTCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75).
AK101004GCCACGTCNONE
J065022L23GCCACGTCNONE
J065087F24GCCACGTCNONE
Os02g0119400AK060055TTGGCCCACGTGTCCNONE
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52).
J033107H09TTGGCCCACGTGTCCNONE
J075175F09TTGGCCCACGTGTCCNONE
J090011H05TTGGCCCACGTGTCCNONE
J090091O05TTGGCCCACGTGTCCNONE
Os02g0120300006-078-G12GACACGTGNONE
AK066100GACACGTGConserved hypothetical protein.
J013059H10GACACGTGNONE
Os02g0120900Os02g0120900ACGTGGGGTetrahydrofolate dehydrogenase/cyclohydrolase family protein.
Os02g0122300016-074-F09CACGTGGGGNONE
AK073059CACGTGGGGNONE
AK106553CACGTGGGGConserved hypothetical protein.
J065085D17CACGTGGGGNONE
J065167I17CACGTGGGGNONE
Os02g0123100011-014-B01CGACACGTNONE
011-014-B01GACGTGGCNONE
012-013-G11CGACACGTNONE
012-013-G11GACGTGGCNONE
016-011-A12CGACACGTNONE
016-011-A12GACGTGGCNONE
AK063438CGACACGTNONE
AK063438GACGTGGCNONE
AK064363CGACACGTNONE
AK064363GACGTGGCNONE
AK101344CGACACGTSimilar to Cell division control protein 28 (EC 2.7.1.37).
AK101344GACGTGGCSimilar to Cell division control protein 28 (EC 2.7.1.37).
X60375CGACACGTNONE
X60375GACGTGGCNONE
Os02g0127900AK102783GGTGACGTHypothetical protein.
AK102783GGTGACGTGGCHypothetical protein.
J065042F15GGTGACGTNONE
J065042F15GGTGACGTGGCNONE
J075005J10GGTGACGTNONE
J075005J10GGTGACGTGGCNONE
J075038F02GGTGACGTNONE
J075038F02GGTGACGTGGCNONE
J075048K10GGTGACGTNONE
J075048K10GGTGACGTGGCNONE
J075064D21GGTGACGTNONE
J075064D21GGTGACGTGGCNONE
J075074M07GGTGACGTNONE
J075074M07GGTGACGTGGCNONE
J075078D20GGTGACGTNONE
J075078D20GGTGACGTGGCNONE
J075109P15GGTGACGTNONE
J075109P15GGTGACGTGGCNONE
J075115K24GGTGACGTNONE
J075115K24GGTGACGTGGCNONE
J075135G01GGTGACGTNONE
J075135G01GGTGACGTGGCNONE
J075156B07GGTGACGTNONE
J075156B07GGTGACGTGGCNONE
Os02g0135600AK069843GACACGTGGGGConserved hypothetical protein.
AK069843GACACGTGGGGGConserved hypothetical protein.
J023034H09GACACGTGGGGNONE
J023034H09GACACGTGGGGGNONE
J033090D08GACACGTGGGGNONE
J033090D08GACACGTGGGGGNONE
J100025N07GACACGTGGGGNONE
J100025N07GACACGTGGGGGNONE
J100075G18GACACGTGGGGNONE
J100075G18GACACGTGGGGGNONE
Os02g0135700AK100570CCCCACGTGTCDNA polymerase V family protein.
AK100570CCCCCACGTGTCDNA polymerase V family protein.
Os02g0135800006-039-F03GCCACGTCNONE
AB055156GCCACGTCSimilar to Sec13-like protein (Fragment).
AK111732GCCACGTCNONE
AK112028GCCACGTCNONE
J023038B14GCCACGTCNONE
J023039H16GCCACGTCNONE
J033033L03GCCACGTCNONE
J033082B07GCCACGTCNONE
J065076M03GCCACGTCNONE
J065159C05GCCACGTCNONE
J075052L24GCCACGTCNONE
J075087J09GCCACGTCNONE
J075119I03GCCACGTCNONE
J075124I20GCCACGTCNONE
J100042B01GCCACGTCNONE
J100067M10GCCACGTCNONE
Os02g0139100009-069-E01GCCACGTCNONE
AK065722GCCACGTCConserved hypothetical protein.
J033139D09GCCACGTCNONE
Os02g0142060J065137N15GAGACGTGAGGGACGGACSynapsin family protein.
Os02g0143200AK070600CCCCACGTCTCArmadillo-like helical domain containing protein.
Os02g0148100AF216317CACGTCACNONE
AF241166CACGTCACNONE
AK119650CACGTCACMAP kinase MAPK2 (MAP kinase 3).
Os02g0148500AK068931GACACGTGSimilar to TIMING OF CAB 1 (Fragment).
Os02g0148600AK059287GACACGTGTGGCConserved hypothetical protein.
Os02g0158900AK108324CGCCACGTCSimilar to SNF4.
Os02g0160000AK062904CACGTCACSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y- 1140 of Kluyveromyces lactis.
Os02g0165500AK060547GACGTGGCGConserved hypothetical protein.
Os02g0169000AK101628GCCACGTCConserved hypothetical protein.
Os02g0169900AK070107CGACACGTInositol monophosphatase family protein.
AK099345CGACACGTNONE
AK103039CGACACGTNONE
AK105887CGACACGTNONE
Os02g0170200AK107753CGTCGGATGAGACGTGConserved hypothetical protein.
J065117F22CGTCGGATGAGACGTGNONE
Os02g0173100AK066680GGACACGTNONE
AK100596GGACACGTSimilar to Cytochrome P450 97B3 (EC 1.14.-.-).
J023106P10GGACACGTNONE
Os02g0176300AK066588GGACACGTGTCConserved hypothetical protein.
J013072N24GGACACGTGTCNONE
Os02g0177700AK119941CGCCACGTProtein of unknown function DUF588 family protein.
Os02g0178800016-033-C04ACACGTGGNONE
AK060909ACACGTGGNONE
J013070P03ACACGTGGNONE
J023095E16ACACGTGGNONE
J043027P11ACACGTGGNONE
J043039N10ACACGTGGNONE
J065050K08ACACGTGGNONE
J065106C17ACACGTGGNONE
J065121G18ACACGTGGNONE
Os02g0180100005-013-B11GCCACGTCNONE
AK067359GCCACGTCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein.
AK104700GCCACGTCNONE
J013090O22GCCACGTCNONE
J013099P19GCCACGTCNONE
J090041M21GCCACGTCNONE
J090049C14GCCACGTCNONE
Os02g0184000AK072584CACGTCTCZinc finger, DHHC-type domain containing protein.
J090079L17CACGTCTCNONE
Os02g0186500AK068056CCCCACGTGGGSimilar to Protein kinase-like protein.
AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein.
AK099031CCCCACGTGGGNONE
AK099031CGCCACGTGTCCGACCCGCNONE
J013111A12CCCCACGTGGGNONE
J013111A12CGCCACGTGTCCGACCCGCNONE
J013127K13CCCCACGTGGGNONE
J013127K13CGCCACGTGTCCGACCCGCNONE
J013132O11CCCCACGTGGGNONE
J013132O11CGCCACGTGTCCGACCCGCNONE
J023056A11CCCCACGTGGGNONE
J023056A11CGCCACGTGTCCGACCCGCNONE
J023078M08CCCCACGTGGGNONE
J023078M08CGCCACGTGTCCGACCCGCNONE
J033081F07CCCCACGTGGGNONE
J033081F07CGCCACGTGTCCGACCCGCNONE
J090079E24CCCCACGTGGGNONE
J090079E24CGCCACGTGTCCGACCCGCNONE
J090097I02CCCCACGTGGGNONE
J090097I02CGCCACGTGTCCGACCCGCNONE
Os02g0188000011-003-E06CGCCACGTCNONE
AK105236CGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein.
Os02g0192900AK108910CGACACGTProtein kinase-like domain containing protein.
J065121E05CGACACGTNONE
Os02g0193500009-092-G09GACACGTGNONE
AK101237GACACGTGHypothetical protein.
