version

Summary of CCGAC (All List)

Organism Oryza sativa
PPDB Motif CCGAC
Description DRE core, stress response
Total Entry Count 2483

Entry Sequences (2483 entries)

LocusGene modelSequenceDescription
Os01g0158100AK109233ATCCGACGGPentatricopeptide repeat containing protein.
Os01g0184000015-008-B06CCGTCGGATCNONE
AK071130CCGTCGGATCNUC156 family protein.
AK100604CCGTCGGATCNONE
Os01g0190400AK064011CCGATCCGACSimilar to Hexokinase.
AK099119CCGATCCGACNONE
Os01g0281200AK107209GATCCGACSimilar to Type B-like cyclin (Fragment).
AY647458GATCCGACNONE
Os01g0314000015-084-B08GTCGGATCNONE
AK106418GTCGGATCNONE
Os01g0331900013-026-D04GCCACGTCGGATNONE
AK064784GCCACGTCGGATNONE
AK121761GCCACGTCGGATProtein of unknown function DUF846, eukaryotic family protein.
J013000B15GCCACGTCGGATNONE
J033090D07GCCACGTCGGATNONE
J090006L21GCCACGTCGGATNONE
Os01g0363600014-029-H08CCGTCGGATNONE
AK063667CCGTCGGATConserved hypothetical protein.
Os01g0505600AK072726GATCCGACFlagellar calcium-binding protein (calflagin) family protein.
J065021A18GATCCGACNONE
J065021B17GATCCGACNONE
J065153G22GATCCGACNONE
Os01g0571700AK120410CCGTCGGATCNucleic acid-binding, OB-fold domain containing protein.
Os01g0663400016-054-B01CCGATCCGACGGNONE
AK072283CCGATCCGACGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-).
AK072645CCGATCCGACGGNONE
J065180A21CCGATCCGACGGNONE
J075026E13CCGATCCGACGGNONE
J075109M23CCGATCCGACGGNONE
J075151A02CCGATCCGACGGNONE
J090004B07CCGATCCGACGGNONE
J090023O22CCGATCCGACGGNONE
J090054G09CCGATCCGACGGNONE
J090058H13CCGATCCGACGGNONE
J090076G13CCGATCCGACGGNONE
J100057F11CCGATCCGACGGNONE
Os01g0686600AK119910GTCGGATCTetratricopeptide-like helical domain containing protein.
Os01g0693900AK066034CCGTCGGATNONE
AK066034CCGTCGGATNONE
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein.
AK099894CCGTCGGATPeptidyl-tRNA hydrolase family protein.
J065165G19CCGTCGGATNONE
J065165G19CCGTCGGATNONE
J100042C04CCGTCGGATNONE
J100042C04CCGTCGGATNONE
Os01g0736100011-091-H04CCGTCGGATCNONE
015-004-D10CCGTCGGATCNONE
AK064298CCGTCGGATCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK099365CCGTCGGATCNONE
AK103355CCGTCGGATCNONE
J033044B20CCGTCGGATCNONE
J033094G06CCGTCGGATCNONE
J033111N02CCGTCGGATCNONE
J033111P10CCGTCGGATCNONE
J033126K03CCGTCGGATCNONE
J043034D12CCGTCGGATCNONE
Os01g0812600Os01g0812600GTCGGATCNSF attachment protein family protein.
Os01g0817800AK073827CCGTCGGACGGACWD40-like domain containing protein.
J033068H02CCGTCGGACGGACNONE
J065042H22CCGTCGGACGGACNONE
J090083M24CCGTCGGACGGACNONE
Os01g0830100AK069755GATCCGACGGTGGGGGAGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein.
Os01g0835500AK100241ATCCGACGGSimilar to Respiratory burst oxidase protein.
Os01g0837900AK103207TCCGACGGSimilar to Protein kinase AFC1 (EC 2.7.1.-).
Os01g0844800AK099801GATCCGACGGSimilar to Pumilio RBD (Fragment).
AK102882GATCCGACGGNONE
AK103686GATCCGACGGNONE
Os01g0844900AK066659TCCGACGGHomeodomain-like containing protein.
Os01g0847900006-030-E09CCGATCCGACNONE
AK059798CCGATCCGACPrenylated rab acceptor PRA1 family protein.
AK073643CCGATCCGACNONE
J065091G23CCGATCCGACNONE
Os01g0848200AK069425ATCCGACGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
AK101230ATCCGACGNONE
Os01g0848550J065073P06CGTCGGATConserved hypothetical protein.
Os01g0856900AK107570GATCCGACGGlycoside hydrolase, starch-binding domain containing protein.
J065081B03GATCCGACGNONE
J075028J03GATCCGACGNONE
J075052C05GATCCGACGNONE
J075199J04GATCCGACGNONE
J090052L20GATCCGACGNONE
J090075L24GATCCGACGNONE
Os01g0877400AK106754ATCCGACGSimilar to Avr9 elicitor response-like protein.
Os01g0889400012-011-B10CGTCGGATCNONE
AB200237CGTCGGATCNONE
AK071407CGTCGGATCSimilar to LOB domain protein 6 (ASYMMETRIC LEAVES2).
AK119575CGTCGGATCNONE
J023089G14CGTCGGATCNONE
J075028N06CGTCGGATCNONE
J075121D21CGTCGGATCNONE
J075122K20CGTCGGATCNONE
J075176J05CGTCGGATCNONE
J080025B12CGTCGGATCNONE
J080040M21CGTCGGATCNONE
J080041I06CGTCGGATCNONE
J080047F15CGTCGGATCNONE
J080067B19CGTCGGATCNONE
J080068J04CGTCGGATCNONE
J080068M01CGTCGGATCNONE
J080077C15CGTCGGATCNONE
J080079M04CGTCGGATCNONE
J080306O05CGTCGGATCNONE
J090004J23CGTCGGATCNONE
Os01g0900800009-086-C08GATCCGACGNONE
AK068254GATCCGACGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK105713GATCCGACGNONE
J053025O10GATCCGACGNONE
J065063K24GATCCGACGNONE
J065167N21GATCCGACGNONE
J100060A20GATCCGACGNONE
J100079J03GATCCGACGNONE
J100087D11GATCCGACGNONE
J100089K10GATCCGACGNONE
Os01g0917100AK107234CCGTCGGATCConserved hypothetical protein.
Os01g0931100AK059213CCGTCGGANONE
AK068780CCGTCGGAConserved hypothetical protein.
J013159E17CCGTCGGANONE
J065059I12CCGTCGGANONE
J065064G11CCGTCGGANONE
J065138H23CCGTCGGANONE
J065167P22CCGTCGGANONE
Os01g0933900006-115-F10TCCGACGGNONE
009-130-C11TCCGACGGNONE
009-183-F07TCCGACGGNONE
009-196-F08TCCGACGGNONE
012-078-H05TCCGACGGNONE
015-004-D01TCCGACGGNONE
015-083-F05TCCGACGGNONE
AF309383TCCGACGGSimilar to Glutathione transferase III(B) (EC 2.5.1.18).
AK059985TCCGACGGNONE
AK103927TCCGACGGNONE
J065026P12TCCGACGGNONE
J065041M20TCCGACGGNONE
J065043H06TCCGACGGNONE
J065049E19TCCGACGGNONE
J065097D10TCCGACGGNONE
J065143I07TCCGACGGNONE
J065152F10TCCGACGGNONE
J065163F22TCCGACGGNONE
J065166O17TCCGACGGNONE
J065188B21TCCGACGGNONE
J065197D18TCCGACGGNONE
J065198E06TCCGACGGNONE
J065199D17TCCGACGGNONE
J065212I10TCCGACGGNONE
J075001L04TCCGACGGNONE
J090051G02TCCGACGGNONE
J090074K01TCCGACGGNONE
Os01g0966700006-038-E12GATCCGACNONE
AK061744GATCCGACNONE
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM.
Os01g0972300009-034-G05GTCGGATCCAACGGNONE
AK062432GTCGGATCCAACGGDVL family protein.
Os02g0115900AF006825CCGTCGGATCNONE
AK065743CCGTCGGATCEndosperm lumenal binding protein.
AK119653CCGTCGGATCNONE
Os02g0170200AK107753CGTCGGATGAGACGTGConserved hypothetical protein.
J065117F22CGTCGGATGAGACGTGNONE
Os02g0223700J013106E03ATCCGACGGConserved hypothetical protein.
J100061D19ATCCGACGGNONE
J100088J17ATCCGACGGNONE
Os02g0236800014-080-B04GATCCGACGGNONE
AK068642GATCCGACGGNONE
AK099886GATCCGACGGSimilar to Peroxidase (EC 1.11.1.7).
AK104670GATCCGACGGNONE
Os02g0301400AK121646GTCGGATCThioredoxin-like fold domain containing protein.
J033028E10GTCGGATCNONE
J033058J23GTCGGATCNONE
Os02g0453300006-099-D03CGTCGGATNONE
009-120-D02CGTCGGATNONE
AK071220CGTCGGATNONE
AK109380CGTCGGATConserved hypothetical protein.
J023083M17CGTCGGATNONE
Os02g0533800009-149-F12ATCCGACGGNONE
013-058-H02ATCCGACGGNONE
014-017-G07ATCCGACGGNONE
014-028-F04ATCCGACGGNONE
014-050-G04ATCCGACGGNONE
014-095-F04ATCCGACGGNONE
014-099-C08ATCCGACGGNONE
016-046-F05ATCCGACGGNONE
AK121139ATCCGACGGConserved hypothetical protein.
J013104A14ATCCGACGGNONE
J023077F13ATCCGACGGNONE
J023145I11ATCCGACGGNONE
J065033D14ATCCGACGGNONE
J065079I15ATCCGACGGNONE
J065104E21ATCCGACGGNONE
J065128E06ATCCGACGGNONE
J065174F07ATCCGACGGNONE
J065195B12ATCCGACGGNONE
J065207B12ATCCGACGGNONE
J080304M24ATCCGACGGNONE
J090040A13ATCCGACGGNONE
J090054B18ATCCGACGGNONE
J100037A06ATCCGACGGNONE
J100042F24ATCCGACGGNONE
J100043N23ATCCGACGGNONE
J100044H14ATCCGACGGNONE
J100056K24ATCCGACGGNONE
J100063O22ATCCGACGGNONE
J100071G05ATCCGACGGNONE
J100078G15ATCCGACGGNONE
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE
AK099539GACGGCCCGGATCCGACCCGCNONE
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein.
AK106801GACGGCCCGGATCCGACCCGCNONE
AK121758GACGGCCCGGATCCGACCCGCNONE
AK121891GACGGCCCGGATCCGACCCGCNONE
J013059H01GACGGCCCGGATCCGACCCGCNONE
J013092F08GACGGCCCGGATCCGACCCGCNONE
J013146J04GACGGCCCGGATCCGACCCGCNONE
J023001K12GACGGCCCGGATCCGACCCGCNONE
J023002H16GACGGCCCGGATCCGACCCGCNONE
J023013B10GACGGCCCGGATCCGACCCGCNONE
J023081I22GACGGCCCGGATCCGACCCGCNONE
J023084K19GACGGCCCGGATCCGACCCGCNONE
J023150E24GACGGCCCGGATCCGACCCGCNONE
J033023B18GACGGCCCGGATCCGACCCGCNONE
J033025F18GACGGCCCGGATCCGACCCGCNONE
J033048P08GACGGCCCGGATCCGACCCGCNONE
J033060M24GACGGCCCGGATCCGACCCGCNONE
J033070G06GACGGCCCGGATCCGACCCGCNONE
J033088P12GACGGCCCGGATCCGACCCGCNONE
J033105C13GACGGCCCGGATCCGACCCGCNONE
J043009N18GACGGCCCGGATCCGACCCGCNONE
J065103G21GACGGCCCGGATCCGACCCGCNONE
J075039H15GACGGCCCGGATCCGACCCGCNONE
J090014K10GACGGCCCGGATCCGACCCGCNONE
J090022N02GACGGCCCGGATCCGACCCGCNONE
J090033F18GACGGCCCGGATCCGACCCGCNONE
J090033I04GACGGCCCGGATCCGACCCGCNONE
J090041F11GACGGCCCGGATCCGACCCGCNONE
J090045P20GACGGCCCGGATCCGACCCGCNONE
J090054B01GACGGCCCGGATCCGACCCGCNONE
J090055M12GACGGCCCGGATCCGACCCGCNONE
J090071K09GACGGCCCGGATCCGACCCGCNONE
J090098O16GACGGCCCGGATCCGACCCGCNONE
J090099P15GACGGCCCGGATCCGACCCGCNONE
J100050I16GACGGCCCGGATCCGACCCGCNONE
Os02g0605600016-017-B02GATCCGACGGCCCGNONE
AK066104GATCCGACGGCCCGLUC7 related family protein.
J013052G16GATCCGACGGCCCGNONE
J043022E03GATCCGACGGCCCGNONE
J065105P10GATCCGACGGCCCGNONE
Os02g0626100003-107-B06ATCCGACGGNONE
AK120127ATCCGACGGNONE
Os02g0631000AK068667CCGTCGGATCConserved hypothetical protein.
J013159L03CCGTCGGATCNONE
J023119O20CCGTCGGATCNONE
J090098N20CCGTCGGATCNONE
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE
AK070079GATCCGACSimilar to C13 endopeptidase NP1 (Fragment).
AK101360GTGGCGTGGGCCGTCGGATCNONE
AY062178GTGGCGTGGGCCGTCGGATCNONE
J023043E22GTGGCGTGGGCCGTCGGATCNONE
J033024F05GTGGCGTGGGCCGTCGGATCNONE
J033035H01GTGGCGTGGGCCGTCGGATCNONE
J033042J19GTGGCGTGGGCCGTCGGATCNONE
J033057G18GTGGCGTGGGCCGTCGGATCNONE
J033111F09GTGGCGTGGGCCGTCGGATCNONE
J033115L11GTGGCGTGGGCCGTCGGATCNONE
J033143I16GTGGCGTGGGCCGTCGGATCNONE
J033143M21GTGGCGTGGGCCGTCGGATCNONE
J075072B10GTGGCGTGGGCCGTCGGATCNONE
J075072L04GTGGCGTGGGCCGTCGGATCNONE
J075088F01GTGGCGTGGGCCGTCGGATCNONE
J075196H23GTGGCGTGGGCCGTCGGATCNONE
Os02g0658100AK064728CGTCGGATCNONE
Os02g0745100012-001-A06GATCCGACNONE
AK069842GATCCGACSimilar to NOD26-like membrane integral protein ZmNIP2-1.
J023031E16GATCCGACNONE
J065089L08GATCCGACNONE
J100042F04GATCCGACNONE
J100051L18GATCCGACNONE
J100057I03GATCCGACNONE
J100060A19GATCCGACNONE
J100060N02GATCCGACNONE
J100062M17GATCCGACNONE
J100068P18GATCCGACNONE
J100088O22GATCCGACNONE
Os02g0760500009-140-F05GATCCGACGGNONE
AK062958GATCCGACGGSimilar to ER6 protein (Fragment).
J065057E02GATCCGACGGNONE
J075060D20GATCCGACGGNONE
J090090E17GATCCGACGGNONE
Os02g0762400AK103084CCGTCGGATCGGCyclin-dependent kinase inhibitor family protein.
Os02g0767700AK071237CCGTCGGAConserved hypothetical protein.
J023086E09CCGTCGGANONE
J075002J17CCGTCGGANONE
J075016K13CCGTCGGANONE
J075017J06CCGTCGGANONE
J075041J23CCGTCGGANONE
J075067D22CCGTCGGANONE
J075073N10CCGTCGGANONE
J075118N03CCGTCGGANONE
J075135A02CCGTCGGANONE
J075135L09CCGTCGGANONE
J075144D06CCGTCGGANONE
J075157I20CCGTCGGANONE
J075168J16CCGTCGGANONE
J075183A03CCGTCGGANONE
J075186M12CCGTCGGANONE
J075188F18CCGTCGGANONE
Os02g0785000AK103670ATCCGACGGlycosyl transferase, family 31 protein.
