
Summary of ACGT (All List)

Organism Oryza sativa
Description bZIP-binding motif, environmental responses
Total Entry Count 16071

Entry Sequences (16071 entries)

LocusGene modelSequenceDescription
AK100002ACGTGGCGTGConserved hypothetical protein.
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein.
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein.
AK121535GGACACGTTransferase family protein.
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein.
Os01g0138500AK073435CACGTGTCCProtein of unknown function DUF789 family protein.
AK073435GGTGACGTProtein of unknown function DUF789 family protein.
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein.
Os01g0140100AK068990GTGACGTGPeptidase A1, pepsin family protein.
AK058909GACGTGGCGSimilar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15).
U43530GCCACGTGTMetallothionein-like protein type 2.
Os01g0151600AK063435GCCGGCCCGCCACGTGTConserved hypothetical protein.
AK071635GCCACGTCSimilar to Splicing factor RSZ33.
Os01g0155800J065061I19GACGTGGCConserved hypothetical protein.
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein.
AK066699CACGTCACProtein of unknown function DUF410 family protein.
AK109475ACGTGGGCCTTGConserved hypothetical protein.
Os01g0173900AK121690ACGTGGGGSimilar to MRP-like ABC transporter.
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein.
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein.
Os01g0180300AK120377ACACGTGGCGLipoprotein, type 6 family protein.
Os01g0184800AK073377GGGACCCACGTGPhosducin family protein.
AK066832CACGTGGGTCCCSimilar to SSRP1 protein.
AK065131CGTGTGGGGCCCACGTGTransferase family protein.
AK105331CACGTCACCConserved hypothetical protein.
AK105331GAGACGTGConserved hypothetical protein.
Os01g0187700AK101445GCCACGTGGCGConserved hypothetical protein.
D16499CACGTCACNADP-dependent malic enzyme, chloroplast precursor (EC (NADP-ME).
Os01g0198100AK119908CGACACGTGGCConserved hypothetical protein.
Os01g0206600J065041P19CACGTGTCConserved hypothetical protein.
J065041P19GCCACGTCConserved hypothetical protein.
Os01g0212700AK108311CACGTCACCZinc finger, RING-type domain containing protein.
Os01g0218700AK064992GGACACGTGTCCABC transporter, transmembrane region, type 1 domain containing protein.
J065208O10CCCACGTGSFT2-like family protein.
AK109524CCCACGTGPlant lipid transfer protein/Par allergen family protein.
AK101946GAGACGTGACGTGZinc finger, BED-type predicted domain containing protein.
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein.
Os01g0223900AK101712ACGTGGGCCurculin-like (mannose-binding) lectin domain containing protein.
Os01g0226400AK102301AGCCCACGTAAA ATPase domain containing protein.
AK070320CCACGTGTSimilar to RAB7D.
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein.
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein.
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein.
AK066024TTTCGGCCCACGTVHS domain containing protein.
Os01g0229400AB029508GCCCCACGTGSmall GTP-binding protein OsRac1.
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
AK062972GACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
Os01g0253500J100088F12CGGGCCCCACGTConserved hypothetical protein.
AY620417GACGTGGCGSimilar to NTGB2 (Fragment).
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein.
J075061L04ACACGTGGGTCCConserved hypothetical protein.
J075061L04GCCACGTCConserved hypothetical protein.
AK069749CGCCACGTCRedoxin domain containing protein.
AK119511CGCCACGTGTSimilar to Cysteine protease inhibitor.
Os01g0276300AK108165ACGTGTCCSimilar to Group 3 late embryogenesis abundant protein (Fragment).
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC (PRA-PH)].
J065183G15GCCACGTGConserved hypothetical protein.
J065183G15GCCACGTGTConserved hypothetical protein.
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein.
AK109672GTGACGTGTGGCGTGConserved hypothetical protein.
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment).
J075157P20GCCCCCACACACGTGGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J075157P20GGACACGTMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
Os01g0305900Os01g0305900CCCACGTGTCSimilar to A-type R2R3 Myb protein (Fragment).
Os01g0314300AK073419GCCACGTCUncharacterized domain 2 containing protein.
