version

Summary of ACGCGC (All List)

Organism Oryza sativa
PPDB Motif ACGCGC
Description CGCG box, stress response?
Total Entry Count 3461

Entry Sequences (3461 entries)

LocusGene modelSequenceDescription
Os01g0101200006-040-D03GTCGCGCGCCCATATNONE
006-068-A02GTCGCGCGCCCATATNONE
AK104517GTCGCGCGCCCATATNONE
AK104625GTCGCGCGCCCATATNONE
AK104752GTCGCGCGCCCATATNONE
AK119457GTCGCGCGCCCATAT2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein.
J013089L16GTCGCGCGCCCATATNONE
J023103K24GTCGCGCGCCCATATNONE
J075050A15GTCGCGCGCCCATATNONE
Os01g0159600013-096-A02GTCGCGCGNONE
AK064055GTCGCGCGSmall hydrophilic plant seed protein family protein.
AK122153GTCGCGCGNONE
J033073N07GTCGCGCGNONE
J033088A13GTCGCGCGNONE
J033143J06GTCGCGCGNONE
J053031D05GTCGCGCGNONE
J053037K14GTCGCGCGNONE
J053045E08GTCGCGCGNONE
J053062D01GTCGCGCGNONE
J053083H22GTCGCGCGNONE
J053089G12GTCGCGCGNONE
J053089G24GTCGCGCGNONE
J053099O13GTCGCGCGNONE
J065070H11GTCGCGCGNONE
J075013L17GTCGCGCGNONE
J075021L24GTCGCGCGNONE
J075033B10GTCGCGCGNONE
J075034G01GTCGCGCGNONE
J075035A11GTCGCGCGNONE
J075045F22GTCGCGCGNONE
J075046N02GTCGCGCGNONE
J075047K11GTCGCGCGNONE
J075058N15GTCGCGCGNONE
J075059E22GTCGCGCGNONE
J075061G22GTCGCGCGNONE
J075078E12GTCGCGCGNONE
J075079B08GTCGCGCGNONE
J075090K12GTCGCGCGNONE
J075096P05GTCGCGCGNONE
J075097G05GTCGCGCGNONE
J075097O15GTCGCGCGNONE
J075101J04GTCGCGCGNONE
J075104K17GTCGCGCGNONE
J075110F15GTCGCGCGNONE
J075118D23GTCGCGCGNONE
J075118E10GTCGCGCGNONE
J075137K22GTCGCGCGNONE
J075138P08GTCGCGCGNONE
J075142E22GTCGCGCGNONE
J075147K12GTCGCGCGNONE
J075149D12GTCGCGCGNONE
J075152A15GTCGCGCGNONE
J075152H08GTCGCGCGNONE
J075156C11GTCGCGCGNONE
J075156H20GTCGCGCGNONE
J075162I01GTCGCGCGNONE
J075166H16GTCGCGCGNONE
J075186F11GTCGCGCGNONE
J075189F22GTCGCGCGNONE
J075190E16GTCGCGCGNONE
J075193O11GTCGCGCGNONE
Os01g0176500AK102552GCGCGCGAGConserved hypothetical protein.
Os01g0205900006-057-B04CTCGCGCGCGCGCGCGAGNONE
AK060687CTCGCGCGCGCGCGCGAGNONE
AK105932CTCGCGCGCGCGCGCGAGSimilar to Class III peroxidase GvPx2b (Fragment).
J033143I12CTCGCGCGCGCGCGCGAGNONE
J075013J08CTCGCGCGCGCGCGCGAGNONE
J075090B11CTCGCGCGCGCGCGCGAGNONE
J075143C17CTCGCGCGCGCGCGCGAGNONE
J075147O13CTCGCGCGCGCGCGCGAGNONE
J075161L02CTCGCGCGCGCGCGCGAGNONE
Os01g0212700AK108311CTCGCGCGCZinc finger, RING-type domain containing protein.
Os01g0215700011-079-A08GTCGCGCGCNONE
013-033-E05GTCGCGCGCNONE
013-052-D07GTCGCGCGCNONE
014-010-D04GTCGCGCGCNONE
014-044-G08GTCGCGCGCNONE
AK059088GTCGCGCGCLipolytic enzyme, G-D-S-L family protein.
AK061118GTCGCGCGCNONE
AK119598GTCGCGCGCNONE
AK119642GTCGCGCGCNONE
Os01g0223600AK110821GTCGCGCGSimilar to Pto kinase interactor 1-like protein.
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein.
Os01g0253500J100088F12CTCGCGCGCConserved hypothetical protein.
Os01g0279800006-035-E07CTCGCGCGNONE
AK059775CTCGCGCGNONE
AK061114CTCGCGCGSimilar to LRR protein.
Os01g0294700006-057-A09CTCGCGCGNONE
AK068755CTCGCGCGHaem peroxidase, plant/fungal/bacterial family protein.
AK104388CTCGCGCGNONE
AK104781CTCGCGCGNONE
J013000M08CTCGCGCGNONE
J013067E04CTCGCGCGNONE
J013067E05CTCGCGCGNONE
J013159G18CTCGCGCGNONE
J065053A05CTCGCGCGNONE
J065065J01CTCGCGCGNONE
J065109H12CTCGCGCGNONE
J065131F05CTCGCGCGNONE
J075095D14CTCGCGCGNONE
J075156A05CTCGCGCGNONE
Os01g0295700AK070333GTCGCGCGSimilar to Protein phosphatase-2C.
Os01g0300900AK119559CGCGCGACNONE
Os01g0312500AK105998CGCGCGACSimilar to Pectin methylesterase isoform alpha (EC 3.1.1.11) (Fragment).
Os01g0390900009-113-F05CGCGCGAGNONE
AK103881CGCGCGAGSimilar to Dual-specificity protein phosphatase-like protein.
J023003K08CGCGCGAGNONE
J023092K13CGCGCGAGNONE
J023117N02CGCGCGAGNONE
J043038C04CGCGCGAGNONE
Os01g0508300AK101435CGCGCGAGNONE
AK111287CGCGCGAGConserved hypothetical protein.
J065096N08CGCGCGAGNONE
J075003F13CGCGCGAGNONE
J075014I16CGCGCGAGNONE
J075022D23CGCGCGAGNONE
J075040N19CGCGCGAGNONE
J075121O06CGCGCGAGNONE
J075131E17CGCGCGAGNONE
J075136N22CGCGCGAGNONE
J075147D01CGCGCGAGNONE
J075173C07CGCGCGAGNONE
J075196L22CGCGCGAGNONE
Os01g0512200J013067C10GTCGCGCGCNONE
Os01g0513400AK069619CTCGCGCGProtein of unknown function DUF789 family protein.
Os01g0533900AK101194CTCGCGCGSimilar to Multidrug resistance protein 1 homolog.
Os01g0594900AK070921CGCGCGACGCCGCGACGCGConserved hypothetical protein.
AK070921CGCGCGAGConserved hypothetical protein.
AK070921CTCGCGCGCConserved hypothetical protein.
J023074J04CGCGCGACGCCGCGACGCGNONE
J023074J04CGCGCGAGNONE
J023074J04CTCGCGCGCNONE
J023078B04CGCGCGACGCCGCGACGCGNONE
J023078B04CGCGCGAGNONE
J023078B04CTCGCGCGCNONE
J023078N11CGCGCGACGCCGCGACGCGNONE
J023078N11CGCGCGAGNONE
J023078N11CTCGCGCGCNONE
J075143E19CGCGCGACGCCGCGACGCGNONE
J075143E19CGCGCGAGNONE
J075143E19CTCGCGCGCNONE
J075187L10CGCGCGACGCCGCGACGCGNONE
J075187L10CGCGCGAGNONE
J075187L10CTCGCGCGCNONE
J080010N23CGCGCGACGCCGCGACGCGNONE
J080010N23CGCGCGAGNONE
J080010N23CTCGCGCGCNONE
J080013C01CGCGCGACGCCGCGACGCGNONE
J080013C01CGCGCGAGNONE
J080013C01CTCGCGCGCNONE
J080013G03CGCGCGACGCCGCGACGCGNONE
J080013G03CGCGCGAGNONE
J080013G03CTCGCGCGCNONE
J080016I23CGCGCGACGCCGCGACGCGNONE
J080016I23CGCGCGAGNONE
J080016I23CTCGCGCGCNONE
J080017E01CGCGCGACGCCGCGACGCGNONE
J080017E01CGCGCGAGNONE
J080017E01CTCGCGCGCNONE
J080029E18CGCGCGACGCCGCGACGCGNONE
J080029E18CGCGCGAGNONE
J080029E18CTCGCGCGCNONE
J080034L24CGCGCGACGCCGCGACGCGNONE
J080034L24CGCGCGAGNONE
J080034L24CTCGCGCGCNONE
J080039N12CGCGCGACGCCGCGACGCGNONE
J080039N12CGCGCGAGNONE
J080039N12CTCGCGCGCNONE
J080067L11CGCGCGACGCCGCGACGCGNONE
J080067L11CGCGCGAGNONE
J080067L11CTCGCGCGCNONE
J080068N08CGCGCGACGCCGCGACGCGNONE
J080068N08CGCGCGAGNONE
J080068N08CTCGCGCGCNONE
J080069E19CGCGCGACGCCGCGACGCGNONE
J080069E19CGCGCGAGNONE
J080069E19CTCGCGCGCNONE
J080071E16CGCGCGACGCCGCGACGCGNONE
J080071E16CGCGCGAGNONE
J080071E16CTCGCGCGCNONE
J080077J09CGCGCGACGCCGCGACGCGNONE
J080077J09CGCGCGAGNONE
J080077J09CTCGCGCGCNONE
J080085E03CGCGCGACGCCGCGACGCGNONE
J080085E03CGCGCGAGNONE
J080085E03CTCGCGCGCNONE
J080301J09CGCGCGACGCCGCGACGCGNONE
J080301J09CGCGCGAGNONE
J080301J09CTCGCGCGCNONE
J080303L19CGCGCGACGCCGCGACGCGNONE
J080303L19CGCGCGAGNONE
J080303L19CTCGCGCGCNONE
J080308B12CGCGCGACGCCGCGACGCGNONE
J080308B12CGCGCGAGNONE
J080308B12CTCGCGCGCNONE
Os01g0654400Os01g0654400CGCGCGACConserved hypothetical protein.
Os01g0663400AK072645CTCGCGCGNONE
J090023O22CTCGCGCGNONE
J090054G09CTCGCGCGNONE
J090058H13CTCGCGCGNONE
J090076G13CTCGCGCGNONE
Os01g0667400016-057-F02CGCGCGACNONE
AK064236CGCGCGACConserved hypothetical protein.
Os01g0667900013-097-A02GCGTCGCGCGGGCCCCACCNONE
014-011-C01GCGTCGCGCGGGCCCCACCNONE
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein.
J065156F10GCGTCGCGCGGGCCCCACCNONE
J065163D22GCGTCGCGCGGGCCCCACCNONE
J065197J04GCGTCGCGCGGGCCCCACCNONE
J075122C02GCGTCGCGCGGGCCCCACCNONE
J100047L16GCGTCGCGCGGGCCCCACCNONE
Os01g0670800AK103776CTCGCGCGAGNONE
J033143P19CTCGCGCGAGNONE
Os01g0714800AK108555GTCGCGCGCWRKY transcription factor 26.
AY870609GTCGCGCGCNONE
Os01g0716200AK062106CTCGCGCGCIQ calmodulin-binding region domain containing protein.
AK098920CTCGCGCGCNONE
AK120664CTCGCGCGCNONE
J013002N06CTCGCGCGCNONE
J013050O19CTCGCGCGCNONE
J013074N19CTCGCGCGCNONE
J013098J01CTCGCGCGCNONE
J013127F17CTCGCGCGCNONE
J013155C17CTCGCGCGCNONE
J013158K07CTCGCGCGCNONE
J013159J10CTCGCGCGCNONE
J053086D01CTCGCGCGCNONE
Os01g0736000AK108695CGCGCGAGHMG-I and HMG-Y, DNA-binding domain containing protein.
Os01g0737100AK108262CTCGCGCGCConserved hypothetical protein.
Os01g0741900014-012-B05CTCGCGCGNONE
AK068600CTCGCGCGSimilar to Auxin-responsive protein IAA26 (Indoleacetic acid-induced protein 26) (Phytochrome-associated protein 1).
J013035G23CTCGCGCGNONE
J013154A18CTCGCGCGNONE
J033092G10CTCGCGCGNONE
J043020A20CTCGCGCGNONE
J100041K22CTCGCGCGNONE
J100066E16CTCGCGCGNONE
J100081J06CTCGCGCGNONE
Os01g0756300014-074-B05CTCGCGCGNONE
AK069648CTCGCGCGConserved hypothetical protein.
Os01g0757200AB092485GCGCGCGAGNONE
AK060666GCGCGCGAGNONE
AK060714GCGCGCGAGNONE
AK099350GCGCGCGAGNONE
AK101713GCGCGCGAGSimilar to GA 2-oxidase 4.
Os01g0757900AK105476CGCGCGACGCHaloacid dehalogenase/epoxide hydrolase family protein.
Os01g0763900AK108127GTCGCGCGX8 domain containing protein.
J075121H14GTCGCGCGNONE
Os01g0764000006-021-G03ACCCGCGCGAGNONE
006-025-C07ACCCGCGCGAGNONE
006-029-G11ACCCGCGCGAGNONE
006-030-C04ACCCGCGCGAGNONE
006-035-E05ACCCGCGCGAGNONE
006-037-G01ACCCGCGCGAGNONE
006-038-C01ACCCGCGCGAGNONE
006-039-G05ACCCGCGCGAGNONE
006-042-E11ACCCGCGCGAGNONE
006-044-H04ACCCGCGCGAGNONE
006-045-A10ACCCGCGCGAGNONE
006-045-C05ACCCGCGCGAGNONE
006-047-A11ACCCGCGCGAGNONE
006-048-H10ACCCGCGCGAGNONE
006-050-C01ACCCGCGCGAGNONE
006-050-H11ACCCGCGCGAGNONE
006-051-G10ACCCGCGCGAGNONE
006-051-G11ACCCGCGCGAGNONE
006-056-B04ACCCGCGCGAGNONE
006-063-F04ACCCGCGCGAGNONE
006-063-H12ACCCGCGCGAGNONE
006-065-G09ACCCGCGCGAGNONE
006-067-F11ACCCGCGCGAGNONE
006-073-D10ACCCGCGCGAGNONE
006-074-G09ACCCGCGCGAGNONE
006-075-D04ACCCGCGCGAGNONE
006-077-C10ACCCGCGCGAGNONE
006-082-A10ACCCGCGCGAGNONE
006-084-C12ACCCGCGCGAGNONE
006-085-F05ACCCGCGCGAGNONE
006-087-H12ACCCGCGCGAGNONE
006-092-E10ACCCGCGCGAGNONE
006-094-C06ACCCGCGCGAGNONE
006-096-G11ACCCGCGCGAGNONE
006-097-H11ACCCGCGCGAGNONE
006-101-A07ACCCGCGCGAGNONE
006-101-G08ACCCGCGCGAGNONE
006-110-E08ACCCGCGCGAGNONE
006-111-D04ACCCGCGCGAGNONE
006-116-H04ACCCGCGCGAGNONE
AK058894ACCCGCGCGAGNONE
AK059818ACCCGCGCGAGSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi).
AK099142ACCCGCGCGAGNONE
J013119N15ACCCGCGCGAGNONE
J013123P15ACCCGCGCGAGNONE
J023055F24ACCCGCGCGAGNONE
J023125K17ACCCGCGCGAGNONE
J053050A20ACCCGCGCGAGNONE
J053056P10ACCCGCGCGAGNONE
J053074D19ACCCGCGCGAGNONE
J053078A14ACCCGCGCGAGNONE
J053086P10ACCCGCGCGAGNONE
J053094N23ACCCGCGCGAGNONE
J053095M23ACCCGCGCGAGNONE
J065006D02ACCCGCGCGAGNONE
J065030A17ACCCGCGCGAGNONE
J065030K04ACCCGCGCGAGNONE
J065035L12ACCCGCGCGAGNONE
J065046E12ACCCGCGCGAGNONE
J065065H19ACCCGCGCGAGNONE
J065073C01ACCCGCGCGAGNONE
J065105F01ACCCGCGCGAGNONE
J065131N16ACCCGCGCGAGNONE
J065144O13ACCCGCGCGAGNONE
J065160E12ACCCGCGCGAGNONE
J065160K02ACCCGCGCGAGNONE
J065163F09ACCCGCGCGAGNONE
J065165E18ACCCGCGCGAGNONE
J065174E04ACCCGCGCGAGNONE
J065175O08ACCCGCGCGAGNONE
J065191N24ACCCGCGCGAGNONE
J065193D19ACCCGCGCGAGNONE
J065198D04ACCCGCGCGAGNONE
J065200G09ACCCGCGCGAGNONE
J075016L06ACCCGCGCGAGNONE
J075017J11ACCCGCGCGAGNONE
J075019L08ACCCGCGCGAGNONE
J075028M08ACCCGCGCGAGNONE
J075029K05ACCCGCGCGAGNONE
J075039K04ACCCGCGCGAGNONE
J075047J22ACCCGCGCGAGNONE
J075079H13ACCCGCGCGAGNONE
J075095K14ACCCGCGCGAGNONE
J075111D21ACCCGCGCGAGNONE
J075131A19ACCCGCGCGAGNONE
J075147G20ACCCGCGCGAGNONE
J075158F11ACCCGCGCGAGNONE
J075166N10ACCCGCGCGAGNONE
J075196G09ACCCGCGCGAGNONE
J075198I24ACCCGCGCGAGNONE
J090001L08ACCCGCGCGAGNONE
J090026G07ACCCGCGCGAGNONE
J090050M15ACCCGCGCGAGNONE
J090071A01ACCCGCGCGAGNONE
J090072P16ACCCGCGCGAGNONE
J090078D22ACCCGCGCGAGNONE
J090089C18ACCCGCGCGAGNONE
J100019B07ACCCGCGCGAGNONE
J100019H15ACCCGCGCGAGNONE
J100019P09ACCCGCGCGAGNONE
J100023A16ACCCGCGCGAGNONE
J100023B09ACCCGCGCGAGNONE
J100026O18ACCCGCGCGAGNONE
J100027E09ACCCGCGCGAGNONE
J100028F22ACCCGCGCGAGNONE
J100029P05ACCCGCGCGAGNONE
J100031M19ACCCGCGCGAGNONE
J100032A11ACCCGCGCGAGNONE
J100036G19ACCCGCGCGAGNONE
J100038E22ACCCGCGCGAGNONE
J100040A12ACCCGCGCGAGNONE
J100040L02ACCCGCGCGAGNONE
J100043O13ACCCGCGCGAGNONE
J100045E20ACCCGCGCGAGNONE
J100046H18ACCCGCGCGAGNONE
J100047E08ACCCGCGCGAGNONE
J100050E08ACCCGCGCGAGNONE
J100050P14ACCCGCGCGAGNONE
J100051G10ACCCGCGCGAGNONE
J100052L12ACCCGCGCGAGNONE
J100056G24ACCCGCGCGAGNONE
J100066B15ACCCGCGCGAGNONE
J100068O15ACCCGCGCGAGNONE
J100070J16ACCCGCGCGAGNONE
J100074I22ACCCGCGCGAGNONE
J100075M12ACCCGCGCGAGNONE
J100077M09ACCCGCGCGAGNONE
J100077O14ACCCGCGCGAGNONE
J100079J08ACCCGCGCGAGNONE
J100080I16ACCCGCGCGAGNONE
Os01g0764600AK060621CGCGCGACFosfomycin resistance kinase FomA family protein.
J013111L18CGCGCGACNONE
J013134N08CGCGCGACNONE
Os01g0764800AK102809GCGCGCGACSimilar to Nt-gh3 deduced protein.
Os01g0765000AK101905CTCGCGCGCSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase).
Os01g0767700AK122168GTCGCGCGCSimilar to DEIH-box RNA/DNA helicase.
Os01g0772500AK109736CACGTCTCGCGCGGlycosyl transferase, family 14 protein.
Os01g0778700AK064933CTCGCGCGCConserved hypothetical protein.
AK064933GCGCGCGAGConserved hypothetical protein.
Os01g0787000006-035-E12CGCGCGAGNONE
015-056-B07CGCGCGAGNONE
AK101743CGCGCGAGSimilar to Peroxidase (EC 1.11.1.7).
AK109348CGCGCGAGNONE
J065096L02CGCGCGAGNONE
J065185H10CGCGCGAGNONE
J065186E06CGCGCGAGNONE
J090081I17CGCGCGAGNONE
Os01g0787400006-097-H03GCGCGCGACNONE
AK061223GCGCGCGACConserved hypothetical protein.
J065011G11GCGCGCGACNONE
J065161F18GCGCGCGACNONE
Os01g0793900009-109-G11CGCGCGACNONE
009-125-A10CGCGCGACNONE
AK062811CGCGCGACConserved hypothetical protein.
Os01g0796700AK120491CGCGTCGCGCGZinc finger, RING-type domain containing protein.