J065179I04ATCCGACGNONE
J065179J03ATCCGACGNONE
Os02g0797600004-004-A08ATCCGACGGNONE
006-050-H07ATCCGACGGNONE
006-092-B02ATCCGACGGNONE
006-100-B08ATCCGACGGNONE
013-037-D09ATCCGACGGNONE
013-068-H02ATCCGACGGNONE
AK060857ATCCGACGGNONE
AK098882ATCCGACGGNONE
AK104474ATCCGACGGNONE
AK120644ATCCGACGGConserved hypothetical protein.
J013001F21ATCCGACGGNONE
J013074D07ATCCGACGGNONE
J013096H23ATCCGACGGNONE
J013098H07ATCCGACGGNONE
J013132L13ATCCGACGGNONE
J013134K05ATCCGACGGNONE
J013155B15ATCCGACGGNONE
J023002L17ATCCGACGGNONE
J023013B08ATCCGACGGNONE
J023087I01ATCCGACGGNONE
J033071O04ATCCGACGGNONE
J065161N23ATCCGACGGNONE
J075055G11ATCCGACGGNONE
J075106J02ATCCGACGGNONE
J080009D06ATCCGACGGNONE
J080009N22ATCCGACGGNONE
J080016L03ATCCGACGGNONE
J080023E17ATCCGACGGNONE
J080027A12ATCCGACGGNONE
J080036M24ATCCGACGGNONE
J080038N07ATCCGACGGNONE
J080041A04ATCCGACGGNONE
J080042K11ATCCGACGGNONE
J080050A04ATCCGACGGNONE
J080053G16ATCCGACGGNONE
J080063D03ATCCGACGGNONE
J080063F07ATCCGACGGNONE
J080067H13ATCCGACGGNONE
J080068F12ATCCGACGGNONE
J080072G17ATCCGACGGNONE
J080072I06ATCCGACGGNONE
J080072J24ATCCGACGGNONE
J080076G09ATCCGACGGNONE
J080085H10ATCCGACGGNONE
J080092I17ATCCGACGGNONE
J080092N20ATCCGACGGNONE
J080093G10ATCCGACGGNONE
J090074C23ATCCGACGGNONE
J090083O18ATCCGACGGNONE
J100046M05ATCCGACGGNONE
J100050N16ATCCGACGGNONE
J100054D07ATCCGACGGNONE
J100054O11ATCCGACGGNONE
J100055F04ATCCGACGGNONE
J100055H22ATCCGACGGNONE
J100063A05ATCCGACGGNONE
J100063I24ATCCGACGGNONE
J100067I12ATCCGACGGNONE
J100074A22ATCCGACGGNONE
J100078B22ATCCGACGGNONE
J100079B03ATCCGACGGNONE
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein.
Os03g0174300AK067994GTCGGATCExostosin-like family protein.
Os03g0177100AK068092ATCCGACGGTCCAGAConserved hypothetical protein.
J100036F01ATCCGACGGTCCAGANONE
J100040N06ATCCGACGGTCCAGANONE
J100043E08ATCCGACGGTCCAGANONE
Os03g0179400AK107046ATCCGACGSimilar to Avr9/Cf-9 induced kinase 1.
Os03g0180400006-067-C02ATCCGACGNONE
006-091-E05ATCCGACGNONE
006-094-F06ATCCGACGNONE
009-126-C06ATCCGACGNONE
AB026558ATCCGACGNONE
AK059929ATCCGACGNONE
AK060026ATCCGACGNONE
AK101031ATCCGACGProteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (20S proteasome subunit alpha-1).
AK104324ATCCGACGNONE
J023001I24ATCCGACGNONE
J023150K05ATCCGACGNONE
J033086P06ATCCGACGNONE
J043017O21ATCCGACGNONE
J043021K10ATCCGACGNONE
J053034G22ATCCGACGNONE
J053055G07ATCCGACGNONE
J053095K16ATCCGACGNONE
J065012G02ATCCGACGNONE
J065022K22ATCCGACGNONE
J065030B18ATCCGACGNONE
J065030N19ATCCGACGNONE
J065032A17ATCCGACGNONE
J065032G24ATCCGACGNONE
J065040M17ATCCGACGNONE
J065071D18ATCCGACGNONE
J065072E08ATCCGACGNONE
J065085G14ATCCGACGNONE
J065091H03ATCCGACGNONE
J065108B21ATCCGACGNONE
J065120G08ATCCGACGNONE
J065124L20ATCCGACGNONE
J065130M23ATCCGACGNONE
J065138N18ATCCGACGNONE
J065150F03ATCCGACGNONE
J065169L24ATCCGACGNONE
J065173G21ATCCGACGNONE
J065201E10ATCCGACGNONE
J065209P07ATCCGACGNONE
J065218B04ATCCGACGNONE
J075062P08ATCCGACGNONE
J075097O11ATCCGACGNONE
J090060L06ATCCGACGNONE
J090067F04ATCCGACGNONE
J090074G17ATCCGACGNONE
Os03g0191200AK070228CCGTCGGAWW/Rsp5/WWP domain containing protein.
Os03g0213600AK100407CCGTCGGATCConserved hypothetical protein.
Os03g0217900AK119980CCGTCGGATCConserved hypothetical protein.
J053089K18CCGTCGGATCNONE
J090058B20CCGTCGGATCNONE
J090081L09CCGTCGGATCNONE
Os03g0275700AK111329TCCGACGGConserved hypothetical protein.
Os03g0276500011-014-A06ATCCGACGGNONE
012-043-E04ATCCGACGGNONE
012-096-G01ATCCGACGGNONE
014-005-A07ATCCGACGGNONE
014-031-F09ATCCGACGGNONE
014-040-C09ATCCGACGGNONE
014-092-G02ATCCGACGGNONE
AK072830ATCCGACGGNONE
AK099275ATCCGACGGNONE
AK109474ATCCGACGGSimilar to Heat shock protein 70.
J013036E08ATCCGACGGNONE
J013047P03ATCCGACGGNONE
J013048H14ATCCGACGGNONE
J013060E24ATCCGACGGNONE
J013093N10ATCCGACGGNONE
J013123K11ATCCGACGGNONE
J013153C09ATCCGACGGNONE
J023010D20ATCCGACGGNONE
J023027O13ATCCGACGGNONE
J023029B01ATCCGACGGNONE
J023063G14ATCCGACGGNONE
J023083D09ATCCGACGGNONE
J023091M13ATCCGACGGNONE
J023121M10ATCCGACGGNONE
J023126D10ATCCGACGGNONE
J023139H01ATCCGACGGNONE
J023145B18ATCCGACGGNONE
J033029G15ATCCGACGGNONE
J033050K13ATCCGACGGNONE
J033057L09ATCCGACGGNONE
J033092M15ATCCGACGGNONE
J065007N14ATCCGACGGNONE
J065038E07ATCCGACGGNONE
J065043A09ATCCGACGGNONE
J065100C19ATCCGACGGNONE
J065117C02ATCCGACGGNONE
J065213I04ATCCGACGGNONE
J090001F01ATCCGACGGNONE
J090025D07ATCCGACGGNONE
J090037C11ATCCGACGGNONE
J090047N11ATCCGACGGNONE
J090053O05ATCCGACGGNONE
J090070F11ATCCGACGGNONE
J090082O16ATCCGACGGNONE
J090085F20ATCCGACGGNONE
J090096N08ATCCGACGGNONE
Os03g0279200009-097-C06GATCCGACNONE
013-007-B07GATCCGACNONE
AK121750GATCCGACSimilar to Histone H2A.
J033087I02GATCCGACNONE
J065002G20GATCCGACNONE
J065102M04GATCCGACNONE
J065139A02GATCCGACNONE
J075109D21GATCCGACNONE
J075191L12GATCCGACNONE
J090096C03GATCCGACNONE
J100036C23GATCCGACNONE
Os03g0294200AK069285ATCCGACGSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase.
Os03g0320500AK108145ATCCGACGVQ domain containing protein.
J065122I01ATCCGACGNONE
J100057H12ATCCGACGNONE
J100078A15ATCCGACGNONE
Os03g0323100009-108-G02CGGGTGGGGCGTCGGATCNONE
AK062803CGGGTGGGGCGTCGGATCHypothetical protein.
AK070776CGGGTGGGGCGTCGGATCNONE
Os03g0323200AK067323GATCCGACGCCCCACCCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor.
Os03g0335100AK107094CCGATCCGACConserved hypothetical protein.
Os03g0337600AF119232ATCCGACGNONE
AK070859ATCCGACGSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment).
J013110I18ATCCGACGNONE
J013147M17ATCCGACGNONE
J065083M01ATCCGACGNONE
J065199H24ATCCGACGNONE
Os03g0343500009-042-G06CCGTCGGATCNONE
009-063-D01CCGTCGGATCNONE
009-156-H09CCGTCGGATCNONE
AB117995CCGTCGGATCNONE
AK058737CCGTCGGATCNONE
AK059599CCGTCGGATCSimilar to 60S ribosomal protein L22-2.
AK121502CCGTCGGATCNONE
J023082D10CCGTCGGATCNONE
J033022G11CCGTCGGATCNONE
J075048M16CCGTCGGATCNONE
J075049O20CCGTCGGATCNONE
J075082I02CCGTCGGATCNONE
J075105G01CCGTCGGATCNONE
J075131K05CCGTCGGATCNONE
J080002H01CCGTCGGATCNONE
J080003H01CCGTCGGATCNONE
J080005G08CCGTCGGATCNONE
J080011M13CCGTCGGATCNONE
J080020M02CCGTCGGATCNONE
J080026N24CCGTCGGATCNONE
J080028L09CCGTCGGATCNONE
J080032O14CCGTCGGATCNONE
J080033J12CCGTCGGATCNONE
J080035D05CCGTCGGATCNONE
J080039H01CCGTCGGATCNONE
J080044B07CCGTCGGATCNONE
J080044E23CCGTCGGATCNONE
J080049N11CCGTCGGATCNONE
J080050A21CCGTCGGATCNONE
J080055L24CCGTCGGATCNONE
J080059N20CCGTCGGATCNONE
J080061F04CCGTCGGATCNONE
J080078I16CCGTCGGATCNONE
J080079G24CCGTCGGATCNONE
J080080K13CCGTCGGATCNONE
J080083G20CCGTCGGATCNONE
J080087B08CCGTCGGATCNONE
J080091L19CCGTCGGATCNONE
J080094D06CCGTCGGATCNONE
J090038L06CCGTCGGATCNONE
J090075H06CCGTCGGATCNONE
J090081D12CCGTCGGATCNONE
Os03g0376000AK059565CCGATCCGACemp24/gp25L/p24 family protein.
Os03g0410700J065102A22CCGTCGGANONE
Os03g0410900J065067F10TCCGACGGNONE
J065073D08TCCGACGGNONE
J065176C06TCCGACGGNONE
J065189O13TCCGACGGNONE
J065214E05TCCGACGGNONE
J080007H09TCCGACGGNONE
J080012B19TCCGACGGNONE
J080020J16TCCGACGGNONE
J080038J22TCCGACGGNONE
J080045I09TCCGACGGNONE
J080059M16TCCGACGGNONE
J080060C19TCCGACGGNONE
J080080P22TCCGACGGNONE
J080083C03TCCGACGGNONE
J080093M17TCCGACGGNONE
J100029F12TCCGACGGLike-Sm ribonucleoprotein, core family protein.
Os03g0421800AK099491CCGATCCGACCGTTGVirulence factor, pectin lyase fold family protein.
J065198F08CCGATCCGACCGTTGNONE
Os03g0428800AK060233CCGTCGGATetratricopeptide-like helical domain containing protein.
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39.
J023106M18CCGATCCGACGGCCCGNONE
J065178J05CCGATCCGACGGCCCGNONE
J065196F10CCGATCCGACGGCCCGNONE
Os03g0577200006-030-H11ATCCGACGGCCCAGGNONE
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A).
AK098953ATCCGACGGCCCAGGNONE
AK099558ATCCGACGGCCCAGGNONE
AK104547ATCCGACGGCCCAGGNONE
J013034B14ATCCGACGGCCCAGGNONE
J013066J17ATCCGACGGCCCAGGNONE
J090033N14ATCCGACGGCCCAGGNONE
Os03g0633800AK073044GATCCGACGGCCCSimilar to IAA6 (Fragment).
J065038L22GATCCGACGGCCCNONE
J065185C13GATCCGACGGCCCNONE
Os03g0654800013-068-E05CCGTCGGATNONE
AK103330CCGTCGGATHypothetical protein.
J033125N05CCGTCGGATNONE
J065171F15CCGTCGGATNONE
J100056J05CCGTCGGATNONE
J100069D02CCGTCGGATNONE
Os03g0722500AK099926CCGTCGGATCGGGlycoside hydrolase, family 17 protein.
AK100108CCGTCGGATCGGNONE
J023004N24CCGTCGGATCGGNONE
J100018K24CCGTCGGATCGGNONE
J100032B22CCGTCGGATCGGNONE
J100036K14CCGTCGGATCGGNONE
J100043B05CCGTCGGATCGGNONE
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein.
J065100I07ATCCGACGGCCCAGGNONE
Os03g0745600014-030-E09CGCCACGTCGGATCNONE
J053057E07CGCCACGTCGGATCNONE
J075044L08CGCCACGTCGGATCNONE
J075069C24CGCCACGTCGGATCNONE
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein.
J075180G21CGCCACGTCGGATCNONE
J075189M22CGCCACGTCGGATCNONE
J075192P11CGCCACGTCGGATCNONE
Os03g0753500005-012-D10GTCGGATCGGNONE
016-012-D03GTCGGATCGGNONE
016-078-D06GTCGGATCGGNONE
016-079-A05GTCGGATCGGNONE
AK070136GTCGGATCGGProtein of unknown function DUF1618 domain containing protein.
AK100468GTCGGATCGGNONE
AK103935GTCGGATCGGNONE
J013089F06GTCGGATCGGNONE
J013111N14GTCGGATCGGNONE
J023004F15GTCGGATCGGNONE
J023049P09GTCGGATCGGNONE
J023084E09GTCGGATCGGNONE
J023085A02GTCGGATCGGNONE
J023092H12GTCGGATCGGNONE
J023109O13GTCGGATCGGNONE
J033045G16GTCGGATCGGNONE
J033050A05GTCGGATCGGNONE
J033060G05GTCGGATCGGNONE
J033100F08GTCGGATCGGNONE
J033103M12GTCGGATCGGNONE
J033105K21GTCGGATCGGNONE
J033125H09GTCGGATCGGNONE
J033138H14GTCGGATCGGNONE
J043012H09GTCGGATCGGNONE
J090051L22GTCGGATCGGNONE
J090066M07GTCGGATCGGNONE
J090070J09GTCGGATCGGNONE
J090077M02GTCGGATCGGNONE
J100019P19GTCGGATCGGNONE
J100024M18GTCGGATCGGNONE
J100035E21GTCGGATCGGNONE
J100050C07GTCGGATCGGNONE
Os03g0753600AK067449CCGTCGGATCChromo domain containing protein.
J013107L13CCGTCGGATCNONE
Os03g0758800AJ252135GATCCGACGGNONE
AJ312906GATCCGACGGNONE
AK060387GATCCGACGGSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D).