J033031K13GACACGTGNONE
J033034P12GACACGTGNONE
J080304L19GACACGTGNONE
J100059N21GACACGTGNONE
Os02g0197600003-113-H08GCCACGTGGCNONE
003-129-H06GCCACGTGGCNONE
006-021-H09GCCACGTGGCNONE
006-022-B05GCCACGTGGCNONE
006-022-G12GCCACGTGGCNONE
006-023-A02GCCACGTGGCNONE
006-023-C02GCCACGTGGCNONE
006-023-G09GCCACGTGGCNONE
006-024-D12GCCACGTGGCNONE
006-025-C09GCCACGTGGCNONE
006-025-E01GCCACGTGGCNONE
006-026-A11GCCACGTGGCNONE
006-026-A12GCCACGTGGCNONE
006-028-E11GCCACGTGGCNONE
006-028-G03GCCACGTGGCNONE
006-029-A09GCCACGTGGCNONE
006-029-A12GCCACGTGGCNONE
006-029-D01GCCACGTGGCNONE
006-029-F12GCCACGTGGCNONE
006-029-G12GCCACGTGGCNONE
006-030-A08GCCACGTGGCNONE
006-030-C09GCCACGTGGCNONE
006-030-G06GCCACGTGGCNONE
006-031-D06GCCACGTGGCNONE
006-032-C01GCCACGTGGCNONE
006-034-B07GCCACGTGGCNONE
006-035-G01GCCACGTGGCNONE
006-036-H12GCCACGTGGCNONE
006-040-C01GCCACGTGGCNONE
006-041-G12GCCACGTGGCNONE
006-041-H02GCCACGTGGCNONE
006-041-H11GCCACGTGGCNONE
006-042-B01GCCACGTGGCNONE
006-042-F10GCCACGTGGCNONE
006-043-C04GCCACGTGGCNONE
006-044-D10GCCACGTGGCNONE
006-048-D11GCCACGTGGCNONE
006-049-D07GCCACGTGGCNONE
006-050-H05GCCACGTGGCNONE
006-051-D10GCCACGTGGCNONE
006-051-E05GCCACGTGGCNONE
006-053-C07GCCACGTGGCNONE
006-054-B10GCCACGTGGCNONE
006-054-C12GCCACGTGGCNONE
006-054-G08GCCACGTGGCNONE
006-055-D12GCCACGTGGCNONE
006-056-C04GCCACGTGGCNONE
006-056-H06GCCACGTGGCNONE
006-057-E07GCCACGTGGCNONE
006-058-C12GCCACGTGGCNONE
006-059-B06GCCACGTGGCNONE
006-059-B09GCCACGTGGCNONE
006-059-D05GCCACGTGGCNONE
006-060-D07GCCACGTGGCNONE
006-061-D01GCCACGTGGCNONE
006-061-G09GCCACGTGGCNONE
006-062-A12GCCACGTGGCNONE
006-062-D04GCCACGTGGCNONE
006-062-G01GCCACGTGGCNONE
006-063-C10GCCACGTGGCNONE
006-064-A10GCCACGTGGCNONE
006-067-E04GCCACGTGGCNONE
006-067-H11GCCACGTGGCNONE
006-069-G08GCCACGTGGCNONE
006-071-G06GCCACGTGGCNONE
006-073-E06GCCACGTGGCNONE
006-074-B12GCCACGTGGCNONE
006-074-F06GCCACGTGGCNONE
006-074-H01GCCACGTGGCNONE
006-076-D12GCCACGTGGCNONE
006-077-C08GCCACGTGGCNONE
006-083-H01GCCACGTGGCNONE
006-083-H09GCCACGTGGCNONE
006-084-C02GCCACGTGGCNONE
006-086-D05GCCACGTGGCNONE
006-086-E09GCCACGTGGCNONE
006-087-D04GCCACGTGGCNONE
006-087-E12GCCACGTGGCNONE
006-088-A01GCCACGTGGCNONE
006-088-H09GCCACGTGGCNONE
006-089-G01GCCACGTGGCNONE
006-090-G01GCCACGTGGCNONE
006-092-H10GCCACGTGGCNONE
006-096-G12GCCACGTGGCNONE
006-097-C04GCCACGTGGCNONE
006-098-B06GCCACGTGGCNONE
006-099-A02GCCACGTGGCNONE
006-099-B05GCCACGTGGCNONE
006-100-F02GCCACGTGGCNONE
006-100-F07GCCACGTGGCNONE
006-104-A01GCCACGTGGCNONE
006-107-F06GCCACGTGGCNONE
006-109-A05GCCACGTGGCNONE
006-110-G03GCCACGTGGCNONE
006-111-A06GCCACGTGGCNONE
006-111-C12GCCACGTGGCNONE
006-112-B03GCCACGTGGCNONE
006-113-A02GCCACGTGGCNONE
006-113-H06GCCACGTGGCNONE
006-115-D11GCCACGTGGCNONE
006-116-F11GCCACGTGGCNONE
006-117-A10GCCACGTGGCNONE
006-117-C01GCCACGTGGCNONE
006-117-D08GCCACGTGGCNONE
006-118-B12GCCACGTGGCNONE
006-118-D08GCCACGTGGCNONE
006-118-E11GCCACGTGGCNONE
006-118-H08GCCACGTGGCNONE
006-119-C10GCCACGTGGCNONE
006-120-H11GCCACGTGGCNONE
009-025-G09GCCACGTGGCNONE
009-061-H06GCCACGTGGCNONE
009-070-E02GCCACGTGGCNONE
009-077-A07GCCACGTGGCNONE
009-114-A07GCCACGTGGCNONE
009-115-G02GCCACGTGGCNONE
009-123-C06GCCACGTGGCNONE
009-125-H03GCCACGTGGCNONE
009-127-H11GCCACGTGGCNONE
009-136-G03GCCACGTGGCNONE
009-154-B05GCCACGTGGCNONE
009-162-B02GCCACGTGGCNONE
009-176-D09GCCACGTGGCNONE
009-178-F10GCCACGTGGCNONE
009-190-F05GCCACGTGGCNONE
009-200-C08GCCACGTGGCNONE
011-064-H10GCCACGTGGCNONE
AK060143GCCACGTGGCNONE
AK060970GCCACGTGGCNONE
AK068102GCCACGTGGCSimilar to PSI type III chlorophyll a/b-binding protein.
AK104096GCCACGTGGCNONE
AK104215GCCACGTGGCNONE
AK104348GCCACGTGGCNONE
AK104385GCCACGTGGCNONE
AK104392GCCACGTGGCNONE
AK104446GCCACGTGGCNONE
AK104458GCCACGTGGCNONE
AK104469GCCACGTGGCNONE
AK104522GCCACGTGGCNONE
AK104535GCCACGTGGCNONE
AK104557GCCACGTGGCNONE
AK104636GCCACGTGGCNONE
AK104646GCCACGTGGCNONE
AK104734GCCACGTGGCNONE
AK106085GCCACGTGGCNONE
AK109398GCCACGTGGCNONE
AK119554GCCACGTGGCNONE
J013044I21GCCACGTGGCNONE
J013090N21GCCACGTGGCNONE
J013130I24GCCACGTGGCNONE
J023038D09GCCACGTGGCNONE
J023064C23GCCACGTGGCNONE
J023088A09GCCACGTGGCNONE
J023105K12GCCACGTGGCNONE
J065022M15GCCACGTGGCNONE
J075062L23GCCACGTGGCNONE
J075069B05GCCACGTGGCNONE
J075072D15GCCACGTGGCNONE
J075090E24GCCACGTGGCNONE
J075126D14GCCACGTGGCNONE
J075154L21GCCACGTGGCNONE
J075165F23GCCACGTGGCNONE
J075166D04GCCACGTGGCNONE
J080003O05GCCACGTGGCNONE
J080005L07GCCACGTGGCNONE
J080008K15GCCACGTGGCNONE
J080009A07GCCACGTGGCNONE
J080009F05GCCACGTGGCNONE
J080010M06GCCACGTGGCNONE
J080011E06GCCACGTGGCNONE
J080011H20GCCACGTGGCNONE
J080018I05GCCACGTGGCNONE
J080021N17GCCACGTGGCNONE
J080036E20GCCACGTGGCNONE
J080040E22GCCACGTGGCNONE
J080044D19GCCACGTGGCNONE
J080045C21GCCACGTGGCNONE
J080047B08GCCACGTGGCNONE
J080048E24GCCACGTGGCNONE
J080053D19GCCACGTGGCNONE
J080053N09GCCACGTGGCNONE
J080054A19GCCACGTGGCNONE
J080061O16GCCACGTGGCNONE
J080064P15GCCACGTGGCNONE
J080065M06GCCACGTGGCNONE
J080067G11GCCACGTGGCNONE
J080072M09GCCACGTGGCNONE
J080079I15GCCACGTGGCNONE
J080082I12GCCACGTGGCNONE
J080083K21GCCACGTGGCNONE
J080096H12GCCACGTGGCNONE
J080096J10GCCACGTGGCNONE
J080097O13GCCACGTGGCNONE
J080305P05GCCACGTGGCNONE
J080311C21GCCACGTGGCNONE
J080317C16GCCACGTGGCNONE
Os02g0198200J075078L15GCCCCACGTGTCATCCACCCCCACGNONE
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE
Os02g0199800AK072970GCCACGTGTTGGGCSimilar to No pollen.
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein.
J043024M20GCGGCCCACGTGTCAGTGGNONE
Os02g0208200J023104K09TCCGGCCCACGTNONE
J033080L20TCCGGCCCACGTNONE
J033105D08TCCGGCCCACGTNONE
J090079N16TCCGGCCCACGTNONE
Os02g0208900003-126-D10ACAGCCCACGTNONE
AK066171ACAGCCCACGTNONE
AK070031ACAGCCCACGTNONE
AK121183ACAGCCCACGTSimilar to ZIGA2 protein (Fragment).
J013031N09ACAGCCCACGTNONE
J013045O19ACAGCCCACGTNONE
J023102A14ACAGCCCACGTNONE
J023145E14ACAGCCCACGTNONE
J033033E15ACAGCCCACGTNONE
J033041H19ACAGCCCACGTNONE
J033050E09ACAGCCCACGTNONE
J065191H21ACAGCCCACGTNONE
J065193C21ACAGCCCACGTNONE
J075068F07ACAGCCCACGTNONE
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE
AK060915ATCGGACGGCCCACGTNONE
AK099194ATCGGACGGCCCACGTNONE
AK104206ATCGGACGGCCCACGTNONE
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1).
