version

Summary of AACCG(G/A) (All List)

Organism Oryza sativa
PPDB Motif AACCG(G/A)
Description overlapping GT1 box
Total Entry Count 994

Entry Sequences (994 entries)

LocusGene modelSequenceDescription
Os01g0134500AK111908ACCGGCCCSimilar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase).
AK112014ACCGGCCCNONE
Os01g0156300AK107993ACCGGCCCSimilar to Cappuccino protein.
Os01g0203300015-045-F03ACCGGCCCATCTNONE
015-045-F03ACCGGCCCATTNONE
AK106329ACCGGCCCATCTConserved hypothetical protein.
AK106329ACCGGCCCATTConserved hypothetical protein.
Os01g0236800Os01g0236800GGGCCGGTSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2).
Os01g0276500006-030-E04GGGCCGGTNONE
AK061002GGGCCGGTSimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)].
AK099335GGGCCGGTNONE
Os01g0303300J053035N19ACCGGCCCACGCNONE
J075042F02ACCGGCCCACGCNONE
J075068E10ACCGGCCCACGCNONE
J075116E19ACCGGCCCACGCNONE
J075131C10ACCGGCCCACGCNONE
J075145J11ACCGGCCCACGCNONE
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J075164G12ACCGGCCCACGCNONE
Os01g0316800009-188-E08ACCGGCCCATAANONE
AK058821ACCGGCCCATAANONE
AK119788ACCGGCCCATAASimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1).
J065098A09ACCGGCCCATAANONE
J065102J21ACCGGCCCATAANONE
J065173M10ACCGGCCCATAANONE
J075066K08ACCGGCCCATAANONE
J080302B04ACCGGCCCATAANONE
J080310P14ACCGGCCCATAANONE
J080311I23ACCGGCCCATAANONE
J080319N12ACCGGCCCATAANONE
J100024D14ACCGGCCCATAANONE
J100055N12ACCGGCCCATAANONE
Os01g0337900AK120645ACCGGCCCSimilar to Dihydrolipoamide dehydrogenase.
Os01g0346400J100032G11ACCGGCCCATTConserved hypothetical protein.
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein.
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4.
J013105M07AAAAGCCCAAACCGGCCCACCACNONE
J013155A16AAAAGCCCAAACCGGCCCACCACNONE
J033025C03AAAAGCCCAAACCGGCCCACCACNONE
J033072L20AAAAGCCCAAACCGGCCCACCACNONE
J033095I15AAAAGCCCAAACCGGCCCACCACNONE
J033105E03AAAAGCCCAAACCGGCCCACCACNONE
J033112G18AAAAGCCCAAACCGGCCCACCACNONE
J033125D09AAAAGCCCAAACCGGCCCACCACNONE
J065100L16AAAAGCCCAAACCGGCCCACCACNONE
J065176I05AAAAGCCCAAACCGGCCCACCACNONE
J090001C14AAAAGCCCAAACCGGCCCACCACNONE
J090058E15AAAAGCCCAAACCGGCCCACCACNONE
J090068F07AAAAGCCCAAACCGGCCCACCACNONE
Os01g0513700AK058445ACCGGCCCATGGNONE
AK068877ACCGGCCCATGGSybindin-like protein family protein.
J023001F01ACCGGCCCATGGNONE
J065065I18ACCGGCCCATGGNONE
J065165A09ACCGGCCCATGGNONE
J065184N12ACCGGCCCATGGNONE
J065205M05ACCGGCCCATGGNONE
J075172I17ACCGGCCCATGGNONE
J090025O09ACCGGCCCATGGNONE
J100087H03ACCGGCCCATGGNONE
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein.
Os01g0613900014-018-D04ACCGGCCCACAANONE
AK119181ACCGGCCCACAAProtein of unknown function UPF0052 and CofD family protein.
J023119M14ACCGGCCCACAANONE
J065019A15ACCGGCCCACAANONE
J075090J10ACCGGCCCACAANONE
J075195H12ACCGGCCCACAANONE
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein.