AK121592GATCCGACGGNONE
J023109G09GATCCGACGGNONE
J033038B14GATCCGACGGNONE
J043013C09GATCCGACGGNONE
J053096E21GATCCGACGGNONE
J065026B08GATCCGACGGNONE
J065062B16GATCCGACGGNONE
J065066E03GATCCGACGGNONE
J065091J12GATCCGACGGNONE
J065164A06GATCCGACGGNONE
J075014I20GATCCGACGGNONE
J075117N07GATCCGACGGNONE
J075142M03GATCCGACGGNONE
J075175D04GATCCGACGGNONE
J075188M01GATCCGACGGNONE
J075199I20GATCCGACGGNONE
J090010J12GATCCGACGGNONE
J090025O16GATCCGACGGNONE
J090041H05GATCCGACGGNONE
J090078P07GATCCGACGGNONE
J100031K10GATCCGACGGNONE
J100055F23GATCCGACGGNONE
J100064G05GATCCGACGGNONE
J100080C24GATCCGACGGNONE
J100080O07GATCCGACGGNONE
J100090F01GATCCGACGGNONE
Os03g0782500AK105637GATCCGACBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os03g0789800AK106804ATCCGACGNONE
AK106804TCCGACGGNONE
J065068E17ATCCGACGNONE
J065068E17TCCGACGGNONE
J090016H22ATCCGACGNONE
J090016H22TCCGACGGNONE
Os03g0800400AK071430GTCGGATCProtein of unknown function DUF1618 domain containing protein.
J023019H20GTCGGATCNONE
J023097A10GTCGGATCNONE
J023100K15GTCGGATCNONE
J075095I09GTCGGATCNONE
J090014B19GTCGGATCNONE
J090072D02GTCGGATCNONE
J100029E17GTCGGATCNONE
J100047F04GTCGGATCNONE
Os03g0820600013-030-F01ATCCGACGNONE
AK058941ATCCGACGSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3).
J065038I10ATCCGACGNONE
J065043C23ATCCGACGNONE
J065060H20ATCCGACGNONE
J065065E06ATCCGACGNONE
J065078K18ATCCGACGNONE
J065116J24ATCCGACGNONE
J065118G22ATCCGACGNONE
J065129D16ATCCGACGNONE
J065153G20ATCCGACGNONE
J065159I03ATCCGACGNONE
J065176E14ATCCGACGNONE
J065187B11ATCCGACGNONE
J065203D14ATCCGACGNONE
J065217P15ATCCGACGNONE
J075105D14ATCCGACGNONE
J100036F11ATCCGACGNONE
J100044M07ATCCGACGNONE
Os03g0825700AK067902GATCCGACSimilar to Defective in exine formation.
Os03g0830500AK071173GATCCGACSimilar to PGPS/D12.
J023082F07GATCCGACNONE
J065024E21GATCCGACNONE
J065100L04GATCCGACNONE
Os03g0848600AK065662ATCCGACGSimilar to NOI protein.
J013041L20ATCCGACGNONE
J053074F15ATCCGACGNONE
J090098L10ATCCGACGNONE
Os04g0105500AK068066CCGTCGGANONE
AK071444CCGTCGGASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis.
J013130G18CCGTCGGANONE
J023093I17CCGTCGGANONE
J033079J01CCGTCGGANONE
J043027J02CCGTCGGANONE
J065135G05CCGTCGGANONE
Os04g0253000005-012-H08ATCCGACGGNONE
009-095-D01ATCCGACGGNONE
016-090-D11ATCCGACGGNONE
AK073668ATCCGACGGSimilar to Histone H1.
J013088G23ATCCGACGGNONE
J013162C07ATCCGACGGNONE
J023031N06ATCCGACGGNONE
J023039N07ATCCGACGGNONE
J023083I01ATCCGACGGNONE
J023083O14ATCCGACGGNONE
J023122B19ATCCGACGGNONE
J023133L08ATCCGACGGNONE
J033052L06ATCCGACGGNONE
J033080E10ATCCGACGGNONE
J090032L14ATCCGACGGNONE
J100022N05ATCCGACGGNONE
J100029A08ATCCGACGGNONE
J100029H18ATCCGACGGNONE
J100066D09ATCCGACGGNONE
J100077M22ATCCGACGGNONE
Os04g0269900J065139P11CGTCGGATCGGNONE
J100034P12CGTCGGATCGGNONE
J100045D21CGTCGGATCGGNONE
Os04g0304200AB018443CCGTCGGANONE
AK067128CCGTCGGASimilar to Nonphototropic hypocotyl protein 1 (EC 2.7.1.37) (Phototropin).
Os04g0401000006-024-G01GATCCGACGGNONE
009-047-D03GATCCGACGGNONE
009-078-G04GATCCGACGGNONE
009-083-C06GATCCGACGGNONE
009-094-D02GATCCGACGGNONE
009-129-B02GATCCGACGGNONE
009-186-E03GATCCGACGGNONE
AK070581GATCCGACGGNONE
AK072320GATCCGACGGNONE
AK106153GATCCGACGGHeavy metal transport/detoxification protein domain containing protein.
Os04g0405600015-003-G04ATCCGACGGNONE
AK068579ATCCGACGGProtein of unknown function DUF1350 family protein.
AK101565ATCCGACGGNONE
J013023M11ATCCGACGGNONE
J013055A13ATCCGACGGNONE
J013157C11ATCCGACGGNONE
J033128I12ATCCGACGGNONE
J065193N19ATCCGACGGNONE
J090055C15ATCCGACGGNONE
J090058C22ATCCGACGGNONE
J090077L18ATCCGACGGNONE
J090086C04ATCCGACGGNONE
J090095D03ATCCGACGGNONE
J100040K04ATCCGACGGNONE
J100040M11ATCCGACGGNONE
Os04g0449100AK110929CCGTCGGATXyloglucan fucosyltransferase family protein.
Os04g0470300AK059742ATCCGACGGNONE
AK070483ATCCGACGGProtein of unknown function UPF0136, Transmembrane family protein.
J065200F06ATCCGACGGNONE
J090047A18ATCCGACGGNONE
Os04g0484900AK122179GATCCGACGGSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis.
J023093A12GATCCGACGGNONE
J033024H07GATCCGACGGNONE
J033149C03GATCCGACGGNONE
Os04g0491500AK068089GTCGGATCGGNONE
AK101116GTCGGATCGGTGF-beta receptor, type I/II extracellular region family protein.
Os04g0530300009-053-E04CGTCGGATCGGNONE
009-074-E03CGTCGGATCGGNONE
AK066705CGTCGGATCGGConserved hypothetical protein.
Os04g0542900AK068610CGACACGTCGGATCConserved hypothetical protein.
Os04g0576300J065199E10GATCCGACGPseudouridylate synthase TruB, N-terminal domain containing protein.
Os04g0612600AB042115TCCGACGGGCCCACCTNONE
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit.
AK099008TCCGACGGGCCCACCTNONE
AK104427TCCGACGGGCCCACCTNONE
J023043H02TCCGACGGGCCCACCTNONE
J033033I23TCCGACGGGCCCACCTNONE
J033067P21TCCGACGGGCCCACCTNONE
J033088M21TCCGACGGGCCCACCTNONE
J033133M08TCCGACGGGCCCACCTNONE
J043030I16TCCGACGGGCCCACCTNONE
J075049H08TCCGACGGGCCCACCTNONE
Os04g0627900AK108443ATCCGACGTranslation initiation factor SUI1 domain containing protein.
AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein.
J065178D17ATCCGACGNONE
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE
Os04g0660100AK109923GATCCGACHelix-loop-helix DNA-binding domain containing protein.
J065042A13GATCCGACNONE
J100043N14GATCCGACNONE
Os04g0661300AK070723ATCCGACGGConserved hypothetical protein.
AK103942ATCCGACGGNONE
Os04g0668700012-043-D01ATCCGACGNONE
AK065237ATCCGACGPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein.
J013002G17ATCCGACGNONE
J013002I02ATCCGACGNONE
J013059C11ATCCGACGNONE
J013059D22ATCCGACGNONE
J013063G18ATCCGACGNONE
J013088O04ATCCGACGNONE
J013095K03ATCCGACGNONE
J013096K15ATCCGACGNONE
J013100O17ATCCGACGNONE
J013102F10ATCCGACGNONE
J013111L07ATCCGACGNONE
J013127E24ATCCGACGNONE
J013130A10ATCCGACGNONE
J013134L13ATCCGACGNONE
J023109G08ATCCGACGNONE
J033022E17ATCCGACGNONE
J033022N13ATCCGACGNONE
J033026D04ATCCGACGNONE
J033028M05ATCCGACGNONE
J033037E04ATCCGACGNONE
J033042D11ATCCGACGNONE
J033044N20ATCCGACGNONE
J033046K11ATCCGACGNONE
J033046M21ATCCGACGNONE
J033076E19ATCCGACGNONE
J033076J24ATCCGACGNONE
J033086N03ATCCGACGNONE
J033095F22ATCCGACGNONE
J033115F17ATCCGACGNONE
J033117M06ATCCGACGNONE
J033125D22ATCCGACGNONE
J033129J10ATCCGACGNONE
J033145E18ATCCGACGNONE
J043021F24ATCCGACGNONE
J053046G14ATCCGACGNONE
J053090P03ATCCGACGNONE
J065042N10ATCCGACGNONE
J065053B13ATCCGACGNONE
J065085G03ATCCGACGNONE
J065173J11ATCCGACGNONE
J090014M14ATCCGACGNONE
J090027J07ATCCGACGNONE
J090039E23ATCCGACGNONE
J090051C15ATCCGACGNONE
J090055H06ATCCGACGNONE
J090062L03ATCCGACGNONE
J100017L21ATCCGACGNONE
J100024B07ATCCGACGNONE
J100032G07ATCCGACGNONE
J100040N09ATCCGACGNONE
J100062N03ATCCGACGNONE
J100078E07ATCCGACGNONE
J100080E14ATCCGACGNONE
J100084D07ATCCGACGNONE
Os04g0677400AK069563CCGTCGGANONE
AK069752CCGTCGGAProtein of unknown function DUF639 family protein.
J023022G06CCGTCGGANONE
J023030K02CCGTCGGANONE
J023030L01CCGTCGGANONE
Os05g0110900AK073169CCGTTGGATGCCCATCCGACGGSimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-).
Os05g0127300AK106429CCGATCCGACGCGTCCGTCCGNONE
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein.
J065021F23CCGATCCGACGCGTCCGTCCGNONE
J100041J04CCGATCCGACGCGTCCGTCCGNONE
Os05g0129400AK102359ATCCGACGTGGCAnkyrin repeat containing protein.
J033091I05ATCCGACGTGGCNONE
Os05g0146100AK106767GTCGGATCPeptidase, trypsin-like serine and cysteine domain containing protein.
Os05g0151200J065041L18ATCCGACGTspO/MBR-related protein family protein.
J065168L08ATCCGACGNONE
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein.
AK103412CCGATCCGACGGCCCAGANONE
J023045H21CCGATCCGACGGCCCAGANONE
J033128G01CCGATCCGACGGCCCAGANONE
J065017O10CCGATCCGACGGCCCAGANONE
J065032H11CCGATCCGACGGCCCAGANONE
J065120G09CCGATCCGACGGCCCAGANONE
Os05g0176100AF030052ATCCGACGGNONE
AF030052ATCCGACGGCCGAGATNONE
AK067850ATCCGACGGNONE
AK067850ATCCGACGGCCGAGATNONE
AK067967ATCCGACGGNONE
AK067967ATCCGACGGCCGAGATNONE
AK098978ATCCGACGGNONE
AK098978ATCCGACGGCCGAGATNONE
AK099228ATCCGACGGNONE
AK099228ATCCGACGGCCGAGATNONE
AK099281ATCCGACGGNONE
AK099281ATCCGACGGCCGAGATNONE
AK100188ATCCGACGGSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment).
AK100188ATCCGACGGCCGAGATSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment).
AK102140ATCCGACGGNONE
AK102140ATCCGACGGCCGAGATNONE
Os05g0189900AK061489ATCCGACGGVirulence factor, pectin lyase fold family protein.
Os05g0249100016-087-B02CGTCGGATNONE
AK064291CGTCGGATConserved hypothetical protein.
AK103049CGTCGGATNONE
J033117G22CGTCGGATNONE
J065021C19CGTCGGATNONE
J065205P17CGTCGGATNONE
Os05g0379300AK109293CCGTCGGATConserved hypothetical protein.
Os05g0388500AK065313TTTTGGGCCCAATCCGACGSimilar to 50S ribosomal protein L1.
AK098990TTTTGGGCCCAATCCGACGNONE
AK104689TTTTGGGCCCAATCCGACGNONE
J013094L23TTTTGGGCCCAATCCGACGNONE
J065118O04TTTTGGGCCCAATCCGACGNONE
Os05g0395300AK066212CGGACGGCATCCGACGGProtein of unknown function DUF21 domain containing protein.
AK066212GATCCGACProtein of unknown function DUF21 domain containing protein.
Os05g0399300AK108949TCCGACGGCGTGGGCTNONE
Os05g0400700009-099-F02GATCCGACGGNONE
AK072739GATCCGACGGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5).
AK103913GATCCGACGGNONE
J023138C10GATCCGACGGNONE
Os05g0411600AK101609CGTCGGATCCGACSingle-stranded nucleic acid binding R3H domain containing protein.
AY224459CGTCGGATCCGACNONE
J065042L01CGTCGGATCCGACNONE
J100068I05CGTCGGATCCGACNONE
J100075L14CGTCGGATCCGACNONE
Os05g0414200015-033-G02TCCGACGGCGGCCCGGCCNONE
AK106297TCCGACGGCGGCCCGGCCDisease resistance protein family protein.
Os05g0415600AK065818CCGTCGGATCNONE
J013042K21CCGTCGGATCNONE
J013114E15CCGTCGGATCNONE
J013131H02CCGTCGGATCNONE
J023041G06CCGTCGGATCNONE
J100037M21CCGTCGGATCNONE
Os05g0422900AK073629GATCCGACGConserved hypothetical protein.
J023126I07GATCCGACGNONE
J023143K12GATCCGACGNONE
J033051N08GATCCGACGNONE
J033128I04GATCCGACGNONE
J065067M02GATCCGACGNONE
J080312N05GATCCGACGNONE
J100032G23GATCCGACGNONE
Os05g0429700AK069203CGTTGGATGGGGATCCGACGGNONE
AK103559CGTTGGATGGGGATCCGACGGC2 calcium/lipid-binding region, CaLB domain containing protein.
Os05g0430200J090095K16ATCCGACGGCCCGNONE
Os05g0435800AK067138GTCGGATCSimilar to Subtilisin-like protease.
J013096L15GTCGGATCNONE
J023003D11GTCGGATCNONE
Os05g0454400AK107942ATCCGACGConserved hypothetical protein.
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH.
Os05g0460000011-074-F09ATCCGACGGNONE
J023002L01ATCCGACGGNONE
J023060I12ATCCGACGGNONE
J023060O12ATCCGACGGNONE
J023106P08ATCCGACGGNONE
J023141D17ATCCGACGGNONE
J023150E11ATCCGACGGSimilar to 70 kDa heat shock cognate protein 1.
J033030A20ATCCGACGGNONE
J033039H14ATCCGACGGNONE
J033101B11ATCCGACGGNONE
J033101B12ATCCGACGGNONE
J033114A09ATCCGACGGNONE
J090037G06ATCCGACGGNONE
J090048G13ATCCGACGGNONE
J090090F15ATCCGACGGNONE
Os05g0506000AF031609CCGTCGGATCAGGCCCCGCGTCGCNONE
AK062012CCGTCGGATCAGGCCCCGCGTCGCNONE
AK098900CCGTCGGATCAGGCCCCGCGTCGCNONE
AK122090CCGTCGGATCAGGCCCCGCGTCGCSimilar to MS5-like protein (Fragment).