Os01g0800300006-097-C12CGCGCGAGNONE
014-070-C12CGCGCGAGNONE
AK072549CGCGCGAGNONE
AK100942CGCGCGAGNONE
AK100951CGCGCGAGConserved hypothetical protein.
AK106023CGCGCGAGNONE
J023138D05CGCGCGAGNONE
J075097P16CGCGCGAGNONE
J075099F23CGCGCGAGNONE
Os01g0800800AK108093CTCGCGCGCConserved hypothetical protein.
Os01g0802200009-092-E04GTCGCGCGGGGGNONE
AK062699GTCGCGCGGGGGConserved hypothetical protein.
J065186C19GTCGCGCGGGGGNONE
Os01g0805200009-031-F03GCGCGCGAGNONE
AK066239GCGCGCGAGConserved hypothetical protein.
AK104864GCGCGCGAGNONE
J013058M15GCGCGCGAGNONE
J023013J10GCGCGCGAGNONE
J053024C05GCGCGCGAGNONE
J065078N15GCGCGCGAGNONE
J065206B14GCGCGCGAGNONE
J075016E22GCGCGCGAGNONE
J075044O08GCGCGCGAGNONE
J075157L16GCGCGCGAGNONE
J080001D07GCGCGCGAGNONE
J080001I05GCGCGCGAGNONE
J080003N24GCGCGCGAGNONE
J080005G15GCGCGCGAGNONE
J080013I04GCGCGCGAGNONE
J080018D01GCGCGCGAGNONE
J080025E19GCGCGCGAGNONE
J080027H24GCGCGCGAGNONE
J080029C05GCGCGCGAGNONE
J080033J18GCGCGCGAGNONE
J080034N13GCGCGCGAGNONE
J080037G21GCGCGCGAGNONE
J080038K05GCGCGCGAGNONE
J080039I17GCGCGCGAGNONE
J080047F14GCGCGCGAGNONE
J080047J22GCGCGCGAGNONE
J080059A22GCGCGCGAGNONE
J080062A12GCGCGCGAGNONE
J080062K14GCGCGCGAGNONE
J080068E09GCGCGCGAGNONE
J080072M10GCGCGCGAGNONE
J080079G07GCGCGCGAGNONE
J080080F19GCGCGCGAGNONE
J080081N09GCGCGCGAGNONE
J080090M11GCGCGCGAGNONE
J080096B11GCGCGCGAGNONE
J080097D06GCGCGCGAGNONE
J080097K16GCGCGCGAGNONE
Os01g0816100012-082-H02CGCGCGAGNONE
AB028183CGCGCGAGNONE
AK073848CGCGCGAGNONE
AY986504CGCGCGAGSimilar to NAC domain protein.
J100061B19CGCGCGAGNONE
Os01g0823600J075039G17GCGCGCGACGCConserved hypothetical protein.
J075042I11GCGCGCGACGCNONE
J075054M24GCGCGCGACGCNONE
J075074C22GCGCGCGACGCNONE
J075081G13GCGCGCGACGCNONE
J075099I03GCGCGCGACGCNONE
J075108D14GCGCGCGACGCNONE
J075129O14GCGCGCGACGCNONE
J075136P07GCGCGCGACGCNONE
J075149P09GCGCGCGACGCNONE
J075157K12GCGCGCGACGCNONE
J075176K20GCGCGCGACGCNONE
J080302C21GCGCGCGACGCNONE
Os01g0831300AK109023CTCGCGCGCSimilar to Ammonium transporter.
Os01g0833200AK121629CGCGTCGCGCGConserved hypothetical protein.
J023093N07CGCGTCGCGCGNONE
J033050C20CGCGTCGCGCGNONE
J080302F22CGCGTCGCGCGNONE
J080303H06CGCGTCGCGCGNONE
J080306J04CGCGTCGCGCGNONE
J080309K06CGCGTCGCGCGNONE
J080311E18CGCGTCGCGCGNONE
J080318A20CGCGTCGCGCGNONE
J100031F20CGCGTCGCGCGNONE
J100034P21CGCGTCGCGCGNONE
J100042K08CGCGTCGCGCGNONE
J100047H24CGCGTCGCGCGNONE
J100065C14CGCGTCGCGCGNONE
J100074E23CGCGTCGCGCGNONE
Os01g0844900AK066659CTCGCGCGCHomeodomain-like containing protein.
AK066659GCGCGCGACHomeodomain-like containing protein.
Os01g0848200AK069425CGCGCGACSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
AK101230CGCGCGACNONE
Os01g0856000016-095-F09CGCGCGAGNONE
AK107439CGCGCGAGSimilar to CDC6 protein.
AK107451CGCGCGAGNONE
Os01g0860601011-099-B05CTCGCGCGCNONE
013-093-G06CTCGCGCGCNONE
AK069860CTCGCGCGCSimilar to Ferredoxin, root R-B1.
J065017K08CTCGCGCGCNONE
J065020D23CTCGCGCGCNONE
J065041N15CTCGCGCGCNONE
J065119F17CTCGCGCGCNONE
J065169G20CTCGCGCGCNONE
J065179F21CTCGCGCGCNONE
J065182L09CTCGCGCGCNONE
Os01g0872300J065128I03CTCGCGCGACConserved hypothetical protein.
J100063A13CTCGCGCGACNONE
Os01g0877400AK106754CTCGCGCGCSimilar to Avr9 elicitor response-like protein.
Os01g0891400J065077E24CTCGCGCGGCCCGGGConserved hypothetical protein.
J065206I07CTCGCGCGGCCCGGGNONE
Os01g0896200AK105622GCGTCGCGCGConserved hypothetical protein.
Os01g0896800AK065268CTCGCGCGACNONE
AK104693CTCGCGCGACEukaryotic ribosomal protein L5 family protein.
J013126P09CTCGCGCGACNONE
J033046N15CTCGCGCGACNONE
J090008K02CTCGCGCGACNONE
J090024F15CTCGCGCGACNONE
J090074I23CTCGCGCGACNONE
J090093F03CTCGCGCGACNONE
J090096N02CTCGCGCGACNONE
Os01g0914300009-174-C06GCGCGCGAGNONE
014-073-B09GCGCGCGAGNONE
AK103489GCGCGCGAGNONE
AK105463GCGCGCGAGPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
J033076A02GCGCGCGAGNONE
J033130M24GCGCGCGAGNONE
Os01g0921600AK071344TCGCGCGCGACSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
J013039J22TCGCGCGCGACNONE
J013109E03TCGCGCGCGACNONE
J023081J12TCGCGCGCGACNONE
J023091E24TCGCGCGCGACNONE
J033022A01TCGCGCGCGACNONE
J033074C13TCGCGCGCGACNONE
J065199E03TCGCGCGCGACNONE
J075172O04TCGCGCGCGACNONE
J090007G18TCGCGCGCGACNONE
J090052B17TCGCGCGCGACNONE
J090074H01TCGCGCGCGACNONE
J100043J09TCGCGCGCGACNONE
J100059J05TCGCGCGCGACNONE
Os01g0963300AK067544CTCGCGCGCSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1).
Os01g0965500J075073G20CGCGCGAGNuclear protein SET domain containing protein.
Os01g0974200003-131-G05CTCGCGCGNONE
009-056-A07CTCGCGCGNONE
009-084-A06CTCGCGCGNONE
009-118-C05CTCGCGCGNONE
009-138-C12CTCGCGCGNONE
009-163-F05CTCGCGCGNONE
009-175-F12CTCGCGCGNONE
009-192-F01CTCGCGCGNONE
AB002820CTCGCGCGNONE
AF017365CTCGCGCGNONE
AK059392CTCGCGCGNONE
AK062796CTCGCGCGRicMT (Metallothionein-like protein).
AK104075CTCGCGCGNONE
J023079A11CTCGCGCGNONE
J023084P04CTCGCGCGNONE
J065060A20CTCGCGCGNONE
J065065L16CTCGCGCGNONE
J065086F04CTCGCGCGNONE
J065103H07CTCGCGCGNONE
J065104O09CTCGCGCGNONE
J065108C08CTCGCGCGNONE
J065121B18CTCGCGCGNONE
J065213D20CTCGCGCGNONE
J075005A13CTCGCGCGNONE
J075012P06CTCGCGCGNONE
J075097C23CTCGCGCGNONE
J075105E16CTCGCGCGNONE
J075114O15CTCGCGCGNONE
J075120G07CTCGCGCGNONE
J075177K02CTCGCGCGNONE
J080002D04CTCGCGCGNONE
J080013A10CTCGCGCGNONE
J080023H15CTCGCGCGNONE
J080025I06CTCGCGCGNONE
J080028G07CTCGCGCGNONE
J080028P13CTCGCGCGNONE
J080029E04CTCGCGCGNONE
J080030B21CTCGCGCGNONE
J080034N04CTCGCGCGNONE
J080036A19CTCGCGCGNONE
J080036F12CTCGCGCGNONE
J080036P20CTCGCGCGNONE
J080042M13CTCGCGCGNONE
J080043N01CTCGCGCGNONE
J080049M13CTCGCGCGNONE
J080059A01CTCGCGCGNONE
J080059I24CTCGCGCGNONE
J080059J18CTCGCGCGNONE
J080066D21CTCGCGCGNONE
J080077B12CTCGCGCGNONE
J080079I11CTCGCGCGNONE
J080083M24CTCGCGCGNONE
J080083P12CTCGCGCGNONE
J080087D01CTCGCGCGNONE
J080092I01CTCGCGCGNONE
J080310J19CTCGCGCGNONE
J080315B15CTCGCGCGNONE
J090075D21CTCGCGCGNONE
J100027F23CTCGCGCGNONE
J100031B07CTCGCGCGNONE
J100034A13CTCGCGCGNONE
J100041O19CTCGCGCGNONE
J100045A01CTCGCGCGNONE
J100065I02CTCGCGCGNONE
J100069G24CTCGCGCGNONE
J100072E11CTCGCGCGNONE
J100082O08CTCGCGCGNONE
Os02g0109200AK108815GCGCGCGAGACGTGNONE
J100030O18GCGCGCGAGACGTGNONE
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
012-035-F06GTCGCGCGNONE
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
013-031-H05GTCGCGCGNONE
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
013-058-E11GTCGCGCGNONE
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
014-010-D01GTCGCGCGNONE
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein.
AK070711GTCGCGCGConserved hypothetical protein.
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
AK119758GTCGCGCGNONE
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J013033G12GTCGCGCGNONE
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J023007M16GTCGCGCGNONE
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J023020K20GTCGCGCGNONE
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J023061H10GTCGCGCGNONE
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J033027H20GTCGCGCGNONE
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J033051E18GTCGCGCGNONE
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090005F12GTCGCGCGNONE
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090017A20GTCGCGCGNONE
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090018G11GTCGCGCGNONE
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J090062C18GTCGCGCGNONE
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100027N10GTCGCGCGNONE
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100032L14GTCGCGCGNONE
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100045C14GTCGCGCGNONE
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100061M09GTCGCGCGNONE
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100062K11GTCGCGCGNONE
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100064H11GTCGCGCGNONE
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100074H16GTCGCGCGNONE
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE
J100082N01GTCGCGCGNONE
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1).
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE
Os02g0175700AK069542CTCGCGCGCEpsin, N-terminal domain containing protein.
J023075D24CTCGCGCGCNONE
J023105C16CTCGCGCGCNONE
J023140A10CTCGCGCGCNONE
J023150G13CTCGCGCGCNONE
Os02g0189900012-074-E11CTCGCGCGCNONE
AK063528CTCGCGCGCHepatocellular carcinoma-associated antigen 59 family protein.
Os02g0202300AK071672GTCGCGCGConserved hypothetical protein.
Os02g0209400AK108109GTCGCGCGCCACGCCACGCCACConserved hypothetical protein.
Os02g0220600AK103901CTCGCGCGNONE
J013058O03CTCGCGCGNONE
J013124E21CTCGCGCGNONE
J023023L03CTCGCGCGNONE
J023023L21CTCGCGCGNONE
J023061N01CTCGCGCGNONE
J023065O09CTCGCGCGNONE
J023106J17CTCGCGCGNONE
J023119N08CTCGCGCGNONE
J033058A19CTCGCGCGNONE
J033098O13CTCGCGCGNONE
J033100M18CTCGCGCGNONE
J033125A21CTCGCGCGNONE
J033148C12CTCGCGCGNONE
J043017F03CTCGCGCGNONE
J043032J02CTCGCGCGNONE
J053047N10CTCGCGCGNONE
J053089P04CTCGCGCGNONE
J065051K09CTCGCGCGNONE
J065064H24CTCGCGCGNONE
J090001L06CTCGCGCGNONE
J090017C24CTCGCGCGNONE
J090058G15CTCGCGCGNONE
J090058H23CTCGCGCGNONE
J090061G20CTCGCGCGNONE
J090069N23CTCGCGCGNONE
J090071A08CTCGCGCGNONE
J090074A08CTCGCGCGNONE
J090077B15CTCGCGCGNONE
J090081K06CTCGCGCGNONE
J090083I05CTCGCGCGNONE
J090091O22CTCGCGCGNONE
J090097L10CTCGCGCGNONE
J100026B11CTCGCGCGNONE
J100044M01CTCGCGCGNONE
J100046F10CTCGCGCGNONE
J100051K14CTCGCGCGNONE
J100060D22CTCGCGCGNONE
J100060H18CTCGCGCGNONE
J100070I06CTCGCGCGNONE
J100071C04CTCGCGCGNONE
J100078M13CTCGCGCGNONE
J100080E17CTCGCGCGNONE
J100083I09CTCGCGCGNONE
Os02g0317300AK071724CGCGCGAGCyclin-like F-box domain containing protein.
J023114H08CGCGCGAGNONE
J075025F14CGCGCGAGNONE
J075031B10CGCGCGAGNONE
J075094J21CGCGCGAGNONE
J075138B09CGCGCGAGNONE
J075145F04CGCGCGAGNONE
J100046G09CGCGCGAGNONE
J100056O03CGCGCGAGNONE
Os02g0321900AK058256CTCGCGCGNONE
AK062103CTCGCGCGSimilar to 60S ribosomal protein L10a-1.
AK102574CTCGCGCGNONE
J065176M06CTCGCGCGNONE
J075112D24CTCGCGCGNONE
Os02g0332700009-144-D04CTCGCGCGNONE
AK062975CTCGCGCGConserved hypothetical protein.
Os02g0437200AK065640CGCGCGACNONE
AY900120CGCGCGACSimilar to SNAP-34.
J013038P06CGCGCGACNONE
J013146B13CGCGCGACNONE
J065015L12CGCGCGACNONE
J065089K05CGCGCGACNONE
J065197E17CGCGCGACNONE
J090077O07CGCGCGACNONE
J100050L21CGCGCGACNONE
J100074L24CGCGCGACNONE
Os02g0445600009-183-B02CTCGCGCGCGACNONE
AK063150CTCGCGCGCGACSimilar to Auxin-induced SAUR-like protein (Fragment).
Os02g0462800AK110587CGCGCGAGWRKY transcription factor 42 (Transcription factor WRKY02).
AY676923CGCGCGAGNONE
Os02g0465400AK100199CCGATCCGCGCGAGSimilar to 7-dehydrocholesterol reductase (EC 1.3.1.21) (7-DHC reductase) (Sterol delta-7-reductase) (Dwarf5 protein).
J090036B02CCGATCCGCGCGAGNONE
Os02g0506600AK107967GTCGCGCGCConserved hypothetical protein.
J065142J01GTCGCGCGCNONE
J100044B16GTCGCGCGCNONE
J100079K18GTCGCGCGCNONE
J100086M04GTCGCGCGCNONE
Os02g0509500009-117-G07CGCGCGACNONE
009-122-G08CGCGCGACNONE
AK105187CGCGCGACConserved hypothetical protein.
J065025C04CGCGCGACNONE
J065030F10CGCGCGACNONE
J065112P22CGCGCGACNONE
J065116I22CGCGCGACNONE
J065127F24CGCGCGACNONE
J065176E11CGCGCGACNONE
J065186F02CGCGCGACNONE
J075041F12CGCGCGACNONE
J075118L20CGCGCGACNONE
J075181D20CGCGCGACNONE
J090023P12CGCGCGACNONE
Os02g0513100AK103266CGCGCGACSimilar to MtN3 protein precursor.
Os02g0518000AK068281CTCGCGCGC2 calcium/lipid-binding region, CaLB domain containing protein.
AK068281GCGCGCGAGC2 calcium/lipid-binding region, CaLB domain containing protein.
J013146J12CTCGCGCGNONE
J013146J12GCGCGCGAGNONE
J013155G12CTCGCGCGNONE
J013155G12GCGCGCGAGNONE
J065141K03CTCGCGCGNONE
J065141K03GCGCGCGAGNONE
J065162I12CTCGCGCGNONE
J065162I12GCGCGCGAGNONE
J065166C16CTCGCGCGNONE
J065166C16GCGCGCGAGNONE
J065171I12CTCGCGCGNONE
J065171I12GCGCGCGAGNONE
Os02g0562300AK073250GCGCGCGACCalmodulin binding protein-like family protein.
Os02g0595800Os02g0595800CGCGCGAGSimilar to Eukaryotic initiation factor 4B (Fragment).
Os02g0610500AK058536CGCGCGAGACGCGSimilar to CONSTANS-like protein CO9 (Fragment).
AK058536CTCGCGCGCGCGTCTCSimilar to CONSTANS-like protein CO9 (Fragment).
AK100097CGCGCGAGACGCGNONE
AK100097CTCGCGCGCGCGTCTCNONE
J090016D17CGCGCGAGACGCGNONE
J090016D17CTCGCGCGCGCGTCTCNONE
J090077O10CGCGCGAGACGCGNONE
J090077O10CTCGCGCGCGCGTCTCNONE
J090097J09CGCGCGAGACGCGNONE
J090097J09CTCGCGCGCGCGTCTCNONE
J100054K15CGCGCGAGACGCGNONE
J100054K15CTCGCGCGCGCGTCTCNONE
J100066N13CGCGCGAGACGCGNONE
J100066N13CTCGCGCGCGCGTCTCNONE
J100072H14CGCGCGAGACGCGNONE
J100072H14CTCGCGCGCGCGTCTCNONE
Os02g0630300AK108598GTCGCGCGCGCCGGCCCGGGCCNONE
Os02g0633400AK073723CGCGTCGCGCGCSimilar to 61 kDa protein homolog.
J100031K17CGCGTCGCGCGCNONE
Os02g0634700AK071869CGCGCGACNONE
J013129B13CGCGCGACNONE
J013134D24CGCGCGACNONE
Os02g0640000AK120841GCGCGCGAGC2 calcium/lipid-binding region, CaLB domain containing protein.
J023022G19GCGCGCGAGNONE
J023081F22GCGCGCGAGNONE
Os02g0643200AK106784CTCGCGCGCYABBY protein family protein.
J075048L13CTCGCGCGCNONE
Os02g0643500AK068423TCGCGCGCGAGPentapeptide repeat containing protein.
Os02g0653900006-024-H11GCGCGCGACNONE
006-069-F05GCGCGCGACNONE
012-005-H01GCGCGCGACNONE
AK064950GCGCGCGACSimilar to Avr9/Cf-9 rapidly elicited protein 14 (Fragment).
AK098925GCGCGCGACNONE
AK104793GCGCGCGACNONE
AK106154GCGCGCGACNONE
J013000P22GCGCGCGACNONE
J013002P22GCGCGCGACNONE
J013072L24GCGCGCGACNONE
J013110J23GCGCGCGACNONE
J013126I23GCGCGCGACNONE
J013160D23GCGCGCGACNONE
J023056H01GCGCGCGACNONE
J033058I09GCGCGCGACNONE
J065183H09GCGCGCGACNONE
J065214P06GCGCGCGACNONE
J075071L23GCGCGCGACNONE
J090042C11GCGCGCGACNONE
J090057H07GCGCGCGACNONE
J090071O22GCGCGCGACNONE
J100029M07GCGCGCGACNONE
J100040O18GCGCGCGACNONE
J100041P12GCGCGCGACNONE
J100047J02GCGCGCGACNONE
J100063L09GCGCGCGACNONE
J100065B12GCGCGCGACNONE
J100066N05GCGCGCGACNONE
J100080O21GCGCGCGACNONE
J100083F13GCGCGCGACNONE
J100087G04GCGCGCGACNONE
J100090J20GCGCGCGACNONE
J100090N08GCGCGCGACNONE
Os02g0670000AK073148CTCGCGCGProtein of unknown function DUF300 family protein.
Os02g0677300006-102-D12GTCGCGCGCNONE
AK060550GTCGCGCGCNONE
AK106041GTCGCGCGCSimilar to CRT/DRE binding factor 1.
Os02g0679700AK108178GCGCGCGAGProtein of unknown function DUF623, plant domain containing protein.
J075112F23GCGCGCGAGNONE
Os02g0686300AK066567CGCGCGAGTGACACConserved hypothetical protein.
Os02g0694100J090034G11CTCGCGCGCyclin-like F-box domain containing protein.