Os01g0314800AF323612ACACGTGGCGLate embryogenesis abundant protein 3 family protein.
AF323612GCCACGTCLate embryogenesis abundant protein 3 family protein.
Os01g0321800AK064712ACGTCACCGas vesicle protein GvpC repeat containing protein.
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein.
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein.
Os01g0337600AK099595ACGTGGGCATPase, F1 complex, gamma subunit family protein.
AK120842GGTGACGTSimilar to 60S ribosomal protein L23a (L25).
Os01g0349000AK108540GCCACGTCConserved hypothetical protein.
AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein.
Os01g0372100J075029A10GACGTGGCConserved hypothetical protein.
Os01g0372400AK108314CGACACGTGlutathione S-transferase, N-terminal domain containing protein.
Os01g0373400AK110973CCACGTGTHomeodomain-like containing protein.
AK110939GCCACGTCCyclin-like F-box domain containing protein.
Os01g0382450J065084M05GCCACGTGGCHypothetical protein.
J065084M05GCCACGTGTCCHypothetical protein.
AK067715GACGTGGCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment).
AK067715GCCACGTCSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment).
AK070914GCCACGTGGCUniversal stress protein (Usp) family protein.
Os01g0514300AK121086ACGTGTCCLissencephaly type-1-like homology motif domain containing protein.
AK068824GGTGACGTSimilar to Cinnamyl alcohol dehydrogenase.
AK105280ACGTGGCGProtein of unknown function DUF295 family protein.
Os01g0533400AK119447GCCCACGTGTGlycoside hydrolase, family 35 protein.
Os01g0541600Os01g0541600GCCACGTGConserved hypothetical protein.
Os01g0549250J065045M13CACGTGGCConserved hypothetical protein.
Os01g0557100Os01g0557100CACGTGGGAlpha/beta hydrolase family protein.
S66160GAGACGTGRas-related protein RIC1.
AK061456GAGACGTGGCGProtein of unknown function DUF1000 family protein.
Os01g0571000AK066090CCCCCACGTMitochondrial substrate carrier family protein.
Os01g0571700AK120410ACACGTGGCNucleic acid-binding, OB-fold domain containing protein.
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein.
Os01g0579000AK064700CGCCACGTConserved hypothetical protein.
Os01g0581300AK066182CGCCACGTGSimilar to Lycopene epsilon-cyclase (Fragment).
Os01g0584900AK108522GAGACGTGWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77).
Os01g0588700AK066951CGACACGTProtein of unknown function DUF572 family protein.
Os01g0597600J075191I06CACGTCTCAmino acid/polyamine transporter II family protein.
Os01g0604100AK099765CCCACGTGGACCUspA domain containing protein.
AK105136CACGTCACGlutelin family protein.
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561CACGTCACProtein of unknown function DUF1644 family protein.
AK066561GACGTGGCGProtein of unknown function DUF1644 family protein.
AK119181GCCACGTGProtein of unknown function UPF0052 and CofD family protein.
Os01g0620800AK108846CCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK074025ACGTGGCGSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment).
Os01g0633400AK108988GACGTGGCTGGGCCBS domain containing protein.
AK067056CACGTCTCProtein of unknown function DUF1645 family protein.
AK067056GTGACGTGProtein of unknown function DUF1645 family protein.
Os01g0643900AK108288ACGTGGGCOleosin family protein.
AK063634CACGTGTCGConserved hypothetical protein.
AK063634GCCCCACGTConserved hypothetical protein.
Os01g0644900AK106910ACGTGTCCConserved hypothetical protein.
Os01g0646300AY464568ACGTGTCCSimilar to RGA2 protein.
AY464568CCACGTGTSimilar to RGA2 protein.
Os01g0649000AK073564ACGTGGGGWD40-like domain containing protein.
AK073990CGCCACGTGCyclin-like F-box domain containing protein.
Os01g0654400Os01g0654400CGCCACGTConserved hypothetical protein.
AK119723CGCCACGTSimilar to NifU-like protein.
Os01g0667100Os01g0667100GCCCCACGTConserved hypothetical protein.
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein.
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein.