J013002B13CCGTCGGATCAGGCCCCGCGTCGCNONE
J023149G13CCGTCGGATCAGGCCCCGCGTCGCNONE
J033123O20CCGTCGGATCAGGCCCCGCGTCGCNONE
J080315O17CCGTCGGATCAGGCCCCGCGTCGCNONE
Os05g0552300AK062179ATCCGACGGSimilar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD).
AK065272ATCCGACGGNONE
AK121567ATCCGACGGNONE
J013002L07ATCCGACGGNONE
J013096F06ATCCGACGGNONE
J013111B06ATCCGACGGNONE
J023024K23ATCCGACGGNONE
J023036P19ATCCGACGGNONE
J033034A18ATCCGACGGNONE
J033034P13ATCCGACGGNONE
J033051E12ATCCGACGGNONE
J033087M05ATCCGACGGNONE
J033092G03ATCCGACGGNONE
J033098N21ATCCGACGGNONE
J033103B15ATCCGACGGNONE
J043038F23ATCCGACGGNONE
J065096K22ATCCGACGGNONE
J065167D17ATCCGACGGNONE
J100040H06ATCCGACGGNONE
J100048M06ATCCGACGGNONE
J100087G01ATCCGACGGNONE
Os05g0571800009-157-G07ATCCGACGGNONE
AK063033ATCCGACGGConserved hypothetical protein.
Os05g0574500006-021-A08ATCCGACGGCCGAAANONE
006-049-A11ATCCGACGGCCGAAANONE
006-086-F03ATCCGACGGCCGAAANONE
009-051-F06ATCCGACGGCCGAAANONE
AB015287ATCCGACGGCCGAAANONE
AB015972ATCCGACGGCCGAAANONE
AK061714ATCCGACGGCCGAAANONE
AK098889ATCCGACGGCCGAAANONE
AK121699ATCCGACGGCCGAAASimilar to GTP-binding nuclear protein Ran1B (Fragment).
J013001L15ATCCGACGGCCGAAANONE
J013072D17ATCCGACGGCCGAAANONE
J023028M04ATCCGACGGCCGAAANONE
J023031F01ATCCGACGGCCGAAANONE
J023114L22ATCCGACGGCCGAAANONE
J033058L12ATCCGACGGCCGAAANONE
J033073D17ATCCGACGGCCGAAANONE
J043031D08ATCCGACGGCCGAAANONE
J043036G01ATCCGACGGCCGAAANONE
J065144O04ATCCGACGGCCGAAANONE
J065181O08ATCCGACGGCCGAAANONE
J080066B20ATCCGACGGCCGAAANONE
Os05g0591400AK120015GATCCGACGGHeat shock protein Hsp70 family protein.
Os05g0592600011-064-D09ATCCGACGNONE
015-032-B11ATCCGACGNONE
AK073484ATCCGACGInitiation factor 2 family protein.
AK099632ATCCGACGNONE
Os05g0594500AK100617TCCGACGGNONE
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase).
J075086I24ATCCGACGGCCCAGATNONE
J075127E23ATCCGACGGCCCAGATNONE
J075157B19ATCCGACGGCCCAGATNONE
J090038E06ATCCGACGGCCCAGATNONE
Os06g0153600AK099903CCGAGCCGTCGGATNONE
AK109685CCGAGCCGTCGGATConserved hypothetical protein.
Os06g0179200AK101156CCGTCGGASimilar to Nodulin-like protein.
J033025B06CCGTCGGANONE
J033027I22CCGTCGGANONE
J033030M16CCGTCGGANONE
J033068C12CCGTCGGANONE
J065158N16CCGTCGGANONE
Os06g0192600AB033535ATCCGACGGNONE
AB033535CCGTCGGATCNONE
AK061876ATCCGACGG26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7).
AK061876CCGTCGGATC26S proteasome regulatory particle triple-A ATPase subunit1 (26S protease regulatory subunit 7).
AK070538ATCCGACGGNONE
AK070538CCGTCGGATCNONE
AK100060ATCCGACGGNONE
AK100060CCGTCGGATCNONE
AK103801ATCCGACGGNONE
AK103801CCGTCGGATCNONE
Os06g0216100Os06g0216100TCCGACGGSimilar to Oxo-phytodienoic acid reductase (12-oxophytodienoic acid reductase).
Os06g0265000AK100247ATCCGACGGSimilar to Asparagine synthetase.
D83378ATCCGACGGNONE
J013033O15ATCCGACGGNONE
J013037K20ATCCGACGGNONE
J013058I07ATCCGACGGNONE
J033125M21ATCCGACGGNONE
J033142B02ATCCGACGGNONE
J043030E23ATCCGACGGNONE
J043034K11ATCCGACGGNONE
J053050B10ATCCGACGGNONE
J053061I09ATCCGACGGNONE
J053068F17ATCCGACGGNONE
J053074G11ATCCGACGGNONE
J053095N11ATCCGACGGNONE
J090028M17ATCCGACGGNONE
J090031O08ATCCGACGGNONE
J090094C22ATCCGACGGNONE
J100045M24ATCCGACGGNONE
J100055P03ATCCGACGGNONE
J100073O10ATCCGACGGNONE
J100081K21ATCCGACGGNONE
U55873ATCCGACGGNONE
Os06g0308300AK059211CCGTCGGATCGGNONE
AK101549CCGTCGGATCGGNONE
AK102553CCGTCGGATCGGSimilar to 65kD microtubule associated protein.
J090014G18CCGTCGGATCGGNONE
J090082B01CCGTCGGATCGGNONE
Os06g0320500004-013-F05GATCCGACGTGGCCCAATNONE
006-021-B06GATCCGACGTGGCCCAATNONE
006-021-D12GATCCGACGTGGCCCAATNONE
006-022-A12GATCCGACGTGGCCCAATNONE
006-024-B10GATCCGACGTGGCCCAATNONE
006-029-F07GATCCGACGTGGCCCAATNONE
006-029-H12GATCCGACGTGGCCCAATNONE
006-031-A05GATCCGACGTGGCCCAATNONE
006-033-C03GATCCGACGTGGCCCAATNONE
006-036-B12GATCCGACGTGGCCCAATNONE
006-048-C08GATCCGACGTGGCCCAATNONE
006-050-F03GATCCGACGTGGCCCAATNONE
006-051-C12GATCCGACGTGGCCCAATNONE
006-054-C03GATCCGACGTGGCCCAATNONE
006-057-D12GATCCGACGTGGCCCAATNONE
006-067-F01GATCCGACGTGGCCCAATNONE
006-071-G12GATCCGACGTGGCCCAATNONE
006-072-G11GATCCGACGTGGCCCAATNONE
006-072-H01GATCCGACGTGGCCCAATNONE
006-081-E02GATCCGACGTGGCCCAATNONE
006-082-A11GATCCGACGTGGCCCAATNONE
006-084-A04GATCCGACGTGGCCCAATNONE
006-085-C08GATCCGACGTGGCCCAATNONE
006-086-D03GATCCGACGTGGCCCAATNONE
006-088-B05GATCCGACGTGGCCCAATNONE
006-088-G02GATCCGACGTGGCCCAATNONE
006-092-G10GATCCGACGTGGCCCAATNONE
006-094-D11GATCCGACGTGGCCCAATNONE
006-094-E04GATCCGACGTGGCCCAATNONE
006-103-G12GATCCGACGTGGCCCAATNONE
006-106-G08GATCCGACGTGGCCCAATNONE
006-111-E06GATCCGACGTGGCCCAATNONE
006-114-C07GATCCGACGTGGCCCAATNONE
006-115-A04GATCCGACGTGGCCCAATNONE
006-117-G11GATCCGACGTGGCCCAATNONE
006-118-G09GATCCGACGTGGCCCAATNONE
009-010-F03GATCCGACGTGGCCCAATNONE
009-076-G01GATCCGACGTGGCCCAATNONE
009-134-E10GATCCGACGTGGCCCAATNONE
009-193-D07GATCCGACGTGGCCCAATNONE
AF094776GATCCGACGTGGCCCAATNONE
AK060904GATCCGACGTGGCCCAATSimilar to Light-harvesting complex I (Fragment).
AK098864GATCCGACGTGGCCCAATNONE
J013001A03GATCCGACGTGGCCCAATNONE
J013098P14GATCCGACGTGGCCCAATNONE
J013127B16GATCCGACGTGGCCCAATNONE
J013169J24GATCCGACGTGGCCCAATNONE
J023084H23GATCCGACGTGGCCCAATNONE
J023093F05GATCCGACGTGGCCCAATNONE
J033041I05GATCCGACGTGGCCCAATNONE
J065196G15GATCCGACGTGGCCCAATNONE
J075019K01GATCCGACGTGGCCCAATNONE
J075053H16GATCCGACGTGGCCCAATNONE
J075055M09GATCCGACGTGGCCCAATNONE
J075099G10GATCCGACGTGGCCCAATNONE
J075099L23GATCCGACGTGGCCCAATNONE
J075127I09GATCCGACGTGGCCCAATNONE
J080001C14GATCCGACGTGGCCCAATNONE
J080016B11GATCCGACGTGGCCCAATNONE
J080029C14GATCCGACGTGGCCCAATNONE
J080029I17GATCCGACGTGGCCCAATNONE
J080034F13GATCCGACGTGGCCCAATNONE
J080039E02GATCCGACGTGGCCCAATNONE
J080040N05GATCCGACGTGGCCCAATNONE
J080042O17GATCCGACGTGGCCCAATNONE
J080043N15GATCCGACGTGGCCCAATNONE
J080056K02GATCCGACGTGGCCCAATNONE
J080063N15GATCCGACGTGGCCCAATNONE
J080069H05GATCCGACGTGGCCCAATNONE
J080070N15GATCCGACGTGGCCCAATNONE
J080075J22GATCCGACGTGGCCCAATNONE
J080076F12GATCCGACGTGGCCCAATNONE
J080086G05GATCCGACGTGGCCCAATNONE
J090046G07GATCCGACGTGGCCCAATNONE
J090059H01GATCCGACGTGGCCCAATNONE
J090099C09GATCCGACGTGGCCCAATNONE
J100028E12GATCCGACGTGGCCCAATNONE
J100048J04GATCCGACGTGGCCCAATNONE
J100054O05GATCCGACGTGGCCCAATNONE
J100062C09GATCCGACGTGGCCCAATNONE
J100075C17GATCCGACGTGGCCCAATNONE
J100075C23GATCCGACGTGGCCCAATNONE
J100075I23GATCCGACGTGGCCCAATNONE
Os06g0518100AK119810CGTCGGATCConserved hypothetical protein.
Os06g0560400AK103575CCGATCCGACGTGTCCNONE
AK108074CCGATCCGACGTGTCCProtein of unknown function DUF862, eukaryotic domain containing protein.
Os06g0596300AK120303CCGTCGGATCSimilar to Acyl-ACP thioesterase (Fragment).
Os06g0604400AK072121CCGATCCGACSimilar to Phospholipase D.
Os06g0621300AK068751ATCCGACGConserved hypothetical protein.
J013159I20ATCCGACGNONE
Os06g0687900003-115-E01GGGCCGGCTCCGACGGNONE
AB054003GGGCCGGCTCCGACGGGlycosyl transferase, family 43 protein.
J065212N07GGGCCGGCTCCGACGGNONE
Os06g0696400011-019-C01CCGTCGGATNONE
011-027-D04CCGTCGGATNONE
013-051-H10CCGTCGGATNONE
013-054-A06CCGTCGGATNONE
013-061-D06CCGTCGGATNONE
013-088-F04CCGTCGGATNONE
014-018-C07CCGTCGGATNONE
014-026-E10CCGTCGGATNONE
AK058291CCGTCGGATNONE
AK066125CCGTCGGATNONE
AK104912CCGTCGGATNONE
BT014685CCGTCGGATSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase).
J013059H08CCGTCGGATNONE
J065065L22CCGTCGGATNONE
J065084O06CCGTCGGATNONE
J075006O13CCGTCGGATNONE
J075013J18CCGTCGGATNONE
J075018L23CCGTCGGATNONE
J075036E14CCGTCGGATNONE
J075039K21CCGTCGGATNONE
J075075H13CCGTCGGATNONE
J075091A14CCGTCGGATNONE
J075093I09CCGTCGGATNONE
J075136L17CCGTCGGATNONE
J075156M24CCGTCGGATNONE
J075174J01CCGTCGGATNONE
J075179P15CCGTCGGATNONE
J075181F02CCGTCGGATNONE
J075194L24CCGTCGGATNONE
J080302J02CCGTCGGATNONE
J080304J11CCGTCGGATNONE
J080308A15CCGTCGGATNONE
J100041B09CCGTCGGATNONE
Os06g0696500J080303G16CGTCGGATSimilar to Xyloglycan endo-transglycosylase precursor.
J080310K14CGTCGGATNONE
J080317J18CGTCGGATNONE
J080318F11CGTCGGATNONE
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein.
Os06g0698400AK108486GTCGGATCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2).
J023055K12GATCCGACGGCCCAGATNONE
J053032B13GATCCGACGGCCCAGATNONE
X82036GATCCGACGGCCCAGATNONE
Os06g0730200J065207O22GATCCGACNONE
Os07g0115500AK108206CCGTCGGAConserved hypothetical protein.
AK108206GATCCGACGGConserved hypothetical protein.
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J033042K24GATCCGACGGCCCGGANONE
J033136G07GATCCGACGGCCCGGANONE
J065092I12GATCCGACGGCCCGGANONE
J065132F04GATCCGACGGCCCGGANONE
J065143I11GATCCGACGGCCCGGANONE
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE
006-021-E02GATCCGACGTGGGCCAANONE
006-025-C06GATCCGACGTGGGCCAANONE
006-027-H11GATCCGACGTGGGCCAANONE
006-036-C05GATCCGACGTGGGCCAANONE
006-046-D07GATCCGACGTGGGCCAANONE
006-047-A02GATCCGACGTGGGCCAANONE
006-050-F02GATCCGACGTGGGCCAANONE
006-053-D07GATCCGACGTGGGCCAANONE
006-054-E06GATCCGACGTGGGCCAANONE
006-055-E01GATCCGACGTGGGCCAANONE
006-055-F01GATCCGACGTGGGCCAANONE
006-056-H12GATCCGACGTGGGCCAANONE
006-057-D07GATCCGACGTGGGCCAANONE
006-074-G10GATCCGACGTGGGCCAANONE
006-077-C02GATCCGACGTGGGCCAANONE
006-081-E01GATCCGACGTGGGCCAANONE
006-089-B08GATCCGACGTGGGCCAANONE
006-089-C10GATCCGACGTGGGCCAANONE
006-092-E07GATCCGACGTGGGCCAANONE
006-096-C11GATCCGACGTGGGCCAANONE
006-096-H06GATCCGACGTGGGCCAANONE
006-097-E07GATCCGACGTGGGCCAANONE
006-098-D03GATCCGACGTGGGCCAANONE
006-102-C05GATCCGACGTGGGCCAANONE
006-107-E09GATCCGACGTGGGCCAANONE
006-110-C09GATCCGACGTGGGCCAANONE
006-113-C01GATCCGACGTGGGCCAANONE
006-114-D09GATCCGACGTGGGCCAANONE
006-115-H06GATCCGACGTGGGCCAANONE
009-016-G06GATCCGACGTGGGCCAANONE
009-031-C05GATCCGACGTGGGCCAANONE
009-060-B05GATCCGACGTGGGCCAANONE
009-123-H12GATCCGACGTGGGCCAANONE
009-154-B09GATCCGACGTGGGCCAANONE
009-172-F07GATCCGACGTGGGCCAANONE
009-193-A04GATCCGACGTGGGCCAANONE
AF022732GATCCGACGTGGGCCAANONE
AF052203GATCCGACGTGGGCCAANONE
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II.