J023109D07ATCGGACGGCCCACGTNONE
Os02g0226200Os02g0226200CACGTCTCHAD-superfamily subfamily IB hydrolase, hypothetical 1 protein.
Os02g0227200009-123-E01GTGACGTGNONE
AB018377GTGACGTGNONE
AK072428GTGACGTGNONE
AK120885GTGACGTGEarly nodulin.
J013022O14GTGACGTGNONE
J043034L12GTGACGTGNONE
J065030L16GTGACGTGNONE
J065056C10GTGACGTGNONE
J065066P11GTGACGTGNONE
J065101I24GTGACGTGNONE
J065102E21GTGACGTGNONE
J065113P17GTGACGTGNONE
J065120I17GTGACGTGNONE
J065122P08GTGACGTGNONE
J065124D04GTGACGTGNONE
J065140K10GTGACGTGNONE
J065140P20GTGACGTGNONE
J065147O15GTGACGTGNONE
J065148L22GTGACGTGNONE
J065159N03GTGACGTGNONE
J065180B09GTGACGTGNONE
J075027C19GTGACGTGNONE
J075120L04GTGACGTGNONE
J075134I10GTGACGTGNONE
J075161B08GTGACGTGNONE
J075172F11GTGACGTGNONE
J090073H01GTGACGTGNONE
J100017B11GTGACGTGNONE
J100030L05GTGACGTGNONE
J100064A03GTGACGTGNONE
Os02g0232400AK120755CCCACGTGSimilar to Citrate synthase, glyoxysomal precursor (EC 2.3.3.1) (GCS).
Os02g0245000AK119770GCCACGTCNONE
AK119874GCCACGTCSWAP/Surp domain containing protein.
J065038L11GCCACGTCNONE
J100059I06GCCACGTCNONE
J100076C23GCCACGTCNONE
J100081P08GCCACGTCNONE
J100084C13GCCACGTCNONE
Os02g0250600J075143F23ACGTGTCCLate embryogenesis abundant protein repeat containing protein.
J075143F23CACGTGTCLate embryogenesis abundant protein repeat containing protein.
Os02g0254600014-004-F08GACGTGGCGNONE
AK063627GACGTGGCGConserved hypothetical protein.
J065022D02GACGTGGCGNONE
J065168J03GACGTGGCGNONE
J065170D03GACGTGGCGNONE
J080021G21GACGTGGCGNONE
J080069G24GACGTGGCGNONE
J080071O10GACGTGGCGNONE
J080072L02GACGTGGCGNONE
J080093D22GACGTGGCGNONE
Os02g0265900006-102-B07CGCCACGTGGGCNONE
016-087-A02CGCCACGTGGGCNONE
AK059921CGCCACGTGGGCReticulon family protein.
AK064290CGCCACGTGGGCNONE
AK072628CGCCACGTGGGCNONE
AK104196CGCCACGTGGGCNONE
J023130B01CGCCACGTGGGCNONE
J080010O13CGCCACGTGGGCNONE
J100065C12CGCCACGTGGGCNONE
J100067M20CGCCACGTGGGCNONE
J100070I01CGCCACGTGGGCNONE
Os02g0266800AK070674ACACGTGGNONE
L34551ACACGTGGTranscriptional activator protein.
Os02g0274100AF442962ACACGTGGNONE
AK073294ACACGTGGPeroxisomal fatty acid beta-oxidation multifunctional protein (MFP) [Includes: Enoyl-CoA hydratase (EC 4.2.1.17); 3-2-trans-enoyl-CoA isomerase (EC 5.3.3.8); 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3); 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)].
J013020N17ACACGTGGNONE
J013092A06ACACGTGGNONE
J013111M11ACACGTGGNONE
J023004L14ACACGTGGNONE
J033034I11ACACGTGGNONE
J033060L04ACACGTGGNONE
J033082E18ACACGTGGNONE
J043017D17ACACGTGGNONE
J075064I16ACACGTGGNONE
J075070D03ACACGTGGNONE
Os02g0276200J075059P05ACGTGTCGIsochorismatase hydrolase family protein.
J075172E19ACGTGTCGNONE
J075199I16ACGTGTCGNONE
Os02g0278700AK100333ACACGTGGSimilar to Kaurene synthase A (Fragment).
Os02g0285800AK072177GACGTGGCSimilar to GTP-binding protein typA (Tyrosine phosphorylated protein A).
AK099035GACGTGGCNONE
Os02g0292800AK106941GCCACGTCProtein of unknown function DUF599 family protein.
Os02g0299200AK105486GCCCGGCCACGTCIQ calmodulin-binding region domain containing protein.
Os02g0301800AK067818GACACGTGGNONE
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein.
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein.
Os02g0307800006-080-C10GGTGACGTGNONE
006-116-A02GGTGACGTGNONE
AK061868GGTGACGTGNONE
AK065304GGTGACGTGConserved hypothetical protein.
Os02g0326700AK064977GGTGACGTGRhomboid-like protein family protein.
Os02g0327500AK069802GCCCACGTCTCProtein of unknown function DUF266, plant family protein.
J065186I04GCCCACGTCTCNONE
Os02g0328300006-039-C09CCACGTGTNONE
006-054-G10CCACGTGTNONE
006-075-B09CCACGTGTNONE
006-101-E09CCACGTGTNONE
006-108-D11CCACGTGTNONE
AK068505CCACGTGTPhenol hydroxylase reductase family protein.
AK104780CCACGTGTNONE
AK109330CCACGTGTNONE
J013092B10CCACGTGTNONE
J013128L11CCACGTGTNONE
J013154E10CCACGTGTNONE
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit.
Os02g0453300006-099-D03GGCCGTCCACGTGTCCNONE
009-120-D02GGCCGTCCACGTGTCCNONE
AK071220GGCCGTCCACGTGTCCNONE
AK109380GGCCGTCCACGTGTCCConserved hypothetical protein.
J023083M17GGCCGTCCACGTGTCCNONE
Os02g0461500AK108772CCCCACGTGBeta-Ig-H3/fasciclin domain containing protein.
Os02g0464700AK107077ACGTGGCGConserved hypothetical protein.
AK107077GACGTGGCGConserved hypothetical protein.
Os02g0467200014-053-H06CACGTCACAAAAGCCCATTNONE
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein.
J065197J05CACGTCACAAAAGCCCATTNONE
Os02g0468200AK103767CACGTCACCProtein of unknown function DUF652 family protein.
J033071N12CACGTCACCNONE
J033143I02CACGTCACCNONE
J100019J22CACGTCACCNONE
J100075O13CACGTCACCNONE
Os02g0493300AK069981ACGTGGCGTetratricopeptide-like helical domain containing protein.
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE
AK100111GCTGGGCCCACGTGTCNONE
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein.
J013074C19GCTGGGCCCACGTGTCNONE
J013153K16GCTGGGCCCACGTGTCNONE
J023078O21GCTGGGCCCACGTGTCNONE
J033127M18GCTGGGCCCACGTGTCNONE
J043038D17GCTGGGCCCACGTGTCNONE
J065090L08GCTGGGCCCACGTGTCNONE
J065110P16GCTGGGCCCACGTGTCNONE
J065163C03GCTGGGCCCACGTGTCNONE
J065213D23GCTGGGCCCACGTGTCNONE
J090010M14GCTGGGCCCACGTGTCNONE
J090016E02GCTGGGCCCACGTGTCNONE
J090044J20GCTGGGCCCACGTGTCNONE
J090091M16GCTGGGCCCACGTGTCNONE
J090099I23GCTGGGCCCACGTGTCNONE
Os02g0506500AK062572CGCCACGTCNONE
AK062572CGCCACGTCNONE
AK062572GACGTGGCNONE
AK063549CGCCACGTCNONE
AK063549CGCCACGTCNONE
AK063549GACGTGGCNONE
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein.
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein.
AK101016GACGTGGCMolybdenum cofactor biosynthesis domain containing protein.
AK109318CGCCACGTCNONE
AK109318CGCCACGTCNONE
AK109318GACGTGGCNONE
J013000C16CGCCACGTCNONE
J013000C16CGCCACGTCNONE
J013000C16GACGTGGCNONE
J013155N06CGCCACGTCNONE
J013155N06CGCCACGTCNONE
J013155N06GACGTGGCNONE
J023067A02CGCCACGTCNONE
J023067A02CGCCACGTCNONE
J023067A02GACGTGGCNONE
J023149E02CGCCACGTCNONE
J023149E02CGCCACGTCNONE
J023149E02GACGTGGCNONE
J033033J18CGCCACGTCNONE
J033033J18CGCCACGTCNONE
J033033J18GACGTGGCNONE
J033051O15CGCCACGTCNONE
J033051O15CGCCACGTCNONE
J033051O15GACGTGGCNONE
J075034C22CGCCACGTCNONE
J075034C22CGCCACGTCNONE
J075034C22GACGTGGCNONE
J075054O10CGCCACGTCNONE
J075054O10CGCCACGTCNONE
J075054O10GACGTGGCNONE
J075108L14CGCCACGTCNONE
J075108L14CGCCACGTCNONE
J075108L14GACGTGGCNONE
J090043O06CGCCACGTCNONE
J090043O06CGCCACGTCNONE
J090043O06GACGTGGCNONE
J100024P03CGCCACGTCNONE
J100024P03CGCCACGTCNONE
J100024P03GACGTGGCNONE
Os02g0509600AK111075CACGTGGCConserved hypothetical protein.