Os01g0673500AK065017GCCCACGTGSimilar to Katanin p60 ATPase-containing subunit A1 (EC (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
Os01g0678100AK099717ACGTGGGCConserved hypothetical protein.
AK102005CCCACGTGTCCSimilar to 65kD microtubule associated protein.
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein.
Os01g0698100AK100466GACACGTGTCSWAP/Surp domain containing protein.
Os01g0698300AK100582CGCCACGTCZinc finger, BED-type predicted domain containing protein.
Os01g0701900AK066793GCCCACGTGGCSimilar to Phosphatidylinositol transfer-like protein III.
Os01g0703300AK069643ACGTGGGCZinc finger, RING-type domain containing protein.
AK064074CGACACGTGLate embryogenesis abundant protein repeat containing protein.
Os01g0718500AK111346ACACGTGGCConserved hypothetical protein.
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase.
J075110D21ACGTGTCCSimilar to Serine acetyltransferase.
Os01g0727400AK065692GCCACGTCConserved hypothetical protein.
Os01g0728700AK108000GACACGTGProtein of unknown function DUF1264 family protein.
Os01g0733200AK066316CACGTCACSimilar to Heat shock transcription factor 29 (Fragment).
AK066316GCCACACGTGGCSimilar to Heat shock transcription factor 29 (Fragment).
AK103129CCCACGTGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK064298CCCACGTGUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os01g0738400AK110661ACGTGTCGSimilar to Zn-finger transcription factor.
Os01g0738600AK073479GACACGTGENTH/VHS domain containing protein.
Os01g0739000AK069568CACGTGGGSimilar to Mitochondrial processing peptidase.
Os01g0743400AK059177CGCCACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment).
AK059177GGACACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment).
Os01g0745400AK107872CCCACGTGGCSec34-like protein family protein.
AK107872GACGTGGCGSec34-like protein family protein.
AK107872GACGTGGCGSec34-like protein family protein.
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein.
AK067516CACGTGGCGProtein of unknown function DUF814 domain containing protein.
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein.
AK101713GGACACGTSimilar to GA 2-oxidase 4.
J065155C07ACACGTGGConserved hypothetical protein.
AK063778CGCCACGTConserved hypothetical protein.
Os01g0764800AK102809GACGTGGCSimilar to Nt-gh3 deduced protein.
AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein.
Os01g0767100AK109493CACGTGTCACCCGCGCSimilar to Lysosomal Pro-X carboxypeptidase.
AK109493GCCCCCACGTSimilar to Lysosomal Pro-X carboxypeptidase.
Os01g0767600AK070672CCCACGTGGCConserved hypothetical protein.
Os01g0767700AK122168CACGTGGGCACGTGGCSimilar to DEIH-box RNA/DNA helicase.
Os01g0769900AK065563GCCACGTCConserved hypothetical protein.
AK061585GGACACGTCyclin-like F-box domain containing protein.
Os01g0772200AK060471CACGTGGGTranscription initiation factor IIF, beta subunit family protein.
Os01g0772500AK109736CACGTCTCGCGCGGlycosyl transferase, family 14 protein.
AK061223CGCCACGTGTConserved hypothetical protein.
Os01g0788400AK109763CACGTGGCSimilar to Pectinesterase (EC (Fragment).
AK062811CACGTCTCConserved hypothetical protein.
AK062811GGCCGTCCACGTGGCConserved hypothetical protein.
AK062404GCCCCCACGTConserved hypothetical protein.
Os01g0800800AK108093CCACGTGTConserved hypothetical protein.
AK108093CGACACGTConserved hypothetical protein.
AK061770GTGACGTGCysteine proteinase inhibitor-I (Oryzacystatin-I).
Os01g0805700AK069400ACGTGTCGConserved hypothetical protein.
Os01g0806400Os01g0806400GAGACGTGTCCProtein of unknown function DUF617, plant family protein.
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein.
Os01g0816700AK100654GACGTGGCGTGSimilar to L-ascorbate oxidase homolog precursor (EC (Ascorbase).
AK100654GGACACGTSimilar to L-ascorbate oxidase homolog precursor (EC (Ascorbase).