AK104722GATCCGACGTGGGCCAANONE
D49713GATCCGACGTGGGCCAANONE
J013002J02GATCCGACGTGGGCCAANONE
J065051O13GATCCGACGTGGGCCAANONE
J065066J18GATCCGACGTGGGCCAANONE
J065077G23GATCCGACGTGGGCCAANONE
J065162C22GATCCGACGTGGGCCAANONE
J065162G22GATCCGACGTGGGCCAANONE
J075091B13GATCCGACGTGGGCCAANONE
J075099J22GATCCGACGTGGGCCAANONE
J100056O22GATCCGACGTGGGCCAANONE
J100059E01GATCCGACGTGGGCCAANONE
J100079F20GATCCGACGTGGGCCAANONE
Os07g0184800AK059544CCGATCCGACGGSimilar to Variant of histone H1.
AK059544CCGTCGGATSimilar to Variant of histone H1.
AK099050CCGATCCGACGGNONE
AK099050CCGTCGGATNONE
AK102642CCGATCCGACGGNONE
AK102642CCGTCGGATNONE
AK106132CCGATCCGACGGNONE
AK106132CCGTCGGATNONE
J023037O08CCGATCCGACGGNONE
J023037O08CCGTCGGATNONE
J023050M02CCGATCCGACGGNONE
J023050M02CCGTCGGATNONE
J023087A10CCGATCCGACGGNONE
J023087A10CCGTCGGATNONE
J033027D14CCGATCCGACGGNONE
J033027D14CCGTCGGATNONE
J033028N17CCGATCCGACGGNONE
J033028N17CCGTCGGATNONE
J033043P10CCGATCCGACGGNONE
J033043P10CCGTCGGATNONE
J033051D07CCGATCCGACGGNONE
J033051D07CCGTCGGATNONE
J033073M07CCGATCCGACGGNONE
J033073M07CCGTCGGATNONE
J033075H01CCGATCCGACGGNONE
J033075H01CCGTCGGATNONE
J033084E04CCGATCCGACGGNONE
J033084E04CCGTCGGATNONE
J033096D10CCGATCCGACGGNONE
J033096D10CCGTCGGATNONE
J033100F04CCGATCCGACGGNONE
J033100F04CCGTCGGATNONE
J033114B06CCGATCCGACGGNONE
J033114B06CCGTCGGATNONE
J033117C10CCGATCCGACGGNONE
J033117C10CCGTCGGATNONE
J033140B21CCGATCCGACGGNONE
J033140B21CCGTCGGATNONE
J043034J07CCGATCCGACGGNONE
J043034J07CCGTCGGATNONE
J065006F04CCGATCCGACGGNONE
J065006F04CCGTCGGATNONE
J065130H16CCGATCCGACGGNONE
J065130H16CCGTCGGATNONE
J075020G13CCGATCCGACGGNONE
J075020G13CCGTCGGATNONE
J075108M17CCGATCCGACGGNONE
J075108M17CCGTCGGATNONE
J080018A06CCGATCCGACGGNONE
J080018A06CCGTCGGATNONE
J080037J11CCGATCCGACGGNONE
J080037J11CCGTCGGATNONE
J080048F15CCGATCCGACGGNONE
J080048F15CCGTCGGATNONE
J080057D16CCGATCCGACGGNONE
J080057D16CCGTCGGATNONE
J080069A10CCGATCCGACGGNONE
J080069A10CCGTCGGATNONE
J080086L09CCGATCCGACGGNONE
J080086L09CCGTCGGATNONE
J080088A17CCGATCCGACGGNONE
J080088A17CCGTCGGATNONE
J100046F24CCGATCCGACGGNONE
J100046F24CCGTCGGATNONE
Os07g0202450J065010G16GATCCGACGGNONE
J065085G13GATCCGACGGNONE
J065117M22GATCCGACGGNONE
J065147K06GATCCGACGGNONE
J065207G15GATCCGACGGNONE
J090089M07GATCCGACGGNONE
J100064D20GATCCGACGGSimilar to Mitosis protein dim1.
Os07g0209000AK059111CCGTCGGATCSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like.
AK099319CCGTCGGATCNONE
Os07g0258700AK068718ATCCGACGNONE
AK069407ATCCGACGBTB domain containing protein.
AK106061ATCCGACGNONE
J080039L24ATCCGACGNONE
Os07g0295200AK059375GATCCGACNONE
AK102836GATCCGACProtein of unknown function DUF167 family protein.
J065113A16GATCCGACNONE
J075066C08GATCCGACNONE
J075070G15GATCCGACNONE
J075081H11GATCCGACNONE
J075190A03GATCCGACNONE
Os07g0415200006-105-B10CCGTCGGATNONE
AK061243CCGTCGGATNONE
AK101796CCGTCGGATRibosomal L23 and L15e, core domain containing protein.
AK104106CCGTCGGATNONE
J033066C05CCGTCGGATNONE
J065188B11CCGTCGGATNONE
J065211E07CCGTCGGATNONE
J090003E03CCGTCGGATNONE
Os07g0419800J080309B06CCGTCGGATNONE
Os07g0474300AK108961GATCCGACCGTTGGAConserved hypothetical protein.
Os07g0541500AK111550ATCCGACGGSimilar to KI domain interacting kinase 1.
Os07g0545400009-136-E03CCGATCCGACGGNONE
013-015-G08CCGATCCGACGGNONE
AK059228CCGATCCGACGGNONE
J065040D09CCGATCCGACGGNONE
J065051C19CCGATCCGACGGNONE
J065139B05CCGATCCGACGGNONE
J065160E20CCGATCCGACGGNONE
J065207I17CCGATCCGACGGNONE
J080319M24CCGATCCGACGGNONE
Os07g0557500AK101830ATCCGACGZinc finger, RING-type domain containing protein.
J013075M04ATCCGACGNONE
J033068I24ATCCGACGNONE
Os07g0562700003-111-G08ATCCGACGTGGCNONE
004-013-E07ATCCGACGTGGCNONE
006-021-D03ATCCGACGTGGCNONE
006-021-D07ATCCGACGTGGCNONE
006-021-F09ATCCGACGTGGCNONE
006-023-D01ATCCGACGTGGCNONE
006-024-F04ATCCGACGTGGCNONE
006-024-G09ATCCGACGTGGCNONE
006-024-G11ATCCGACGTGGCNONE
006-025-A10ATCCGACGTGGCNONE
006-025-B08ATCCGACGTGGCNONE
006-025-E10ATCCGACGTGGCNONE
006-025-F10ATCCGACGTGGCNONE
006-026-B04ATCCGACGTGGCNONE
006-026-C08ATCCGACGTGGCNONE
006-026-D03ATCCGACGTGGCNONE
006-026-F03ATCCGACGTGGCNONE
006-026-F08ATCCGACGTGGCNONE
006-026-F12ATCCGACGTGGCNONE
006-027-A10ATCCGACGTGGCNONE
006-027-C03ATCCGACGTGGCNONE
006-028-C03ATCCGACGTGGCNONE
006-029-E02ATCCGACGTGGCNONE
006-029-G05ATCCGACGTGGCNONE
006-030-A10ATCCGACGTGGCNONE
006-030-C06ATCCGACGTGGCNONE
006-030-D03ATCCGACGTGGCNONE
006-030-D06ATCCGACGTGGCNONE
006-030-G05ATCCGACGTGGCNONE
006-031-B10ATCCGACGTGGCNONE
006-031-D04ATCCGACGTGGCNONE
006-031-D11ATCCGACGTGGCNONE
006-031-H09ATCCGACGTGGCNONE
006-032-C09ATCCGACGTGGCNONE
006-032-H09ATCCGACGTGGCNONE
006-033-B02ATCCGACGTGGCNONE
006-033-B09ATCCGACGTGGCNONE
006-033-E01ATCCGACGTGGCNONE
006-033-F06ATCCGACGTGGCNONE
006-033-G03ATCCGACGTGGCNONE
006-034-A08ATCCGACGTGGCNONE
006-034-C09ATCCGACGTGGCNONE
006-034-F06ATCCGACGTGGCNONE
006-035-B12ATCCGACGTGGCNONE
006-035-C12ATCCGACGTGGCNONE
006-035-H04ATCCGACGTGGCNONE
006-035-H12ATCCGACGTGGCNONE
006-036-A05ATCCGACGTGGCNONE
006-036-A09ATCCGACGTGGCNONE
006-036-B10ATCCGACGTGGCNONE
006-036-C03ATCCGACGTGGCNONE
006-036-E06ATCCGACGTGGCNONE
006-037-H11ATCCGACGTGGCNONE
006-038-G01ATCCGACGTGGCNONE
006-039-B01ATCCGACGTGGCNONE
006-039-B12ATCCGACGTGGCNONE
006-039-C02ATCCGACGTGGCNONE
006-039-E06ATCCGACGTGGCNONE
006-039-G12ATCCGACGTGGCNONE
006-040-G07ATCCGACGTGGCNONE
006-041-H04ATCCGACGTGGCNONE
006-042-A11ATCCGACGTGGCNONE
006-042-E07ATCCGACGTGGCNONE
006-042-F12ATCCGACGTGGCNONE
006-043-C01ATCCGACGTGGCNONE
006-045-H12ATCCGACGTGGCNONE
006-046-A12ATCCGACGTGGCNONE
006-046-F03ATCCGACGTGGCNONE
006-047-A07ATCCGACGTGGCNONE
006-047-A09ATCCGACGTGGCNONE
006-047-E10ATCCGACGTGGCNONE
006-047-G12ATCCGACGTGGCNONE
006-048-B04ATCCGACGTGGCNONE
006-049-D01ATCCGACGTGGCNONE
006-049-G02ATCCGACGTGGCNONE
006-049-G10ATCCGACGTGGCNONE
006-049-H04ATCCGACGTGGCNONE
006-050-D05ATCCGACGTGGCNONE
006-050-F05ATCCGACGTGGCNONE
006-051-B05ATCCGACGTGGCNONE
006-051-G12ATCCGACGTGGCNONE
006-052-D12ATCCGACGTGGCNONE
006-053-D06ATCCGACGTGGCNONE
006-054-H02ATCCGACGTGGCNONE
006-055-A03ATCCGACGTGGCNONE
006-055-C01ATCCGACGTGGCNONE
006-055-E07ATCCGACGTGGCNONE
006-055-H06ATCCGACGTGGCNONE
006-056-F06ATCCGACGTGGCNONE
006-057-D03ATCCGACGTGGCNONE
006-057-D05ATCCGACGTGGCNONE
006-057-G01ATCCGACGTGGCNONE
006-058-A03ATCCGACGTGGCNONE
006-058-B06ATCCGACGTGGCNONE
006-059-A09ATCCGACGTGGCNONE
006-059-H11ATCCGACGTGGCNONE
006-060-A04ATCCGACGTGGCNONE
006-060-A09ATCCGACGTGGCNONE
006-060-C11ATCCGACGTGGCNONE
006-060-D08ATCCGACGTGGCNONE
006-061-A04ATCCGACGTGGCNONE
006-061-E01ATCCGACGTGGCNONE
006-061-G10ATCCGACGTGGCNONE
006-061-H12ATCCGACGTGGCNONE
006-062-B07ATCCGACGTGGCNONE
006-062-G03ATCCGACGTGGCNONE
006-062-H12ATCCGACGTGGCNONE
006-063-D05ATCCGACGTGGCNONE
006-063-E04ATCCGACGTGGCNONE
006-063-F05ATCCGACGTGGCNONE
006-063-G05ATCCGACGTGGCNONE
006-064-B07ATCCGACGTGGCNONE
006-065-C11ATCCGACGTGGCNONE
006-065-H02ATCCGACGTGGCNONE
006-067-C12ATCCGACGTGGCNONE
006-067-F10ATCCGACGTGGCNONE
006-068-E02ATCCGACGTGGCNONE
006-068-G04ATCCGACGTGGCNONE
006-069-A02ATCCGACGTGGCNONE
006-071-A07ATCCGACGTGGCNONE
006-072-F11ATCCGACGTGGCNONE
006-072-F12ATCCGACGTGGCNONE
006-073-E12ATCCGACGTGGCNONE
006-073-F08ATCCGACGTGGCNONE
006-073-H07ATCCGACGTGGCNONE
006-074-A07ATCCGACGTGGCNONE
006-075-A12ATCCGACGTGGCNONE
006-075-B01ATCCGACGTGGCNONE
006-075-H10ATCCGACGTGGCNONE
006-075-H12ATCCGACGTGGCNONE
006-076-B06ATCCGACGTGGCNONE
006-077-A09ATCCGACGTGGCNONE
006-077-D05ATCCGACGTGGCNONE
006-078-C11ATCCGACGTGGCNONE
006-078-D12ATCCGACGTGGCNONE
006-078-E02ATCCGACGTGGCNONE
006-079-A01ATCCGACGTGGCNONE
006-079-E02ATCCGACGTGGCNONE
006-079-F03ATCCGACGTGGCNONE
006-080-G11ATCCGACGTGGCNONE
006-081-C02ATCCGACGTGGCNONE
006-081-C08ATCCGACGTGGCNONE
006-082-B06ATCCGACGTGGCNONE
006-082-C11ATCCGACGTGGCNONE
006-082-H04ATCCGACGTGGCNONE
006-083-E04ATCCGACGTGGCNONE
006-083-H12ATCCGACGTGGCNONE
006-084-C08ATCCGACGTGGCNONE
006-084-E07ATCCGACGTGGCNONE
006-084-E10ATCCGACGTGGCNONE
006-085-E06ATCCGACGTGGCNONE
006-085-E10ATCCGACGTGGCNONE
006-086-F06ATCCGACGTGGCNONE
006-087-D08ATCCGACGTGGCNONE
006-087-F03ATCCGACGTGGCNONE
006-087-F10ATCCGACGTGGCNONE
006-087-G07ATCCGACGTGGCNONE
006-088-A02ATCCGACGTGGCNONE
006-089-A04ATCCGACGTGGCNONE
006-089-B12ATCCGACGTGGCNONE
006-089-D06ATCCGACGTGGCNONE
006-089-D10ATCCGACGTGGCNONE
006-089-H05ATCCGACGTGGCNONE
006-090-C06ATCCGACGTGGCNONE
006-091-A03ATCCGACGTGGCNONE
006-091-E04ATCCGACGTGGCNONE
006-091-H12ATCCGACGTGGCNONE
006-092-A08ATCCGACGTGGCNONE
006-092-F01ATCCGACGTGGCNONE
006-092-G08ATCCGACGTGGCNONE
006-093-B12ATCCGACGTGGCNONE
006-093-D04ATCCGACGTGGCNONE
006-093-F01ATCCGACGTGGCNONE
006-094-A08ATCCGACGTGGCNONE
006-094-F01ATCCGACGTGGCNONE
006-094-F03ATCCGACGTGGCNONE
006-095-C12ATCCGACGTGGCNONE
006-095-E10ATCCGACGTGGCNONE
006-095-E12ATCCGACGTGGCNONE
006-095-G06ATCCGACGTGGCNONE
006-096-B12ATCCGACGTGGCNONE
006-096-C12ATCCGACGTGGCNONE
006-096-G02ATCCGACGTGGCNONE
006-097-D01ATCCGACGTGGCNONE
006-097-D07ATCCGACGTGGCNONE
006-097-F04ATCCGACGTGGCNONE
006-098-C07ATCCGACGTGGCNONE
006-098-D04ATCCGACGTGGCNONE
006-099-E06ATCCGACGTGGCNONE
006-099-F02ATCCGACGTGGCNONE
006-099-F10ATCCGACGTGGCNONE
006-100-A07ATCCGACGTGGCNONE
006-100-B10ATCCGACGTGGCNONE
006-100-G01ATCCGACGTGGCNONE
006-100-H06ATCCGACGTGGCNONE
006-101-D01ATCCGACGTGGCNONE
006-101-F03ATCCGACGTGGCNONE
006-102-A12ATCCGACGTGGCNONE
006-102-B11ATCCGACGTGGCNONE
006-102-C03ATCCGACGTGGCNONE
006-102-F11ATCCGACGTGGCNONE
006-103-A08ATCCGACGTGGCNONE
006-103-B06ATCCGACGTGGCNONE
006-103-D01ATCCGACGTGGCNONE
006-103-F02ATCCGACGTGGCNONE
006-104-B02ATCCGACGTGGCNONE
006-104-C01ATCCGACGTGGCNONE