AK111075CACGTGGCGConserved hypothetical protein.
J065033B09CACGTGGCNONE
J065033B09CACGTGGCGNONE
J065069L04CACGTGGCNONE
J065069L04CACGTGGCGNONE
J065089H14CACGTGGCNONE
J065089H14CACGTGGCGNONE
J065119J16CACGTGGCNONE
J065119J16CACGTGGCGNONE
J065142J22CACGTGGCNONE
J065142J22CACGTGGCGNONE
J065168B14CACGTGGCNONE
J065168B14CACGTGGCGNONE
J065203L03CACGTGGCNONE
J065203L03CACGTGGCGNONE
J075044C18CACGTGGCNONE
J075044C18CACGTGGCGNONE
J075068D13CACGTGGCNONE
J075068D13CACGTGGCGNONE
J075152O09CACGTGGCNONE
J075152O09CACGTGGCGNONE
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
AK058487GCCACGTCNONE
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
AK122107GCCACGTCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J033126F06GCCACGTCNONE
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J053077L04GCCACGTCNONE
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J065010C11GCCACGTCNONE
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J075104O14GCCACGTCNONE
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080003G03GCCACGTCNONE
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080014K05GCCACGTCNONE
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080026F03GCCACGTCNONE
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080027O05GCCACGTCNONE
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080037K15GCCACGTCNONE
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080039D24GCCACGTCNONE
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080043G19GCCACGTCNONE
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080047P05GCCACGTCNONE
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080048D22GCCACGTCNONE
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080049F23GCCACGTCNONE
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080062A21GCCACGTCNONE
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080063H20GCCACGTCNONE
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080067P15GCCACGTCNONE
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080068P19GCCACGTCNONE
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080079J15GCCACGTCNONE
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080092K19GCCACGTCNONE
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE
J080096M04GCCACGTCNONE
Os02g0520800AK102815ACACGTGGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP).
J033108M09ACACGTGGCNONE
J100038E09ACACGTGGCNONE
J100076G11ACACGTGGCNONE
Os02g0522700012-086-C03GCCACGTCACCNONE
Os02g0527200009-022-A08ACACGTGGCCCCCCGCGNONE
009-030-A06ACACGTGGCCCCCCGCGNONE
009-034-F08ACACGTGGCCCCCCGCGNONE
009-041-E08ACACGTGGCCCCCCGCGNONE
009-048-H03ACACGTGGCCCCCCGCGNONE
009-067-E04ACACGTGGCCCCCCGCGNONE
009-081-E04ACACGTGGCCCCCCGCGNONE
009-124-C06ACACGTGGCCCCCCGCGNONE
009-154-A07ACACGTGGCCCCCCGCGNONE
009-180-G04ACACGTGGCCCCCCGCGNONE
009-180-H01ACACGTGGCCCCCCGCGNONE
009-183-C03ACACGTGGCCCCCCGCGNONE
009-198-E04ACACGTGGCCCCCCGCGNONE
009-199-A12ACACGTGGCCCCCCGCGNONE
AK058851ACACGTGGCCCCCCGCGConserved hypothetical protein.
J075041O08ACACGTGGCCCCCCGCGNONE
J075112L20ACACGTGGCCCCCCGCGNONE
J075193M15ACACGTGGCCCCCCGCGNONE
Os02g0528500J053035P18GAGACGTGNONE
J053046L13GAGACGTGNONE
J053099F11GAGACGTGNONE
Os02g0530100AK058520ACACGTGGHeavy metal transport/detoxification protein domain containing protein.
AK058520GACGTGGCGHeavy metal transport/detoxification protein domain containing protein.
Os02g0530600AK102681CCCCCACGTCTCGCGTCTCBRCT domain containing protein.
AK102681GGGTGGGCTACGTGTCGBRCT domain containing protein.
Os02g0531450J065097O14GACGTGGCGHypothetical protein.
J075155C16GACGTGGCGNONE
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein.
Os02g0534600CACGTCTCConserved hypothetical protein.
Os02g0534600GACGTGGCConserved hypothetical protein.
Os02g0538700006-022-A03CGCCACGTNONE
006-023-F01CGCCACGTNONE
006-026-B12CGCCACGTNONE
006-028-B08CGCCACGTNONE
006-028-H01CGCCACGTNONE
006-032-F02CGCCACGTNONE
006-034-E12CGCCACGTNONE
006-045-E02CGCCACGTNONE
006-046-E08CGCCACGTNONE
006-059-B07CGCCACGTNONE
006-060-E05CGCCACGTNONE
006-061-D11CGCCACGTNONE
006-067-G08CGCCACGTNONE
006-068-F12CGCCACGTNONE
006-077-B12CGCCACGTNONE
006-078-E10CGCCACGTNONE
006-079-A06CGCCACGTNONE
006-086-B12CGCCACGTNONE
006-086-E06CGCCACGTNONE
006-087-F01CGCCACGTNONE
006-094-D12CGCCACGTNONE
006-095-A08CGCCACGTNONE
006-097-B01CGCCACGTNONE
006-099-D07CGCCACGTNONE
006-103-A12CGCCACGTNONE
006-108-D05CGCCACGTNONE
006-110-F11CGCCACGTNONE
006-113-E10CGCCACGTNONE
006-120-F07CGCCACGTNONE
009-006-C10CGCCACGTNONE
009-045-F12CGCCACGTNONE
009-045-G05CGCCACGTNONE
009-050-A07CGCCACGTNONE
009-077-D05CGCCACGTNONE
009-080-G04CGCCACGTNONE
009-085-F09CGCCACGTNONE
009-090-A12CGCCACGTNONE
009-127-B07CGCCACGTNONE
009-136-B11CGCCACGTNONE
009-145-C04CGCCACGTNONE
009-164-G04CGCCACGTNONE
009-166-F12CGCCACGTNONE
009-187-D11CGCCACGTNONE
009-193-B07CGCCACGTNONE
009-198-H01CGCCACGTNONE
009-199-C09CGCCACGTNONE
009-199-E04CGCCACGTNONE
013-071-G11CGCCACGTNONE
AK060001CGCCACGTNONE
AK061396CGCCACGTNONE
AK065946CGCCACGTNONE
AK104564CGCCACGTNONE
AK104600CGCCACGTNONE
AK109400CGCCACGTNONE
AK109402CGCCACGTHarpin-induced 1 domain containing protein.
J013049G21CGCCACGTNONE
J065140C21CGCCACGTNONE
J075001F23CGCCACGTNONE
J075197B13CGCCACGTNONE
J100024N04CGCCACGTNONE
Os02g0539200AK108494ACGTGTCGU box domain containing protein.
Os02g0551600009-174-H09GCCACGTCACCNONE
009-174-H09GCCACGTGGCNONE
AK063102GCCACGTCACCConserved hypothetical protein.
AK063102GCCACGTGGCConserved hypothetical protein.
Os02g0555300AK108454CACGTCTCNo apical meristem (NAM) protein domain containing protein.
Os02g0556100006-100-D03CACGTGGCNONE
AK059938CACGTGGCNONE
AK103125CACGTGGCNAD-dependent epimerase/dehydratase family protein.
J033107B22CACGTGGCNONE
J033119M03CACGTGGCNONE
J033120L06CACGTGGCNONE
J043007B02CACGTGGCNONE
J043012G03CACGTGGCNONE
J043024A02CACGTGGCNONE
J043027J18CACGTGGCNONE
J100019E06CACGTGGCNONE
J100069C22CACGTGGCNONE
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein.
Os02g0559300AK100088ACGTGTCGNONE
AK121206ACGTGTCGProtein kinase-like domain containing protein.
J023003H24ACGTGTCGNONE
J023088A16ACGTGTCGNONE
J023100K01ACGTGTCGNONE
J023127H24ACGTGTCGNONE
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein.
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE
AB110167GCCGGCCCACGTCGGCCCATCANONE
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61).
AK104168GCCGGCCCACGTCGGCCCATCANONE
AK109435GCCGGCCCACGTCGGCCCATCANONE
AY224558GCCGGCCCACGTCGGCCCATCANONE
J023013M13GCCGGCCCACGTCGGCCCATCANONE
J023059I08GCCGGCCCACGTCGGCCCATCANONE
J023084C06GCCGGCCCACGTCGGCCCATCANONE
J023114G06GCCGGCCCACGTCGGCCCATCANONE
J023142A09GCCGGCCCACGTCGGCCCATCANONE
J033026E14GCCGGCCCACGTCGGCCCATCANONE
J053042M10GCCGGCCCACGTCGGCCCATCANONE
J053082K21GCCGGCCCACGTCGGCCCATCANONE
J065105J15GCCGGCCCACGTCGGCCCATCANONE
J065150F02GCCGGCCCACGTCGGCCCATCANONE
J075177H05GCCGGCCCACGTCGGCCCATCANONE
J080040B16GCCGGCCCACGTCGGCCCATCANONE
J090077J10GCCGGCCCACGTCGGCCCATCANONE
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein.