AK065059CACGTGGCGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I).
AK065059CCCACGTGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I).
Os01g0818300AK063274GTGACGTGKH domain containing protein.
Os01g0819300AK107799GAGACGTGConserved hypothetical protein.
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment).
AK072813CGCCACGTConserved hypothetical protein.
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein.
AK073540ACGTGGGCCCCASAC3/GANP family protein.
AK073540GACGTGGCGSAC3/GANP family protein.
Os01g0837600AK108007CCCACGTGConserved hypothetical protein 1589, plant family protein.
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein.
AK059805GCCACGTGTSimilar to Triosephosphate isomerase, cytosolic (EC (TIM) (Triose- phosphate isomerase).
Os01g0841800AK111196GCCACGTCRibonuclease II and R domain containing protein.
Os01g0843700J065093C02CACGTCACCConserved hypothetical protein.
Os01g0846300AK065949CACGTCACSimilar to Protein phosphatase 2C.
AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C.
Os01g0848550J065073P06GGTGACGTGConserved hypothetical protein.
Os01g0851300AK101770GACGTGGCGTGReticulon family protein.
Os01g0851400J065070P10GACGTGGCGMachado-Joseph disease protein MJD family protein.
Os01g0858900AK107493CACGTGGCGlycosyl transferase, family 29 protein.
AK062402CCACGTGTCGConserved hypothetical protein.
AK062402GACGTGGCGConserved hypothetical protein.
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein.
AK071410GGACACGTCACSimilar to Uricase (Fragment).
Os01g0866400AB007193CACGTCACCSimilar to Fructose-1,6-bisphosphatase (EC (Fragment).
Os01g0867900AK061366CACGCCACGTCProtein of unknown function DUF502 family protein.
AK061366CGACACGTGProtein of unknown function DUF502 family protein.
AK061366GCCACGTGGCGGACGGCProtein of unknown function DUF502 family protein.
Os01g0868300AB004461GCCCACGTSimilar to DNA polymerase alpha catalytic subunit (EC
AK058284GAGACGTGGCSimilar to Photosystem II subunit PsbS.
Os01g0871600AK103248GACACGTGTGF-beta receptor, type I/II extracellular region family protein.
Os01g0872100AK099405GCCCACGTTGF-beta receptor, type I/II extracellular region family protein.
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein.
Os01g0879200AK109033CGACACGTConserved hypothetical protein.
Os01g0889000AK103621ACGTGGGCTTetratricopeptide-like helical domain containing protein.
Os01g0891300AK063674CATCCCCCCACGTSimilar to Allyl alcohol dehydrogenase.
AK063674CCCACGTGSimilar to Allyl alcohol dehydrogenase.
Os01g0891700AK105471CCACGTGTLeucine rich repeat, N-terminal domain containing protein.
AK068254CACGTCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK068254GACGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1.
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1.
Os01g0913300AK100698GTGACGTGTGF-beta receptor, type I/II extracellular region family protein.
Os01g0913400AK099881CGCCACGTCProtein prenyltransferase domain containing protein.
Os01g0914000AK101364ACGTCACCConserved hypothetical protein.
AK105463CACGTCACPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
Os01g0915200AK121863ACGTGTCCSimilar to Cystatin.
AK063922CCCCCACGTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein).
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3.
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
Os01g0922100AK110737ACGTGGCGConserved hypothetical protein.
AK110737GTGACGTGConserved hypothetical protein.
Os01g0923300AK067520CCCCACGTGTCBS domain containing protein.
AK067520GCCACGTGGCCBS domain containing protein.
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK061690AGCCCACGTSimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK061690CCCACGTGCTGGGCCGGCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK065852GACGTGGCConserved hypothetical protein.
AK067040GCCACGTGConserved hypothetical protein.
Os01g0935700AK069403AAAGCCCACGTSimilar to Cytochrome c1 (Fragment).
Os01g0950900AK101121CACGTGTCGProtein of unknown function DUF221 domain containing protein.
AK101121CGCCACGTProtein of unknown function DUF221 domain containing protein.
AK101121CGCCACGTCProtein of unknown function DUF221 domain containing protein.