006-104-F09ATCCGACGTGGCNONE
006-104-H11ATCCGACGTGGCNONE
006-105-A03ATCCGACGTGGCNONE
006-105-D09ATCCGACGTGGCNONE
006-106-B10ATCCGACGTGGCNONE
006-107-A06ATCCGACGTGGCNONE
006-107-C04ATCCGACGTGGCNONE
006-107-E03ATCCGACGTGGCNONE
006-107-F05ATCCGACGTGGCNONE
006-108-C09ATCCGACGTGGCNONE
006-109-C09ATCCGACGTGGCNONE
006-109-D10ATCCGACGTGGCNONE
006-109-E06ATCCGACGTGGCNONE
006-109-E10ATCCGACGTGGCNONE
006-110-A06ATCCGACGTGGCNONE
006-110-C11ATCCGACGTGGCNONE
006-111-A02ATCCGACGTGGCNONE
006-111-F02ATCCGACGTGGCNONE
006-112-A08ATCCGACGTGGCNONE
006-112-H06ATCCGACGTGGCNONE
006-113-A08ATCCGACGTGGCNONE
006-113-B01ATCCGACGTGGCNONE
006-113-C05ATCCGACGTGGCNONE
006-113-D01ATCCGACGTGGCNONE
006-113-D04ATCCGACGTGGCNONE
006-113-D06ATCCGACGTGGCNONE
006-113-E09ATCCGACGTGGCNONE
006-114-F06ATCCGACGTGGCNONE
006-116-B02ATCCGACGTGGCNONE
006-117-B07ATCCGACGTGGCNONE
006-117-G04ATCCGACGTGGCNONE
006-118-D01ATCCGACGTGGCNONE
006-118-D12ATCCGACGTGGCNONE
006-118-F12ATCCGACGTGGCNONE
006-118-G12ATCCGACGTGGCNONE
006-119-B08ATCCGACGTGGCNONE
006-120-E09ATCCGACGTGGCNONE
006-120-G05ATCCGACGTGGCNONE
006-120-G10ATCCGACGTGGCNONE
009-022-D12ATCCGACGTGGCNONE
009-051-H08ATCCGACGTGGCNONE
009-065-F05ATCCGACGTGGCNONE
009-070-A06ATCCGACGTGGCNONE
009-073-B07ATCCGACGTGGCNONE
009-092-C10ATCCGACGTGGCNONE
009-093-D03ATCCGACGTGGCNONE
009-103-B04ATCCGACGTGGCNONE
009-106-H08ATCCGACGTGGCNONE
009-120-B05ATCCGACGTGGCNONE
009-121-F05ATCCGACGTGGCNONE
009-122-B04ATCCGACGTGGCNONE
009-122-D08ATCCGACGTGGCNONE
009-123-F07ATCCGACGTGGCNONE
009-125-G02ATCCGACGTGGCNONE
009-128-F02ATCCGACGTGGCNONE
009-128-H07ATCCGACGTGGCNONE
009-131-C06ATCCGACGTGGCNONE
009-132-F08ATCCGACGTGGCNONE
009-133-G08ATCCGACGTGGCNONE
009-134-D09ATCCGACGTGGCNONE
009-135-F01ATCCGACGTGGCNONE
009-149-E11ATCCGACGTGGCNONE
009-153-H04ATCCGACGTGGCNONE
009-161-E04ATCCGACGTGGCNONE
009-163-A09ATCCGACGTGGCNONE
009-163-C05ATCCGACGTGGCNONE
009-163-E10ATCCGACGTGGCNONE
009-165-F04ATCCGACGTGGCNONE
009-166-A07ATCCGACGTGGCNONE
009-169-G12ATCCGACGTGGCNONE
009-172-G08ATCCGACGTGGCNONE
009-179-E06ATCCGACGTGGCNONE
009-181-F09ATCCGACGTGGCNONE
009-190-G07ATCCGACGTGGCNONE
009-191-D01ATCCGACGTGGCNONE
009-195-G02ATCCGACGTGGCNONE
AF022738ATCCGACGTGGCNONE
AK061512ATCCGACGTGGCNONE
AK068972ATCCGACGTGGCNONE
AK103926ATCCGACGTGGCNONE
AK103999ATCCGACGTGGCNONE
AK104224ATCCGACGTGGCNONE
AK104465ATCCGACGTGGCNONE
AK104495ATCCGACGTGGCNONE
AK109399ATCCGACGTGGCSimilar to Type III chlorophyll a/b-binding protein (Fragment).
AK119533ATCCGACGTGGCNONE
AK119545ATCCGACGTGGCNONE
J013043L10ATCCGACGTGGCNONE
J013050A09ATCCGACGTGGCNONE
J023001G03ATCCGACGTGGCNONE
J023024D14ATCCGACGTGGCNONE
J023072E11ATCCGACGTGGCNONE
J023149E18ATCCGACGTGGCNONE
J033029B16ATCCGACGTGGCNONE
J065001O21ATCCGACGTGGCNONE
J065035B04ATCCGACGTGGCNONE
J065044D18ATCCGACGTGGCNONE
J065057F12ATCCGACGTGGCNONE
J065060A11ATCCGACGTGGCNONE
J065062G15ATCCGACGTGGCNONE
J065080F13ATCCGACGTGGCNONE
J065084N12ATCCGACGTGGCNONE
J065101D02ATCCGACGTGGCNONE
J065107C07ATCCGACGTGGCNONE
J065112N24ATCCGACGTGGCNONE
J065141I16ATCCGACGTGGCNONE
J065147D05ATCCGACGTGGCNONE
J065167H02ATCCGACGTGGCNONE
J065207K23ATCCGACGTGGCNONE
J075008E16ATCCGACGTGGCNONE
J075014F03ATCCGACGTGGCNONE
J075015O17ATCCGACGTGGCNONE
J075020H20ATCCGACGTGGCNONE
J075021E22ATCCGACGTGGCNONE
J075023N13ATCCGACGTGGCNONE
J075028H10ATCCGACGTGGCNONE
J075040F20ATCCGACGTGGCNONE
J075051L23ATCCGACGTGGCNONE
J075069G16ATCCGACGTGGCNONE
J075084F24ATCCGACGTGGCNONE
J075090H09ATCCGACGTGGCNONE
J075092M21ATCCGACGTGGCNONE
J075110C10ATCCGACGTGGCNONE
J075111J12ATCCGACGTGGCNONE
J075114L04ATCCGACGTGGCNONE
J075139E02ATCCGACGTGGCNONE
J075160M10ATCCGACGTGGCNONE
J075176J03ATCCGACGTGGCNONE
J075183I17ATCCGACGTGGCNONE
J075191N10ATCCGACGTGGCNONE
J075193D07ATCCGACGTGGCNONE
J075194M16ATCCGACGTGGCNONE
J075197K04ATCCGACGTGGCNONE
J080032I11ATCCGACGTGGCNONE
J080076M11ATCCGACGTGGCNONE
J080311J08ATCCGACGTGGCNONE
J080317E05ATCCGACGTGGCNONE
J090034L08ATCCGACGTGGCNONE
J100040D19ATCCGACGTGGCNONE
J100074C11ATCCGACGTGGCNONE
Os07g0582400003-104-B09GATCCGACNONE
AK059423GATCCGACNONE
AK102676GATCCGACNONE
J065001F09GATCCGACNONE
J065005K22GATCCGACNONE
J065006D10GATCCGACNONE
J065006P17GATCCGACNONE
J065015G23GATCCGACNONE
J065020F21GATCCGACNONE
J065028I05GATCCGACNONE
J065042N09GATCCGACNONE
J065043P03GATCCGACNONE
J065059E15GATCCGACNONE
J065090I12GATCCGACNONE
J065130I02GATCCGACNONE
J065131P05GATCCGACNONE
J065163I24GATCCGACNONE
J065168I21GATCCGACNONE
J065174A12GATCCGACNONE
J065178K16GATCCGACNONE
J065182P03GATCCGACNONE
J065186B07GATCCGACNONE
J065189M13GATCCGACNONE
J065208J22GATCCGACNONE
J065211E11GATCCGACNONE
J075054E08GATCCGACNONE
J075067K14GATCCGACNONE
J075104E20GATCCGACNONE
J075152M07GATCCGACNONE
Os07g0586700AK102792CCAGGCCCGGGTCGGATCConserved hypothetical protein.
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein.
J023030F23CCGATCCGACGGCCCGNONE
J065165H21CCGATCCGACGGCCCGNONE
J065193G01CCGATCCGACGGCCCGNONE
J075093F03CCGATCCGACGGCCCGNONE
Os07g0605200AF091458GATCCGACGGNONE
AF139665GATCCGACGGNONE
AJ011675GATCCGACGGNONE
AK064704GATCCGACGGMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7).
J075159J15GATCCGACGGNONE
J090034M06GATCCGACGGNONE
J090079L24GATCCGACGGNONE
Os07g0620300AK059588CCGTCGGATNONE
AK099000CCGTCGGATNONE
AK099150CCGTCGGATNONE
AK119518CCGTCGGATClathrin adaptor complex, medium chain family protein.
Os07g0633000Os07g0633000GATCCGACACGTConserved hypothetical protein.
Os07g0633200AK061338GATCCGACGGSimilar to SC35-like splicing factor SCL30a, 30a kD.
AK073451GATCCGACGGNONE
J033096E22GATCCGACGGNONE
J033125D06GATCCGACGGNONE
J075048C23GATCCGACGGNONE
J075050G02GATCCGACGGNONE
J075104J04GATCCGACGGNONE
J075144N04GATCCGACGGNONE
Os07g0637100AK111132ATCCGACGGHeat shock protein DnaJ, N-terminal domain containing protein.
Os07g0637400AK067595GTCGGATCSimilar to Novel plant SNARE 12 (AtNPSN12).
AY740016GTCGGATCNONE
J013108F08GTCGGATCNONE
J033071O11GTCGGATCNONE
J090029K15GTCGGATCNONE
J100039N22GTCGGATCNONE
Os07g0683900004-013-C10CCGTCGGANONE
AK060899CCGTCGGANONE
J065096G16CCGTCGGANONE
J090003A20CCGTCGGANONE
J090058E17CCGTCGGANONE
J100028P13CCGTCGGANONE
J100046H21CCGTCGGANONE
J100078H20CCGTCGGANONE
Os08g0101100AK069900CCGTCGGATCHigh mobility group box domain containing protein.
Os08g0171000AK071278CCGTCGGATCConserved hypothetical protein.
J023113L21CCGTCGGATCNONE
Os08g0187700AK099689CGTCGGATCRegulation of nuclear pre-mRNA protein domain containing protein.
Os08g0248800AB037416ATCCGACGSimilar to Aspartate carbamoyltransferase 3, chloroplast precursor (EC 2.1.3.2) (Aspartate transcarbamylase 3) (ATCase 3).
AK065010ATCCGACGNONE
J013001F02ATCCGACGNONE
Os08g0386300AK059323CGTCGGATNONE
AK070379CGTCGGATCytochrome b5 domain containing protein.
J023054P20CGTCGGATNONE
J033089H01CGTCGGATNONE
J065013I01CGTCGGATNONE
J065212E17CGTCGGATNONE
J080317O15CGTCGGATNONE
J090018O07CGTCGGATNONE
Os08g0389733J065044M19GTGTGGGCCGGCCGTCGGATNONE
J065104D10GTGTGGGCCGGCCGTCGGATNONE
J065110F18GTGTGGGCCGGCCGTCGGATNONE
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein.
J065039C07ATCCGACGGCCCAGATNONE
J065098N11ATCCGACGGCCCAGATNONE
J065120J15ATCCGACGGCCCAGATNONE
J075076H12ATCCGACGGCCCAGATNONE
J075101N16ATCCGACGGCCCAGATNONE
J080010A07ATCCGACGGCCCAGATNONE
J080023C16ATCCGACGGCCCAGATNONE
J080027G22ATCCGACGGCCCAGATNONE
J080053D02ATCCGACGGCCCAGATNONE
J080065E17ATCCGACGGCCCAGATNONE
J080068C15ATCCGACGGCCCAGATNONE
J090061J10ATCCGACGGCCCAGATNONE
Os08g0416100AK070406CGCCACGTCGGATDEAD/DEAH box helicase, N-terminal domain containing protein.
AY644647CGCCACGTCGGATNONE
Os08g0430000AK120950GATCCGACGGCCGAGATConserved hypothetical protein.
Os08g0454600AK060308CCGTCGGAConserved hypothetical protein.
J080005B13CCGTCGGANONE
J080005H16CCGTCGGANONE
J080009H19CCGTCGGANONE
J080011C20CCGTCGGANONE
J080011F11CCGTCGGANONE
J080013C22CCGTCGGANONE
J080017G13CCGTCGGANONE
J080023L01CCGTCGGANONE
J080024K05CCGTCGGANONE
J080031F01CCGTCGGANONE
J080033L05CCGTCGGANONE
J080035D18CCGTCGGANONE
J080036H15CCGTCGGANONE
J080036M23CCGTCGGANONE
J080037F16CCGTCGGANONE
J080040K05CCGTCGGANONE
J080045K06CCGTCGGANONE
J080052E15CCGTCGGANONE
J080058K08CCGTCGGANONE
J080065G10CCGTCGGANONE
J080067C13CCGTCGGANONE
J080070D10CCGTCGGANONE
J080072P07CCGTCGGANONE
J080075H14CCGTCGGANONE
J080076O13CCGTCGGANONE
J080077G03CCGTCGGANONE
J080079O22CCGTCGGANONE
J080081E04CCGTCGGANONE
J080083D04CCGTCGGANONE
J080090K23CCGTCGGANONE
J080093E16CCGTCGGANONE
J080095D23CCGTCGGANONE
Os08g0464000AK059195CCGTCGGAActivator of Hsp90 ATPase homologue 1-like family protein.
AK102612CCGTCGGANONE
J033099D06CCGTCGGANONE
Os08g0465300AK108076ATCCGACGTGGCConserved hypothetical protein.
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
Os08g0481500J065054C23CGTCGGATConserved hypothetical protein.
J065218E06CGTCGGATNONE
Os08g0535400004-001-H10CCGTCGGANONE
AK071527CCGTCGGAZinc finger, DHHC-type domain containing protein.
J023107B02CCGTCGGANONE
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein.
J090058N13GATCCGACGGCCCAGATNONE
Os08g0544500AK071354CGTCGGATSimilar to ARP2/3 regulatory protein subunit NAPP.
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE
015-040-B04ACGCGTCCTGGGCCGTCGGATCNONE
AK060536ACGCGTCCTGGGCCGTCGGATCNONE
AK102666ACGCGTCCTGGGCCGTCGGATCNONE
AK119660ACGCGTCCTGGGCCGTCGGATCPCF2.
D87261ACGCGTCCTGGGCCGTCGGATCNONE
J090049N23ACGCGTCCTGGGCCGTCGGATCNONE
J090084G06ACGCGTCCTGGGCCGTCGGATCNONE
Os08g0556000AK068463GCCACGTCGGATSimilar to YTH domain protein 2 (High-glucose-regulated protein 8) (NY-REN-2 antigen) (CLL-associated antigen KW-14).
Os09g0115400AK067816CGTCGGATNONE
AK101706CGTCGGATSimilar to Poly(A)-binding protein.