J013149O08ACCGGCCCATGANONE
J033064N24ACCGGCCCATGANONE
J043022M20ACCGGCCCATGANONE
J065075K20ACCGGCCCATGANONE
J065081K04ACCGGCCCATGANONE
J065128K13ACCGGCCCATGANONE
J065131K12ACCGGCCCATGANONE
J065137H20ACCGGCCCATGANONE
J065205A09ACCGGCCCATGANONE
J090030C13ACCGGCCCATGANONE
J090053I08ACCGGCCCATGANONE
J090054O22ACCGGCCCATGANONE
J090082C15ACCGGCCCATGANONE
J090097P12ACCGGCCCATGANONE
Os01g0695200015-090-F01ACCGGCCCNONE
015-090-F01ATCCCCCACCGGCCCNONE
AK064145ACCGGCCCProtein of unknown function DUF266, plant family protein.
AK064145ATCCCCCACCGGCCCProtein of unknown function DUF266, plant family protein.
J065163N10ACCGGCCCNONE
J065163N10ATCCCCCACCGGCCCNONE
J100051F21ACCGGCCCNONE
J100051F21ATCCCCCACCGGCCCNONE
Os01g0706100AK072799CTTGGGCCGGTConserved hypothetical protein.
J013049G14CTTGGGCCGGTNONE
J023136E17CTTGGGCCGGTNONE
Os01g0720600016-050-G11AGAGTGGGCCGGTNONE
AK066808AGAGTGGGCCGGTNONE
AK100976AGAGTGGGCCGGTNONE
AK106541AGAGTGGGCCGGTStarch synthase IVa (Glycogen (Starch) synthase-like).
AY373257AGAGTGGGCCGGTNONE
J100039H11AGAGTGGGCCGGTNONE
J100072K02AGAGTGGGCCGGTNONE
Os01g0731800AK121474ACCGGCCCRINGv domain containing protein.
J023148N13ACCGGCCCNONE
J065136G08ACCGGCCCNONE
Os01g0738600AK073479ACCGGCCCENTH/VHS domain containing protein.
AK120616ACCGGCCCNONE
J013046M12ACCGGCCCNONE
J013152B11ACCGGCCCNONE
J023007A09ACCGGCCCNONE
J023007N03ACCGGCCCNONE
J023042A01ACCGGCCCNONE
J023059P06ACCGGCCCNONE
J023113A05ACCGGCCCNONE
J033044K11ACCGGCCCNONE
J033082E04ACCGGCCCNONE
J090033B13ACCGGCCCNONE
J090062H08ACCGGCCCNONE
J100086G23ACCGGCCCNONE
Os01g0749900AK103588TGGATGGGCCGGTProtein of unknown function DUF250 domain containing protein.
J033090O22TGGATGGGCCGGTNONE
J033133C05TGGATGGGCCGGTNONE
J065122N01TGGATGGGCCGGTNONE
J065188K04TGGATGGGCCGGTNONE
J090012D18TGGATGGGCCGGTNONE
J100074N02TGGATGGGCCGGTNONE
Os01g0756300014-074-B05ACCGGCCCGGTNONE
AK069648ACCGGCCCGGTConserved hypothetical protein.
Os01g0764600AK060621ACCGGCCCAGCFosfomycin resistance kinase FomA family protein.
J013111L18ACCGGCCCAGCNONE
J013134N08ACCGGCCCAGCNONE
Os01g0764800AK102809ACCGGCCCSimilar to Nt-gh3 deduced protein.
Os01g0770400006-112-B08GTGCGGTGGGCCGGTNONE
AK061253GTGCGGTGGGCCGGTNONE
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein.
Os01g0800800AK108093ACCGGCCCACAConserved hypothetical protein.
Os01g0813800AK063065CCTGGGCCGGTNONE
Os01g0827500AK111814ACCGGCCCExo70 exocyst complex subunit family protein.