Os01g0952700AK103457GCCACGTGTMetallo-dependent hydrolase, composite domain containing protein.
AK062680GTGACGTGConserved hypothetical protein.
Os01g0954900AK110957CACGTCTCSimilar to Nucleoid DNA-binding-like protein.
AK068399CACGTGTCACTProtein of unknown function DUF563 family protein.
Os01g0957600AK059235CGACACGTGSimilar to Elicitor-inducible cytochrome P450.
Os01g0962400AK059165GAGACGTGProtein of unknown function UPF0185 family protein.
Os01g0964000AK073599ACACGTGGGCSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1).
Os01g0965500J075073G20CGCCACGTCNuclear protein SET domain containing protein.
AK058564ACGTGGCGProtein of unknown function YGGT family protein.
AK064854CGCCACGTConserved hypothetical protein.
Os01g0970400AK069207GCCACGTCEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit).
AK065652GACGTGGCSimilar to Cysteine synthase, mitochondrial precursor (EC (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C).
AK106213GCCACGTCSimilar to Ferredoxin NADP+ reductase (EC (Fragment).
AK106213GTGGGTCCCACGTGSimilar to Ferredoxin NADP+ reductase (EC (Fragment).
AK102953ACACGTGGCIQ calmodulin-binding region domain containing protein.
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase.
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase.
AK065743CCACGTGTCGEndosperm lumenal binding protein.
AK064002GCCACGTCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75).
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52).
AK066100GACACGTGConserved hypothetical protein.
Os02g0120900Os02g0120900ACGTGGGGTetrahydrofolate dehydrogenase/cyclohydrolase family protein.
AK106553CACGTGGGGConserved hypothetical protein.
AK101344CGACACGTSimilar to Cell division control protein 28 (EC
AK101344GACGTGGCSimilar to Cell division control protein 28 (EC
Os02g0127900AK102783GGTGACGTHypothetical protein.
AK102783GGTGACGTGGCHypothetical protein.
Os02g0135600AK069843GACACGTGGGGConserved hypothetical protein.
AK069843GACACGTGGGGGConserved hypothetical protein.
Os02g0135700AK100570CCCCACGTGTCDNA polymerase V family protein.
AK100570CCCCCACGTGTCDNA polymerase V family protein.
AB055156GCCACGTCSimilar to Sec13-like protein (Fragment).
AK065722GCCACGTCConserved hypothetical protein.
Os02g0142060J065137N15GAGACGTGAGGGACGGACSynapsin family protein.
Os02g0143200AK070600CCCCACGTCTCArmadillo-like helical domain containing protein.
AK119650CACGTCACMAP kinase MAPK2 (MAP kinase 3).
Os02g0148500AK068931GACACGTGSimilar to TIMING OF CAB 1 (Fragment).
Os02g0148600AK059287GACACGTGTGGCConserved hypothetical protein.
Os02g0158900AK108324CGCCACGTCSimilar to SNF4.
Os02g0160000AK062904CACGTCACSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y- 1140 of Kluyveromyces lactis.
Os02g0165500AK060547GACGTGGCGConserved hypothetical protein.
Os02g0169000AK101628GCCACGTCConserved hypothetical protein.
Os02g0169900AK070107CGACACGTInositol monophosphatase family protein.
Os02g0170200AK107753CGTCGGATGAGACGTGConserved hypothetical protein.
AK100596GGACACGTSimilar to Cytochrome P450 97B3 (EC 1.14.-.-).
Os02g0176300AK066588GGACACGTGTCConserved hypothetical protein.
Os02g0177700AK119941CGCCACGTProtein of unknown function DUF588 family protein.
AK067359GCCACGTCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein.
Os02g0184000AK072584CACGTCTCZinc finger, DHHC-type domain containing protein.
Os02g0186500AK068056CCCCACGTGGGSimilar to Protein kinase-like protein.
AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein.
AK105236CGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein.
Os02g0192900AK108910CGACACGTProtein kinase-like domain containing protein.
AK101237GACACGTGHypothetical protein.
AK068102GCCACGTGGCSimilar to PSI type III chlorophyll a/b-binding protein.