Os02g0699000AK109931GCGCGCGACTGF-beta receptor, type I/II extracellular region family protein.
AK109931GTCGCGCGCTGF-beta receptor, type I/II extracellular region family protein.
Os02g0701600AK061746GTCGCGCGCNONE
AK071763GTCGCGCGCSimilar to Tocopherol O-methyltransferase, chloroplast precursor (EC 2.1.1.95) (Gamma-tocopherol methyltransferase).
J023089D05GTCGCGCGCNONE
J023110C23GTCGCGCGCNONE
Os02g0709200AK058999GCGCGCGAGSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase).
AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase).
AK099074GCGCGCGAGNONE
AK099074GTCGCGCGCGTGGGCCCCNONE
Os02g0711300AK107963CTCGCGCGCHSP20-like chaperone domain containing protein.
Os02g0723200AK108140CGCGCGAGSimilar to Alpha galactosyltransferase (Fragment).
J090087D22CGCGCGAGNONE
Os02g0744900AK061968CTCGCGCGSimilar to Geranylgeranyl reductase (Fragment).
AK098873CTCGCGCGNONE
J013001C18CTCGCGCGNONE
J080003D07CTCGCGCGNONE
J080003H24CTCGCGCGNONE
J080010C23CTCGCGCGNONE
J080011I04CTCGCGCGNONE
J080011O03CTCGCGCGNONE
J080012F13CTCGCGCGNONE
J080020E06CTCGCGCGNONE
J080025H22CTCGCGCGNONE
J080026D15CTCGCGCGNONE
J080028D20CTCGCGCGNONE
J080029P20CTCGCGCGNONE
J080031K22CTCGCGCGNONE
J080034I05CTCGCGCGNONE
J080036E11CTCGCGCGNONE
J080036H13CTCGCGCGNONE
J080037E17CTCGCGCGNONE
J080043N05CTCGCGCGNONE
J080044L23CTCGCGCGNONE
J080047N11CTCGCGCGNONE
J080048O04CTCGCGCGNONE
J080049M01CTCGCGCGNONE
J080050F21CTCGCGCGNONE
J080054F09CTCGCGCGNONE
J080055N20CTCGCGCGNONE
J080058C02CTCGCGCGNONE
J080058K15CTCGCGCGNONE
J080062G02CTCGCGCGNONE
J080066H16CTCGCGCGNONE
J080066O05CTCGCGCGNONE
J080067O16CTCGCGCGNONE
J080068E13CTCGCGCGNONE
J080069P16CTCGCGCGNONE
J080072M11CTCGCGCGNONE
J080076H09CTCGCGCGNONE
J080081G24CTCGCGCGNONE
J080082J05CTCGCGCGNONE
J080084I10CTCGCGCGNONE
J080087L24CTCGCGCGNONE
J080089H07CTCGCGCGNONE
J080089M05CTCGCGCGNONE
J080092G18CTCGCGCGNONE
J080095N08CTCGCGCGNONE
Os02g0753000AK121015CTCGCGCGGGTSimilar to Trehalose-6-phosphate phosphatase.
Os02g0756200AK063454CTCGCGCGCNONE
AK101655CTCGCGCGCSimilar to Phi-1 protein.
J065104L21CTCGCGCGCNONE
J065141A07CTCGCGCGCNONE
Os02g0758200AK111266GCGCGCGAGCCCAACCConserved hypothetical protein.
Os02g0771100AB040053GCGCGCGAGNONE
AK102740GCGCGCGAGSimilar to COP1 (Fragment).
AK111614GCGCGCGAGNONE
AK112098GCGCGCGAGNONE
J033106E23GCGCGCGAGNONE
Os02g0777800AK066978CGCGCGACSimilar to Avr9/Cf-9 induced kinase 1.
Os02g0782500013-043-A07CGCGCGACNONE
013-068-B10CGCGCGACNONE
013-093-A08CGCGCGACNONE
014-083-C12CGCGCGACNONE
AK063602CGCGCGACNONE
AK119261CGCGCGACSimilar to Small heat stress protein class CIII.
J065013N12CGCGCGACNONE
J075136E01CGCGCGACNONE
J075149G04CGCGCGACNONE
Os02g0816100AK058331CGCGCGAGHAD-superfamily hydrolase, subfamily IA, variant 2 protein.
AK060021CGCGCGAGNONE
J065132K03CGCGCGAGNONE
Os02g0817900AK068163GTCGCGCGCCytochrome P450 family protein.
Os03g0128300AK064718GCGTCGCGCGCConserved hypothetical protein.
Os03g0132900006-025-D05CTCGCGCGNONE
006-080-C01CTCGCGCGNONE
AF001501CTCGCGCGNONE
AK059871CTCGCGCGNONE
AK099355CTCGCGCGSimilar to Chitinase (EC 3.2.1.14) (Fragment).
J033022O03CTCGCGCGNONE
J033044P19CTCGCGCGNONE
J033119B12CTCGCGCGNONE
J075009H20CTCGCGCGNONE
J075122E04CTCGCGCGNONE
J075161D07CTCGCGCGNONE
Os03g0133100013-080-E12CTCGCGCGCNONE
AK063608CTCGCGCGCHypothetical protein.
AK119680CTCGCGCGCNONE
J075192B05CTCGCGCGCNONE
Os03g0135700AK060029CTCGCGCGGCCCACCNONE
AK103779CTCGCGCGGCCCACCSimilar to Transcriptional activator Rb homolog (Fragment).
J033145C17CTCGCGCGGCCCACCNONE
J043021B17CTCGCGCGGCCCACCNONE
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein.
Os03g0141200AK068968GCCCCACCGCGCGCGACGTGGCSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2).
AK100092GCCCCACCGCGCGCGACGTGGCNONE
J023003L18GCCCCACCGCGCGCGACGTGGCNONE
J023022K18GCCCCACCGCGCGCGACGTGGCNONE
J023107H13GCCCCACCGCGCGCGACGTGGCNONE
J023107K02GCCCCACCGCGCGCGACGTGGCNONE
Os03g0157400AK066035CTCGCGCGGGTABC transporter related domain containing protein.
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein.
AK106245CGCGCGACGCGGGCCGAGNONE
J075144I02CGCGCGACGCGGGCCGAGNONE
Os03g0159600AK106743TCGCGCGCGACSimilar to Rab28 protein.
J075041K15TCGCGCGCGACNONE
J075051E03TCGCGCGCGACNONE
J075055P19TCGCGCGCGACNONE
J075096D01TCGCGCGCGACNONE
Os03g0168100012-058-G09GTCGCGCGNONE
014-008-F07GTCGCGCGNONE
015-084-D03GTCGCGCGNONE
AK121575GTCGCGCGLate embryogenesis abundant protein repeat containing protein.
J033024H14GTCGCGCGNONE
J033036H02GTCGCGCGNONE
J033044I19GTCGCGCGNONE
J033098F11GTCGCGCGNONE
J033125I22GTCGCGCGNONE
J033128N18GTCGCGCGNONE
J033132L19GTCGCGCGNONE
J033149G13GTCGCGCGNONE
J075052I19GTCGCGCGNONE
J075099H16GTCGCGCGNONE
J075099P11GTCGCGCGNONE
J075122I20GTCGCGCGNONE
J075172K14GTCGCGCGNONE
J075188H01GTCGCGCGNONE
Os03g0180800AK070649CTCGCGCGCZIM domain containing protein.
AK070649CTCGCGCGCZIM domain containing protein.
J065121B15CTCGCGCGCNONE
J065121B15CTCGCGCGCNONE
J075067G15CTCGCGCGCNONE
J075067G15CTCGCGCGCNONE
Os03g0184100AK067400GCGCGCGAGHypothetical protein.
J013030J24GCGCGCGAGNONE
J013037M23GCGCGCGAGNONE
J013106B15GCGCGCGAGNONE
J013130H10GCGCGCGAGNONE
J013152B03GCGCGCGAGNONE
J013157J24GCGCGCGAGNONE
J013157K04GCGCGCGAGNONE
J033093A19GCGCGCGAGNONE
J033106E24GCGCGCGAGNONE
J090043G12GCGCGCGAGNONE
Os03g0188400AK107555CCTCGCCCCTCGCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK107555TCTCGGCCACACACCTCGCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os03g0194900006-038-B11CGCGCGAGNONE
006-048-H09CGCGCGAGNONE
009-141-E07CGCGCGAGNONE
013-006-A05CGCGCGAGNONE
013-073-G09CGCGCGAGNONE
013-093-E05CGCGCGAGNONE
AK061389CGCGCGAGNONE
AK070149CGCGCGAGDOMON related domain containing protein.
AK104041CGCGCGAGNONE
AK104413CGCGCGAGNONE
J013134O16CGCGCGAGNONE
J023042P18CGCGCGAGNONE
J023077M08CGCGCGAGNONE
J033068I01CGCGCGAGNONE
J053023E18CGCGCGAGNONE
J053026N22CGCGCGAGNONE
J053043H12CGCGCGAGNONE
J053064P12CGCGCGAGNONE
J053068B02CGCGCGAGNONE
J053069A07CGCGCGAGNONE
J053070F13CGCGCGAGNONE
J053094H07CGCGCGAGNONE
J065061I03CGCGCGAGNONE
J065115D02CGCGCGAGNONE
J065163K24CGCGCGAGNONE
J065195M16CGCGCGAGNONE
J065219A21CGCGCGAGNONE
J075046I11CGCGCGAGNONE
J075097H16CGCGCGAGNONE
J075128N20CGCGCGAGNONE
J075139O20CGCGCGAGNONE
J075168H20CGCGCGAGNONE
J075170E15CGCGCGAGNONE
J075191C04CGCGCGAGNONE
J075192P06CGCGCGAGNONE
J100027K07CGCGCGAGNONE
J100027P03CGCGCGAGNONE
J100033P16CGCGCGAGNONE
J100050M24CGCGCGAGNONE
J100072D05CGCGCGAGNONE
Os03g0197300AK102651CACGCCACGCCACCCCCACGTCGCGCGCCupin, RmlC-type domain containing protein.
Os03g0210600AK070125CTCGCGCGConserved hypothetical protein.
Os03g0214200AK100623CGACACGTGTCGCGCGCProtein of unknown function DUF1675 family protein.
AK100623GCGCGCGAGProtein of unknown function DUF1675 family protein.
J075053B18CGACACGTGTCGCGCGCNONE
J075053B18GCGCGCGAGNONE
Os03g0215700AK099772CTCGCGCGCMyosin II heavy chain-like family protein.
Os03g0227800J013091I04CTCGCGCGNONE
J080305J16CTCGCGCGNONE
Os03g0241600AK120688GTCGCGCGNONE
Os03g0249800009-063-F07CGCGCGAGNONE
009-063-F07GCGCGCGAGNONE
009-135-C05CGCGCGAGNONE
009-135-C05GCGCGCGAGNONE
AK120462CGCGCGAGHypothetical protein.
AK120462GCGCGCGAGHypothetical protein.
AK121219CGCGCGAGNONE
AK121219GCGCGCGAGNONE
J023090G01CGCGCGAGNONE
J023090G01GCGCGCGAGNONE
J100045O11CGCGCGAGNONE
J100045O11GCGCGCGAGNONE
Os03g0252100J065002C04CGCGCGAGNONE
J065061I07CGCGCGAGNONE
J065065G09CGCGCGAGNONE
J065073F02CGCGCGAGNONE
J065073H04CGCGCGAGEsterase/lipase/thioesterase domain containing protein.
J065122K22CGCGCGAGNONE
J065132J11CGCGCGAGNONE
J065162B03CGCGCGAGNONE
J065187P08CGCGCGAGNONE
J075023G18CGCGCGAGNONE
J075173H13CGCGCGAGNONE
J090025K19CGCGCGAGNONE
Os03g0259700015-018-F05CTCGCGCGProtein of unknown function DUF1630 family protein.
J065023N06CTCGCGCGNONE
J065121K01CTCGCGCGNONE
J075142D15CTCGCGCGNONE
J100029H23CTCGCGCGNONE
Os03g0275500AK065232CCCCCGCGCGACEpsin, N-terminal domain containing protein.
J013002H14CCCCCGCGCGACNONE
J013047G17CCCCCGCGCGACNONE
J013050M23CCCCCGCGCGACNONE
J013066D16CCCCCGCGCGACNONE
J013088C16CCCCCGCGCGACNONE
J023026P14CCCCCGCGCGACNONE
J023031E04CCCCCGCGCGACNONE
J023045C06CCCCCGCGCGACNONE
J023086K13CCCCCGCGCGACNONE
J023119G16CCCCCGCGCGACNONE
J033079G11CCCCCGCGCGACNONE
J033090O21CCCCCGCGCGACNONE
J033103H08CCCCCGCGCGACNONE
J033103M23CCCCCGCGCGACNONE
J033106J17CCCCCGCGCGACNONE
J033141M15CCCCCGCGCGACNONE
J090029G22CCCCCGCGCGACNONE
J090032O20CCCCCGCGCGACNONE
J090034P11CCCCCGCGCGACNONE
J090087D18CCCCCGCGCGACNONE
J100078E18CCCCCGCGCGACNONE
J100081C12CCCCCGCGCGACNONE
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1.
AK100522GCGCGCGAGSimilar to GDP dissociation inhibitor protein OsGDI1.
Os03g0284500012-066-D02CCCCCGCGCGAGNONE
012-066-D02CGGGCCCCTCGCGCGNONE
AK105295CCCCCGCGCGAGNONE
AK105295CGGGCCCCTCGCGCGNONE
AK121300CCCCCGCGCGAGHAD-superfamily subfamily IIA hydrolase, CECR5 protein.
AK121300CGGGCCCCTCGCGCGHAD-superfamily subfamily IIA hydrolase, CECR5 protein.
Os03g0284600AK110712CTCGCGCGGGGGThioredoxin fold domain containing protein.
Os03g0300200AK102070CTCGCGCGCSimilar to Ubiquitin-specific protease 16.
Os03g0308100AB116073GCGCGCGAGPeptidase S14, ClpP family protein.
AK060518GCGCGCGAGNONE
AK099107GCGCGCGAGNONE
AK105977GCGCGCGAGNONE
J065005O19GCGCGCGAGNONE
J065007L02GCGCGCGAGNONE
J065128G15GCGCGCGAGNONE
J065128N14GCGCGCGAGNONE
J075010E21GCGCGCGAGNONE
J075101J24GCGCGCGAGNONE
J075124O14GCGCGCGAGNONE
J075126O07GCGCGCGAGNONE
Os03g0310800009-126-C10GTCGCGCGNONE
009-156-D02GTCGCGCGNONE
AK058663GTCGCGCGNONE
AK099476GTCGCGCGSimilar to Hypersensitive reaction associated Ca2+-binding protein.
J065084G15GTCGCGCGNONE
J075046C12GTCGCGCGNONE
J075058D24GTCGCGCGNONE
J075151M03GTCGCGCGNONE
J075151M04GTCGCGCGNONE
J075153I20GTCGCGCGNONE
J075167J05GTCGCGCGNONE
J075179G06GTCGCGCGNONE
J100025I19GTCGCGCGNONE
J100025L21GTCGCGCGNONE
J100029C06GTCGCGCGNONE
J100068E24GTCGCGCGNONE
J100070F10GTCGCGCGNONE
J100083H23GTCGCGCGNONE
J100089H10GTCGCGCGNONE
Os03g0318400015-094-B06GCGCGCGAGNONE
AK106440GCGCGCGAGPeptidase A1, pepsin family protein.
J100029O07GCGCGCGAGNONE
Os03g0336100AK105307CTCGCGCG11-S plant seed storage protein family protein.
Os03g0339400AK065305GTCGCGCGHaem peroxidase, plant/fungal/bacterial family protein.
J013002O02GTCGCGCGNONE
Os03g0387100AB026559ATCGGACGGCGCGCGACNONE
AF022735ATCGGACGGCGCGCGACNONE
AK058567ATCGGACGGCGCGCGACProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
AK101195ATCGGACGGCGCGCGACNONE
J033030J15ATCGGACGGCGCGCGACNONE
J033102N16ATCGGACGGCGCGCGACNONE
J065056E08ATCGGACGGCGCGCGACNONE
J065112M11ATCGGACGGCGCGCGACNONE
J065170H07ATCGGACGGCGCGCGACNONE
J075003P17ATCGGACGGCGCGCGACNONE
J075074D06ATCGGACGGCGCGCGACNONE
J075127F20ATCGGACGGCGCGCGACNONE
J075129I01ATCGGACGGCGCGCGACNONE
J075178A10ATCGGACGGCGCGCGACNONE
J090071P12ATCGGACGGCGCGCGACNONE
J100090D18ATCGGACGGCGCGCGACNONE
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein.
Os03g0576900AK064861CCCCCGCGCGCGAGNONE
J013000I01CCCCCGCGCGCGAGNONE
J013169P21CCCCCGCGCGCGAGNONE
J023001P03CCCCCGCGCGCGAGNONE
J023009M10CCCCCGCGCGCGAGNONE
J023025G11CCCCCGCGCGCGAGNONE
J033046B19CCCCCGCGCGCGAGNONE
J033149I10CCCCCGCGCGCGAGNONE
J090081C04CCCCCGCGCGCGAGNONE
Os03g0646300AK069229CTCGCGCGCSimilar to Cyclic nucleotide-gated channel A (Fragment).
Os03g0668000AK111705CGCGCGAGNONE
AK111783CGCGCGAGCyclin-like F-box domain containing protein.
J023087J12CGCGCGAGNONE
Os03g0670700009-028-B03CTCGCGCGNONE
009-036-H12CTCGCGCGNONE
009-053-H05CTCGCGCGNONE
009-126-B02CTCGCGCGNONE
009-135-D07CTCGCGCGNONE
009-148-A03CTCGCGCGNONE
009-148-A12CTCGCGCGNONE
009-152-B02CTCGCGCGNONE
009-153-B06CTCGCGCGNONE
009-166-G05CTCGCGCGNONE
009-181-A09CTCGCGCGNONE
011-061-D07CTCGCGCGNONE
012-043-C04CTCGCGCGNONE
013-001-A02CTCGCGCGNONE
013-004-F05CTCGCGCGNONE
013-008-C08CTCGCGCGNONE
013-015-B09CTCGCGCGNONE
013-016-G05CTCGCGCGNONE
013-023-A06CTCGCGCGNONE
013-023-B06CTCGCGCGNONE
013-032-F09CTCGCGCGNONE
013-059-C07CTCGCGCGNONE
013-071-E09CTCGCGCGNONE
013-073-D06CTCGCGCGNONE
013-077-C02CTCGCGCGNONE
013-078-B12CTCGCGCGNONE
013-093-A01CTCGCGCGNONE
014-002-B12CTCGCGCGNONE
014-003-E08CTCGCGCGNONE
014-004-D06CTCGCGCGNONE
014-007-C11CTCGCGCGNONE
014-007-G10CTCGCGCGNONE
014-019-C04CTCGCGCGNONE
014-021-F05CTCGCGCGNONE
014-024-G06CTCGCGCGNONE
014-027-C07CTCGCGCGNONE
014-027-D03CTCGCGCGNONE
014-029-E07CTCGCGCGNONE
014-031-B04CTCGCGCGNONE
014-033-B05CTCGCGCGNONE
014-033-C03CTCGCGCGNONE
014-033-C12CTCGCGCGNONE
014-036-F01CTCGCGCGNONE
014-037-C04CTCGCGCGNONE
014-040-H02CTCGCGCGNONE
014-045-H04CTCGCGCGNONE
014-045-H06CTCGCGCGNONE
014-052-A08CTCGCGCGNONE
014-076-G01CTCGCGCGNONE
014-083-F04CTCGCGCGNONE
014-086-E01CTCGCGCGNONE
014-091-D02CTCGCGCGNONE
014-091-F05CTCGCGCGNONE
014-093-E10CTCGCGCGNONE
014-100-C10CTCGCGCGNONE
015-011-H02CTCGCGCGNONE
015-073-B03CTCGCGCGNONE
AF010579CTCGCGCGNONE
AK059164CTCGCGCGSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein.