Os01g0872700AK066633ACCGGCCCNONE
AK100381ACCGGCCCPutative 5-3 exonuclease domain containing protein.
J013028K13ACCGGCCCNONE
J013038C19ACCGGCCCNONE
J023024P16ACCGGCCCNONE
J023074N21ACCGGCCCNONE
J023085E21ACCGGCCCNONE
J033034K14ACCGGCCCNONE
J033044N04ACCGGCCCNONE
J033052O10ACCGGCCCNONE
J033087J09ACCGGCCCNONE
J033129L17ACCGGCCCNONE
J033143O07ACCGGCCCNONE
J065014M22ACCGGCCCNONE
J065025H10ACCGGCCCNONE
J065051H21ACCGGCCCNONE
J065123E05ACCGGCCCNONE
J065181P03ACCGGCCCNONE
J100064B21ACCGGCCCNONE
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein.
J033030B16ACCGGCCCACGCCTCNONE
J033098D06ACCGGCCCACGCCTCNONE
J033112A12ACCGGCCCACGCCTCNONE
J043003L24ACCGGCCCACGCCTCNONE
Os01g0889000AK103621TTGTGGGCCGGTTetratricopeptide-like helical domain containing protein.
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein.
AK120263AGTTGGGCCTTACTGGGCCGGTNONE
Os01g0949200AK102412ACCGGCCCAACTNONE
J033093A04ACCGGCCCAACTNONE
J065053P06ACCGGCCCAACTNONE
J100086D18ACCGGCCCAACTNONE
Os02g0105400009-186-H01GGGCCGGTNONE
011-071-C07GGGCCGGTNONE
014-024-F03GGGCCGGTNONE
AK105416GGGCCGGTNONE
D13817GGGCCGGTNONE
J023087J24GGGCCGGTNONE
J065191M15GGGCCGGTNONE
Os02g0162500009-181-F03ACCGGCCCAATTNONE
AK058907ACCGGCCCAATTNONE
AK121223ACCGGCCCAATTSimilar to 40S ribosomal protein S14.
J023090I10ACCGGCCCAATTNONE
J023136J11ACCGGCCCAATTNONE
J053097J20ACCGGCCCAATTNONE
J053098F01ACCGGCCCAATTNONE
J065065B09ACCGGCCCAATTNONE
J065082M04ACCGGCCCAATTNONE
J065188O05ACCGGCCCAATTNONE
J075057P15ACCGGCCCAATTNONE
J075061J08ACCGGCCCAATTNONE
J075061N15ACCGGCCCAATTNONE
J075131I08ACCGGCCCAATTNONE
J075141H13ACCGGCCCAATTNONE
J080062E14ACCGGCCCAATTNONE
J080062P15ACCGGCCCAATTNONE
J080318G17ACCGGCCCAATTNONE
J080319G19ACCGGCCCAATTNONE
J090001L10ACCGGCCCAATTNONE
J090024I18ACCGGCCCAATTNONE
J090033F24ACCGGCCCAATTNONE
J090036M16ACCGGCCCAATTNONE
J090040I24ACCGGCCCAATTNONE
J090048P06ACCGGCCCAATTNONE
J090049B12ACCGGCCCAATTNONE
J090068C02ACCGGCCCAATTNONE
J090069O04ACCGGCCCAATTNONE
J090084H22ACCGGCCCAATTNONE
J100022L03ACCGGCCCAATTNONE
J100028O14ACCGGCCCAATTNONE
J100028O18ACCGGCCCAATTNONE
J100032A15ACCGGCCCAATTNONE
J100033D21ACCGGCCCAATTNONE
J100034J23ACCGGCCCAATTNONE
J100043K22ACCGGCCCAATTNONE
J100052M22ACCGGCCCAATTNONE
J100053N03ACCGGCCCAATTNONE
J100074N24ACCGGCCCAATTNONE
J100082J10ACCGGCCCAATTNONE
Os02g0179100AK058557CACGCCACCGGCCCATACMetal-dependent phosphohydrolase, HD region domain containing protein.