J065115K07ATTGGGCCACGTGGCGNONE
Os02g0575000AK121198ACGTCACCConserved hypothetical protein.
AK121198ACGTCACCConserved hypothetical protein.
J023087D21ACGTCACCNONE
J023087D21ACGTCACCNONE
J065029M04ACGTCACCNONE
J065029M04ACGTCACCNONE
J065173G10ACGTCACCNONE
J065173G10ACGTCACCNONE
J065188I20ACGTCACCNONE
J065188I20ACGTCACCNONE
J065197H16ACGTCACCNONE
J065197H16ACGTCACCNONE
J100057F16ACGTCACCNONE
J100057F16ACGTCACCNONE
J100077G04ACGTCACCNONE
J100077G04ACGTCACCNONE
Os02g0576400AK107966CACGTCACConserved hypothetical protein.
AK107966CACGTCTCConserved hypothetical protein.
J075083G06CACGTCACNONE
J075083G06CACGTCTCNONE
J075164K09CACGTCACNONE
J075164K09CACGTCTCNONE
Os02g0577900J065164K11ACGTGGCGConserved hypothetical protein.
Os02g0578300012-035-D02GCCACGTGGCGNONE
AK105275GCCACGTGGCGSimilar to Glucosyltransferase (Fragment).
Os02g0579000AB028180GCCACGTCTCNONE
AK108080GCCACGTCTCNo apical meristem (NAM) protein domain containing protein.
J065045C05GCCACGTCTCNONE
J065191M18GCCACGTCTCNONE
J065207F02GCCACGTCTCNONE
J065213H24GCCACGTCTCNONE
J075003H02GCCACGTCTCNONE
J075143B14GCCACGTCTCNONE
J100051O03GCCACGTCTCNONE
J100075K22GCCACGTCTCNONE
Os02g0581800J065071F12AGCCCACACGTGGConserved hypothetical protein.
Os02g0582400006-091-G09GGTGACGTGNONE
AK070989GGTGACGTGConserved hypothetical protein.
J023075I23GGTGACGTGNONE
J080021H07GGTGACGTGNONE
J080068A03GGTGACGTGNONE
J080089B13GGTGACGTGNONE
J080093G22GGTGACGTGNONE
Os02g0582800AK108180CGACACGTConserved hypothetical protein.
J075127H13CGACACGTNONE
Os02g0586900013-044-D08ACGTGTCGNONE
014-087-D07ACGTGTCGNONE
AK063583ACGTGTCGSimilar to Glycine rich protein (Fragment).
AK105378ACGTGTCGNONE
Os02g0600200009-154-A06ACGTGGCGNONE
009-154-A06CACGCCACGTNONE
AK058978ACGTGGCGNONE
AK058978CACGCCACGTNONE
AK066974ACGTGGCGIQ calmodulin-binding region domain containing protein.
AK066974CACGCCACGTIQ calmodulin-binding region domain containing protein.
Os02g0601800AB060276CACGTCACNONE
AK099539CACGTCACNONE
AK101873CACGTCACBromodomain containing protein.
AK106801CACGTCACNONE
AK121758CACGTCACNONE
AK121891CACGTCACNONE
J013059H01CACGTCACNONE
J013092F08CACGTCACNONE
J013146J04CACGTCACNONE
J023001K12CACGTCACNONE
J023002H16CACGTCACNONE
J023013B10CACGTCACNONE
J023081I22CACGTCACNONE
J023084K19CACGTCACNONE
J023150E24CACGTCACNONE
J033023B18CACGTCACNONE
J033025F18CACGTCACNONE
J033048P08CACGTCACNONE
J033060M24CACGTCACNONE
J033070G06CACGTCACNONE
J033088P12CACGTCACNONE
J033105C13CACGTCACNONE
J043009N18CACGTCACNONE
J065103G21CACGTCACNONE
J075039H15CACGTCACNONE
J090014K10CACGTCACNONE
J090022N02CACGTCACNONE
J090033F18CACGTCACNONE
J090033I04CACGTCACNONE
J090041F11CACGTCACNONE
J090045P20CACGTCACNONE
J090054B01CACGTCACNONE
J090055M12CACGTCACNONE
J090071K09CACGTCACNONE
J090098O16CACGTCACNONE
J090099P15CACGTCACNONE
J100050I16CACGTCACNONE
Os02g0602300AK065609GCCGGCCCACGTGNONE
AK065609GGACACGTGNONE
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
AK066929GGACACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
J013092L08GCCGGCCCACGTGNONE
J013092L08GGACACGTGNONE
J090040I23GCCGGCCCACGTGNONE
J090040I23GGACACGTGNONE
Os02g0607700AK109261CCCCACGTGlucose/ribitol dehydrogenase family protein.
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein.
AK100281TAAGCCCACGTAGGCCCAAACNONE
J023074H03TAAGCCCACGTAGGCCCAAACNONE
J065002J16TAAGCCCACGTAGGCCCAAACNONE
J065032I20TAAGCCCACGTAGGCCCAAACNONE
J065076A07TAAGCCCACGTAGGCCCAAACNONE
J065142O21TAAGCCCACGTAGGCCCAAACNONE
J065203A03TAAGCCCACGTAGGCCCAAACNONE
J075017F24TAAGCCCACGTAGGCCCAAACNONE
J075017G24TAAGCCCACGTAGGCCCAAACNONE
Os02g0611500AK072083CGACACGTSimilar to Eukaryotic initiation factor-like protein.
Os02g0612600009-058-F12CCCACGTGGCNONE
009-058-F12GACGTGGCNONE
009-058-F12GACGTGGCGNONE
AK062519CCCACGTGGCConserved hypothetical protein.
AK062519GACGTGGCConserved hypothetical protein.
AK062519GACGTGGCGConserved hypothetical protein.
Os02g0612650Os02g0612650CCCACGTGGCNONE
Os02g0612650GACGTGGCNONE
Os02g0612650GACGTGGCGNONE
Os02g0613200AK064869ACACGTGGGACCCACNONE
AK064869GCCCCCACGTGGCNONE
AK065051ACACGTGGGACCCACNONE
AK065051GCCCCCACGTGGCNONE
AK098853ACACGTGGGACCCACConserved hypothetical protein.
AK098853GCCCCCACGTGGCConserved hypothetical protein.
AK098974ACACGTGGGACCCACNONE
AK098974GCCCCCACGTGGCNONE
J013000H15ACACGTGGGACCCACNONE
J013000H15GCCCCCACGTGGCNONE
J013001I18ACACGTGGGACCCACNONE
J013001I18GCCCCCACGTGGCNONE
J013022I18ACACGTGGGACCCACNONE
J013022I18GCCCCCACGTGGCNONE
J013025D06ACACGTGGGACCCACNONE
J013025D06GCCCCCACGTGGCNONE
J013037H17ACACGTGGGACCCACNONE
J013037H17GCCCCCACGTGGCNONE
J013043F22ACACGTGGGACCCACNONE
J013043F22GCCCCCACGTGGCNONE
J013075E01ACACGTGGGACCCACNONE
J013075E01GCCCCCACGTGGCNONE
J013088D09ACACGTGGGACCCACNONE
J013088D09GCCCCCACGTGGCNONE
J013088E19ACACGTGGGACCCACNONE
J013088E19GCCCCCACGTGGCNONE
J013102O18ACACGTGGGACCCACNONE
J013102O18GCCCCCACGTGGCNONE
J013110C08ACACGTGGGACCCACNONE
J013110C08GCCCCCACGTGGCNONE
J013118C06ACACGTGGGACCCACNONE
J013118C06GCCCCCACGTGGCNONE
J013119F22ACACGTGGGACCCACNONE
J013119F22GCCCCCACGTGGCNONE
J013128K14ACACGTGGGACCCACNONE
J013128K14GCCCCCACGTGGCNONE
J013158C17ACACGTGGGACCCACNONE
J013158C17GCCCCCACGTGGCNONE
J023013P15ACACGTGGGACCCACNONE
J023013P15GCCCCCACGTGGCNONE
J023044L21ACACGTGGGACCCACNONE
J023044L21GCCCCCACGTGGCNONE
J033023I04ACACGTGGGACCCACNONE
J033023I04GCCCCCACGTGGCNONE
J033038I22ACACGTGGGACCCACNONE
J033038I22GCCCCCACGTGGCNONE
J033095M02ACACGTGGGACCCACNONE
J033095M02GCCCCCACGTGGCNONE
J043022F05ACACGTGGGACCCACNONE
J043022F05GCCCCCACGTGGCNONE
J080307N20ACACGTGGGACCCACNONE
J080307N20GCCCCCACGTGGCNONE
J080315C02ACACGTGGGACCCACNONE
J080315C02GCCCCCACGTGGCNONE
J080316A15ACACGTGGGACCCACNONE
J080316A15GCCCCCACGTGGCNONE
J080316G03ACACGTGGGACCCACNONE
J080316G03GCCCCCACGTGGCNONE
J090029E24ACACGTGGGACCCACNONE
J090029E24GCCCCCACGTGGCNONE
J090031H15ACACGTGGGACCCACNONE
J090031H15GCCCCCACGTGGCNONE
J090034F13ACACGTGGGACCCACNONE
J090034F13GCCCCCACGTGGCNONE
J090047G02ACACGTGGGACCCACNONE
J090047G02GCCCCCACGTGGCNONE
J090069M24ACACGTGGGACCCACNONE
J090069M24GCCCCCACGTGGCNONE
J100052E15ACACGTGGGACCCACNONE
J100052E15GCCCCCACGTGGCNONE
Os02g0617500AK106578CCACGTGTDEAD/DEAH box helicase, N-terminal domain containing protein.