AK070016CTCGCGCGNONE
AK119238CTCGCGCGNONE
AK119242CTCGCGCGNONE
J023037K17CTCGCGCGNONE
J033136F11CTCGCGCGNONE
J065008C13CTCGCGCGNONE
J065032K18CTCGCGCGNONE
J065043N10CTCGCGCGNONE
J065045E06CTCGCGCGNONE
J065046P21CTCGCGCGNONE
J065048J17CTCGCGCGNONE
J065053I23CTCGCGCGNONE
J065053P03CTCGCGCGNONE
J065054C13CTCGCGCGNONE
J065058I17CTCGCGCGNONE
J065061I12CTCGCGCGNONE
J065062E09CTCGCGCGNONE
J065063P04CTCGCGCGNONE
J065068J07CTCGCGCGNONE
J065076D02CTCGCGCGNONE
J065083O07CTCGCGCGNONE
J065090J02CTCGCGCGNONE
J065093N08CTCGCGCGNONE
J065097F02CTCGCGCGNONE
J065112H17CTCGCGCGNONE
J065121B01CTCGCGCGNONE
J065124F12CTCGCGCGNONE
J065130L03CTCGCGCGNONE
J065131K05CTCGCGCGNONE
J065132C06CTCGCGCGNONE
J065135J18CTCGCGCGNONE
J065138J22CTCGCGCGNONE
J065140G21CTCGCGCGNONE
J065161B19CTCGCGCGNONE
J065162F22CTCGCGCGNONE
J065162M09CTCGCGCGNONE
J065163D03CTCGCGCGNONE
J065163O21CTCGCGCGNONE
J065165H11CTCGCGCGNONE
J065165O16CTCGCGCGNONE
J065167N06CTCGCGCGNONE
J065168I08CTCGCGCGNONE
J065170A14CTCGCGCGNONE
J065170L03CTCGCGCGNONE
J065171C08CTCGCGCGNONE
J065173G11CTCGCGCGNONE
J065173M09CTCGCGCGNONE
J065176P07CTCGCGCGNONE
J065178K24CTCGCGCGNONE
J065185O12CTCGCGCGNONE
J065191E02CTCGCGCGNONE
J065204H10CTCGCGCGNONE
J075033C23CTCGCGCGNONE
J075041M21CTCGCGCGNONE
J075043F13CTCGCGCGNONE
J075044D02CTCGCGCGNONE
J075044J15CTCGCGCGNONE
J075048L07CTCGCGCGNONE
J075054G12CTCGCGCGNONE
J075055J10CTCGCGCGNONE
J075059F09CTCGCGCGNONE
J075066M23CTCGCGCGNONE
J075071O09CTCGCGCGNONE
J075085G23CTCGCGCGNONE
J075086B21CTCGCGCGNONE
J075087L18CTCGCGCGNONE
J075087L21CTCGCGCGNONE
J075087N14CTCGCGCGNONE
J075088O13CTCGCGCGNONE
J075089B06CTCGCGCGNONE
J075089E20CTCGCGCGNONE
J075090J01CTCGCGCGNONE
J075090L05CTCGCGCGNONE
J075091G05CTCGCGCGNONE
J075091N06CTCGCGCGNONE
J075093G08CTCGCGCGNONE
J075094C13CTCGCGCGNONE
J075095K01CTCGCGCGNONE
J075096C02CTCGCGCGNONE
J075097L16CTCGCGCGNONE
J075097O10CTCGCGCGNONE
J075098H24CTCGCGCGNONE
J075099H02CTCGCGCGNONE
J075099J11CTCGCGCGNONE
J075099L08CTCGCGCGNONE
J075109I11CTCGCGCGNONE
J075114F03CTCGCGCGNONE
J075121G07CTCGCGCGNONE
J075122D23CTCGCGCGNONE
J075132O07CTCGCGCGNONE
J075141L21CTCGCGCGNONE
J075142I08CTCGCGCGNONE
J075145A06CTCGCGCGNONE
J075147J15CTCGCGCGNONE
J075150B09CTCGCGCGNONE
J075151E07CTCGCGCGNONE
J075161M16CTCGCGCGNONE
J075190I16CTCGCGCGNONE
J075192L05CTCGCGCGNONE
J075192O03CTCGCGCGNONE
J075192O08CTCGCGCGNONE
J075193L12CTCGCGCGNONE
J080001M24CTCGCGCGNONE
J080004E20CTCGCGCGNONE
J080005K15CTCGCGCGNONE
J080005L05CTCGCGCGNONE
J080014P20CTCGCGCGNONE
J080029D12CTCGCGCGNONE
J080030H09CTCGCGCGNONE
J080039G05CTCGCGCGNONE
J080040E18CTCGCGCGNONE
J080041B02CTCGCGCGNONE
J080041E06CTCGCGCGNONE
J080041G05CTCGCGCGNONE
J080041G24CTCGCGCGNONE
J080041H07CTCGCGCGNONE
J080041K03CTCGCGCGNONE
J080047G01CTCGCGCGNONE
J080052E07CTCGCGCGNONE
J080053B15CTCGCGCGNONE
J080053N01CTCGCGCGNONE
J080054I01CTCGCGCGNONE
J080054N02CTCGCGCGNONE
J080063P03CTCGCGCGNONE
J080064E13CTCGCGCGNONE
J080064G13CTCGCGCGNONE
J080065F02CTCGCGCGNONE
J080065G03CTCGCGCGNONE
J080065K17CTCGCGCGNONE
J080067D06CTCGCGCGNONE
J080067H23CTCGCGCGNONE
J080067M15CTCGCGCGNONE
J080068B20CTCGCGCGNONE
J080068G24CTCGCGCGNONE
J080072K19CTCGCGCGNONE
J080076I24CTCGCGCGNONE
J080092F05CTCGCGCGNONE
J080092K14CTCGCGCGNONE
J080092N22CTCGCGCGNONE
J080093K02CTCGCGCGNONE
J080094C08CTCGCGCGNONE
J080094E09CTCGCGCGNONE
J080094E20CTCGCGCGNONE
J080094G08CTCGCGCGNONE
J080094H18CTCGCGCGNONE
J080094P22CTCGCGCGNONE
J080095J23CTCGCGCGNONE
J080096F14CTCGCGCGNONE
J080097A21CTCGCGCGNONE
J080097I07CTCGCGCGNONE
J080097J02CTCGCGCGNONE
J080097K01CTCGCGCGNONE
J080097K03CTCGCGCGNONE
J080305H18CTCGCGCGNONE
J080306G01CTCGCGCGNONE
J080306O08CTCGCGCGNONE
J080311I01CTCGCGCGNONE
J080315N24CTCGCGCGNONE
J090003K21CTCGCGCGNONE
J090008C20CTCGCGCGNONE
J090008K19CTCGCGCGNONE
J090008P13CTCGCGCGNONE
J090015H22CTCGCGCGNONE
J090016M01CTCGCGCGNONE
J090018E13CTCGCGCGNONE
J090018G03CTCGCGCGNONE
J090018L17CTCGCGCGNONE
J090019H11CTCGCGCGNONE
J090021B19CTCGCGCGNONE
J090021K02CTCGCGCGNONE
J090023H15CTCGCGCGNONE
J090034E03CTCGCGCGNONE
J090045D16CTCGCGCGNONE
J090045I06CTCGCGCGNONE
J090047L09CTCGCGCGNONE
J090048B05CTCGCGCGNONE
J090048D11CTCGCGCGNONE
J090048N11CTCGCGCGNONE
J090050F20CTCGCGCGNONE
J090052M20CTCGCGCGNONE
J090083H03CTCGCGCGNONE
J090084C12CTCGCGCGNONE
J090095B05CTCGCGCGNONE
J090095M18CTCGCGCGNONE
J100024I22CTCGCGCGNONE
J100024J12CTCGCGCGNONE
J100024J22CTCGCGCGNONE
J100025F07CTCGCGCGNONE
J100026B13CTCGCGCGNONE
J100027N03CTCGCGCGNONE
J100029F14CTCGCGCGNONE
J100029L20CTCGCGCGNONE
J100032C22CTCGCGCGNONE
J100032I08CTCGCGCGNONE
J100032O05CTCGCGCGNONE
J100033J24CTCGCGCGNONE
J100033L12CTCGCGCGNONE
J100034K06CTCGCGCGNONE
J100037D09CTCGCGCGNONE
J100038H02CTCGCGCGNONE
J100039A12CTCGCGCGNONE
J100039N12CTCGCGCGNONE
J100039O21CTCGCGCGNONE
J100040K05CTCGCGCGNONE
J100042A02CTCGCGCGNONE
J100042A17CTCGCGCGNONE
J100043C15CTCGCGCGNONE
J100044A17CTCGCGCGNONE
J100044E18CTCGCGCGNONE
J100044I11CTCGCGCGNONE
J100044J15CTCGCGCGNONE
J100045E23CTCGCGCGNONE
J100049B18CTCGCGCGNONE
J100050G04CTCGCGCGNONE
J100051D06CTCGCGCGNONE
J100051H20CTCGCGCGNONE
J100052J01CTCGCGCGNONE
J100052K07CTCGCGCGNONE
J100055I01CTCGCGCGNONE
J100057D02CTCGCGCGNONE
J100059G14CTCGCGCGNONE
J100059G21CTCGCGCGNONE
J100059H03CTCGCGCGNONE
J100059H15CTCGCGCGNONE
J100063E13CTCGCGCGNONE
J100063M02CTCGCGCGNONE
J100064B17CTCGCGCGNONE
J100064F11CTCGCGCGNONE
J100066G12CTCGCGCGNONE
J100066H09CTCGCGCGNONE
J100068B12CTCGCGCGNONE
J100068L16CTCGCGCGNONE
J100068M23CTCGCGCGNONE
J100069A02CTCGCGCGNONE
J100069D07CTCGCGCGNONE
J100069M13CTCGCGCGNONE
J100070C07CTCGCGCGNONE
J100070J11CTCGCGCGNONE
J100070L20CTCGCGCGNONE
J100071H10CTCGCGCGNONE
J100072L14CTCGCGCGNONE
J100072N12CTCGCGCGNONE
J100073A21CTCGCGCGNONE
J100074K17CTCGCGCGNONE
J100074M04CTCGCGCGNONE
J100075F11CTCGCGCGNONE
J100076E23CTCGCGCGNONE
J100076G03CTCGCGCGNONE
J100077K01CTCGCGCGNONE
J100077N23CTCGCGCGNONE
J100079H17CTCGCGCGNONE
J100081N01CTCGCGCGNONE
J100082E04CTCGCGCGNONE
J100082K11CTCGCGCGNONE
J100085H23CTCGCGCGNONE
J100086O18CTCGCGCGNONE
J100087F21CTCGCGCGNONE
J100088E02CTCGCGCGNONE
J100088F08CTCGCGCGNONE
J100088G24CTCGCGCGNONE
J100088K20CTCGCGCGNONE
J100089B19CTCGCGCGNONE
J100089K22CTCGCGCGNONE
J100089N22CTCGCGCGNONE
J100089O17CTCGCGCGNONE
J100090N05CTCGCGCGNONE
Os03g0684400AK100086CGCGCGAGMg2+ transporter protein, CorA-like family protein.
Os03g0685000009-031-F08CTCGCGCGCNONE
AK059896CTCGCGCGCSimilar to Ferredoxin.
AK098989CTCGCGCGCNONE
AK099303CTCGCGCGCNONE
J065041E14CTCGCGCGCNONE
J065085G22CTCGCGCGCNONE
Os03g0695400AK070048CGCGCGACAnkyrin repeat containing protein.
Os03g0699400AK069110GTCGCGCGAGSilencing group B protein.
J023009F11GTCGCGCGAGNONE
J065010K14GTCGCGCGAGNONE
J065013G22GTCGCGCGAGNONE
J065041E22GTCGCGCGAGNONE
J065045P04GTCGCGCGAGNONE
J065060N03GTCGCGCGAGNONE
J065077K12GTCGCGCGAGNONE
J090024D16GTCGCGCGAGNONE
J100031M08GTCGCGCGAGNONE
J100075I05GTCGCGCGAGNONE
Os03g0701100014-015-E11CGCGCGAGNONE
AK109455CGCGCGAGNONE
AK110740CGCGCGAGNONE
Os03g0704100003-129-D05CGCGCGACNONE
AK070474CGCGCGACPAP fibrillin family protein.
Os03g0725000AK059294GCGCGCGAGNONE
J043026H11GCGCGCGAGNONE
J065187O06GCGCGCGAGNONE
J090066M23GCGCGCGAGNONE
Os03g0727800014-002-D07CTCGCGCGNONE
014-002-D07GCGCGCGAGNONE
AK109453CTCGCGCGCyclin-like F-box domain containing protein.
AK109453GCGCGCGAGCyclin-like F-box domain containing protein.
Os03g0738600AK073529GCGCGCGACCCACACGSimilar to Lipoxygenase L-2 (EC 1.13.11.12).
X64396GCGCGCGACCCACACGNONE
Os03g0744800AK059983CTCGCGCGCemp24/gp25L/p24 family protein.
J065067D01CTCGCGCGCNONE
J065122L19CTCGCGCGCNONE
J090041I03CTCGCGCGCNONE
J100039H03CTCGCGCGCNONE
Os03g0748500AK110695CGCACGCGCGAGNONE
AK110695GTCGCGCGAGNONE
Os03g0751600006-043-F03GCGCGCGACNONE
006-050-G05GCGCGCGACNONE
006-059-F10GCGCGCGACNONE
AK061520GCGCGCGACHeavy metal transport/detoxification protein domain containing protein.
AK104665GCGCGCGACNONE
Os03g0764200Os03g0764200GTCGCGCGCNONE
Os03g0764600AK105625GCGCGCGAGHomeodomain-like containing protein.
Os03g0801900015-081-G06CGCGCGACNONE
AK106415CGCGCGACProtein of unknown function DUF569 family protein.
J090099L17CGCGCGACNONE
J100024B03CGCGCGACNONE
J100088I08CGCGCGACNONE
Os03g0802200009-047-D08CGCGCGACNONE
009-047-D08CTCGCGCGCNONE
013-057-D02CGCGCGACNONE
013-057-D02CTCGCGCGCNONE
013-089-F02CGCGCGACNONE
013-089-F02CTCGCGCGCNONE
014-079-D02CGCGCGACNONE
014-079-D02CTCGCGCGCNONE
016-004-A11CGCGCGACNONE
016-004-A11CTCGCGCGCNONE
AK111769CGCGCGACConserved hypothetical protein.
AK111769CTCGCGCGCConserved hypothetical protein.
J075006H18CGCGCGACNONE
J075006H18CTCGCGCGCNONE
J075060G07CGCGCGACNONE
J075060G07CTCGCGCGCNONE
Os03g0819900006-058-B05CGCACGCGCGCGACNONE
AK111912CGCACGCGCGCGACNONE
AK112029CGCACGCGCGCGACSimilar to RAB8C.
AY576526CGCACGCGCGCGACNONE
AY579410CGCACGCGCGCGACNONE
J075041G24CGCACGCGCGCGACNONE
J100070N08CGCACGCGCGCGACNONE
Os03g0829600AK071298CGCGCGACNONE
AK119707CGCGCGACConserved hypothetical protein.
J023084A07CGCGCGACNONE
Os03g0851100AF303468CTCGCGCGCNONE
AK102069CTCGCGCGCSimilar to Translational elongation factor EF-TuM.
J033082G06CTCGCGCGCNONE
J043036M21CTCGCGCGCNONE
J065158H05CTCGCGCGCNONE
J065192A04CTCGCGCGCNONE
Os04g0406600AK103609GCGCGCGAGPrephenate dehydratase domain containing protein.
J033133I10GCGCGCGAGNONE
J075092D11GCGCGCGAGNONE
J100031M09GCGCGCGAGNONE
Os04g0410400AK108077CGCGCGAGRoot cap family protein.
Os04g0412300AK110902CGCGCGACGCGNONE
AK121151CGCGCGACGCGGlycoside hydrolase, family 17 protein.
J013126I01CGCGCGACGCGNONE
J023078I08CGCGCGACGCGNONE
J090006M17CGCGCGACGCGNONE
J090060D03CGCGCGACGCGNONE
J090063F12CGCGCGACGCGNONE
J100040E06CGCGCGACGCGNONE
J100057F18CGCGCGACGCGNONE
J100058B19CGCGCGACGCGNONE
J100058C20CGCGCGACGCGNONE
J100067G08CGCGCGACGCGNONE
J100082C09CGCGCGACGCGNONE
J100086D14CGCGCGACGCGNONE
Os04g0417000AK063428GCGCGCGAGSimilar to Aluminum-activated malate transporter.
Os04g0434400014-079-B10CGCACGCGCGCGAGNONE
014-079-B10CGCGCGACGCGNONE
AK063725CGCACGCGCGCGAGConserved hypothetical protein.
AK063725CGCGCGACGCGConserved hypothetical protein.
Os04g0435700AK100857GTCGCGCGCSimilar to UVB-resistance protein UVR8.
Os04g0447400AK070858GCCCCCACCACGTCGCGCGCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2).
J023002M09GCCCCCACCACGTCGCGCGCNONE
J023003G16GCCCCCACCACGTCGCGCGCNONE
J023006F16GCCCCCACCACGTCGCGCGCNONE
J023008D10GCCCCCACCACGTCGCGCGCNONE
J023010A01GCCCCCACCACGTCGCGCGCNONE
J023012M16GCCCCCACCACGTCGCGCGCNONE
J023023H17GCCCCCACCACGTCGCGCGCNONE
J023029B12GCCCCCACCACGTCGCGCGCNONE
J023030F09GCCCCCACCACGTCGCGCGCNONE
J023034K03GCCCCCACCACGTCGCGCGCNONE
J023045A16GCCCCCACCACGTCGCGCGCNONE
J023048I04GCCCCCACCACGTCGCGCGCNONE
J023056C09GCCCCCACCACGTCGCGCGCNONE
J023056F05GCCCCCACCACGTCGCGCGCNONE
J023058B21GCCCCCACCACGTCGCGCGCNONE
J023058N06GCCCCCACCACGTCGCGCGCNONE
J023059F03GCCCCCACCACGTCGCGCGCNONE
J023059M19GCCCCCACCACGTCGCGCGCNONE
J023060P05GCCCCCACCACGTCGCGCGCNONE
J023062D07GCCCCCACCACGTCGCGCGCNONE
J023063F16GCCCCCACCACGTCGCGCGCNONE
J023068K15GCCCCCACCACGTCGCGCGCNONE
J023069L04GCCCCCACCACGTCGCGCGCNONE
J023075I24GCCCCCACCACGTCGCGCGCNONE
J023086H01GCCCCCACCACGTCGCGCGCNONE
J023086I24GCCCCCACCACGTCGCGCGCNONE
J023091M08GCCCCCACCACGTCGCGCGCNONE
J023095A07GCCCCCACCACGTCGCGCGCNONE
J023110K06GCCCCCACCACGTCGCGCGCNONE
J023113D07GCCCCCACCACGTCGCGCGCNONE
J023126J05GCCCCCACCACGTCGCGCGCNONE
J023140F04GCCCCCACCACGTCGCGCGCNONE
J023141N19GCCCCCACCACGTCGCGCGCNONE
Os04g0447500AK064090GCGCGCGACGTGGTGGGGGCSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247).
Os04g0457700J075145N15TTTGGGCCTCGCGCGCConserved hypothetical protein.
Os04g0461000Os04g0461000CGCGCGAGSimilar to Myb-related transcription factor LBM1.
Os04g0489600003-130-E01GTCGCGCGCNONE
AK062301GTCGCGCGCNONE
AK068039GTCGCGCGCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os04g0494600AK110895CGCGTCGCGCGProtein of unknown function DUF642 family protein.
Os04g0505200004-004-B07CTCGCGCGCNONE
004-004-B07GTCGCGCGCGCGACNONE
006-025-D10CTCGCGCGCNONE
006-025-D10GTCGCGCGCGCGACNONE
006-038-D07CTCGCGCGCNONE
006-038-D07GTCGCGCGCGCGACNONE
006-044-H11CTCGCGCGCNONE
006-044-H11GTCGCGCGCGCGACNONE
006-061-A09CTCGCGCGCNONE
006-061-A09GTCGCGCGCGCGACNONE
006-083-C02CTCGCGCGCNONE
006-083-C02GTCGCGCGCGCGACNONE
009-167-F06CTCGCGCGCNONE
009-167-F06GTCGCGCGCGCGACNONE
013-093-B02CTCGCGCGCNONE
013-093-B02GTCGCGCGCGCGACNONE
AK061301CTCGCGCGCLeucine-rich repeat, plant specific containing protein.
AK061301GTCGCGCGCGCGACLeucine-rich repeat, plant specific containing protein.
AK066703CTCGCGCGCNONE
AK066703GTCGCGCGCGCGACNONE
AK104903CTCGCGCGCNONE
AK104903GTCGCGCGCGCGACNONE
J013027H24CTCGCGCGCNONE
J013027H24GTCGCGCGCGCGACNONE
J013075O17CTCGCGCGCNONE
J013075O17GTCGCGCGCGCGACNONE
J013130D11CTCGCGCGCNONE
J013130D11GTCGCGCGCGCGACNONE
J033069B22CTCGCGCGCNONE
J033069B22GTCGCGCGCGCGACNONE
J033102K15CTCGCGCGCNONE
J033102K15GTCGCGCGCGCGACNONE
J090004A17CTCGCGCGCNONE
J090004A17GTCGCGCGCGCGACNONE
J090008L22CTCGCGCGCNONE
J090008L22GTCGCGCGCGCGACNONE
J090063C05CTCGCGCGCNONE
J090063C05GTCGCGCGCGCGACNONE
Os04g0510900012-083-A10CGCGCGACNONE
014-002-F04CGCGCGACNONE
AK063625CGCGCGACSimilar to Embryo-specific protein 1 (ATS1).