Os02g0199800AK072970GCCACGTGTTGGGCSimilar to No pollen.
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein.
AK121183ACAGCCCACGTSimilar to ZIGA2 protein (Fragment).
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1).
Os02g0226200Os02g0226200CACGTCTCHAD-superfamily subfamily IB hydrolase, hypothetical 1 protein.
AK120885GTGACGTGEarly nodulin.
Os02g0232400AK120755CCCACGTGSimilar to Citrate synthase, glyoxysomal precursor (EC (GCS).
AK119874GCCACGTCSWAP/Surp domain containing protein.
Os02g0250600J075143F23ACGTGTCCLate embryogenesis abundant protein repeat containing protein.
J075143F23CACGTGTCLate embryogenesis abundant protein repeat containing protein.
AK063627GACGTGGCGConserved hypothetical protein.
AK059921CGCCACGTGGGCReticulon family protein.
L34551ACACGTGGTranscriptional activator protein.
AK073294ACACGTGGPeroxisomal fatty acid beta-oxidation multifunctional protein (MFP) [Includes: Enoyl-CoA hydratase (EC; 3-2-trans-enoyl-CoA isomerase (EC; 3-hydroxybutyryl-CoA epimerase (EC; 3-hydroxyacyl-CoA dehydrogenase (EC].
Os02g0276200J075059P05ACGTGTCGIsochorismatase hydrolase family protein.
Os02g0278700AK100333ACACGTGGSimilar to Kaurene synthase A (Fragment).
Os02g0285800AK072177GACGTGGCSimilar to GTP-binding protein typA (Tyrosine phosphorylated protein A).
Os02g0292800AK106941GCCACGTCProtein of unknown function DUF599 family protein.
Os02g0299200AK105486GCCCGGCCACGTCIQ calmodulin-binding region domain containing protein.
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein.
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein.
AK065304GGTGACGTGConserved hypothetical protein.
Os02g0326700AK064977GGTGACGTGRhomboid-like protein family protein.
Os02g0327500AK069802GCCCACGTCTCProtein of unknown function DUF266, plant family protein.
AK068505CCACGTGTPhenol hydroxylase reductase family protein.
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit.
AK109380GGCCGTCCACGTGTCCConserved hypothetical protein.
Os02g0461500AK108772CCCCACGTGBeta-Ig-H3/fasciclin domain containing protein.
Os02g0464700AK107077ACGTGGCGConserved hypothetical protein.
AK107077GACGTGGCGConserved hypothetical protein.
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein.
Os02g0468200AK103767CACGTCACCProtein of unknown function DUF652 family protein.
Os02g0493300AK069981ACGTGGCGTetratricopeptide-like helical domain containing protein.
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein.
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein.
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein.
AK101016GACGTGGCMolybdenum cofactor biosynthesis domain containing protein.
Os02g0509600AK111075CACGTGGCConserved hypothetical protein.
AK111075CACGTGGCGConserved hypothetical protein.
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
AK122107GCCACGTCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
Os02g0520800AK102815ACACGTGGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC (Rieske iron-sulfur protein) (RISP).
AK058851ACACGTGGCCCCCCGCGConserved hypothetical protein.
Os02g0530100AK058520ACACGTGGHeavy metal transport/detoxification protein domain containing protein.
AK058520GACGTGGCGHeavy metal transport/detoxification protein domain containing protein.
Os02g0530600AK102681CCCCCACGTCTCGCGTCTCBRCT domain containing protein.
AK102681GGGTGGGCTACGTGTCGBRCT domain containing protein.
Os02g0531450J065097O14GACGTGGCGHypothetical protein.
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein.
Os02g0534600CACGTCTCConserved hypothetical protein.
Os02g0534600GACGTGGCConserved hypothetical protein.
AK109402CGCCACGTHarpin-induced 1 domain containing protein.
Os02g0539200AK108494ACGTGTCGU box domain containing protein.
AK063102GCCACGTCACCConserved hypothetical protein.
AK063102GCCACGTGGCConserved hypothetical protein.
Os02g0555300AK108454CACGTCTCNo apical meristem (NAM) protein domain containing protein.