Os02g0621600AK071074CGCCACGTNONE
AK108575CGCCACGTConserved hypothetical protein.
J023078O20CGCCACGTNONE
J075025M01CGCCACGTNONE
J090047L11CGCCACGTNONE
Os02g0643500AK068423CACGTCTCPentapeptide repeat containing protein.
Os02g0644500Os02g0644500CGACACGTConserved hypothetical protein.
Os02g0649300014-043-A05CGCCACGTGTNONE
014-043-A05GCCACGTGTCGNONE
AK063685CGCCACGTGTSimilar to Short highly repeated, interspersed DNA (Fragment).
AK063685GCCACGTGTCGSimilar to Short highly repeated, interspersed DNA (Fragment).
Os02g0651300AK061454ACGTGTCCNONE
AK099767ACGTGTCCConserved hypothetical protein.
Os02g0652800AK063448CGCCACGTCMajor facilitator superfamily MFS_1 protein.
Os02g0653800J023002B17CCCCCACGTNONE
J033067E03CCCCCACGTSimilar to GTP-binding protein.
J033105M04CCCCCACGTNONE
J053039E15CCCCCACGTNONE
J065026L07CCCCCACGTNONE
J065038B03CCCCCACGTNONE
J065087J15CCCCCACGTNONE
J065121B22CCCCCACGTNONE
J065128N12CCCCCACGTNONE
J065189E19CCCCCACGTNONE
J100058B03CCCCCACGTNONE
Os02g0654100AK101814GCCACGTCSimilar to Enoyl-CoA hydratase.
Os02g0654700006-060-H09CACGTGGGGGATNONE
AK073812CACGTGGGGGATSimilar to Ethylene-responsive transcription factor 5 (Ethylene-responsive element binding factor 5) (EREBP-5) (AtERF5).
AK105940CACGTGGGGGATNONE
AY831394CACGTGGGGGATNONE
J013134K17CACGTGGGGGATNONE
J023054H09CACGTGGGGGATNONE
J033068P11CACGTGGGGGATNONE
J065161B10CACGTGGGGGATNONE
J065170K01CACGTGGGGGATNONE
J100041G22CACGTGGGGGATNONE
Os02g0658033J090015D03CACGTCACPleckstrin-like domain containing protein.
Os02g0658100AK064728ACGTGGCGNONE
AK064728CGCCACGTCNONE
Os02g0661900006-030-G12ACGTGGGCNONE
AK061447ACGTGGGCSimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2.
AK068742ACGTGGGCNONE
J075046K13ACGTGGGCNONE
J075139O08ACGTGGGCNONE
J075149I16ACGTGGGCNONE
Os02g0663800AK069605GAGACGTGSimilar to Actin-depolymerizing factor (ADF).
J023022O15GAGACGTGNONE
J023138H18GAGACGTGNONE
Os02g0669100012-068-E10CGCCACGTCNONE
016-075-F09CGCCACGTCNONE
AB011367CGCCACGTCNONE
AK070197CGCCACGTCNONE
AY587109CGCCACGTCDehydrin family protein.
AY786415CGCCACGTCNONE
J023042N13CGCCACGTCNONE
J023128F01CGCCACGTCNONE
J065002K05CGCCACGTCNONE
J090057I09CGCCACGTCNONE
J090067J23CGCCACGTCNONE
J090071B04CGCCACGTCNONE
J100018L23CGCCACGTCNONE
J100036A11CGCCACGTCNONE
J100063L18CGCCACGTCNONE
J100071G02CGCCACGTCNONE
J100084P19CGCCACGTCNONE
Os02g0671200J065152N20CGCCACGTCNONE
J075053E22CGCCACGTCConserved hypothetical protein.
Os02g0672200AK112025CACGTCTCNONE
Os02g0672600AK070286CGCCACGTSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2.
AK101174CGCCACGTNONE
Os02g0673000AK108650ACGTGTCCProtein of unknown function UPF0005 family protein.
Os02g0677300006-102-D12GCGGCCCACGTNONE
AK060550GCGGCCCACGTNONE
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1.
Os02g0677700AK119947CGCCACGTCNONE
Os02g0690600AK110831CACGTCACU box domain containing protein.
Os02g0697600011-021-B01GCCACGTCNONE
AK121757GCCACGTCAAA ATPase domain containing protein.
Os02g0699700AK072471CGCCACGTGSimilar to DNA topoisomerase II.
Os02g0703800AK120025CACGTGTCConserved hypothetical protein.
Os02g0709900AB110204GCCCCACGTGPrefoldin domain containing protein.
AK109259GCCCCACGTGNONE
J013093N22GCCCCACGTGNONE
J033116F21GCCCCACGTGNONE
Os02g0710300AK109662GAGACGTGSimilar to INDEHISCENT protein.
Os02g0713700J043034B19ACGTGTCGNONE
J065041I10ACGTGTCGNONE
J065121M03ACGTGTCGNONE
J065134C21ACGTGTCGProtein of unknown function DUF296 domain containing protein.
J065186F18ACGTGTCGNONE
J100033H10ACGTGTCGNONE
J100043C12ACGTGTCGNONE
J100048E07ACGTGTCGNONE
J100087G13ACGTGTCGNONE
J100090J08ACGTGTCGNONE
Os02g0717500AK067050GACGTGGCConserved hypothetical protein.
J013092A12GACGTGGCNONE
J013124H24GACGTGGCNONE
J013154C11GACGTGGCNONE
J075098L15GACGTGGCNONE
J090083L24GACGTGGCNONE
J100049G21GACGTGGCNONE
J100073N20GACGTGGCNONE
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein.
J023031J12GGACACGTGGCGNONE
J075195G22GGACACGTGGCGNONE
J100088O11GGACACGTGGCGNONE
Os02g0720200AK105451CGCCACGTCNONE
AK121803CGCCACGTCSimilar to 65kD microtubule associated protein.
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV.
Os02g0726000AK072936CGACACGTNONE
AK099178CGACACGTBeta-Ig-H3/fasciclin domain containing protein.
J090014C14CGACACGTNONE
J090014G22CGACACGTNONE
J090031H04CGACACGTNONE
J090054D18CGACACGTNONE
J090054I05CGACACGTNONE
J090064M02CGACACGTNONE
J090073C19CGACACGTNONE
Os02g0727100AK069154CGACACGTAmino acid/polyamine transporter II family protein.
J023006P21CGACACGTNONE
J023027D19CGACACGTNONE
J023044N10CGACACGTNONE
J023088H15CGACACGTNONE
J023090A13CGACACGTNONE
J023142P16CGACACGTNONE
Os02g0727500009-018-G06CGCCACGTNONE
AK121427CGCCACGTConserved hypothetical protein.
J023136B21CGCCACGTNONE
J033044C13CGCCACGTNONE
J043037O12CGCCACGTNONE
J053072C14CGCCACGTNONE
J065008B15CGCCACGTNONE
J065033I12CGCCACGTNONE
J065077I18CGCCACGTNONE
J065149G03CGCCACGTNONE
J065159H07CGCCACGTNONE
J065162I17CGCCACGTNONE
J065168H02CGCCACGTNONE
J065176N09CGCCACGTNONE
J065178K23CGCCACGTNONE
J065216N03CGCCACGTNONE
J080001G08CGCCACGTNONE
J080002C09CGCCACGTNONE
J080007N17CGCCACGTNONE
J080009B04CGCCACGTNONE
J080009B17CGCCACGTNONE
J080011O15CGCCACGTNONE
J080022B06CGCCACGTNONE
J080022C13CGCCACGTNONE
J080024L04CGCCACGTNONE
J080031G21CGCCACGTNONE
J080035N14CGCCACGTNONE
J080036O14CGCCACGTNONE
J080040P10CGCCACGTNONE
J080042D03CGCCACGTNONE
J080042H05CGCCACGTNONE
J080042I20CGCCACGTNONE
J080043A01CGCCACGTNONE
J080043F17CGCCACGTNONE
J080046I19CGCCACGTNONE
J080053L20CGCCACGTNONE
J080055A20CGCCACGTNONE
J080055F01CGCCACGTNONE
J080056L02CGCCACGTNONE
J080058H02CGCCACGTNONE
J080059F11CGCCACGTNONE
J080062C03CGCCACGTNONE
J080064A07CGCCACGTNONE
J080064K15CGCCACGTNONE
J080067M17CGCCACGTNONE
J080067N17CGCCACGTNONE
J080068G07CGCCACGTNONE
J080069H15CGCCACGTNONE
J080069L08CGCCACGTNONE
J080069L20CGCCACGTNONE
J080069L21CGCCACGTNONE
J080069N20CGCCACGTNONE
J080071N24CGCCACGTNONE
J080074K17CGCCACGTNONE
J080076H08CGCCACGTNONE
J080082F19CGCCACGTNONE
J080086O16CGCCACGTNONE
J090025A19CGCCACGTNONE
J090025M06CGCCACGTNONE
J090070D02CGCCACGTNONE
Os02g0728100AK070290ACGTGGCGPeptidase S49, protease IV family protein.