Os09g0123100AK103665GATCCGACGGTetratricopeptide-like helical domain containing protein.
J013104A07GATCCGACGGNONE
J013130B03GATCCGACGGNONE
J013151K05GATCCGACGGNONE
J023036M18GATCCGACGGNONE
J023064M07GATCCGACGGNONE
J023084H20GATCCGACGGNONE
J023139A11GATCCGACGGNONE
J023148O20GATCCGACGGNONE
J033027B17GATCCGACGGNONE
J033029B12GATCCGACGGNONE
J033067E23GATCCGACGGNONE
J033069D06GATCCGACGGNONE
J033093L17GATCCGACGGNONE
J033098N22GATCCGACGGNONE
J033112B12GATCCGACGGNONE
J033115E15GATCCGACGGNONE
J033127F08GATCCGACGGNONE
J033128P17GATCCGACGGNONE
J033135J15GATCCGACGGNONE
Os09g0240500009-015-D11CCGTCGGATCNONE
009-039-B12CCGTCGGATCNONE
AF493793CCGTCGGATCNONE
AK062451CCGTCGGATCNONE
AK067676CCGTCGGATCNONE
AK069796CCGTCGGATCSimilar to Sulfate transporter 4.1, chloroplast precursor (AST82).
Os09g0258000AK061499GATCCGACCellular retinaldehyde-binding/triple function, N-terminal domain containing protein.
AK104755GATCCGACNONE
J053043P09GATCCGACNONE
Os09g0305300006-118-C07CCGTCGGANONE
AK101001CCGTCGGAProtein of unknown function DUF247, plant family protein.
AK105016CCGTCGGANONE
J023147E24CCGTCGGANONE
Os09g0315200006-022-A10CCGTCGGATNONE
AK105900CCGTCGGATConserved hypothetical protein.
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE
011-030-A03GATCCGACGGNONE
AK061601CCGATCCGACGGCCCAGATNONE
AK061601GATCCGACGGNONE
AK063310CCGATCCGACGGCCCAGATHypothetical protein.
AK063310GATCCGACGGHypothetical protein.
J100063G01CCGATCCGACGGCCCAGATNONE
J100063G01GATCCGACGGNONE
Os09g0380000AK068230GATCCGACSimilar to Acetyl-CoA synthetase-like protein.
J013147J22GATCCGACNONE
J100055P18GATCCGACNONE
J100072E04GATCCGACNONE
J100073P09GATCCGACNONE
J100084G09GATCCGACNONE
Os09g0416700AK061283ATCCGACGNONE
AK061283ATCCGACGNONE
AK101300ATCCGACGVesicle transport v-SNARE family protein.
AK101300ATCCGACGVesicle transport v-SNARE family protein.
J075138J18ATCCGACGNONE
J075138J18ATCCGACGNONE
Os09g0449600009-188-G11ATCCGACGGNONE
016-031-E04ATCCGACGGNONE
AK065937ATCCGACGGNONE
J013043E22ATCCGACGGNONE
J013123B08ATCCGACGGNONE
J013134D04ATCCGACGGNONE
J033061M16ATCCGACGGNONE
J090091L19ATCCGACGGNONE
J100025J23ATCCGACGGNONE
Os09g0451500AK062254ATCCGACGThioredoxin domain 2 containing protein.
AK072941ATCCGACGNONE
Os09g0480600AK107853GATCCGACGGHypothetical protein.
Os09g0512900006-066-A10CCGATCCGATCCGACNONE
AK061814CCGATCCGATCCGACConserved hypothetical protein.
AK066925CCGATCCGATCCGACNONE
AK104595CCGATCCGATCCGACNONE
J013092F14CCGATCCGATCCGACNONE
J023148N20CCGATCCGATCCGACNONE
J033131F06CCGATCCGATCCGACNONE
J053025L20CCGATCCGATCCGACNONE
J075003B20CCGATCCGATCCGACNONE
J075019N18CCGATCCGATCCGACNONE
J075032D10CCGATCCGATCCGACNONE
J075037G14CCGATCCGATCCGACNONE
J075098D24CCGATCCGATCCGACNONE
J075106M13CCGATCCGATCCGACNONE
J075122N14CCGATCCGATCCGACNONE
J075146E22CCGATCCGATCCGACNONE
J075187E06CCGATCCGATCCGACNONE
J075198I17CCGATCCGATCCGACNONE
J090023O05CCGATCCGATCCGACNONE
J100040E10CCGATCCGATCCGACNONE
J100080P12CCGATCCGATCCGACNONE
J100088B06CCGATCCGATCCGACNONE
Os09g0526700011-075-B12GATCCGACGGNONE
AB097460GATCCGACGGNONE
AK073610GATCCGACGGSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase).
AK104977GATCCGACGGNONE
Os09g0544800011-092-G08CCGTCGGANONE
011-092-H10CCGTCGGANONE
012-082-G06CCGTCGGANONE
AK073737CCGTCGGANONE
AK105420CCGTCGGAProtein of unknown function DUF315 domain containing protein.
J033024L08CCGTCGGANONE
J033029G19CCGTCGGANONE
J033051I04CCGTCGGANONE
J033061I11CCGTCGGANONE
J033064E08CCGTCGGANONE
J033120A15CCGTCGGANONE
J033132D04CCGTCGGANONE
J033140N14CCGTCGGANONE
J033142N14CCGTCGGANONE
J065069I19CCGTCGGANONE
J065081O10CCGTCGGANONE
J065201I24CCGTCGGANONE
J090023F01CCGTCGGANONE
J090036C13CCGTCGGANONE
Os09g0548100009-134-B12GTCGGATCGGNONE
AK062925GTCGGATCGGHypothetical protein.
Os09g0558200016-083-C09GATCCGACGNONE
AK068834GATCCGACGNONE
AK103673GATCCGACGHomeodomain-like containing protein.
J013159M18GATCCGACGNONE
J065022I04GATCCGACGNONE
J065089B19GATCCGACGNONE
Os09g0568800AK059234ATCCGACGGSimilar to Ribosomal protein S25 (40S ribosomal 25S subunit).
J033140B10ATCCGACGGNONE
J033142B10ATCCGACGGNONE
J065011L22ATCCGACGGNONE
J065030J07ATCCGACGGNONE
J065038K20ATCCGACGGNONE
J065040B12ATCCGACGGNONE
J065056B12ATCCGACGGNONE
J065064L14ATCCGACGGNONE
J065116B03ATCCGACGGNONE
J065128E10ATCCGACGGNONE
J065135B14ATCCGACGGNONE
J065143F21ATCCGACGGNONE
J065197F15ATCCGACGGNONE
J075011K03ATCCGACGGNONE
J075015B17ATCCGACGGNONE
J075021I04ATCCGACGGNONE
J075025G18ATCCGACGGNONE
J075030E17ATCCGACGGNONE
J075034A22ATCCGACGGNONE
J075035C18ATCCGACGGNONE
J075081E22ATCCGACGGNONE
J075090F16ATCCGACGGNONE
J075120P07ATCCGACGGNONE
J075151D16ATCCGACGGNONE
J075183B11ATCCGACGGNONE
J075187N12ATCCGACGGNONE
J075195N06ATCCGACGGNONE
J080008P04ATCCGACGGNONE
J080009D04ATCCGACGGNONE
J080017F06ATCCGACGGNONE
J080030A10ATCCGACGGNONE
J080031K06ATCCGACGGNONE
J080044N14ATCCGACGGNONE
J080046B13ATCCGACGGNONE
J080046I07ATCCGACGGNONE
J080047D05ATCCGACGGNONE
J080050F09ATCCGACGGNONE
J080059H13ATCCGACGGNONE
J080071G18ATCCGACGGNONE
J080074K19ATCCGACGGNONE
J080082L07ATCCGACGGNONE
J080086N23ATCCGACGGNONE
J080088H05ATCCGACGGNONE
J080088P03ATCCGACGGNONE
J080090N24ATCCGACGGNONE
J080093G02ATCCGACGGNONE
J080311L14ATCCGACGGNONE
J090021N07ATCCGACGGNONE
J100045I01ATCCGACGGNONE
J100057A16ATCCGACGGNONE
Os11g0153800009-146-G07GATCCGACGGNONE
AK058630GATCCGACGGSimilar to Ribosomal protein S25 (40S ribosomal 25S subunit).
J075071N04GATCCGACGGNONE
Os11g0202300AK066860CGTCGGATNONE
AK068673CGTCGGATConserved hypothetical protein.
J013073M16CGTCGGATNONE
J013088K08CGTCGGATNONE
Os11g0210300009-169-E10ATCCGACGGNONE
012-007-H08ATCCGACGGNONE
012-065-A02ATCCGACGGNONE
012-095-H06ATCCGACGGNONE
015-007-F02ATCCGACGGNONE
015-017-F10ATCCGACGGNONE
015-078-F12ATCCGACGGNONE
016-085-G04ATCCGACGGNONE
AK061267ATCCGACGGNONE
AK069330ATCCGACGGAlcohol dehydrogenase 1.
D10412ATCCGACGGNONE
J023026C01ATCCGACGGNONE
J023037O21ATCCGACGGNONE
J023044J09ATCCGACGGNONE
J023066N19ATCCGACGGNONE
J023100L06ATCCGACGGNONE
J023121G14ATCCGACGGNONE
J023132I24ATCCGACGGNONE
J023134J18ATCCGACGGNONE
J033024J23ATCCGACGGNONE
J033029B21ATCCGACGGNONE
J033030H09ATCCGACGGNONE
J033040N09ATCCGACGGNONE
J033050I11ATCCGACGGNONE
J033052F03ATCCGACGGNONE
J033067J22ATCCGACGGNONE
J033068K15ATCCGACGGNONE
J033070A13ATCCGACGGNONE
J033072A02ATCCGACGGNONE
J033072F17ATCCGACGGNONE
J033081C02ATCCGACGGNONE
J033082F08ATCCGACGGNONE
J033086L02ATCCGACGGNONE
J033087O09ATCCGACGGNONE
J033088P05ATCCGACGGNONE
J033094D13ATCCGACGGNONE
J033098I11ATCCGACGGNONE
J033102I15ATCCGACGGNONE
J033102P13ATCCGACGGNONE
J033103N07ATCCGACGGNONE
J033109A11ATCCGACGGNONE
J033109O05ATCCGACGGNONE
J033111K07ATCCGACGGNONE
J033113I09ATCCGACGGNONE
J033113I10ATCCGACGGNONE
J033115B12ATCCGACGGNONE
J033121D20ATCCGACGGNONE
J033125H21ATCCGACGGNONE
J033128M09ATCCGACGGNONE
J033135L03ATCCGACGGNONE
J033136O13ATCCGACGGNONE
J043003H06ATCCGACGGNONE
J043010B17ATCCGACGGNONE
J043015O11ATCCGACGGNONE
J043026D03ATCCGACGGNONE
J043030G18ATCCGACGGNONE
J043035L17ATCCGACGGNONE
J043037K04ATCCGACGGNONE
J043040G24ATCCGACGGNONE
J053024N13ATCCGACGGNONE
J065035H08ATCCGACGGNONE
J065116G23ATCCGACGGNONE
J065138J15ATCCGACGGNONE
J065161L12ATCCGACGGNONE
J075011O04ATCCGACGGNONE
J075109M05ATCCGACGGNONE
J075133K12ATCCGACGGNONE
J075167H23ATCCGACGGNONE
J075198I09ATCCGACGGNONE
J100023O11ATCCGACGGNONE
J100042B17ATCCGACGGNONE
J100052M16ATCCGACGGNONE
J100059M23ATCCGACGGNONE
J100076G19ATCCGACGGNONE
X16296ATCCGACGGNONE
Os11g0237600J023045M16ATCCGACGNB-ARC domain containing protein.
J075186H09ATCCGACGNONE
Os11g0536900J100027G18GATCCGACConserved hypothetical protein.
J100073G12GATCCGACNONE
Os11g0544700AF464904GTCGGATCNONE
AK072844GTCGGATCRepressor protein.
J023143I16GTCGGATCNONE
Os11g0557700AK071694CCGATCCGACGNONE
AK107593CCGATCCGACGSAM (and some other nucleotide) binding motif domain containing protein.
J023108E23CCGATCCGACGNONE
Os11g0702700016-059-A09GATCCGACNONE
AK064388GATCCGACHomeodomain-like containing protein.
AK099346GATCCGACNONE
J033025L03GATCCGACNONE
J090067J06GATCCGACNONE
Os12g0149000AK108734GATCCGACGGConserved hypothetical protein.
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein.
Os12g0210200AF309381CCGATCCGACGNONE
AK069105CCGATCCGACGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18).
J023004I03CCGATCCGACGNONE
J033069C11CCGATCCGACGNONE
J065087E20CCGATCCGACGNONE
J065097G21CCGATCCGACGNONE
Os12g0263100AK102127ATCCGACGGSimilar to Zinc finger, DHHC domain containing 4.
J090099K03ATCCGACGGNONE
Os12g0457500015-025-F11GATCCGACNONE
AK073212GATCCGACHypothetical protein.
Os12g0485500AK071132CGGATCGGATCCGACGGSimilar to HesB/YadR/YfhF family protein.
AK099510CGGATCGGATCCGACGGNONE
J065024D15CGGATCGGATCCGACGGNONE
J075168O15CGGATCGGATCCGACGGNONE
J075190F06CGGATCGGATCCGACGGNONE
Os12g0562100AK064831CCGTCGGATCConserved hypothetical protein.
AK065844CCGTCGGATCNONE
J013000F11CCGTCGGATCNONE
Os12g0578200AK105512GATCCGACGGSimilar to Chorismate mutase, chloroplast precursor (EC 5.4.99.5) (CM-1).
Os12g0602200AK119494GTCGGATCHypothetical protein.
Os12g0605800AK121511ACCCCCCATCCGACGSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment).
Os12g0632000AF010580ACCCCCCACCGTCGGATNONE
AJ002893ACCCCCCACCGTCGGATSimilar to Glycine-rich RNA-binding protein 1 (Fragment).