J080311O10CACGCCACCGGCCCATACNONE
Os02g0227000J023084F07ACCGGCCCATTTNONE
J033051H22ACCGGCCCATTTProtein of unknown function UPF0054 family protein.
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein.
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein.
Os02g0530300014-069-H07GGGCCGGTNONE
AK063708GGGCCGGTZinc finger, A20-type domain containing protein.
Os02g0556100006-100-D03GGGCCGGTNONE
AK059938GGGCCGGTNONE
AK103125GGGCCGGTNAD-dependent epimerase/dehydratase family protein.
J033107B22GGGCCGGTNONE
J033119M03GGGCCGGTNONE
J033120L06GGGCCGGTNONE
J043007B02GGGCCGGTNONE
J043012G03GGGCCGGTNONE
J043024A02GGGCCGGTNONE
J043027J18GGGCCGGTNONE
J100019E06GGGCCGGTNONE
J100069C22GGGCCGGTNONE
Os02g0629800AK121915ATTGGGCCGGTSimilar to Defensin precursor.
J033106C08ATTGGGCCGGTNONE
J065053G20ATTGGGCCGGTNONE
J065114P06ATTGGGCCGGTNONE
J065174H18ATTGGGCCGGTNONE
J065183J04ATTGGGCCGGTNONE
J080310C15ATTGGGCCGGTNONE
Os02g0651900AK101633AATGGGCCGGTNONE
AK102949AATGGGCCGGTConserved hypothetical protein.
J080018N20AATGGGCCGGTNONE
J080062I19AATGGGCCGGTNONE
J100064N12AATGGGCCGGTNONE
J100083B11AATGGGCCGGTNONE
J100089D08AATGGGCCGGTNONE
Os02g0672500AK109266ACCGGCCCACACNONE
Os02g0697200015-013-B10TGTTGGGCCGGTNONE
AK059475TGTTGGGCCGGTNONE
AK102993TGTTGGGCCGGTConserved hypothetical protein.
J033079I18TGTTGGGCCGGTNONE
J033082A14TGTTGGGCCGGTNONE
J065047H08TGTTGGGCCGGTNONE
J065131M14TGTTGGGCCGGTNONE
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like.
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22).
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein.
Os02g0792900AK068367ACCGGCCCGGTTMS membrane protein/tumour differentially expressed protein family protein.
AK104731ACCGGCCCGGTNONE
AK106174ACCGGCCCGGTNONE
AK119191ACCGGCCCGGTNONE
Os02g0823800AK120318ACCGGCCCATATConserved hypothetical protein.
J075055J16ACCGGCCCATATNONE
Os03g0130700AK110670GCTGGGCCGGTNONE
Os03g0131500AK109755TCCGGGCCGGTVitamin K epoxide reductase domain containing protein.
Os03g0145700AK065716AAATGGGCCGGTNONE
J013039F14AAATGGGCCGGTNONE
J013091M20AAATGGGCCGGTNONE
J065059P20AAATGGGCCGGTNONE
J065128M07AAATGGGCCGGTNONE
J065136N23AAATGGGCCGGTNONE
J065163H21AAATGGGCCGGTNONE
J065176B18AAATGGGCCGGTNONE
J065177A17AAATGGGCCGGTNONE
J065201F24AAATGGGCCGGTNONE
Os03g0192400009-081-A03AGTTGGGCCGGTNONE
009-159-B02AGTTGGGCCGGTNONE
AK070573AGTTGGGCCGGTGRIM-19 family protein.