Os02g0733900AK111335GGACACGTGConserved hypothetical protein.
J065092J17GGACACGTGNONE
J065140P16GGACACGTGNONE
J065191N21GGACACGTGNONE
Os02g0738200J100040B06CCCCACGTNONE
J100050N02CCCCACGTU box domain containing protein.
J100056J12CCCCACGTNONE
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1.
AK102767GGCCCCACGTGTCNONE
Os02g0744700AF395537GACACGTGGGCCCCACACNONE
AJ308110GACACGTGGGCCCCACACNONE
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21).
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment).
AK098873GTGACGTGGCNONE
J013001C18GTGACGTGGCNONE
J080003D07GTGACGTGGCNONE
J080003H24GTGACGTGGCNONE
J080010C23GTGACGTGGCNONE
J080011I04GTGACGTGGCNONE
J080011O03GTGACGTGGCNONE
J080012F13GTGACGTGGCNONE
J080020E06GTGACGTGGCNONE
J080025H22GTGACGTGGCNONE
J080026D15GTGACGTGGCNONE
J080028D20GTGACGTGGCNONE
J080029P20GTGACGTGGCNONE
J080031K22GTGACGTGGCNONE
J080034I05GTGACGTGGCNONE
J080036E11GTGACGTGGCNONE
J080036H13GTGACGTGGCNONE
J080037E17GTGACGTGGCNONE
J080043N05GTGACGTGGCNONE
J080044L23GTGACGTGGCNONE
J080047N11GTGACGTGGCNONE
J080048O04GTGACGTGGCNONE
J080049M01GTGACGTGGCNONE
J080050F21GTGACGTGGCNONE
J080054F09GTGACGTGGCNONE
J080055N20GTGACGTGGCNONE
J080058C02GTGACGTGGCNONE
J080058K15GTGACGTGGCNONE
J080062G02GTGACGTGGCNONE
J080066H16GTGACGTGGCNONE
J080066O05GTGACGTGGCNONE
J080067O16GTGACGTGGCNONE
J080068E13GTGACGTGGCNONE
J080069P16GTGACGTGGCNONE
J080072M11GTGACGTGGCNONE
J080076H09GTGACGTGGCNONE
J080081G24GTGACGTGGCNONE
J080082J05GTGACGTGGCNONE
J080084I10GTGACGTGGCNONE
J080087L24GTGACGTGGCNONE
J080089H07GTGACGTGGCNONE
J080089M05GTGACGTGGCNONE
J080092G18GTGACGTGGCNONE
J080095N08GTGACGTGGCNONE
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein.
J023132N16CCCACCACGTGTCACTNONE
J033069F17CCCACCACGTGTCACTNONE
Os02g0753000AK121015CACGTGGCGSimilar to Trehalose-6-phosphate phosphatase.
AK121015CCCCCACGTGSimilar to Trehalose-6-phosphate phosphatase.
Os02g0753800AK101787GGACACGTSimilar to Annexin p35.
Os02g0754300009-048-D05CGCCACGTGNONE
AK059012CGCCACGTGNONE
AK068621CGCCACGTGNONE
AK099805CGCCACGTGRibosomal protein L29 family protein.
J065102P04CGCCACGTGNONE
J065161I03CGCCACGTGNONE
Os02g0754700AK066904GGTGACGTSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21).
AK099136GGTGACGTNONE
Os02g0755600014-024-D06CGACACGTNONE
014-024-D06TGTGGGCCCACGTGNONE
015-039-F09CGACACGTNONE
015-039-F09TGTGGGCCCACGTGNONE
AK064105CGACACGTNONE
AK064105TGTGGGCCCACGTGNONE
AK106639CGACACGTSimilar to UDP-glucuronosyltransferase.
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase.
Os02g0762600AK103657CACGTCACNONE
AK110321CACGTCACConserved hypothetical protein.
J033135G19CACGTCACNONE
J090004E21CACGTCACNONE
J100067M04CACGTCACNONE
Os02g0766600006-039-E02CACGTCACNONE
009-087-E05CACGTCACNONE
013-049-E02CACGTCACNONE
AK059779CACGTCACProtein of unknown function DUF1685 family protein.
AK099386CACGTCACNONE
J033072H02CACGTCACNONE
J065045F21CACGTCACNONE
J065079P05CACGTCACNONE
J065121M12CACGTCACNONE
J065134C23CACGTCACNONE
J065140G23CACGTCACNONE
J065180P12CACGTCACNONE
J065212O07CACGTCACNONE
J100028B03CACGTCACNONE
J100030E05CACGTCACNONE
J100037O12CACGTCACNONE
J100050P11CACGTCACNONE
J100058I07CACGTCACNONE
J100059G05CACGTCACNONE
J100062H11CACGTCACNONE
J100064L18CACGTCACNONE
J100068G08CACGTCACNONE
Os02g0771200011-006-B07CCCGGCCCACGTNONE
AK066823CCCGGCCCACGTConserved hypothetical protein.
AK071059CCCGGCCCACGTNONE
J013075K03CCCGGCCCACGTNONE
Os02g0771500006-096-D12GACGTGGCNONE
006-096-D12GACGTGGCNONE
006-096-D12GACGTGGCGNONE
009-011-G02GACGTGGCNONE
009-011-G02GACGTGGCNONE
009-011-G02GACGTGGCGNONE
AK062335GACGTGGCNONE
AK062335GACGTGGCNONE
AK062335GACGTGGCGNONE
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018GACGTGGCGSimilar to Pap1p; poly A polymerase (Eukaryotic type).
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor.
Os02g0776800AB042415ACGTGGGCCGAGNONE
AK072308ACGTGGGCCGAGReplication protein A 70kDa.
AK101212ACGTGGGCCGAGNONE
J033031B02ACGTGGGCCGAGNONE
J090004E18ACGTGGGCCGAGNONE
J090084C24ACGTGGGCCGAGNONE
Os02g0780800J090080O19ACGTGGGCCGTGGNONE
J090091I06ACGTGGGCCGTGGNONE
Os02g0782100AK065421CACGTCTCChorismate synthase family protein.
J065038A03CACGTCTCNONE
Os02g0782300AK109297GGCTGGGCGAGACGTGNONE
Os02g0789600AK101046GCCACGTGGCGNONE
AK112100GCCACGTGGCGSimilar to DEM2.
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein.
Os02g0801900006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein.
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
Os02g0802400J065054M13GAAGCCCACGTNONE
J065061I04GAAGCCCACGTNONE
J065112M15GAAGCCCACGTEF-Hand type domain containing protein.
J100050L24GAAGCCCACGTNONE
J100059D20GAAGCCCACGTNONE
Os02g0803600AK064750ACGTCACCLongin-like domain containing protein.
Os02g0803900AK106930GCCACGTCSimilar to UDP-glycosyltransferase 91D1.
AK106930GCCACGTGGCGCCACGTCSimilar to UDP-glycosyltransferase 91D1.
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE
AK060165TCTCGGCCCATTTCACGTGTCNONE
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein.
J013112C12TCTCGGCCCATTTCACGTGTCNONE
J023098C22TCTCGGCCCATTTCACGTGTCNONE
J033123P06TCTCGGCCCATTTCACGTGTCNONE
J065060N24TCTCGGCCCATTTCACGTGTCNONE
J065069H22TCTCGGCCCATTTCACGTGTCNONE
J065155N20TCTCGGCCCATTTCACGTGTCNONE
J065170K07TCTCGGCCCATTTCACGTGTCNONE
J090033D12TCTCGGCCCATTTCACGTGTCNONE
Os02g0814300AK111376GCCCCACGTGCytochrome c, monohaem domain containing protein.
J065063I24GCCCCACGTGNONE
Os02g0815300AK061607ACGTGGGCTConserved hypothetical protein.
J075088I01ACGTGGGCTNONE
Os02g0817500AK072707GACACGTGKCNAB voltage-gated K+ channel, beta subunit family protein.
AK104135GACACGTGNONE
U46758GACACGTGNONE
Os02g0817900AK068163GGCCCCACGTCytochrome P450 family protein.
Os02g0824400AK121390CACGTCACConserved hypothetical protein.
AK121390CGCCACGTGTCCConserved hypothetical protein.
AK121390GCCACGTGTCCConserved hypothetical protein.
J023128P21CACGTCACNONE
J023128P21CGCCACGTGTCCNONE
J023128P21GCCACGTGTCCNONE
J053097O16CACGTCACNONE
J053097O16CGCCACGTGTCCNONE
J053097O16GCCACGTGTCCNONE
J065012I02CACGTCACNONE
J065012I02CGCCACGTGTCCNONE
J065012I02GCCACGTGTCCNONE
J065049C06CACGTCACNONE
J065049C06CGCCACGTGTCCNONE
J065049C06GCCACGTGTCCNONE
J065051H02CACGTCACNONE
J065051H02CGCCACGTGTCCNONE
J065051H02GCCACGTGTCCNONE
J065069A13CACGTCACNONE
J065069A13CGCCACGTGTCCNONE
J065069A13GCCACGTGTCCNONE
J065082E04CACGTCACNONE
J065082E04CGCCACGTGTCCNONE
J065082E04GCCACGTGTCCNONE
J065102N09CACGTCACNONE
J065102N09CGCCACGTGTCCNONE
J065102N09GCCACGTGTCCNONE
J065157O10CACGTCACNONE
J065157O10CGCCACGTGTCCNONE
J065157O10GCCACGTGTCCNONE
J065188N23CACGTCACNONE
J065188N23CGCCACGTGTCCNONE
J065188N23GCCACGTGTCCNONE
J065190J11CACGTCACNONE
J065190J11CGCCACGTGTCCNONE
J065190J11GCCACGTGTCCNONE
J065202M09CACGTCACNONE
J065202M09CGCCACGTGTCCNONE
J065202M09GCCACGTGTCCNONE
Os02g0824500AK111296GGACACGTGGCSimilar to Remorin.