J065136I20CGCGCGACNONE
J065144F23CGCGCGACNONE
J065153D08CGCGCGACNONE
J065178A02CGCGCGACNONE
J065178B01CGCGCGACNONE
J065195M21CGCGCGACNONE
Os04g0535200012-036-D08CGCGCGAGNONE
AK060585CGCGCGAGNONE
AK101505CGCGCGAGNONE
AK119767CGCGCGAGPeptidase A1, pepsin family protein.
J033044F04CGCGCGAGNONE
J065167K19CGCGCGAGNONE
J075017H22CGCGCGAGNONE
J075180E03CGCGCGAGNONE
J080025H04CGCGCGAGNONE
J080026P04CGCGCGAGNONE
J080029A01CGCGCGAGNONE
J080034L18CGCGCGAGNONE
J080038J07CGCGCGAGNONE
J080053L24CGCGCGAGNONE
J080071P08CGCGCGAGNONE
J080093F09CGCGCGAGNONE
Os04g0542000J090086F02CTCGCGCGNONE
Os04g0562100AK060598CGCGCGAGAmino acid/polyamine transporter II family protein.
Os04g0587300AK119483GCGCGCGACSimilar to Purine permease-like protein.
Os04g0589600011-100-F04GCGCGCGACNONE
AK061833GCGCGCGACGlycosyl transferase, group 1 domain containing protein.
AK098964GCGCGCGACNONE
AK100053GCGCGCGACNONE
Os04g0593200J100032B06CTCGCGCGSimilar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4).
J100049K04CTCGCGCGNONE
Os04g0594100014-046-H12CACCTGTCGCGCGCNONE
014-049-F01CACCTGTCGCGCGCNONE
AK111960CACCTGTCGCGCGCSimilar to P-type R2R3 Myb protein (Fragment).
Os04g0602800AK100925GCGCGCGAGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica.
Os04g0612100AK060663CGCGCGACSimilar to Beta-1,3-glucanase-like protein.
AK060663CGCGCGAGSimilar to Beta-1,3-glucanase-like protein.
Os04g0612500003-117-H11GCGCGCGACNONE
AK062295GCGCGCGACSimilar to Prolin rich protein.
Os04g0612800016-010-G05CGCGCGACNONE
AK071230CGCGCGACProtein prenyltransferase domain containing protein.
Os04g0623800AK059270CGCGTCGCGCGCNONE
AK099234CGCGTCGCGCGCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT).
Os04g0635000009-031-A05GCGCGCGAGNONE
009-031-A05GTCGCGCGAGNONE
009-074-F05GCGCGCGAGNONE
009-074-F05GTCGCGCGAGNONE
009-163-H03GCGCGCGAGNONE
009-163-H03GTCGCGCGAGNONE
AK062619GCGCGCGAGConserved hypothetical protein.
AK062619GTCGCGCGAGConserved hypothetical protein.
Os04g0639100009-158-D03GTCGCGCGNONE
AK063036GTCGCGCGConserved hypothetical protein.
J075045D14GTCGCGCGNONE
J075047L16GTCGCGCGNONE
J075048D20GTCGCGCGNONE
J075056E20GTCGCGCGNONE
J075074E14GTCGCGCGNONE
J075108F16GTCGCGCGNONE
J075143L19GTCGCGCGNONE
J075146L07GTCGCGCGNONE
J075158I04GTCGCGCGNONE
J075172B20GTCGCGCGNONE
J090061M08GTCGCGCGNONE
Os04g0661200AK102842GCGCGCGAGProtein of unknown function DUF941 family protein.
J033075E19GCGCGCGAGNONE
J033109O19GCGCGCGAGNONE
J065002J12GCGCGCGAGNONE
J065026E22GCGCGCGAGNONE
J065061F05GCGCGCGAGNONE
J065068D22GCGCGCGAGNONE
J065072N14GCGCGCGAGNONE
J065085F02GCGCGCGAGNONE
J075055G19GCGCGCGAGNONE
J075105B14GCGCGCGAGNONE
J075118M17GCGCGCGAGNONE
J075193H02GCGCGCGAGNONE
J100040O05GCGCGCGAGNONE
J100064I04GCGCGCGAGNONE
Os04g0667600009-131-H09CGCGCGACNONE
009-200-A04CGCGCGACNONE
AK068657CGCGCGACHeavy metal transport/detoxification protein domain containing protein.
J065013M12CGCGCGACNONE
J065024H17CGCGCGACNONE
J065025P10CGCGCGACNONE
J065028I11CGCGCGACNONE
J065044K11CGCGCGACNONE
J065045B14CGCGCGACNONE
J065052B02CGCGCGACNONE
J065061F20CGCGCGACNONE
J065061K16CGCGCGACNONE
J065063E12CGCGCGACNONE
J065065E16CGCGCGACNONE
J065082M02CGCGCGACNONE
J065084O10CGCGCGACNONE
J065096H18CGCGCGACNONE
J065122F02CGCGCGACNONE
J065131F09CGCGCGACNONE
J065139P06CGCGCGACNONE
J065148L17CGCGCGACNONE
J065164D23CGCGCGACNONE
J065167M17CGCGCGACNONE
J065174B15CGCGCGACNONE
J065176G01CGCGCGACNONE
J065186K17CGCGCGACNONE
J065186N05CGCGCGACNONE
J065213N24CGCGCGACNONE
J075001P17CGCGCGACNONE
J075004A15CGCGCGACNONE
J075007B03CGCGCGACNONE
J075026D23CGCGCGACNONE
J075032D17CGCGCGACNONE
J075058C22CGCGCGACNONE
J075080L14CGCGCGACNONE
J075094K18CGCGCGACNONE
J075097K15CGCGCGACNONE
J075098E02CGCGCGACNONE
J075104D11CGCGCGACNONE
J075120L16CGCGCGACNONE
J075126A18CGCGCGACNONE
J075129M08CGCGCGACNONE
J075143N14CGCGCGACNONE
J075146D07CGCGCGACNONE
J075149L10CGCGCGACNONE
J075171F22CGCGCGACNONE
J090058C05CGCGCGACNONE
J100018N19CGCGCGACNONE
J100024K09CGCGCGACNONE
J100036F15CGCGCGACNONE
J100042A15CGCGCGACNONE
J100042P14CGCGCGACNONE
J100051N18CGCGCGACNONE
J100055K14CGCGCGACNONE
J100056F05CGCGCGACNONE
J100058L10CGCGCGACNONE
J100083J17CGCGCGACNONE
J100086N07CGCGCGACNONE
Os04g0679400004-018-E07GCGCGCGAGNONE
006-039-G08GCGCGCGAGNONE
006-045-D06GCGCGCGAGNONE
006-048-B12GCGCGCGAGNONE
006-061-C05GCGCGCGAGNONE
006-062-A03GCGCGCGAGNONE
006-063-A06GCGCGCGAGNONE
006-066-B04GCGCGCGAGNONE
006-068-H12GCGCGCGAGNONE
006-075-C08GCGCGCGAGNONE
006-076-A02GCGCGCGAGNONE
006-083-B04GCGCGCGAGNONE
006-090-F04GCGCGCGAGNONE
006-099-H12GCGCGCGAGNONE
006-105-F10GCGCGCGAGNONE
006-106-G03GCGCGCGAGNONE
006-107-B05GCGCGCGAGNONE
006-108-F06GCGCGCGAGNONE
006-109-E09GCGCGCGAGNONE
006-111-B02GCGCGCGAGNONE
006-113-C10GCGCGCGAGNONE
009-128-G11GCGCGCGAGNONE
009-150-B02GCGCGCGAGNONE
009-156-E08GCGCGCGAGNONE
012-015-E07GCGCGCGAGNONE
012-027-B04GCGCGCGAGNONE
012-030-A03GCGCGCGAGNONE
012-066-E06GCGCGCGAGNONE
012-083-A09GCGCGCGAGNONE
012-088-E07GCGCGCGAGNONE
012-097-F08GCGCGCGAGNONE
013-010-D04GCGCGCGAGNONE
013-012-A01GCGCGCGAGNONE
013-016-D04GCGCGCGAGNONE
013-041-B01GCGCGCGAGNONE
013-043-F10GCGCGCGAGNONE
013-047-C12GCGCGCGAGNONE
013-058-E10GCGCGCGAGNONE
013-063-B07GCGCGCGAGNONE
013-076-A01GCGCGCGAGNONE
013-081-D04GCGCGCGAGNONE
013-090-D05GCGCGCGAGNONE
013-091-B07GCGCGCGAGNONE
014-030-A04GCGCGCGAGNONE
014-055-A04GCGCGCGAGNONE
014-070-A04GCGCGCGAGNONE
015-033-C10GCGCGCGAGNONE
015-040-H10GCGCGCGAGNONE
016-006-F03GCGCGCGAGNONE
016-090-B03GCGCGCGAGNONE
AK065314GCGCGCGAGNONE
AK068608GCGCGCGAGNONE
AK099009GCGCGCGAGNONE
AK099087GCGCGCGAGNONE
AK099368GCGCGCGAGNONE
AK099653GCGCGCGAGNONE
AK099975GCGCGCGAGNONE
AK104249GCGCGCGAGNONE
AK104376GCGCGCGAGNONE
AK106133GCGCGCGAGNONE
AK119666GCGCGCGAGNONE
AK120508GCGCGCGAGNONE
AK121152GCGCGCGAGSimilar to Ripening-associated protein (Fragment).
J013002O24GCGCGCGAGNONE
J013023H15GCGCGCGAGNONE
J013036E15GCGCGCGAGNONE
J013042D22GCGCGCGAGNONE
J013045A07GCGCGCGAGNONE
J013056D24GCGCGCGAGNONE
J013057D10GCGCGCGAGNONE
J013059B08GCGCGCGAGNONE
J013059D01GCGCGCGAGNONE
J013060C02GCGCGCGAGNONE
J013070N22GCGCGCGAGNONE
J013071K02GCGCGCGAGNONE
J013073G04GCGCGCGAGNONE
J013096J17GCGCGCGAGNONE
J013098G08GCGCGCGAGNONE
J013123H02GCGCGCGAGNONE
J013135I23GCGCGCGAGNONE
J013149G08GCGCGCGAGNONE
J013155N04GCGCGCGAGNONE
J013156C23GCGCGCGAGNONE
J013157C07GCGCGCGAGNONE
J013157D23GCGCGCGAGNONE
J023001K19GCGCGCGAGNONE
J023002H21GCGCGCGAGNONE
J023003H14GCGCGCGAGNONE
J023006D09GCGCGCGAGNONE
J023010E07GCGCGCGAGNONE
J023014E18GCGCGCGAGNONE
J023024G16GCGCGCGAGNONE
J023034F13GCGCGCGAGNONE
J023034F17GCGCGCGAGNONE
J023045C18GCGCGCGAGNONE
J023058P17GCGCGCGAGNONE
J023061H18GCGCGCGAGNONE
J023064H05GCGCGCGAGNONE
J023078J16GCGCGCGAGNONE
J023079L03GCGCGCGAGNONE
J023085N10GCGCGCGAGNONE
J023087G10GCGCGCGAGNONE
J023088I02GCGCGCGAGNONE
J023093K24GCGCGCGAGNONE
J023095H05GCGCGCGAGNONE
J023097C02GCGCGCGAGNONE
J023101P15GCGCGCGAGNONE
J023106C22GCGCGCGAGNONE
J023121B08GCGCGCGAGNONE
J023121N13GCGCGCGAGNONE
J023123F01GCGCGCGAGNONE
J023128E14GCGCGCGAGNONE
J023128M11GCGCGCGAGNONE
J023135L14GCGCGCGAGNONE
J023141H20GCGCGCGAGNONE
J023150A12GCGCGCGAGNONE
J033035G16GCGCGCGAGNONE
J033037N04GCGCGCGAGNONE
J033041D20GCGCGCGAGNONE
J033052O07GCGCGCGAGNONE
J033061D19GCGCGCGAGNONE
J033068M01GCGCGCGAGNONE
J033090I15GCGCGCGAGNONE
J033103G06GCGCGCGAGNONE
J033117F16GCGCGCGAGNONE
J033120H02GCGCGCGAGNONE
J033126N05GCGCGCGAGNONE
J033136C13GCGCGCGAGNONE
J033139H08GCGCGCGAGNONE
J043024N03GCGCGCGAGNONE
J043027G07GCGCGCGAGNONE
J065103L02GCGCGCGAGNONE
J065108G02GCGCGCGAGNONE
J065175N11GCGCGCGAGNONE
J080003B03GCGCGCGAGNONE
J080007J02GCGCGCGAGNONE
J080008D02GCGCGCGAGNONE
J080008E04GCGCGCGAGNONE
J080015H20GCGCGCGAGNONE
J080017J09GCGCGCGAGNONE
J080020O09GCGCGCGAGNONE
J080021F06GCGCGCGAGNONE
J080027L11GCGCGCGAGNONE
J080028J11GCGCGCGAGNONE
J080030G17GCGCGCGAGNONE
J080035E09GCGCGCGAGNONE
J080035F20GCGCGCGAGNONE
J080036H18GCGCGCGAGNONE
J080039M19GCGCGCGAGNONE
J080042A21GCGCGCGAGNONE
J080043A07GCGCGCGAGNONE
J080052A16GCGCGCGAGNONE
J080055G22GCGCGCGAGNONE
J080061O12GCGCGCGAGNONE
J080062I05GCGCGCGAGNONE
J080068K18GCGCGCGAGNONE
J080070G01GCGCGCGAGNONE
J080077F11GCGCGCGAGNONE
J080079N14GCGCGCGAGNONE
J080084G11GCGCGCGAGNONE
J080093C04GCGCGCGAGNONE
J090056G10GCGCGCGAGNONE
J090091H01GCGCGCGAGNONE
J100025J03GCGCGCGAGNONE
J100027L16GCGCGCGAGNONE
J100030B22GCGCGCGAGNONE
J100048H23GCGCGCGAGNONE
J100050C24GCGCGCGAGNONE
J100055F22GCGCGCGAGNONE
J100057L08GCGCGCGAGNONE
J100065E17GCGCGCGAGNONE
J100072C03GCGCGCGAGNONE
Os04g0686700AK105746CGCGCGAGKelch repeat containing protein.
J065021K04CGCGCGAGNONE
J065097E18CGCGCGAGNONE
J075004C12CGCGCGAGNONE
J080301H10CGCGCGAGNONE
J090087N02CGCGCGAGNONE
J100060E19CGCGCGAGNONE
Os04g0688200011-046-G12CGCGCGACNONE
AK103558CGCGCGACSimilar to Peroxidase (EC 1.11.1.7).
J033023B21CGCGCGACNONE
J033060E20CGCGCGACNONE
J033079N12CGCGCGACNONE
J033132H20CGCGCGACNONE
J100018D11CGCGCGACNONE
J100028D18CGCGCGACNONE
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein.
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
Os05g0151200J065041L18CGCGCGAGTspO/MBR-related protein family protein.
J065168L08CGCGCGAGNONE
Os05g0186300AK070360ACCCGCGCGACSimilar to NADP-malic enzyme.
AK099249ACCCGCGCGACNONE
AY435404ACCCGCGCGACNONE
J023006D11ACCCGCGCGACNONE
J023059P07ACCCGCGCGACNONE
Os05g0190300004-005-C08GCGCGCGACNONE
006-025-C01GCGCGCGACNONE
006-027-F06GCGCGCGACNONE
006-028-B04GCGCGCGACNONE
006-035-C02GCGCGCGACNONE
006-036-C11GCGCGCGACNONE
006-041-A01GCGCGCGACNONE
006-045-D03GCGCGCGACNONE
006-054-D06GCGCGCGACNONE
006-059-H03GCGCGCGACNONE
006-064-A07GCGCGCGACNONE
006-064-D09GCGCGCGACNONE
006-066-C11GCGCGCGACNONE
006-074-H09GCGCGCGACNONE
006-079-D01GCGCGCGACNONE
006-084-A12GCGCGCGACNONE
006-089-A10GCGCGCGACNONE
006-090-A09GCGCGCGACNONE
006-096-C06GCGCGCGACNONE
006-102-E03GCGCGCGACNONE
006-109-B09GCGCGCGACNONE
006-115-D12GCGCGCGACNONE
AK061507GCGCGCGACNONE
AK104180GCGCGCGACNONE
AK104252GCGCGCGACNONE
AK104267GCGCGCGACNONE
AK104355GCGCGCGACNONE
AK106112GCGCGCGACNONE
AK119190GCGCGCGACAcid phosphatase (Class B) family protein.
J013088K07GCGCGCGACNONE
J013110D12GCGCGCGACNONE
J013118F19GCGCGCGACNONE
J013124A02GCGCGCGACNONE
J013135I19GCGCGCGACNONE
J023027C12GCGCGCGACNONE
J023063O08GCGCGCGACNONE
J023122E16GCGCGCGACNONE
J023150C11GCGCGCGACNONE
J065035F03GCGCGCGACNONE
J065057B06GCGCGCGACNONE
Os05g0194900AK071798GTCGCGCGSimilar to Pyrophosphate-fructose-6-phosphate 1-phosphotransferase-like protein (Pyrophosphate-dependent phosphofructo-1-kinase-like protein).
J023112B14GTCGCGCGNONE
Os05g0195200015-031-H09CGCGCGAGNONE
015-070-C11CGCGCGAGNONE
016-063-C11CGCGCGAGNONE
AK106392CGCGCGAGZinc finger, CCCH-type domain containing protein.
J033051N05CGCGCGAGNONE
J065118P05CGCGCGAGNONE
J100071H15CGCGCGAGNONE
J100078J22CGCGCGAGNONE
Os05g0349800011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1.
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE
Os05g0361700AJ575218GAGACGCGCGACGCGNONE
AK100184GAGACGCGCGACGCGSimilar to EREBP-2 protein (Fragment).
AK111676GAGACGCGCGACGCGNONE
J013155B14GAGACGCGCGACGCGNONE
J065073N01GAGACGCGCGACGCGNONE
J065161J12GAGACGCGCGACGCGNONE
J075074A07GAGACGCGCGACGCGNONE
J100029H13GAGACGCGCGACGCGNONE
Os05g0388500AK065313CCCCCGCGACGCGCGAGSimilar to 50S ribosomal protein L1.
AK098990CCCCCGCGACGCGCGAGNONE
AK104689CCCCCGCGACGCGCGAGNONE
J013094L23CCCCCGCGACGCGCGAGNONE
J065118O04CCCCCGCGACGCGCGAGNONE
Os05g0388600AK105904CTCGCGCGConserved hypothetical protein.
AK105904GTCGCGCGAGConserved hypothetical protein.
Os05g0392200013-072-B10GTCGCGCGCNONE
AK063603GTCGCGCGCGeneric methyltransferase domain containing protein.
J065116F18GTCGCGCGCNONE
J075112N20GTCGCGCGCNONE
J075136D16GTCGCGCGCNONE
J090090O10GTCGCGCGCNONE
J090091G05GTCGCGCGCNONE
Os05g0397700AK067298GCGCGCGACACGTGSecY protein family protein.
Os05g0406800AK062566CGCGCGAGNONE
AK099640CGCGCGAGLeucine rich repeat, N-terminal domain containing protein.
J013060B14CGCGCGAGNONE
J090013F14CGCGCGAGNONE
J090062E13CGCGCGAGNONE
J090063D09CGCGCGAGNONE
J090075H10CGCGCGAGNONE
J090096E22CGCGCGAGNONE
Os05g0407100AK063349CGCGTCGCGCGCFour F5 protein family protein.
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein.
J065182F20GCGGGCCCCACGCGCGACGCNONE
Os05g0424800AK121054CTCGCGCGSimilar to AER274Wp.
AK121054CTCGCGCGTCGCGTCSimilar to AER274Wp.
J023055P22CTCGCGCGNONE
J023055P22CTCGCGCGTCGCGTCNONE
J023102M21CTCGCGCGNONE
J023102M21CTCGCGCGTCGCGTCNONE
J033088E13CTCGCGCGNONE
J033088E13CTCGCGCGTCGCGTCNONE
J033123K17CTCGCGCGNONE
J033123K17CTCGCGCGTCGCGTCNONE
J065176L18CTCGCGCGNONE
J065176L18CTCGCGCGTCGCGTCNONE
J075002F14CTCGCGCGNONE
J075002F14CTCGCGCGTCGCGTCNONE
J075005E10CTCGCGCGNONE
J075005E10CTCGCGCGTCGCGTCNONE
J075005K21CTCGCGCGNONE
J075005K21CTCGCGCGTCGCGTCNONE
J075007A18CTCGCGCGNONE
J075007A18CTCGCGCGTCGCGTCNONE
J075021J16CTCGCGCGNONE
J075021J16CTCGCGCGTCGCGTCNONE
J075040K11CTCGCGCGNONE
J075040K11CTCGCGCGTCGCGTCNONE
J075061A14CTCGCGCGNONE
J075061A14CTCGCGCGTCGCGTCNONE
J075106H07CTCGCGCGNONE
J075106H07CTCGCGCGTCGCGTCNONE
J075109M22CTCGCGCGNONE
J075109M22CTCGCGCGTCGCGTCNONE
J075121O13CTCGCGCGNONE
J075121O13CTCGCGCGTCGCGTCNONE
J075132M08CTCGCGCGNONE
J075132M08CTCGCGCGTCGCGTCNONE
J075153B19CTCGCGCGNONE
J075153B19CTCGCGCGTCGCGTCNONE
J075158L15CTCGCGCGNONE
J075158L15CTCGCGCGTCGCGTCNONE
J075187G20CTCGCGCGNONE
J075187G20CTCGCGCGTCGCGTCNONE
J100079N17CTCGCGCGNONE
J100079N17CTCGCGCGTCGCGTCNONE
Os05g0429900AK066834CTCGCGCGCNONE
AK099108CTCGCGCGCNONE
AK104053CTCGCGCGCNONE
D88617CTCGCGCGCSimilar to MybHv5 (Fragment).