AK103125CACGTGGCNAD-dependent epimerase/dehydratase family protein.
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein.
AK121206ACGTGTCGProtein kinase-like domain containing protein.
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein.
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein.
Os02g0575000AK121198ACGTCACCConserved hypothetical protein.
AK121198ACGTCACCConserved hypothetical protein.
Os02g0576400AK107966CACGTCACConserved hypothetical protein.
AK107966CACGTCTCConserved hypothetical protein.
Os02g0577900J065164K11ACGTGGCGConserved hypothetical protein.
AK105275GCCACGTGGCGSimilar to Glucosyltransferase (Fragment).
AK108080GCCACGTCTCNo apical meristem (NAM) protein domain containing protein.
Os02g0581800J065071F12AGCCCACACGTGGConserved hypothetical protein.
AK070989GGTGACGTGConserved hypothetical protein.
Os02g0582800AK108180CGACACGTConserved hypothetical protein.
AK063583ACGTGTCGSimilar to Glycine rich protein (Fragment).
AK066974ACGTGGCGIQ calmodulin-binding region domain containing protein.
AK066974CACGCCACGTIQ calmodulin-binding region domain containing protein.
AK101873CACGTCACBromodomain containing protein.
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
AK066929GGACACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
Os02g0607700AK109261CCCCACGTGlucose/ribitol dehydrogenase family protein.
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein.
Os02g0611500AK072083CGACACGTSimilar to Eukaryotic initiation factor-like protein.
AK062519CCCACGTGGCConserved hypothetical protein.
AK062519GACGTGGCConserved hypothetical protein.
AK062519GACGTGGCGConserved hypothetical protein.
AK098853ACACGTGGGACCCACConserved hypothetical protein.
AK098853GCCCCCACGTGGCConserved hypothetical protein.
Os02g0617500AK106578CCACGTGTDEAD/DEAH box helicase, N-terminal domain containing protein.
AK108575CGCCACGTConserved hypothetical protein.
Os02g0643500AK068423CACGTCTCPentapeptide repeat containing protein.
Os02g0644500Os02g0644500CGACACGTConserved hypothetical protein.
AK063685CGCCACGTGTSimilar to Short highly repeated, interspersed DNA (Fragment).
AK063685GCCACGTGTCGSimilar to Short highly repeated, interspersed DNA (Fragment).
AK099767ACGTGTCCConserved hypothetical protein.
Os02g0652800AK063448CGCCACGTCMajor facilitator superfamily MFS_1 protein.
J033067E03CCCCCACGTSimilar to GTP-binding protein.
Os02g0654100AK101814GCCACGTCSimilar to Enoyl-CoA hydratase.
AK073812CACGTGGGGGATSimilar to Ethylene-responsive transcription factor 5 (Ethylene-responsive element binding factor 5) (EREBP-5) (AtERF5).
Os02g0658033J090015D03CACGTCACPleckstrin-like domain containing protein.
AK061447ACGTGGGCSimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2.
Os02g0663800AK069605GAGACGTGSimilar to Actin-depolymerizing factor (ADF).
AY587109CGCCACGTCDehydrin family protein.
J075053E22CGCCACGTCConserved hypothetical protein.
Os02g0672600AK070286CGCCACGTSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2.
Os02g0673000AK108650ACGTGTCCProtein of unknown function UPF0005 family protein.
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1.
Os02g0690600AK110831CACGTCACU box domain containing protein.
AK121757GCCACGTCAAA ATPase domain containing protein.
Os02g0699700AK072471CGCCACGTGSimilar to DNA topoisomerase II.
Os02g0703800AK120025CACGTGTCConserved hypothetical protein.
Os02g0709900AB110204GCCCCACGTGPrefoldin domain containing protein.
Os02g0710300AK109662GAGACGTGSimilar to INDEHISCENT protein.
J065134C21ACGTGTCGProtein of unknown function DUF296 domain containing protein.
Os02g0717500AK067050GACGTGGCConserved hypothetical protein.
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein.
AK121803CGCCACGTCSimilar to 65kD microtubule associated protein.
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV.
AK099178CGACACGTBeta-Ig-H3/fasciclin domain containing protein.