J023056B01AGTTGGGCCGGTNONE
J023075G06AGTTGGGCCGGTNONE
J033048K16AGTTGGGCCGGTNONE
J033048L16AGTTGGGCCGGTNONE
J053031H23AGTTGGGCCGGTNONE
J065002H14AGTTGGGCCGGTNONE
J065006G22AGTTGGGCCGGTNONE
J065032G13AGTTGGGCCGGTNONE
J065056A09AGTTGGGCCGGTNONE
J065078I01AGTTGGGCCGGTNONE
J065095G01AGTTGGGCCGGTNONE
J065095I18AGTTGGGCCGGTNONE
J065134M18AGTTGGGCCGGTNONE
J065158P07AGTTGGGCCGGTNONE
J065165K17AGTTGGGCCGGTNONE
J065181J12AGTTGGGCCGGTNONE
J065189N09AGTTGGGCCGGTNONE
J065200D13AGTTGGGCCGGTNONE
J065202H20AGTTGGGCCGGTNONE
J065215K20AGTTGGGCCGGTNONE
J075049N19AGTTGGGCCGGTNONE
J075147J16AGTTGGGCCGGTNONE
J090081E19AGTTGGGCCGGTNONE
J100017C16AGTTGGGCCGGTNONE
J100039M16AGTTGGGCCGGTNONE
J100043E23AGTTGGGCCGGTNONE
J100063L12AGTTGGGCCGGTNONE
J100079F22AGTTGGGCCGGTNONE
Os03g0195900J065063O15GGAGTGGGCCGGTNONE
Os03g0260600AK106649GGGCCGGTBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os03g0276500011-014-A06ACCGGCCCAACNONE
012-043-E04ACCGGCCCAACNONE
012-096-G01ACCGGCCCAACNONE
014-005-A07ACCGGCCCAACNONE
014-031-F09ACCGGCCCAACNONE
014-040-C09ACCGGCCCAACNONE
014-092-G02ACCGGCCCAACNONE
AK072830ACCGGCCCAACNONE
AK099275ACCGGCCCAACNONE
AK109474ACCGGCCCAACSimilar to Heat shock protein 70.
J013036E08ACCGGCCCAACNONE
J013047P03ACCGGCCCAACNONE
J013048H14ACCGGCCCAACNONE
J013060E24ACCGGCCCAACNONE
J013093N10ACCGGCCCAACNONE
J013123K11ACCGGCCCAACNONE
J013153C09ACCGGCCCAACNONE
J023010D20ACCGGCCCAACNONE
J023027O13ACCGGCCCAACNONE
J023029B01ACCGGCCCAACNONE
J023063G14ACCGGCCCAACNONE
J023083D09ACCGGCCCAACNONE
J023091M13ACCGGCCCAACNONE
J023121M10ACCGGCCCAACNONE
J023126D10ACCGGCCCAACNONE
J023139H01ACCGGCCCAACNONE
J023145B18ACCGGCCCAACNONE
J033029G15ACCGGCCCAACNONE
J033050K13ACCGGCCCAACNONE
J033057L09ACCGGCCCAACNONE
J033092M15ACCGGCCCAACNONE
J065007N14ACCGGCCCAACNONE
J065038E07ACCGGCCCAACNONE
J065043A09ACCGGCCCAACNONE
J065100C19ACCGGCCCAACNONE
J065117C02ACCGGCCCAACNONE
J065213I04ACCGGCCCAACNONE
J090001F01ACCGGCCCAACNONE
J090025D07ACCGGCCCAACNONE
J090037C11ACCGGCCCAACNONE
J090047N11ACCGGCCCAACNONE
J090053O05ACCGGCCCAACNONE
J090070F11ACCGGCCCAACNONE
J090082O16ACCGGCCCAACNONE
J090085F20ACCGGCCCAACNONE
J090096N08ACCGGCCCAACNONE
Os03g0278200AK103544GGGCCGGTNAD-dependent epimerase/dehydratase family protein.
Os03g0319300006-021-E05AACGGGCCGGTNONE
006-022-H12AACGGGCCGGTNONE
009-187-E02AACGGGCCGGTNONE
AF042840AACGGGCCGGTNONE
AK059756AACGGGCCGGTCalmodulin (CaM).