J090031E22CTCGCGCGCNONE
Os05g0444200AK102658CGCGCGACGCSimilar to T6J4.5 protein (WIP6 protein).
AK102658CTCGCGCGCACGCGSimilar to T6J4.5 protein (WIP6 protein).
Os05g0455500AK101985CTCGCGCGNONE
AK102633CTCGCGCGDelta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
AY574031CTCGCGCGNONE
D49714CTCGCGCGNONE
J013002F07CTCGCGCGNONE
J033085C02CTCGCGCGNONE
Os05g0465100AK065821CGCACCGCGCGCGACRabGAP/TBC domain containing protein.
Os05g0467300006-113-H02CGCGCGACNONE
AK061873CGCGCGACSelT/selW/selH selenoprotein family protein.
AK098945CGCGCGACNONE
J013050H09CGCGCGACNONE
J023108B17CGCGCGACNONE
J065189J01CGCGCGACNONE
J075011H05CGCGCGACNONE
J075019G20CGCGCGACNONE
Os05g0478000AK111029CTCGCGCGCZinc finger, RING-type domain containing protein.
Os05g0499800016-065-G04GTCGCGCGCCACGTCNONE
AK064392GTCGCGCGCCACGTCNONE
AK103146GTCGCGCGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
J023075J11GTCGCGCGCCACGTCNONE
J033120I02GTCGCGCGCCACGTCNONE
Os05g0510100Os05g0510100CGCGCGAGProtein of unknown function DUF567 family protein.
Os05g0510700AK070308CTCGCGCGCBSD domain containing protein.
Os05g0533500Os05g0533500GTCGCGCGCSimilar to Serine acetyltransferase.
Os05g0534400AK101368CTCGCGCGSimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein).
J033035L13CTCGCGCGNONE
J065045H07CTCGCGCGNONE
Os05g0555300009-032-C03CGTGTGGCGCGCGAGNONE
009-125-E08CGTGTGGCGCGCGAGNONE
009-149-C12CGTGTGGCGCGCGAGNONE
009-172-C01CGTGTGGCGCGCGAGNONE
AK062890CGTGTGGCGCGCGAGFerredoxin domain containing protein.
AK062997CGTGTGGCGCGCGAGNONE
Os05g0569400AK100553CTCGCGCGAldose 1-epimerase family protein.
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase.
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE
Os06g0101600AF093636GCGCGCGACNONE
AK070447GCGCGCGACPlastocyanin, chloroplast precursor.
J065001A20GCGCGCGACNONE
J065019M17GCGCGCGACNONE
J065021H18GCGCGCGACNONE
J065061A17GCGCGCGACNONE
J065073L02GCGCGCGACNONE
J065099F17GCGCGCGACNONE
J065101C23GCGCGCGACNONE
J065121E23GCGCGCGACNONE
J065122N04GCGCGCGACNONE
J065141N05GCGCGCGACNONE
J065143N21GCGCGCGACNONE
J065161H09GCGCGCGACNONE
J065161J04GCGCGCGACNONE
J065162P20GCGCGCGACNONE
J065182K10GCGCGCGACNONE
J065184M05GCGCGCGACNONE
J065186H24GCGCGCGACNONE
J065189G21GCGCGCGACNONE
J065190N14GCGCGCGACNONE
J065191H08GCGCGCGACNONE
J065205H17GCGCGCGACNONE
J075001E03GCGCGCGACNONE
J075001H21GCGCGCGACNONE
J075003J23GCGCGCGACNONE
J075003K01GCGCGCGACNONE
J075005I11GCGCGCGACNONE
J075007F16GCGCGCGACNONE
J075017I11GCGCGCGACNONE
J075018O05GCGCGCGACNONE
J075019G24GCGCGCGACNONE
J075032D04GCGCGCGACNONE
J075032N13GCGCGCGACNONE
J075033C09GCGCGCGACNONE
J075033D11GCGCGCGACNONE
J075039A20GCGCGCGACNONE
J075058P12GCGCGCGACNONE
J075062E10GCGCGCGACNONE
J075062P16GCGCGCGACNONE
J075063C17GCGCGCGACNONE
J075066E07GCGCGCGACNONE
J075066I20GCGCGCGACNONE
J075075K21GCGCGCGACNONE
J075078F03GCGCGCGACNONE
J075082F10GCGCGCGACNONE
J075086G16GCGCGCGACNONE
J075087E07GCGCGCGACNONE
J075087K06GCGCGCGACNONE
J075087L04GCGCGCGACNONE
J075088B16GCGCGCGACNONE
J075088D02GCGCGCGACNONE
J075094H21GCGCGCGACNONE
J075094I24GCGCGCGACNONE
J075094K10GCGCGCGACNONE
J075095C18GCGCGCGACNONE
J075097B05GCGCGCGACNONE
J075099C13GCGCGCGACNONE
J075099H22GCGCGCGACNONE
J075099L16GCGCGCGACNONE
J075104K08GCGCGCGACNONE
J075118O06GCGCGCGACNONE
J075119E15GCGCGCGACNONE
J075124N06GCGCGCGACNONE
J075126G02GCGCGCGACNONE
J075127L24GCGCGCGACNONE
J075131E23GCGCGCGACNONE
J075140H06GCGCGCGACNONE
J075146I20GCGCGCGACNONE
J075146N24GCGCGCGACNONE
J075147I19GCGCGCGACNONE
J075155K07GCGCGCGACNONE
J075156C05GCGCGCGACNONE
J075161G07GCGCGCGACNONE
J075164G01GCGCGCGACNONE
J075170J18GCGCGCGACNONE
J075172G17GCGCGCGACNONE
J075176G10GCGCGCGACNONE
J075178C05GCGCGCGACNONE
J075179G01GCGCGCGACNONE
J075181E24GCGCGCGACNONE
J080029D19GCGCGCGACNONE
J080034L11GCGCGCGACNONE
J080039G07GCGCGCGACNONE
J080062M23GCGCGCGACNONE
J080302A01GCGCGCGACNONE
J100042I15GCGCGCGACNONE
J100043G22GCGCGCGACNONE
J100056L12GCGCGCGACNONE
J100061A12GCGCGCGACNONE
J100073O20GCGCGCGACNONE
J100082I08GCGCGCGACNONE
Os06g0163200AK068888CTCGCGCGCEsterase/lipase/thioesterase domain containing protein.
J023001E15CTCGCGCGCNONE
J075100H16CTCGCGCGCNONE
J075138N07CTCGCGCGCNONE
Os06g0166500016-094-H06CTCGCGCGCNONE
AK102541CTCGCGCGCSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20).
Os06g0168800AK111753GCGCGCGAGSimilar to Protein kinase.
Os06g0184300AK102933CGCGCGAGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
Os06g0199100AK120323GAGACGCGCGAGProtein prenyltransferase domain containing protein.
Os06g0211200011-063-B02GCGCGCGACNONE
AK103188GCGCGCGACSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 1) (AREB1).
AK105312GCGCGCGACNONE
J065214N03GCGCGCGACNONE
J090046C13GCGCGCGACNONE
J090049L03GCGCGCGACNONE
J100074P03GCGCGCGACNONE
Os06g0215500AK108079CGCGCGAGSimilar to Oxo-phytodienoic acid reductase.
Os06g0219900AK058704GTCGCGCGCSimilar to Phi-1 protein.
Os06g0220500011-038-H05GCGCGCGACNONE
011-086-F05GCGCGCGACNONE
AK063324GCGCGCGACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
J100040M16GCGCGCGACNONE
Os06g0220600AK058664CTCGCGCGConserved hypothetical protein.
J075096L21CTCGCGCGNONE
Os06g0268800AK120796GCGCGCGAGProtein of unknown function UPF0005 family protein.
Os06g0274500AK066417TCGCGCGCGAGSimilar to SERK1 (Fragment).
Os06g0320000009-030-C04CTCGCGCGNONE
009-135-F08CTCGCGCGNONE
J075103B05CTCGCGCGProtein of unknown function DUF953, thioredoxin-like family protein.
J075187J24CTCGCGCGNONE
Os06g0348800AF318581GCGCGCGACCGGCCCNONE
AK061946GCGCGCGACCGGCCCNONE
AK065184GCGCGCGACCGGCCCNONE
AK098909GCGCGCGACCGGCCCNONE
AK098915GCGCGCGACCGGCCCHomeodomain-like containing protein.
AK122161GCGCGCGACCGGCCCNONE
J013002D22GCGCGCGACCGGCCCNONE
J013002F22GCGCGCGACCGGCCCNONE
J013002I19GCGCGCGACCGGCCCNONE
J013022A07GCGCGCGACCGGCCCNONE
J013135J08GCGCGCGACCGGCCCNONE
J033147G01GCGCGCGACCGGCCCNONE
J075012G19GCGCGCGACCGGCCCNONE
J075049L03GCGCGCGACCGGCCCNONE
J075068G02GCGCGCGACCGGCCCNONE
J075145E15GCGCGCGACCGGCCCNONE
J075145J09GCGCGCGACCGGCCCNONE
J075155B11GCGCGCGACCGGCCCNONE
J075173E22GCGCGCGACCGGCCCNONE
J075180B11GCGCGCGACCGGCCCNONE
J075195D12GCGCGCGACCGGCCCNONE
Os06g0553100J065130H10CGCGCGACACGTNONE
J075102G23CGCGCGACACGTNONE
J075147H23CGCGCGACACGTHeat shock factor (HSF)-type, DNA-binding domain containing protein.
Os06g0556600AK072511GTCGCGCGCSimilar to Pollen allergen Phl p 11.
J023077F02GTCGCGCGCNONE
J023132A12GTCGCGCGCNONE
Os06g0574200Os06g0574200CTCGCGCGCGAUspA domain containing protein.
Os06g0593100AK060274GCGCGCGACSimilar to UDP-galactose/UDP-glucose transporter.
AK071175GCGCGCGACNONE
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog.
J023066J03GTCGCGTCGCGCGCNONE
Os06g0633100AK107791GCGCGCGACGCGConserved hypothetical protein.
J065001N11GCGCGCGACGCGNONE
Os06g0656800AK109762GCGCGCGACBeta-Ig-H3/fasciclin domain containing protein.
Os06g0678800AK071465CGCGCGACSimilar to Pollen-specific protein NTP303 precursor.
Os06g0698300AK071637CGCGCGAGProtein phosphatase 2C family protein.
J023098M15CGCGCGAGNONE
J023101G03CGCGCGAGNONE
J023139A04CGCGCGAGNONE
Os06g0713300J065143C11CTCGCGCGNONE
Os07g0133500015-010-H05CTCGCGCGNONE
AB110179CTCGCGCGNONE
AK106244CTCGCGCGProtein of unknown function DUF1005 family protein.
J090075I21CTCGCGCGNONE
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein.
Os07g0141400003-129-D08GCGCGCGACNONE
006-021-E02GCGCGCGACNONE
006-025-C06GCGCGCGACNONE
006-027-H11GCGCGCGACNONE
006-036-C05GCGCGCGACNONE
006-046-D07GCGCGCGACNONE
006-047-A02GCGCGCGACNONE
006-050-F02GCGCGCGACNONE
006-053-D07GCGCGCGACNONE
006-054-E06GCGCGCGACNONE
006-055-E01GCGCGCGACNONE
006-055-F01GCGCGCGACNONE
006-056-H12GCGCGCGACNONE
006-057-D07GCGCGCGACNONE
006-074-G10GCGCGCGACNONE
006-077-C02GCGCGCGACNONE
006-081-E01GCGCGCGACNONE
006-089-B08GCGCGCGACNONE
006-089-C10GCGCGCGACNONE
006-092-E07GCGCGCGACNONE
006-096-C11GCGCGCGACNONE
006-096-H06GCGCGCGACNONE
006-097-E07GCGCGCGACNONE
006-098-D03GCGCGCGACNONE
006-102-C05GCGCGCGACNONE
006-107-E09GCGCGCGACNONE
006-110-C09GCGCGCGACNONE
006-113-C01GCGCGCGACNONE
006-114-D09GCGCGCGACNONE
006-115-H06GCGCGCGACNONE
009-016-G06GCGCGCGACNONE
009-031-C05GCGCGCGACNONE
009-060-B05GCGCGCGACNONE
009-123-H12GCGCGCGACNONE
009-154-B09GCGCGCGACNONE
009-172-F07GCGCGCGACNONE
009-193-A04GCGCGCGACNONE
AF022732GCGCGCGACNONE
AF052203GCGCGCGACNONE
AK065248GCGCGCGACSimilar to 23 kDa polypeptide of photosystem II.
AK104722GCGCGCGACNONE
D49713GCGCGCGACNONE
J013002J02GCGCGCGACNONE
J065051O13GCGCGCGACNONE
J065066J18GCGCGCGACNONE
J065077G23GCGCGCGACNONE
J065162C22GCGCGCGACNONE
J065162G22GCGCGCGACNONE
J075091B13GCGCGCGACNONE
J075099J22GCGCGCGACNONE
J100056O22GCGCGCGACNONE
J100059E01GCGCGCGACNONE
J100079F20GCGCGCGACNONE
Os07g0191600AK071418GTCGCGCGCNONE
AK071418GTCGCGCGCNONE
AK102563GTCGCGCGCNONE
AK102563GTCGCGCGCNONE
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment).
AK103768ACCCGCGCGACGTGGGGCCCACGCNONE
Os07g0240300AK072205CGCGCGACGCConserved hypothetical protein.
AK098977CGCGCGACGCNONE
Os07g0262950J033120B02CGCGCGACGCGTGGConserved hypothetical protein.
J075040G05CGCGCGACGCGTGGNONE
J075160F23CGCGCGACGCGTGGNONE
Os07g0414800AK108552CTCGCGCGCF-actin capping protein, alpha subunit family protein.
Os07g0456900AK101301CTCGCGCGNo apical meristem (NAM) protein domain containing protein.
J033033K06CTCGCGCGNONE
Os07g0501900AK067791CGCGCGACNONE
Os07g0502200006-027-C06CCCCCGCGCGCGACNONE
012-007-C05CCCCCGCGCGCGACNONE
AK120682CCCCCGCGCGCGACMulti antimicrobial extrusion protein MatE family protein.
J053045G13CCCCCGCGCGCGACNONE
J053064I18CCCCCGCGCGCGACNONE
J053091G24CCCCCGCGCGCGACNONE
J065016E10CCCCCGCGCGCGACNONE
J065021B18CCCCCGCGCGCGACNONE
J065022A17CCCCCGCGCGCGACNONE
J065059D18CCCCCGCGCGCGACNONE
J065063N19CCCCCGCGCGCGACNONE
J065065O10CCCCCGCGCGCGACNONE
J065196F12CCCCCGCGCGCGACNONE
J065208I01CCCCCGCGCGCGACNONE
J065218G15CCCCCGCGCGCGACNONE
J100040G01CCCCCGCGCGCGACNONE
J100060M03CCCCCGCGCGCGACNONE
J100061P09CCCCCGCGCGCGACNONE
J100065P05CCCCCGCGCGCGACNONE
Os07g0529000011-012-E06GCGCGCGAGNONE
011-054-G04GCGCGCGAGNONE
016-094-D08GCGCGCGAGNONE
AK063353GCGCGCGAGSimilar to Isocitrate lyase (Fragment).
AK103744GCGCGCGAGNONE
J065022H24GCGCGCGAGNONE
J065040B11GCGCGCGAGNONE
J065053J07GCGCGCGAGNONE
J065057K21GCGCGCGAGNONE
J065063M16GCGCGCGAGNONE
J065073G06GCGCGCGAGNONE
J065158H07GCGCGCGAGNONE
J065159C23GCGCGCGAGNONE
J065184F18GCGCGCGAGNONE
J065184K08GCGCGCGAGNONE
J065192A11GCGCGCGAGNONE
J065199L23GCGCGCGAGNONE
J065212K16GCGCGCGAGNONE
J075002I18GCGCGCGAGNONE
J075055G16GCGCGCGAGNONE
J075112H09GCGCGCGAGNONE
J075199I10GCGCGCGAGNONE
Os07g0543750J013059L18CGCGCGAGNONE
J013060O22CGCGCGAGNONE
J013067A13CGCGCGAGNONE
J023135I04CGCGCGAGNONE
J033091F24CGCGCGAGNONE
J033094G15CGCGCGAGConserved hypothetical protein.
Os07g0549600J080302I11GCGCGCGAGGGCGAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
J080304E08GCGCGCGAGGGCGAGGNONE
J080306P15GCGCGCGAGGGCGAGGNONE
J080312F02GCGCGCGAGGGCGAGGNONE
J080316C13GCGCGCGAGGGCGAGGNONE
J080316K21GCGCGCGAGGGCGAGGNONE
J080319K19GCGCGCGAGGGCGAGGNONE
Os07g0558000AK069272GTCGCGCGCNONE
AK101867GTCGCGCGCABC-1 domain containing protein.
Os07g0565800009-114-F12CGCGCGACGCNONE
009-114-F12GTCGCGCGCNONE
AK062834CGCGCGACGCConserved hypothetical protein.
AK062834GTCGCGCGCConserved hypothetical protein.
J065026L16CGCGCGACGCNONE
J065026L16GTCGCGCGCNONE
Os07g0595800011-069-G09CTCGCGCGACNONE
AK066349CTCGCGCGACPrefoldin related, ubiquitously expressed transcript family protein.
J013062C05CTCGCGCGACNONE
Os07g0637300AF323611GCGCGCGAGNONE
AK069157GCGCGCGAGNONE
J023007C01GCGCGCGAGNONE
Os07g0656600006-022-H05CTCGCGCGNONE
AK060061CTCGCGCGRibosomal protein L14b/L23e family protein.
Os07g0657100AK108253CGCGCGACGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein.
J075072F01CGCGCGACNONE
J075078C21CGCGCGACNONE
J075147E12CGCGCGACNONE
J075180N10CGCGCGACNONE
J075197D01CGCGCGACNONE
Os07g0659300AK069789CTCGCGCGCConserved hypothetical protein.
Os07g0673400009-130-B03CGCGCGAGNONE
014-016-A11CGCGCGAGNONE
AF491815CGCGCGAGNONE
AK064061CGCGCGAGUniversal stress protein (Usp) family protein.
AK073356CGCGCGAGNONE
AY224503CGCGCGAGNONE
J033028K22CGCGCGAGNONE
J065010E10CGCGCGAGNONE
Os07g0686600AK108527GTCGCGCGVQ domain containing protein.
Os08g0101100AK069900GCGCGCGAGHigh mobility group box domain containing protein.
Os08g0126700AK111805GTCGCGCGCNONE
AK111902GTCGCGCGCZinc finger, CCCH-type domain containing protein.
Os08g0144100AK071435TCGCGCGCGCGACGCGSimilar to Avr9/Cf-9 rapidly elicited protein 31.
Os08g0163400AB005290GCGCGCGAGAGAGTGGGSigma-70 factor family protein.
AK065997GCGCGCGAGAGAGTGGGNONE
AK071725GCGCGCGAGAGAGTGGGNONE
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2.
AK099083CGCGTCGCGCGCCCAATTNONE
Os08g0244100012-067-B02GTCGCGCGNONE
AK064015GTCGCGCGNONE
AK101898GTCGCGCGNONE
AK102977GTCGCGCGt-snare domain containing protein.
J033071B08GTCGCGCGNONE
J033115N03GTCGCGCGNONE
J065031I08GTCGCGCGNONE
J065091O05GTCGCGCGNONE
J065116E21GTCGCGCGNONE
J065131F08GTCGCGCGNONE
J065196N04GTCGCGCGNONE
J075064N17GTCGCGCGNONE
J075078P10GTCGCGCGNONE
J075108N23GTCGCGCGNONE
J075142C18GTCGCGCGNONE
J075163I12GTCGCGCGNONE
J075177B18GTCGCGCGNONE
J075178A18GTCGCGCGNONE
J075191N04GTCGCGCGNONE
Os08g0327200AK069803GCGCGCGAGVirulence factor, pectin lyase fold family protein.
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein.
Os08g0405700AK108256GCGCGCGAGSimilar to Copper chaperone homolog CCH.
J100052M11GCGCGCGAGNONE
Os08g0425700AK059408CGCGCGACSimilar to Annexin-like protein.
AK104119CGCGCGACNONE
J065063J06CGCGCGACNONE
Os08g0443800AK110630GTCGCGCGCCD9/CD37/CD63 antigen family protein.