Os02g0727100AK069154CGACACGTAmino acid/polyamine transporter II family protein.
AK121427CGCCACGTConserved hypothetical protein.
Os02g0728100AK070290ACGTGGCGPeptidase S49, protease IV family protein.
Os02g0733900AK111335GGACACGTGConserved hypothetical protein.
J100050N02CCCCACGTU box domain containing protein.
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1.
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC
Os02g0744900AK061968GTGACGTGGCSimilar to Geranylgeranyl reductase (Fragment).
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein.
Os02g0753000AK121015CACGTGGCGSimilar to Trehalose-6-phosphate phosphatase.
AK121015CCCCCACGTGSimilar to Trehalose-6-phosphate phosphatase.
Os02g0753800AK101787GGACACGTSimilar to Annexin p35.
AK099805CGCCACGTGRibosomal protein L29 family protein.
Os02g0754700AK066904GGTGACGTSimilar to Histidyl-tRNA synthetase (EC
AK106639CGACACGTSimilar to UDP-glucuronosyltransferase.
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase.
AK110321CACGTCACConserved hypothetical protein.
AK059779CACGTCACProtein of unknown function DUF1685 family protein.
AK066823CCCGGCCCACGTConserved hypothetical protein.
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018GACGTGGCSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018GACGTGGCGSimilar to Pap1p; poly A polymerase (Eukaryotic type).
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor.
AK072308ACGTGGGCCGAGReplication protein A 70kDa.
Os02g0782100AK065421CACGTCTCChorismate synthase family protein.
AK112100GCCACGTGGCGSimilar to DEM2.
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein.
J065112M15GAAGCCCACGTEF-Hand type domain containing protein.
Os02g0803600AK064750ACGTCACCLongin-like domain containing protein.
Os02g0803900AK106930GCCACGTCSimilar to UDP-glycosyltransferase 91D1.
AK106930GCCACGTGGCGCCACGTCSimilar to UDP-glycosyltransferase 91D1.
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein.
Os02g0814300AK111376GCCCCACGTGCytochrome c, monohaem domain containing protein.
Os02g0815300AK061607ACGTGGGCTConserved hypothetical protein.
Os02g0817500AK072707GACACGTGKCNAB voltage-gated K+ channel, beta subunit family protein.
Os02g0817900AK068163GGCCCCACGTCytochrome P450 family protein.
Os02g0824400AK121390CACGTCACConserved hypothetical protein.
AK121390CGCCACGTGTCCConserved hypothetical protein.
AK121390GCCACGTGTCCConserved hypothetical protein.
Os02g0824500AK111296GGACACGTGGCSimilar to Remorin.
AK111296GGACACGTGGCGSimilar to Remorin.
AK111296GTGACGTGSimilar to Remorin.
Os02g0827900AK099911CGCCACGTCSimilar to Signal peptidase 18 subunit (Fragment).
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa.
AK101841GTGACGTGACGTGProtein prenyltransferase domain containing protein.
AK103279GACGTGGCAGO1 homologous protein.
Os03g0100050Os03g0100050ACGTGGCGHypothetical protein.
AK063343CCACGTGTCProtein of unknown function UPF0187 family protein.
AK105115GTGGGACCCACGTGGCConserved hypothetical protein.
Os03g0111600AK101020AGCCGTCCGATCCCCACGTProtein of unknown function DUF1618 domain containing protein.
AK058286ACGTCACCProtein kinase-like domain containing protein.
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein.
AK102606ACGTGGGGConserved hypothetical protein.
AK066955GACACGTGGCConserved hypothetical protein.
AK066955GCCACGTGGGConserved hypothetical protein.
Os03g0117900AK108930ACGTGGCGSimilar to Transcription factor.
Os03g0119900AK058741CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)].
AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)].
AK065033CACGTGTCCGGCCCSimilar to 50S ribosomal protein L11.
Os03g0124900AK070284GCCACGTCVirulence factor, pectin lyase fold family protein.
Os03g0125400AK101342GCCACGTGGCConserved hypothetical protein 147 family protein.
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein.
AK098993GCCCACGTSeven transmembrane protein MLO2.