J065001J09ACCCCCCACCGTCGGATNONE
J065002D04ACCCCCCACCGTCGGATNONE
J065041I19ACCCCCCACCGTCGGATNONE
J065051I02ACCCCCCACCGTCGGATNONE
J065054G12ACCCCCCACCGTCGGATNONE
J065061A03ACCCCCCACCGTCGGATNONE
J065061B03ACCCCCCACCGTCGGATNONE
J065062D24ACCCCCCACCGTCGGATNONE
J065079O14ACCCCCCACCGTCGGATNONE
J065083P21ACCCCCCACCGTCGGATNONE
J065098H21ACCCCCCACCGTCGGATNONE
J065101F01ACCCCCCACCGTCGGATNONE
J065102M05ACCCCCCACCGTCGGATNONE
J065121E24ACCCCCCACCGTCGGATNONE
J065138P03ACCCCCCACCGTCGGATNONE
J065161B22ACCCCCCACCGTCGGATNONE
J065163E13ACCCCCCACCGTCGGATNONE
J065165D14ACCCCCCACCGTCGGATNONE
J065169J17ACCCCCCACCGTCGGATNONE
J065191B15ACCCCCCACCGTCGGATNONE
J065197C23ACCCCCCACCGTCGGATNONE
J075002C02ACCCCCCACCGTCGGATNONE
J075003D03ACCCCCCACCGTCGGATNONE
J075003M01ACCCCCCACCGTCGGATNONE
J075011J11ACCCCCCACCGTCGGATNONE
J075013I09ACCCCCCACCGTCGGATNONE
J075013P21ACCCCCCACCGTCGGATNONE
J075020D15ACCCCCCACCGTCGGATNONE
J075020L10ACCCCCCACCGTCGGATNONE
J075025P14ACCCCCCACCGTCGGATNONE
J075031G13ACCCCCCACCGTCGGATNONE
J075044J01ACCCCCCACCGTCGGATNONE
J075048K03ACCCCCCACCGTCGGATNONE
J075081H02ACCCCCCACCGTCGGATNONE
J075081M24ACCCCCCACCGTCGGATNONE
J075093H13ACCCCCCACCGTCGGATNONE
J075096I02ACCCCCCACCGTCGGATNONE
J075096K17ACCCCCCACCGTCGGATNONE
J075097I08ACCCCCCACCGTCGGATNONE
J075097L19ACCCCCCACCGTCGGATNONE
J075098K03ACCCCCCACCGTCGGATNONE
J075099L15ACCCCCCACCGTCGGATNONE
J075118E23ACCCCCCACCGTCGGATNONE
J075118H23ACCCCCCACCGTCGGATNONE
J075118J24ACCCCCCACCGTCGGATNONE
J075127N03ACCCCCCACCGTCGGATNONE
J075142H14ACCCCCCACCGTCGGATNONE
J075146D17ACCCCCCACCGTCGGATNONE
J075156K21ACCCCCCACCGTCGGATNONE
J080016A22ACCCCCCACCGTCGGATNONE
J080016B03ACCCCCCACCGTCGGATNONE
J080040H01ACCCCCCACCGTCGGATNONE
J080068A22ACCCCCCACCGTCGGATNONE
J080068G23ACCCCCCACCGTCGGATNONE
J080071M07ACCCCCCACCGTCGGATNONE
J080072C22ACCCCCCACCGTCGGATNONE
J080092L23ACCCCCCACCGTCGGATNONE
J080094M23ACCCCCCACCGTCGGATNONE
J080094P05ACCCCCCACCGTCGGATNONE
J080304H19ACCCCCCACCGTCGGATNONE
J090045K01ACCCCCCACCGTCGGATNONE
J090051E23ACCCCCCACCGTCGGATNONE
J090084I02ACCCCCCACCGTCGGATNONE
J100024B13ACCCCCCACCGTCGGATNONE
J100024H16ACCCCCCACCGTCGGATNONE
J100025F08ACCCCCCACCGTCGGATNONE
J100026C20ACCCCCCACCGTCGGATNONE
J100026J20ACCCCCCACCGTCGGATNONE
J100026J24ACCCCCCACCGTCGGATNONE
J100026K14ACCCCCCACCGTCGGATNONE
J100026M15ACCCCCCACCGTCGGATNONE
J100027A21ACCCCCCACCGTCGGATNONE
J100027C08ACCCCCCACCGTCGGATNONE
J100027D04ACCCCCCACCGTCGGATNONE
J100027F17ACCCCCCACCGTCGGATNONE
J100027G08ACCCCCCACCGTCGGATNONE
J100027H22ACCCCCCACCGTCGGATNONE
J100027N15ACCCCCCACCGTCGGATNONE
J100028F01ACCCCCCACCGTCGGATNONE
J100028J11ACCCCCCACCGTCGGATNONE
J100029B19ACCCCCCACCGTCGGATNONE
J100029C17ACCCCCCACCGTCGGATNONE
J100029K13ACCCCCCACCGTCGGATNONE
J100029N17ACCCCCCACCGTCGGATNONE
J100030A16ACCCCCCACCGTCGGATNONE
J100030F13ACCCCCCACCGTCGGATNONE
J100030M17ACCCCCCACCGTCGGATNONE
J100030N04ACCCCCCACCGTCGGATNONE
J100030N09ACCCCCCACCGTCGGATNONE
J100031F16ACCCCCCACCGTCGGATNONE
J100031I07ACCCCCCACCGTCGGATNONE
J100031K06ACCCCCCACCGTCGGATNONE
J100031K09ACCCCCCACCGTCGGATNONE
J100032E01ACCCCCCACCGTCGGATNONE
J100032F13ACCCCCCACCGTCGGATNONE
J100032I20ACCCCCCACCGTCGGATNONE
J100032N21ACCCCCCACCGTCGGATNONE
J100032O06ACCCCCCACCGTCGGATNONE
J100033E08ACCCCCCACCGTCGGATNONE
J100033M19ACCCCCCACCGTCGGATNONE
J100033M22ACCCCCCACCGTCGGATNONE
J100034B22ACCCCCCACCGTCGGATNONE
J100034H08ACCCCCCACCGTCGGATNONE
J100034K22ACCCCCCACCGTCGGATNONE
J100034N04ACCCCCCACCGTCGGATNONE
J100034P17ACCCCCCACCGTCGGATNONE
J100035K22ACCCCCCACCGTCGGATNONE
J100035L11ACCCCCCACCGTCGGATNONE
J100035N24ACCCCCCACCGTCGGATNONE
J100036L18ACCCCCCACCGTCGGATNONE
J100037B01ACCCCCCACCGTCGGATNONE
J100037F04ACCCCCCACCGTCGGATNONE
J100037H23ACCCCCCACCGTCGGATNONE
J100037L18ACCCCCCACCGTCGGATNONE
J100038B05ACCCCCCACCGTCGGATNONE
J100038F13ACCCCCCACCGTCGGATNONE
J100038K04ACCCCCCACCGTCGGATNONE
J100039G20ACCCCCCACCGTCGGATNONE
J100040G09ACCCCCCACCGTCGGATNONE
J100041A11ACCCCCCACCGTCGGATNONE
J100041B22ACCCCCCACCGTCGGATNONE
J100041K06ACCCCCCACCGTCGGATNONE
J100041O09ACCCCCCACCGTCGGATNONE
J100042A20ACCCCCCACCGTCGGATNONE
J100042C07ACCCCCCACCGTCGGATNONE
J100042I02ACCCCCCACCGTCGGATNONE
J100042K03ACCCCCCACCGTCGGATNONE
J100043C18ACCCCCCACCGTCGGATNONE
J100043D20ACCCCCCACCGTCGGATNONE
J100043F08ACCCCCCACCGTCGGATNONE
J100043G23ACCCCCCACCGTCGGATNONE
J100043H22ACCCCCCACCGTCGGATNONE
J100043I23ACCCCCCACCGTCGGATNONE
J100043K11ACCCCCCACCGTCGGATNONE
J100043P03ACCCCCCACCGTCGGATNONE
J100044C01ACCCCCCACCGTCGGATNONE
J100044F02ACCCCCCACCGTCGGATNONE
J100044L10ACCCCCCACCGTCGGATNONE
J100045A13ACCCCCCACCGTCGGATNONE
J100045D16ACCCCCCACCGTCGGATNONE
J100045D23ACCCCCCACCGTCGGATNONE
J100045F09ACCCCCCACCGTCGGATNONE
J100045H22ACCCCCCACCGTCGGATNONE
J100045O07ACCCCCCACCGTCGGATNONE
J100046J15ACCCCCCACCGTCGGATNONE
J100046K14ACCCCCCACCGTCGGATNONE
J100046L15ACCCCCCACCGTCGGATNONE
J100047L23ACCCCCCACCGTCGGATNONE
J100047P05ACCCCCCACCGTCGGATNONE
J100048A20ACCCCCCACCGTCGGATNONE
J100048C22ACCCCCCACCGTCGGATNONE
J100048G17ACCCCCCACCGTCGGATNONE
J100048J20ACCCCCCACCGTCGGATNONE
J100048K18ACCCCCCACCGTCGGATNONE
J100048L22ACCCCCCACCGTCGGATNONE
J100048O22ACCCCCCACCGTCGGATNONE
J100049F18ACCCCCCACCGTCGGATNONE
J100049M03ACCCCCCACCGTCGGATNONE
J100050C20ACCCCCCACCGTCGGATNONE
J100050G14ACCCCCCACCGTCGGATNONE
J100050O10ACCCCCCACCGTCGGATNONE
J100051E09ACCCCCCACCGTCGGATNONE
J100051F20ACCCCCCACCGTCGGATNONE
J100051I22ACCCCCCACCGTCGGATNONE
J100051J11ACCCCCCACCGTCGGATNONE
J100051J17ACCCCCCACCGTCGGATNONE
J100052A04ACCCCCCACCGTCGGATNONE
J100052E01ACCCCCCACCGTCGGATNONE
J100052E13ACCCCCCACCGTCGGATNONE
J100054A10ACCCCCCACCGTCGGATNONE
J100054B08ACCCCCCACCGTCGGATNONE
J100054B12ACCCCCCACCGTCGGATNONE
J100054F05ACCCCCCACCGTCGGATNONE
J100054I16ACCCCCCACCGTCGGATNONE
J100054L18ACCCCCCACCGTCGGATNONE
J100055A03ACCCCCCACCGTCGGATNONE
J100055K11ACCCCCCACCGTCGGATNONE
J100056I06ACCCCCCACCGTCGGATNONE
J100056I16ACCCCCCACCGTCGGATNONE
J100056M20ACCCCCCACCGTCGGATNONE
J100057D04ACCCCCCACCGTCGGATNONE
J100057E15ACCCCCCACCGTCGGATNONE
J100057G07ACCCCCCACCGTCGGATNONE
J100057H22ACCCCCCACCGTCGGATNONE
J100058H07ACCCCCCACCGTCGGATNONE
J100058M11ACCCCCCACCGTCGGATNONE
J100058M20ACCCCCCACCGTCGGATNONE
J100058N04ACCCCCCACCGTCGGATNONE
J100058N16ACCCCCCACCGTCGGATNONE
J100058O11ACCCCCCACCGTCGGATNONE
J100059A20ACCCCCCACCGTCGGATNONE
J100059E05ACCCCCCACCGTCGGATNONE
J100059K17ACCCCCCACCGTCGGATNONE
J100059M07ACCCCCCACCGTCGGATNONE
J100060A07ACCCCCCACCGTCGGATNONE
J100060G24ACCCCCCACCGTCGGATNONE
J100060I15ACCCCCCACCGTCGGATNONE
J100060M15ACCCCCCACCGTCGGATNONE
J100060M20ACCCCCCACCGTCGGATNONE
J100060N23ACCCCCCACCGTCGGATNONE
J100061H20ACCCCCCACCGTCGGATNONE
J100062C04ACCCCCCACCGTCGGATNONE
J100062C22ACCCCCCACCGTCGGATNONE
J100062F20ACCCCCCACCGTCGGATNONE
J100062G08ACCCCCCACCGTCGGATNONE
J100062H17ACCCCCCACCGTCGGATNONE
J100062I05ACCCCCCACCGTCGGATNONE
J100062L21ACCCCCCACCGTCGGATNONE
J100062O04ACCCCCCACCGTCGGATNONE
J100063B10ACCCCCCACCGTCGGATNONE
J100063C01ACCCCCCACCGTCGGATNONE
J100063D11ACCCCCCACCGTCGGATNONE
J100064B18ACCCCCCACCGTCGGATNONE
J100064G01ACCCCCCACCGTCGGATNONE
J100064K07ACCCCCCACCGTCGGATNONE
J100064L09ACCCCCCACCGTCGGATNONE
J100064M13ACCCCCCACCGTCGGATNONE
J100064O10ACCCCCCACCGTCGGATNONE
J100065J24ACCCCCCACCGTCGGATNONE
J100065N15ACCCCCCACCGTCGGATNONE
J100066E13ACCCCCCACCGTCGGATNONE
J100066G16ACCCCCCACCGTCGGATNONE
J100066J03ACCCCCCACCGTCGGATNONE
J100066K06ACCCCCCACCGTCGGATNONE
J100066P15ACCCCCCACCGTCGGATNONE
J100067D12ACCCCCCACCGTCGGATNONE
J100067G04ACCCCCCACCGTCGGATNONE
J100067G18ACCCCCCACCGTCGGATNONE
J100067I18ACCCCCCACCGTCGGATNONE
J100067K04ACCCCCCACCGTCGGATNONE
J100068C21ACCCCCCACCGTCGGATNONE
J100068D08ACCCCCCACCGTCGGATNONE
J100068G17ACCCCCCACCGTCGGATNONE
J100068H09ACCCCCCACCGTCGGATNONE
J100069F05ACCCCCCACCGTCGGATNONE
J100069I20ACCCCCCACCGTCGGATNONE
J100069J05ACCCCCCACCGTCGGATNONE
J100070D16ACCCCCCACCGTCGGATNONE
J100070I09ACCCCCCACCGTCGGATNONE
J100070K06ACCCCCCACCGTCGGATNONE
J100071G09ACCCCCCACCGTCGGATNONE
J100071H20ACCCCCCACCGTCGGATNONE
J100071K07ACCCCCCACCGTCGGATNONE
J100071L03ACCCCCCACCGTCGGATNONE
J100071L13ACCCCCCACCGTCGGATNONE
J100072A11ACCCCCCACCGTCGGATNONE
J100072C19ACCCCCCACCGTCGGATNONE
J100072E13ACCCCCCACCGTCGGATNONE
J100072E16ACCCCCCACCGTCGGATNONE
J100072M06ACCCCCCACCGTCGGATNONE
J100072O10ACCCCCCACCGTCGGATNONE
J100073E05ACCCCCCACCGTCGGATNONE
J100073L14ACCCCCCACCGTCGGATNONE
J100073N05ACCCCCCACCGTCGGATNONE
J100074I04ACCCCCCACCGTCGGATNONE
J100074K21ACCCCCCACCGTCGGATNONE
J100074L22ACCCCCCACCGTCGGATNONE
J100074N07ACCCCCCACCGTCGGATNONE
J100075F18ACCCCCCACCGTCGGATNONE
J100075H14ACCCCCCACCGTCGGATNONE
J100075I03ACCCCCCACCGTCGGATNONE
J100075K02ACCCCCCACCGTCGGATNONE
J100075K11ACCCCCCACCGTCGGATNONE
J100075K16ACCCCCCACCGTCGGATNONE
J100075N08ACCCCCCACCGTCGGATNONE
J100076A03ACCCCCCACCGTCGGATNONE
J100076C05ACCCCCCACCGTCGGATNONE
J100076I24ACCCCCCACCGTCGGATNONE
J100077H07ACCCCCCACCGTCGGATNONE
J100077P09ACCCCCCACCGTCGGATNONE
J100078C15ACCCCCCACCGTCGGATNONE
J100078J15ACCCCCCACCGTCGGATNONE
J100078K02ACCCCCCACCGTCGGATNONE
J100078K23ACCCCCCACCGTCGGATNONE
J100078M11ACCCCCCACCGTCGGATNONE
J100079E21ACCCCCCACCGTCGGATNONE
J100079F03ACCCCCCACCGTCGGATNONE
J100079K13ACCCCCCACCGTCGGATNONE
J100081L17ACCCCCCACCGTCGGATNONE
J100081P09ACCCCCCACCGTCGGATNONE
J100082D14ACCCCCCACCGTCGGATNONE
J100083E07ACCCCCCACCGTCGGATNONE
J100083H07ACCCCCCACCGTCGGATNONE
J100084B12ACCCCCCACCGTCGGATNONE
J100084C20ACCCCCCACCGTCGGATNONE
J100084D21ACCCCCCACCGTCGGATNONE
J100084L21ACCCCCCACCGTCGGATNONE
J100085I10ACCCCCCACCGTCGGATNONE
J100085L22ACCCCCCACCGTCGGATNONE
J100085M20ACCCCCCACCGTCGGATNONE
J100086G15ACCCCCCACCGTCGGATNONE
J100086N03ACCCCCCACCGTCGGATNONE
J100087E11ACCCCCCACCGTCGGATNONE
J100087I01ACCCCCCACCGTCGGATNONE
J100088C17ACCCCCCACCGTCGGATNONE
J100088N20ACCCCCCACCGTCGGATNONE
J100089I18ACCCCCCACCGTCGGATNONE
J100089M13ACCCCCCACCGTCGGATNONE
J100090E17ACCCCCCACCGTCGGATNONE
J100090J19ACCCCCCACCGTCGGATNONE


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.