Os08g0459600AK071203CTCGCGCGSimilar to 12-oxophytodienoate reductase 3 (EC 1.3.1.42) (12-oxophytodienoate- 10,11-reductase 3) (OPDA-reductase 3) (LeOPR3).
AK104843CTCGCGCGNONE
Os08g0473600011-035-H09CTCGCGCGCNONE
011-052-E06CTCGCGCGCNONE
012-004-D02CTCGCGCGCNONE
012-006-G11CTCGCGCGCNONE
012-025-G01CTCGCGCGCNONE
012-026-E10CTCGCGCGCNONE
012-034-F07CTCGCGCGCNONE
012-038-A04CTCGCGCGCNONE
012-043-A07CTCGCGCGCNONE
012-050-C12CTCGCGCGCNONE
012-060-A06CTCGCGCGCNONE
012-062-A07CTCGCGCGCNONE
012-066-G07CTCGCGCGCNONE
012-067-G12CTCGCGCGCNONE
012-075-F02CTCGCGCGCNONE
012-082-H06CTCGCGCGCNONE
012-088-C08CTCGCGCGCNONE
012-088-D06CTCGCGCGCNONE
012-089-D12CTCGCGCGCNONE
012-091-H05CTCGCGCGCNONE
012-092-C06CTCGCGCGCNONE
012-093-H01CTCGCGCGCNONE
012-100-C09CTCGCGCGCNONE
013-033-C02CTCGCGCGCNONE
014-042-F10CTCGCGCGCNONE
014-050-E03CTCGCGCGCNONE
014-075-F10CTCGCGCGCNONE
015-004-G11CTCGCGCGCNONE
015-005-E07CTCGCGCGCNONE
015-005-G08CTCGCGCGCNONE
015-013-D03CTCGCGCGCNONE
015-013-F04CTCGCGCGCNONE
015-017-D03CTCGCGCGCNONE
015-048-D02CTCGCGCGCNONE
015-049-D02CTCGCGCGCNONE
015-092-F03CTCGCGCGCNONE
016-019-H02CTCGCGCGCNONE
016-027-F03CTCGCGCGCNONE
016-096-D06CTCGCGCGCNONE
AK064071CTCGCGCGCNONE
AK064300CTCGCGCGCAlpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase).
AK103413CTCGCGCGCNONE
AK106526CTCGCGCGCNONE
J033030A15CTCGCGCGCNONE
J033040E10CTCGCGCGCNONE
J033057P15CTCGCGCGCNONE
J033127G12CTCGCGCGCNONE
J033128G11CTCGCGCGCNONE
J053054F05CTCGCGCGCNONE
J065006J19CTCGCGCGCNONE
J065007M11CTCGCGCGCNONE
J065013H10CTCGCGCGCNONE
J065015G17CTCGCGCGCNONE
J065019C10CTCGCGCGCNONE
J065020H22CTCGCGCGCNONE
J065022H12CTCGCGCGCNONE
J065024C08CTCGCGCGCNONE
J065029F11CTCGCGCGCNONE
J065036D04CTCGCGCGCNONE
J065039F22CTCGCGCGCNONE
J065042G09CTCGCGCGCNONE
J065045L16CTCGCGCGCNONE
J065046M13CTCGCGCGCNONE
J065049E18CTCGCGCGCNONE
J065052H21CTCGCGCGCNONE
J065053G17CTCGCGCGCNONE
J065066H10CTCGCGCGCNONE
J065069M24CTCGCGCGCNONE
J065070P07CTCGCGCGCNONE
J065073O06CTCGCGCGCNONE
J065078G19CTCGCGCGCNONE
J065082P16CTCGCGCGCNONE
J065086P15CTCGCGCGCNONE
J065093H11CTCGCGCGCNONE
J065097A14CTCGCGCGCNONE
J065103D19CTCGCGCGCNONE
J065105A18CTCGCGCGCNONE
J065108N23CTCGCGCGCNONE
J065109N14CTCGCGCGCNONE
J065121K22CTCGCGCGCNONE
J065122C18CTCGCGCGCNONE
J065129L03CTCGCGCGCNONE
J065130B11CTCGCGCGCNONE
J065135P07CTCGCGCGCNONE
J065139B03CTCGCGCGCNONE
J065144O11CTCGCGCGCNONE
J065163I17CTCGCGCGCNONE
J065163J15CTCGCGCGCNONE
J065177G16CTCGCGCGCNONE
J065186D17CTCGCGCGCNONE
J065187D02CTCGCGCGCNONE
J065188L03CTCGCGCGCNONE
J065191L02CTCGCGCGCNONE
J065193F09CTCGCGCGCNONE
J065197J03CTCGCGCGCNONE
J065200F07CTCGCGCGCNONE
J065208K11CTCGCGCGCNONE
J065211I22CTCGCGCGCNONE
J065213O22CTCGCGCGCNONE
J065213P22CTCGCGCGCNONE
Os08g0476300014-029-G10GTCGCGCGCNONE
AK071937GTCGCGCGCNONE
AK105359GTCGCGCGCGlucose/ribitol dehydrogenase family protein.
J065099P11GTCGCGCGCNONE
J075083H04GTCGCGCGCNONE
J075130H04GTCGCGCGCNONE
Os08g0482100AK065903CGCGCGAGLETM1-like domain containing protein.
J013049J03CGCGCGAGNONE
Os08g0485700AK068131GCGCGCGACGCGNONE
AK069097GCGCGCGACGCGMethyl-CpG binding domain containing protein.
J013130L03GCGCGCGACGCGNONE
Os08g0495300Os08g0495300GCGCGCGAGConserved hypothetical protein.
Os08g0517700AK071151GCGCGCGACOxysterol-binding protein family protein.
Os08g0535400004-001-H10GAGACGTGGGCCCCACCCTCGCGCGCNONE
AK071527GAGACGTGGGCCCCACCCTCGCGCGCZinc finger, DHHC-type domain containing protein.
J023107B02GAGACGTGGGCCCCACCCTCGCGCGCNONE
Os08g0565200AK108143GTCGCGCGCPathogenesis-related transcriptional factor and ERF domain containing protein.
Os09g0101800AK102345CTCGCGCGCWD40-like domain containing protein.
J090030C23CTCGCGCGCNONE
Os09g0133700011-038-F10CTCGCGCGAGNONE
015-095-D09CTCGCGCGAGNONE
AK101816CTCGCGCGAGATPase, BadF/BadG/BcrA/BcrD type domain containing protein.
J065001B01CTCGCGCGAGNONE
Os09g0265050J065112H09CGCGCGACGCGTGGConserved hypothetical protein.
Os09g0346500004-015-F05GCCCCACGCGCGAGNONE
005-018-A05GCCCCACGCGCGAGNONE
006-021-B03GCCCCACGCGCGAGNONE
006-021-D10GCCCCACGCGCGAGNONE
006-021-E07GCCCCACGCGCGAGNONE
006-021-F03GCCCCACGCGCGAGNONE
006-022-A06GCCCCACGCGCGAGNONE
006-022-B07GCCCCACGCGCGAGNONE
006-022-C02GCCCCACGCGCGAGNONE
006-023-E02GCCCCACGCGCGAGNONE
006-023-G08GCCCCACGCGCGAGNONE
006-023-H05GCCCCACGCGCGAGNONE
006-024-B09GCCCCACGCGCGAGNONE
006-024-E02GCCCCACGCGCGAGNONE
006-025-F01GCCCCACGCGCGAGNONE
006-025-G12GCCCCACGCGCGAGNONE
006-026-D02GCCCCACGCGCGAGNONE
006-026-D05GCCCCACGCGCGAGNONE
006-028-C05GCCCCACGCGCGAGNONE
006-028-E07GCCCCACGCGCGAGNONE
006-028-F05GCCCCACGCGCGAGNONE
006-028-F07GCCCCACGCGCGAGNONE
006-028-F08GCCCCACGCGCGAGNONE
006-028-G09GCCCCACGCGCGAGNONE
006-029-B04GCCCCACGCGCGAGNONE
006-029-C10GCCCCACGCGCGAGNONE
006-030-H03GCCCCACGCGCGAGNONE
006-031-F04GCCCCACGCGCGAGNONE
006-031-G11GCCCCACGCGCGAGNONE
006-032-D07GCCCCACGCGCGAGNONE
006-032-G02GCCCCACGCGCGAGNONE
006-032-H02GCCCCACGCGCGAGNONE
006-032-H10GCCCCACGCGCGAGNONE
006-033-A05GCCCCACGCGCGAGNONE
006-033-C04GCCCCACGCGCGAGNONE
006-033-D02GCCCCACGCGCGAGNONE
006-034-C05GCCCCACGCGCGAGNONE
006-034-D01GCCCCACGCGCGAGNONE
006-034-H10GCCCCACGCGCGAGNONE
006-035-A10GCCCCACGCGCGAGNONE
006-035-B10GCCCCACGCGCGAGNONE
006-035-D05GCCCCACGCGCGAGNONE
006-036-B07GCCCCACGCGCGAGNONE
006-036-F04GCCCCACGCGCGAGNONE
006-036-H02GCCCCACGCGCGAGNONE
006-036-H05GCCCCACGCGCGAGNONE
006-036-H06GCCCCACGCGCGAGNONE
006-037-C10GCCCCACGCGCGAGNONE
006-037-F03GCCCCACGCGCGAGNONE
006-038-B05GCCCCACGCGCGAGNONE
006-038-E03GCCCCACGCGCGAGNONE
006-038-E06GCCCCACGCGCGAGNONE
006-039-B07GCCCCACGCGCGAGNONE
006-039-D03GCCCCACGCGCGAGNONE
006-039-F05GCCCCACGCGCGAGNONE
006-041-A10GCCCCACGCGCGAGNONE
006-041-B07GCCCCACGCGCGAGNONE
006-042-B05GCCCCACGCGCGAGNONE
006-042-C04GCCCCACGCGCGAGNONE
006-042-D12GCCCCACGCGCGAGNONE
006-043-C11GCCCCACGCGCGAGNONE
006-043-E04GCCCCACGCGCGAGNONE
006-044-E09GCCCCACGCGCGAGNONE
006-045-B01GCCCCACGCGCGAGNONE
006-045-G02GCCCCACGCGCGAGNONE
006-046-A01GCCCCACGCGCGAGNONE
006-046-C07GCCCCACGCGCGAGNONE
006-046-G02GCCCCACGCGCGAGNONE
006-047-B02GCCCCACGCGCGAGNONE
006-047-C01GCCCCACGCGCGAGNONE
006-047-D05GCCCCACGCGCGAGNONE
006-047-F09GCCCCACGCGCGAGNONE
006-049-E05GCCCCACGCGCGAGNONE
006-049-E09GCCCCACGCGCGAGNONE
006-050-A01GCCCCACGCGCGAGNONE
006-050-A12GCCCCACGCGCGAGNONE
006-050-C05GCCCCACGCGCGAGNONE
006-050-C06GCCCCACGCGCGAGNONE
006-050-G06GCCCCACGCGCGAGNONE
006-050-G10GCCCCACGCGCGAGNONE
006-050-H02GCCCCACGCGCGAGNONE
006-051-A02GCCCCACGCGCGAGNONE
006-051-B09GCCCCACGCGCGAGNONE
006-051-C02GCCCCACGCGCGAGNONE
006-051-H01GCCCCACGCGCGAGNONE
006-052-B12GCCCCACGCGCGAGNONE
006-052-D08GCCCCACGCGCGAGNONE
006-052-E08GCCCCACGCGCGAGNONE
006-052-F05GCCCCACGCGCGAGNONE
006-052-F11GCCCCACGCGCGAGNONE
006-052-G08GCCCCACGCGCGAGNONE
006-052-G11GCCCCACGCGCGAGNONE
006-052-H07GCCCCACGCGCGAGNONE
006-053-A08GCCCCACGCGCGAGNONE
006-053-B06GCCCCACGCGCGAGNONE
006-054-H08GCCCCACGCGCGAGNONE
006-055-B08GCCCCACGCGCGAGNONE
006-055-E03GCCCCACGCGCGAGNONE
006-055-H08GCCCCACGCGCGAGNONE
006-056-A10GCCCCACGCGCGAGNONE
006-056-C10GCCCCACGCGCGAGNONE
006-056-E04GCCCCACGCGCGAGNONE
006-057-A10GCCCCACGCGCGAGNONE
006-058-A02GCCCCACGCGCGAGNONE
006-058-D11GCCCCACGCGCGAGNONE
006-058-F01GCCCCACGCGCGAGNONE
006-058-H03GCCCCACGCGCGAGNONE
006-058-H10GCCCCACGCGCGAGNONE
006-059-B04GCCCCACGCGCGAGNONE
006-059-F04GCCCCACGCGCGAGNONE
006-060-A06GCCCCACGCGCGAGNONE
006-060-B07GCCCCACGCGCGAGNONE
006-060-D03GCCCCACGCGCGAGNONE
006-062-B09GCCCCACGCGCGAGNONE
006-062-C02GCCCCACGCGCGAGNONE
006-062-D01GCCCCACGCGCGAGNONE
006-062-E01GCCCCACGCGCGAGNONE
006-062-F03GCCCCACGCGCGAGNONE
006-062-H02GCCCCACGCGCGAGNONE
006-063-C03GCCCCACGCGCGAGNONE
006-063-G02GCCCCACGCGCGAGNONE
006-063-H10GCCCCACGCGCGAGNONE
006-064-H01GCCCCACGCGCGAGNONE
006-067-F08GCCCCACGCGCGAGNONE
006-068-G11GCCCCACGCGCGAGNONE
006-071-B06GCCCCACGCGCGAGNONE
006-071-G08GCCCCACGCGCGAGNONE
006-071-H10GCCCCACGCGCGAGNONE
006-072-H11GCCCCACGCGCGAGNONE
006-073-C12GCCCCACGCGCGAGNONE
006-073-E07GCCCCACGCGCGAGNONE
006-073-H09GCCCCACGCGCGAGNONE
006-074-C03GCCCCACGCGCGAGNONE
006-074-F03GCCCCACGCGCGAGNONE
006-074-G02GCCCCACGCGCGAGNONE
006-074-H12GCCCCACGCGCGAGNONE
006-075-C06GCCCCACGCGCGAGNONE
006-075-G07GCCCCACGCGCGAGNONE
006-075-G08GCCCCACGCGCGAGNONE
006-075-G09GCCCCACGCGCGAGNONE
006-075-H09GCCCCACGCGCGAGNONE
006-076-C02GCCCCACGCGCGAGNONE
006-076-E12GCCCCACGCGCGAGNONE
006-076-G04GCCCCACGCGCGAGNONE
006-076-G06GCCCCACGCGCGAGNONE
006-076-G11GCCCCACGCGCGAGNONE
006-077-D09GCCCCACGCGCGAGNONE
006-077-E08GCCCCACGCGCGAGNONE
006-079-B10GCCCCACGCGCGAGNONE
006-079-F11GCCCCACGCGCGAGNONE
006-079-H04GCCCCACGCGCGAGNONE
006-079-H11GCCCCACGCGCGAGNONE
006-080-D06GCCCCACGCGCGAGNONE
006-080-E10GCCCCACGCGCGAGNONE
006-080-F09GCCCCACGCGCGAGNONE
006-080-G04GCCCCACGCGCGAGNONE
006-081-C05GCCCCACGCGCGAGNONE
006-081-D08GCCCCACGCGCGAGNONE
006-081-E09GCCCCACGCGCGAGNONE
006-081-F07GCCCCACGCGCGAGNONE
006-081-H11GCCCCACGCGCGAGNONE
006-082-E05GCCCCACGCGCGAGNONE
006-083-E12GCCCCACGCGCGAGNONE
006-083-F12GCCCCACGCGCGAGNONE
006-084-A10GCCCCACGCGCGAGNONE
006-084-B07GCCCCACGCGCGAGNONE
006-084-E05GCCCCACGCGCGAGNONE
006-084-F07GCCCCACGCGCGAGNONE
006-085-C01GCCCCACGCGCGAGNONE
006-085-D08GCCCCACGCGCGAGNONE
006-085-G07GCCCCACGCGCGAGNONE
006-085-G11GCCCCACGCGCGAGNONE
006-086-A01GCCCCACGCGCGAGNONE
006-086-B09GCCCCACGCGCGAGNONE
006-086-E05GCCCCACGCGCGAGNONE
006-086-F11GCCCCACGCGCGAGNONE
006-086-F12GCCCCACGCGCGAGNONE
006-086-G03GCCCCACGCGCGAGNONE
006-087-C01GCCCCACGCGCGAGNONE
006-087-D09GCCCCACGCGCGAGNONE
006-087-E02GCCCCACGCGCGAGNONE
006-087-F07GCCCCACGCGCGAGNONE
006-088-A05GCCCCACGCGCGAGNONE
006-088-F02GCCCCACGCGCGAGNONE
006-089-F08GCCCCACGCGCGAGNONE
006-090-G11GCCCCACGCGCGAGNONE
006-091-H10GCCCCACGCGCGAGNONE
006-092-B09GCCCCACGCGCGAGNONE
006-092-E09GCCCCACGCGCGAGNONE
006-093-B01GCCCCACGCGCGAGNONE
006-093-C09GCCCCACGCGCGAGNONE
006-093-G08GCCCCACGCGCGAGNONE
006-094-G06GCCCCACGCGCGAGNONE
006-095-A11GCCCCACGCGCGAGNONE
006-095-D06GCCCCACGCGCGAGNONE
006-095-F06GCCCCACGCGCGAGNONE
006-096-E05GCCCCACGCGCGAGNONE
006-096-H05GCCCCACGCGCGAGNONE
006-097-A04GCCCCACGCGCGAGNONE
006-097-H01GCCCCACGCGCGAGNONE
006-098-B10GCCCCACGCGCGAGNONE
006-098-F01GCCCCACGCGCGAGNONE
006-098-G08GCCCCACGCGCGAGNONE
006-098-H08GCCCCACGCGCGAGNONE
006-099-E01GCCCCACGCGCGAGNONE
006-100-C11GCCCCACGCGCGAGNONE
006-100-F03GCCCCACGCGCGAGNONE
006-101-B03GCCCCACGCGCGAGNONE
006-101-B06GCCCCACGCGCGAGNONE
006-101-B09GCCCCACGCGCGAGNONE
006-101-G02GCCCCACGCGCGAGNONE
006-101-H03GCCCCACGCGCGAGNONE
006-102-A03GCCCCACGCGCGAGNONE
006-102-E11GCCCCACGCGCGAGNONE
006-102-H01GCCCCACGCGCGAGNONE
006-102-H03GCCCCACGCGCGAGNONE
006-103-C04GCCCCACGCGCGAGNONE
006-103-H06GCCCCACGCGCGAGNONE
006-104-A03GCCCCACGCGCGAGNONE
006-104-F11GCCCCACGCGCGAGNONE
006-105-H05GCCCCACGCGCGAGNONE
006-105-H07GCCCCACGCGCGAGNONE
006-106-B12GCCCCACGCGCGAGNONE
006-106-D04GCCCCACGCGCGAGNONE
006-107-A08GCCCCACGCGCGAGNONE
006-107-C03GCCCCACGCGCGAGNONE
006-107-G02GCCCCACGCGCGAGNONE
006-108-B06GCCCCACGCGCGAGNONE
006-109-B02GCCCCACGCGCGAGNONE
006-109-D08GCCCCACGCGCGAGNONE
006-109-F11GCCCCACGCGCGAGNONE
006-109-G08GCCCCACGCGCGAGNONE
006-110-G12GCCCCACGCGCGAGNONE
006-110-H07GCCCCACGCGCGAGNONE
006-111-A01GCCCCACGCGCGAGNONE
006-111-A11GCCCCACGCGCGAGNONE
006-111-D01GCCCCACGCGCGAGNONE
006-111-H10GCCCCACGCGCGAGNONE
006-111-H11GCCCCACGCGCGAGNONE
006-112-A03GCCCCACGCGCGAGNONE
006-112-B02GCCCCACGCGCGAGNONE
006-112-B10GCCCCACGCGCGAGNONE
006-112-E12GCCCCACGCGCGAGNONE
006-112-F06GCCCCACGCGCGAGNONE
006-112-H10GCCCCACGCGCGAGNONE
006-113-A10GCCCCACGCGCGAGNONE
006-113-C07GCCCCACGCGCGAGNONE
006-114-A04GCCCCACGCGCGAGNONE
006-114-B10GCCCCACGCGCGAGNONE
006-114-C04GCCCCACGCGCGAGNONE
006-114-D03GCCCCACGCGCGAGNONE
006-114-D07GCCCCACGCGCGAGNONE
006-114-G11GCCCCACGCGCGAGNONE
006-115-C01GCCCCACGCGCGAGNONE
006-116-A12GCCCCACGCGCGAGNONE
006-116-F09GCCCCACGCGCGAGNONE
006-116-H01GCCCCACGCGCGAGNONE
006-117-B04GCCCCACGCGCGAGNONE
006-117-B08GCCCCACGCGCGAGNONE
006-117-E07GCCCCACGCGCGAGNONE
006-117-E11GCCCCACGCGCGAGNONE
006-117-H04GCCCCACGCGCGAGNONE
006-117-H11GCCCCACGCGCGAGNONE
006-118-A12GCCCCACGCGCGAGNONE
006-118-C01GCCCCACGCGCGAGNONE
006-119-A12GCCCCACGCGCGAGNONE
006-119-C11GCCCCACGCGCGAGNONE
006-119-F06GCCCCACGCGCGAGNONE
009-038-E07GCCCCACGCGCGAGNONE
009-053-G07GCCCCACGCGCGAGNONE
009-088-D05GCCCCACGCGCGAGNONE
009-109-G12GCCCCACGCGCGAGNONE
009-124-H09GCCCCACGCGCGAGNONE
009-134-F04GCCCCACGCGCGAGNONE
009-149-G07GCCCCACGCGCGAGNONE
009-181-D07GCCCCACGCGCGAGNONE
009-191-D03GCCCCACGCGCGAGNONE
AK058305GCCCCACGCGCGAGNONE
AK060851GCCCCACGCGCGAGSimilar to Chlorophyll a-b binding protein, chloroplast precursor (LHCII type I CAB) (LHCP).