AK111296GGACACGTGGCGSimilar to Remorin.
AK111296GTGACGTGSimilar to Remorin.
J065048M11GGACACGTGGCNONE
J065048M11GGACACGTGGCGNONE
J065048M11GTGACGTGNONE
J065081F01GGACACGTGGCNONE
J065081F01GGACACGTGGCGNONE
J065081F01GTGACGTGNONE
Os02g0827900AK099911CGCCACGTCSimilar to Signal peptidase 18 subunit (Fragment).
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa.
AK103235GCGGGCCCCACGTGTCNONE
Os02g0830000011-075-D11GTGACGTGACGTGNONE
AK101841GTGACGTGACGTGProtein prenyltransferase domain containing protein.
J033069G13GTGACGTGACGTGNONE
Os02g0831600AB081951GACGTGGCNONE
AK103279GACGTGGCAGO1 homologous protein.
Os03g0100050Os03g0100050ACGTGGCGHypothetical protein.
Os03g0106000011-049-C02CCACGTGTCNONE
AK063343CCACGTGTCProtein of unknown function UPF0187 family protein.
J065001I04CCACGTGTCNONE
J065021G09CCACGTGTCNONE
J065021I09CCACGTGTCNONE
J100035C20CCACGTGTCNONE
Os03g0108700003-131-E01GTGGGACCCACGTGGCNONE
AK105115GTGGGACCCACGTGGCConserved hypothetical protein.
AY224538GTGGGACCCACGTGGCNONE
J065029A19GTGGGACCCACGTGGCNONE
J065109N11GTGGGACCCACGTGGCNONE
Os03g0111600AK101020AGCCGTCCGATCCCCACGTProtein of unknown function DUF1618 domain containing protein.
J023149K08AGCCGTCCGATCCCCACGTNONE
J033042K17AGCCGTCCGATCCCCACGTNONE
J033073E05AGCCGTCCGATCCCCACGTNONE
J043032K02AGCCGTCCGATCCCCACGTNONE
J090009D04AGCCGTCCGATCCCCACGTNONE
J090037M16AGCCGTCCGATCCCCACGTNONE
Os03g0113000009-007-C03ACGTCACCNONE
AK058286ACGTCACCProtein kinase-like domain containing protein.
AK071309ACGTCACCNONE
AK104314ACGTCACCNONE
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein.
Os03g0115800012-084-C12ACGTGGGGNONE
AK063981ACGTGGGGNONE
AK102606ACGTGGGGConserved hypothetical protein.
J033045E13ACGTGGGGNONE
J033091C17ACGTGGGGNONE
J033098P07ACGTGGGGNONE
J053034A07ACGTGGGGNONE
J065005L07ACGTGGGGNONE
J065010K23ACGTGGGGNONE
J065014B03ACGTGGGGNONE
J065072E20ACGTGGGGNONE
J065073A18ACGTGGGGNONE
J065087D12ACGTGGGGNONE
J065088I24ACGTGGGGNONE
J065099O07ACGTGGGGNONE
J065108E09ACGTGGGGNONE
J065117K05ACGTGGGGNONE
J065119E02ACGTGGGGNONE
J065127B09ACGTGGGGNONE
J065139M15ACGTGGGGNONE
J065154I06ACGTGGGGNONE
J065157C02ACGTGGGGNONE
J065169D19ACGTGGGGNONE
J065184L23ACGTGGGGNONE
J065187K09ACGTGGGGNONE
J065199B06ACGTGGGGNONE
J065199L09ACGTGGGGNONE
J065201P10ACGTGGGGNONE
J065208J19ACGTGGGGNONE
J065209B09ACGTGGGGNONE
J065210F11ACGTGGGGNONE
J065212L13ACGTGGGGNONE
Os03g0116800012-097-D10GACACGTGGCNONE
012-097-D10GCCACGTGGGNONE
016-024-H10GACACGTGGCNONE
016-024-H10GCCACGTGGGNONE
AK066955GACACGTGGCConserved hypothetical protein.
AK066955GCCACGTGGGConserved hypothetical protein.
AK068678GACACGTGGCNONE
AK068678GCCACGTGGGNONE
AK104839GACACGTGGCNONE
AK104839GCCACGTGGGNONE
J013033G16GACACGTGGCNONE
J013033G16GCCACGTGGGNONE
J013091C10GACACGTGGCNONE
J013091C10GCCACGTGGGNONE
J013158H22GACACGTGGCNONE
J013158H22GCCACGTGGGNONE
J023106K11GACACGTGGCNONE
J023106K11GCCACGTGGGNONE
J065051O15GACACGTGGCNONE
J065051O15GCCACGTGGGNONE
J065129G22GACACGTGGCNONE
J065129G22GCCACGTGGGNONE
J075001K02GACACGTGGCNONE
J075001K02GCCACGTGGGNONE
J075011O03GACACGTGGCNONE
J075011O03GCCACGTGGGNONE
J075024K04GACACGTGGCNONE
J075024K04GCCACGTGGGNONE
J075026E07GACACGTGGCNONE
J075026E07GCCACGTGGGNONE
J075037O14GACACGTGGCNONE
J075037O14GCCACGTGGGNONE
J075071D17GACACGTGGCNONE
J075071D17GCCACGTGGGNONE
J075084M05GACACGTGGCNONE
J075084M05GCCACGTGGGNONE
J075114B06GACACGTGGCNONE
J075114B06GCCACGTGGGNONE
J075128C23GACACGTGGCNONE
J075128C23GCCACGTGGGNONE
J075153A13GACACGTGGCNONE
J075153A13GCCACGTGGGNONE
J075158A15GACACGTGGCNONE
J075158A15GCCACGTGGGNONE
J075165P09GACACGTGGCNONE
J075165P09GCCACGTGGGNONE
J075167M21GACACGTGGCNONE
J075167M21GCCACGTGGGNONE
J075170F11GACACGTGGCNONE
J075170F11GCCACGTGGGNONE
J075186F12GACACGTGGCNONE
J075186F12GCCACGTGGGNONE
J075186L13GACACGTGGCNONE
J075186L13GCCACGTGGGNONE
J075189A01GACACGTGGCNONE
J075189A01GCCACGTGGGNONE
J075192D19GACACGTGGCNONE
J075192D19GCCACGTGGGNONE
Os03g0117900AK108930ACGTGGCGSimilar to Transcription factor.
Os03g0119900AK058741CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)].
AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)].
J065035O07CGCCACGTCNONE
J065035O07CGCCACGTCACCGATCCGNONE
J065165C24CGCCACGTCNONE
J065165C24CGCCACGTCACCGATCCGNONE
J075039M05CGCCACGTCNONE
J075039M05CGCCACGTCACCGATCCGNONE
Os03g0122200009-052-H10CACGTGTCCGGCCCNONE
AB042934CACGTGTCCGGCCCNONE
AK065033CACGTGTCCGGCCCSimilar to 50S ribosomal protein L11.
J013001H03CACGTGTCCGGCCCNONE
J023149C23CACGTGTCCGGCCCNONE
J065025J15CACGTGTCCGGCCCNONE
J065093D22CACGTGTCCGGCCCNONE
Os03g0124900AK070284GCCACGTCVirulence factor, pectin lyase fold family protein.
J013052O13GCCACGTCNONE
J023048L01GCCACGTCNONE
J090085D12GCCACGTCNONE
Os03g0125400AK101342GCCACGTGGCConserved hypothetical protein 147 family protein.
J043012L05GCCACGTGGCNONE
J065013L10GCCACGTGGCNONE
J065046D23GCCACGTGGCNONE
J090074D20GCCACGTGGCNONE
J090087F22GCCACGTGGCNONE
J100047D05GCCACGTGGCNONE
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein.
J013152D10TAGGCCCAGCAAAGCCCACGTNONE
J075167I20TAGGCCCAGCAAAGCCCACGTNONE
J090067O04TAGGCCCAGCAAAGCCCACGTNONE
Os03g0129100003-009-E09GCCCACGTNONE
AF384030GCCCACGTNONE
AK098993GCCCACGTSeven transmembrane protein MLO2.
AK111990GCCCACGTNONE
J013098A12GCCCACGTNONE
J023020M16GCCCACGTNONE
J043001L02GCCCACGTNONE
Os03g0131200AB020502CACGTCTCNONE
AB020502GCCCCACGTNONE
AK062174CACGTCTCNONE
AK062174GCCCCACGTNONE
AK066378CACGTCTCSimilar to Catalase isozyme 2 (EC