AK104281GCCCCACGCGCGAGNONE
AK104288GCCCCACGCGCGAGNONE
AK104350GCCCCACGCGCGAGNONE
D00641GCCCCACGCGCGAGNONE
J013091G20GCCCCACGCGCGAGNONE
J013129G18GCCCCACGCGCGAGNONE
J013158J17GCCCCACGCGCGAGNONE
J023013M23GCCCCACGCGCGAGNONE
J023062B14GCCCCACGCGCGAGNONE
J023105C20GCCCCACGCGCGAGNONE
J023113G18GCCCCACGCGCGAGNONE
J065060F20GCCCCACGCGCGAGNONE
J065132G17GCCCCACGCGCGAGNONE
J065163A19GCCCCACGCGCGAGNONE
J075001K18GCCCCACGCGCGAGNONE
J075047E10GCCCCACGCGCGAGNONE
J075050E09GCCCCACGCGCGAGNONE
J075058J15GCCCCACGCGCGAGNONE
J075086B22GCCCCACGCGCGAGNONE
J075086E16GCCCCACGCGCGAGNONE
J075092C16GCCCCACGCGCGAGNONE
J075130A10GCCCCACGCGCGAGNONE
J075140F10GCCCCACGCGCGAGNONE
J075161K06GCCCCACGCGCGAGNONE
J075176J22GCCCCACGCGCGAGNONE
J075177I20GCCCCACGCGCGAGNONE
J075179H01GCCCCACGCGCGAGNONE
J080003C15GCCCCACGCGCGAGNONE
J080005N03GCCCCACGCGCGAGNONE
J080011I16GCCCCACGCGCGAGNONE
J080014C08GCCCCACGCGCGAGNONE
J080017L17GCCCCACGCGCGAGNONE
J080018K10GCCCCACGCGCGAGNONE
J080022J03GCCCCACGCGCGAGNONE
J080024I10GCCCCACGCGCGAGNONE
J080026F17GCCCCACGCGCGAGNONE
J080029G15GCCCCACGCGCGAGNONE
J080032H11GCCCCACGCGCGAGNONE
J080034C09GCCCCACGCGCGAGNONE
J080035B22GCCCCACGCGCGAGNONE
J080037H20GCCCCACGCGCGAGNONE
J080039J16GCCCCACGCGCGAGNONE
J080042J20GCCCCACGCGCGAGNONE
J080044F03GCCCCACGCGCGAGNONE
J080044F23GCCCCACGCGCGAGNONE
J080045H08GCCCCACGCGCGAGNONE
J080048H13GCCCCACGCGCGAGNONE
J080062K23GCCCCACGCGCGAGNONE
J080063G19GCCCCACGCGCGAGNONE
J080068M05GCCCCACGCGCGAGNONE
J080069L18GCCCCACGCGCGAGNONE
J080071P09GCCCCACGCGCGAGNONE
J080074E21GCCCCACGCGCGAGNONE
J080075A14GCCCCACGCGCGAGNONE
J080075C06GCCCCACGCGCGAGNONE
J080085D10GCCCCACGCGCGAGNONE
J080085E07GCCCCACGCGCGAGNONE
J080086E17GCCCCACGCGCGAGNONE
J080089F09GCCCCACGCGCGAGNONE
J080089O19GCCCCACGCGCGAGNONE
J080096A04GCCCCACGCGCGAGNONE
J080301D10GCCCCACGCGCGAGNONE
J080301E15GCCCCACGCGCGAGNONE
J080306C23GCCCCACGCGCGAGNONE
J080307L24GCCCCACGCGCGAGNONE
J080308G21GCCCCACGCGCGAGNONE
J080315H03GCCCCACGCGCGAGNONE
J090014I10GCCCCACGCGCGAGNONE
J090018H12GCCCCACGCGCGAGNONE
J090031J20GCCCCACGCGCGAGNONE
J090055A05GCCCCACGCGCGAGNONE
J090062H23GCCCCACGCGCGAGNONE
J090071K20GCCCCACGCGCGAGNONE
J090099G11GCCCCACGCGCGAGNONE
J100045E10GCCCCACGCGCGAGNONE
J100046E18GCCCCACGCGCGAGNONE
J100052B19GCCCCACGCGCGAGNONE
J100053A01GCCCCACGCGCGAGNONE
J100079P18GCCCCACGCGCGAGNONE
Os09g0363700AK103667GTCGCGCGCConserved hypothetical protein.
J075001L14GTCGCGCGCNONE
J075049M23GTCGCGCGCNONE
J075051I04GTCGCGCGCNONE
J075073L04GTCGCGCGCNONE
J075077E03GTCGCGCGCNONE
J075083J11GTCGCGCGCNONE
J075094J22GTCGCGCGCNONE
J075112E08GTCGCGCGCNONE
J075137J23GTCGCGCGCNONE
J075192E02GTCGCGCGCNONE
J100039K04GTCGCGCGCNONE
Os09g0403000AK111051GCGCGCGACConserved hypothetical protein.
Os09g0417600006-110-A01CTCGCGCGCNONE
AF467736CTCGCGCGCNONE
AK059966CTCGCGCGCNONE
AK068337CTCGCGCGCWRKY transcription factor 76.
AY323479CTCGCGCGCNONE
J013151N12CTCGCGCGCNONE
J065064C11CTCGCGCGCNONE
J065152D10CTCGCGCGCNONE
J065162J10CTCGCGCGCNONE
J075033B01CTCGCGCGCNONE
Os09g0418000006-022-F01CTCGCGCGCNONE
006-038-G10CTCGCGCGCNONE
006-089-G04CTCGCGCGCNONE
006-098-F07CTCGCGCGCNONE
AK061220CTCGCGCGCNONE
AK061493CTCGCGCGCNONE
AK100881CTCGCGCGCNONE
AK119760CTCGCGCGCProtein kinase-like domain containing protein.
J023127H10CTCGCGCGCNONE
J033122J01CTCGCGCGCNONE
J065162D08CTCGCGCGCNONE
J065214P03CTCGCGCGCNONE
J090009B17CTCGCGCGCNONE
J090093C21CTCGCGCGCNONE
J100067C01CTCGCGCGCNONE
J100067P06CTCGCGCGCNONE
Os09g0433000009-198-H02CTCGCGCGCNONE
AK063243CTCGCGCGCNONE
Os09g0445600AK107839CTCGCGCGConserved hypothetical protein.
Os09g0456200015-025-E01CCACGCGTCGCGCGCNONE
015-025-E01CTCGCGCGCCACGTNONE
AK065873CCACGCGTCGCGCGCSimilar to BZIP transcription factor ABI5.
AK065873CTCGCGCGCCACGTSimilar to BZIP transcription factor ABI5.
J013049N23CCACGCGTCGCGCGCNONE
J013049N23CTCGCGCGCCACGTNONE
J033128E10CCACGCGTCGCGCGCNONE
J033128E10CTCGCGCGCCACGTNONE
Os09g0459900009-190-G09CTCGCGCGCNONE
AK063208CTCGCGCGCCyclin-dependent kinase inhibitor family protein.
AK111010CTCGCGCGCNONE
Os09g0476100AK099938CTCGCGCGTGGGGCCCACCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
Os09g0480600AK107853GTCGCGCGCGCGAGHypothetical protein.
Os09g0486500006-062-H11CGCGCGACGCNONE
009-049-A11CGCGCGACGCNONE
009-070-D06CGCGCGACGCNONE
009-089-A10CGCGCGACGCNONE
009-107-D06CGCGCGACGCNONE
009-133-F02CGCGCGACGCNONE
009-142-A05CGCGCGACGCNONE
009-175-G07CGCGCGACGCNONE
013-044-C05CGCGCGACGCNONE
014-044-D10CGCGCGACGCNONE
AF140722CGCGCGACGCNONE
AK061067CGCGCGACGCNONE
AK070140CGCGCGACGCNONE
AK106128CGCGCGACGCMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1).
AK119793CGCGCGACGCNONE
J023042G11CGCGCGACGCNONE
J053043H07CGCGCGACGCNONE
J053046N13CGCGCGACGCNONE
J053091K15CGCGCGACGCNONE
J053094I21CGCGCGACGCNONE
J053094N04CGCGCGACGCNONE
J053100D12CGCGCGACGCNONE
J053101K11CGCGCGACGCNONE
J065079H06CGCGCGACGCNONE
J100028D11CGCGCGACGCNONE
J100033A20CGCGCGACGCNONE
J100033F15CGCGCGACGCNONE
Os09g0493700015-091-G11GCGGGTCGCGCGNONE
AK068501GCGGGTCGCGCGSimilar to CUC2.
AK099237GCGGGTCGCGCGNONE
J013155B08GCGGGTCGCGCGNONE
J023006E01GCGGGTCGCGCGNONE
J023060K23GCGGGTCGCGCGNONE
J023100B11GCGGGTCGCGCGNONE
J033026L19GCGGGTCGCGCGNONE
J033129J12GCGGGTCGCGCGNONE
J033149K09GCGGGTCGCGCGNONE
J065045I06GCGGGTCGCGCGNONE
J065061A10GCGGGTCGCGCGNONE
J065101H05GCGGGTCGCGCGNONE
J065135A03GCGGGTCGCGCGNONE
J065169C16GCGGGTCGCGCGNONE
J100047C11GCGGGTCGCGCGNONE
J100047K07GCGGGTCGCGCGNONE
Os09g0511600015-078-A09CTCGCGCGAGNONE
015-078-A09CTCGCGCGCNONE
AK102869CTCGCGCGAGNONE
AK102869CTCGCGCGCNONE
AK121679CTCGCGCGAGNONE
AK121679CTCGCGCGCNONE
AK121935CTCGCGCGAGGlycoside hydrolase, family 1 protein.
AK121935CTCGCGCGCGlycoside hydrolase, family 1 protein.
Os09g0526700011-075-B12CTCGCGCGCNONE
AB097460CTCGCGCGCNONE
AK073610CTCGCGCGCSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase).
AK104977CTCGCGCGCNONE
Os09g0551600005-020-H08CGCGTCGCGCGCNONE
006-043-E02CGCGTCGCGCGCNONE
013-043-F03CGCGTCGCGCGCNONE
AK066658CGCGTCGCGCGCSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101).
J013071N11CGCGTCGCGCGCNONE
J065177J20CGCGTCGCGCGCNONE
J075041D06CGCGTCGCGCGCNONE
J075199H24CGCGTCGCGCGCNONE
J080001G07CGCGTCGCGCGCNONE
J080024A12CGCGTCGCGCGCNONE
J080025B15CGCGTCGCGCGCNONE
J090017G07CGCGTCGCGCGCNONE
J090050G23CGCGTCGCGCGCNONE
J090083G11CGCGTCGCGCGCNONE
Os11g0131900AK065240CGCGCGACSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II.
Os11g0146700AK065900CTCGCGCGNONE
AK072412CTCGCGCGRED-like, C-terminal family protein.
Os11g0216900AK060326CTCGCGCGCGTGGGCCTTGSimilar to IDI2.
AK060549CTCGCGCGCGTGGGCCTTGNONE
AK100869CTCGCGCGCGTGGGCCTTGNONE
Os11g0223000J065060C21AGATGGGCGCGCGAGNONE
Os11g0276000AK072319GTCGCGCGCSimilar to Roothairless 1.
Os11g0582400AF049348CCCCCGCGCGCGACGTGGGCTConserved hypothetical protein.
AF516927CCCCCGCGCGCGACGTGGGCTNONE
AK073083CCCCCGCGCGCGACGTGGGCTNONE
AK108352CCCCCGCGCGCGACGTGGGCTNONE
J075005O16CCCCCGCGCGCGACGTGGGCTNONE
J075007D15CCCCCGCGCGCGACGTGGGCTNONE
J075007L04CCCCCGCGCGCGACGTGGGCTNONE
J075009C11CCCCCGCGCGCGACGTGGGCTNONE
J075012L11CCCCCGCGCGCGACGTGGGCTNONE
J075013A14CCCCCGCGCGCGACGTGGGCTNONE
J075015K01CCCCCGCGCGCGACGTGGGCTNONE
J075019O21CCCCCGCGCGCGACGTGGGCTNONE
J075020G20CCCCCGCGCGCGACGTGGGCTNONE
J075020H06CCCCCGCGCGCGACGTGGGCTNONE
J075022D07CCCCCGCGCGCGACGTGGGCTNONE
J075024M12CCCCCGCGCGCGACGTGGGCTNONE
J075025G04CCCCCGCGCGCGACGTGGGCTNONE
J075026F09CCCCCGCGCGCGACGTGGGCTNONE
J075027D19CCCCCGCGCGCGACGTGGGCTNONE
J075030A12CCCCCGCGCGCGACGTGGGCTNONE
J075030C16CCCCCGCGCGCGACGTGGGCTNONE
J075030D15CCCCCGCGCGCGACGTGGGCTNONE
J075034M20CCCCCGCGCGCGACGTGGGCTNONE
J075041H12CCCCCGCGCGCGACGTGGGCTNONE
J075052D12CCCCCGCGCGCGACGTGGGCTNONE
J075052G11CCCCCGCGCGCGACGTGGGCTNONE
J075053L09CCCCCGCGCGCGACGTGGGCTNONE
J075064G05CCCCCGCGCGCGACGTGGGCTNONE
J075067J01CCCCCGCGCGCGACGTGGGCTNONE
J075071O03CCCCCGCGCGCGACGTGGGCTNONE
J075072G12CCCCCGCGCGCGACGTGGGCTNONE
J075078H06CCCCCGCGCGCGACGTGGGCTNONE
J075081D06CCCCCGCGCGCGACGTGGGCTNONE
J075084G23CCCCCGCGCGCGACGTGGGCTNONE
J075085M10CCCCCGCGCGCGACGTGGGCTNONE
J075087N20CCCCCGCGCGCGACGTGGGCTNONE
J075088E11CCCCCGCGCGCGACGTGGGCTNONE
J075088O22CCCCCGCGCGCGACGTGGGCTNONE
J075091E10CCCCCGCGCGCGACGTGGGCTNONE
J075092B12CCCCCGCGCGCGACGTGGGCTNONE
J075093E08CCCCCGCGCGCGACGTGGGCTNONE
J075095D04CCCCCGCGCGCGACGTGGGCTNONE
J075095J10CCCCCGCGCGCGACGTGGGCTNONE
J075095O19CCCCCGCGCGCGACGTGGGCTNONE
J075096H20CCCCCGCGCGCGACGTGGGCTNONE
J075098F10CCCCCGCGCGCGACGTGGGCTNONE
J075100H10CCCCCGCGCGCGACGTGGGCTNONE
J075104C23CCCCCGCGCGCGACGTGGGCTNONE
J075105B10CCCCCGCGCGCGACGTGGGCTNONE
J075106I24CCCCCGCGCGCGACGTGGGCTNONE
J075109H23CCCCCGCGCGCGACGTGGGCTNONE
J075115A03CCCCCGCGCGCGACGTGGGCTNONE
J075118M06CCCCCGCGCGCGACGTGGGCTNONE
J075121G08CCCCCGCGCGCGACGTGGGCTNONE
J075122C09CCCCCGCGCGCGACGTGGGCTNONE
J075122J12CCCCCGCGCGCGACGTGGGCTNONE
J075123E06CCCCCGCGCGCGACGTGGGCTNONE
J075123E16CCCCCGCGCGCGACGTGGGCTNONE
J075124N09CCCCCGCGCGCGACGTGGGCTNONE
J075127F23CCCCCGCGCGCGACGTGGGCTNONE
J075128H17CCCCCGCGCGCGACGTGGGCTNONE
J075129C02CCCCCGCGCGCGACGTGGGCTNONE
J075139P18CCCCCGCGCGCGACGTGGGCTNONE
J075140H17CCCCCGCGCGCGACGTGGGCTNONE
J075146E12CCCCCGCGCGCGACGTGGGCTNONE
J075146I07CCCCCGCGCGCGACGTGGGCTNONE
J075150A08CCCCCGCGCGCGACGTGGGCTNONE
J075150I22CCCCCGCGCGCGACGTGGGCTNONE
J075155D01CCCCCGCGCGCGACGTGGGCTNONE
J075155N10CCCCCGCGCGCGACGTGGGCTNONE
J075155O09CCCCCGCGCGCGACGTGGGCTNONE
J075156K11CCCCCGCGCGCGACGTGGGCTNONE
J075157N01CCCCCGCGCGCGACGTGGGCTNONE
J075164L09CCCCCGCGCGCGACGTGGGCTNONE
J075166F14CCCCCGCGCGCGACGTGGGCTNONE
J075169E20CCCCCGCGCGCGACGTGGGCTNONE
J075170B13CCCCCGCGCGCGACGTGGGCTNONE
J075170F24CCCCCGCGCGCGACGTGGGCTNONE
J075170N16CCCCCGCGCGCGACGTGGGCTNONE
J075172H22CCCCCGCGCGCGACGTGGGCTNONE
J075172I02CCCCCGCGCGCGACGTGGGCTNONE
J075176E08CCCCCGCGCGCGACGTGGGCTNONE
J075177H17CCCCCGCGCGCGACGTGGGCTNONE
J075179C18CCCCCGCGCGCGACGTGGGCTNONE
J075182H23CCCCCGCGCGCGACGTGGGCTNONE
J075187B10CCCCCGCGCGCGACGTGGGCTNONE
J075192L10CCCCCGCGCGCGACGTGGGCTNONE
J075195C04CCCCCGCGCGCGACGTGGGCTNONE
U25969CCCCCGCGCGCGACGTGGGCTNONE
Os11g0586300AK072257CTCGCGCGCConserved hypothetical protein.
Os11g0619800016-094-C06CTCGCGCGCNONE
AK107437CTCGCGCGCTRAF-like domain containing protein.
Os12g0128700AK072576CGCGCGACSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II.
J013047N12CGCGCGACNONE
Os12g0134000AK066940GGTCCACGCGCGACSimilar to Hydroxymethylglutaryl-CoA lyase.
Os12g0149300AK110842CGCGTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1).
AK110842CTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1).
Os12g0149900004-010-G09CTCGCGCGNONE
AK060888CTCGCGCGNONE
AK072203CTCGCGCGIQ calmodulin-binding region domain containing protein.
AK102297CTCGCGCGNONE
J013050I08CTCGCGCGNONE
J013096D15CTCGCGCGNONE
J033025C09CTCGCGCGNONE
J033061C16CTCGCGCGNONE
J033079M05CTCGCGCGNONE
J033089L12CTCGCGCGNONE
J033147F22CTCGCGCGNONE
J043036P05CTCGCGCGNONE
J090022O19CTCGCGCGNONE
J100063L21CTCGCGCGNONE
J100084K12CTCGCGCGNONE
J100089F24CTCGCGCGNONE
Os12g0255866J075127N18CGCGCGACGCGTGGConserved hypothetical protein.
Os12g0407100J075130F11GCGCGCGACACGTGTCNONE
J075150G14GCGCGCGACACGTGTCConserved hypothetical protein.
J090089B20GCGCGCGACACGTGTCNONE
J100042D22GCGCGCGACACGTGTCNONE
Os12g0535400004-008-H02CGCGCGAGNONE
004-008-H02CTCGCGCGGCTCGGNONE
AK065318CGCGCGAGHypothetical protein.
AK065318CTCGCGCGGCTCGGHypothetical protein.
J013002P10CGCGCGAGNONE
J013002P10CTCGCGCGGCTCGGNONE
Os12g0541900AK069047GTCGCGCGRapid ALkalinization Factor family protein.
AK071210GTCGCGCGNONE
Os12g0550800006-091-A05TCGCGCGCGACNONE
AK061828TCGCGCGCGACNONE
AK098944TCGCGCGCGACNONE
AK102550TCGCGCGCGACHypothetical protein.
J013045G24TCGCGCGCGACNONE
J065156K11TCGCGCGCGACNONE
J065201E21TCGCGCGCGACNONE
Os12g0640700AK108649CGCGCGACN/apple PAN domain containing protein.


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.