AK070090AACGGGCCGGTNONE
J065017J02AACGGGCCGGTNONE
J065028G17AACGGGCCGGTNONE
J065045N09AACGGGCCGGTNONE
J065078F21AACGGGCCGGTNONE
J065091H01AACGGGCCGGTNONE
J065112B19AACGGGCCGGTNONE
J065186E08AACGGGCCGGTNONE
J065199G12AACGGGCCGGTNONE
J075030K07AACGGGCCGGTNONE
J075050B02AACGGGCCGGTNONE
J075057G07AACGGGCCGGTNONE
J075070F01AACGGGCCGGTNONE
J075093N12AACGGGCCGGTNONE
J075095K13AACGGGCCGGTNONE
J075102D14AACGGGCCGGTNONE
J075103B17AACGGGCCGGTNONE
J075114K05AACGGGCCGGTNONE
J075142F18AACGGGCCGGTNONE
J075154L11AACGGGCCGGTNONE
J075185F08AACGGGCCGGTNONE
J090012A14AACGGGCCGGTNONE
J090044L10AACGGGCCGGTNONE
J100044C12AACGGGCCGGTNONE
J100088J19AACGGGCCGGTNONE
Os03g0372900AK100417ACCGGCCCCyclin-like F-box domain containing protein.
Os03g0647800003-103-H03ACCGGCCCACCAACNONE
006-104-G09ACCGGCCCACCAACNONE
AK070243ACCGGCCCACCAACConserved hypothetical protein.
J100056F22ACCGGCCCACCAACNONE
Os03g0656900AK066416ATATGGGCCGGTNusB/RsmB/TIM44 domain containing protein.
J065157L23ATATGGGCCGGTNONE
J065166P22ATATGGGCCGGTNONE
Os03g0685900009-026-A09TATTGGGCCGGTNONE
009-145-C09TATTGGGCCGGTNONE
AK062981TATTGGGCCGGTConserved hypothetical protein.
J065001D12TATTGGGCCGGTNONE
J065023B10TATTGGGCCGGTNONE
J065041E10TATTGGGCCGGTNONE
J065046C01TATTGGGCCGGTNONE
J065146I22TATTGGGCCGGTNONE
J065184F20TATTGGGCCGGTNONE
J075011E15TATTGGGCCGGTNONE
J075048H17TATTGGGCCGGTNONE
J075070H15TATTGGGCCGGTNONE
J075133C01TATTGGGCCGGTNONE
J075170D02TATTGGGCCGGTNONE
J090001G08TATTGGGCCGGTNONE
J090026B09TATTGGGCCGGTNONE
J100055M03TATTGGGCCGGTNONE
Os03g0687700AK064673ACCGGCCCGCAConserved hypothetical protein.
AK119706ACCGGCCCGCANONE
J075042I10ACCGGCCCGCANONE
J075111I20ACCGGCCCGCANONE
J075176K09ACCGGCCCGCANONE
J080072D18ACCGGCCCGCANONE
J080306M23ACCGGCCCGCANONE
Os03g0695600006-103-C09ACCGGCCCACTNONE
014-029-B11ACCGGCCCACTNONE
AB026566ACCGGCCCACTNONE
AK061228ACCGGCCCACTProteasome subunit beta type 2 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit beta-4).
AK099128ACCGGCCCACTNONE
J023041C17ACCGGCCCACTNONE
J043030L19ACCGGCCCACTNONE
J065002E17ACCGGCCCACTNONE
J065042H23ACCGGCCCACTNONE
J065110P10ACCGGCCCACTNONE
J065112D10ACCGGCCCACTNONE
J065114B21ACCGGCCCACTNONE
J065124B02ACCGGCCCACTNONE
J065138P08ACCGGCCCACTNONE
J065182O20ACCGGCCCACTNONE
J065216N05ACCGGCCCACTNONE
J075060D19ACCGGCCCACTNONE
J075097M03ACCGGCCCACTNONE
J075098I11ACCGGCCCACTNONE
J075142I15ACCGGCCCACTNONE
J090018B21ACCGGCCCACTNONE
J090034E12ACCGGCCCACTNONE
J090042N01ACCGGCCCACTNONE
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein.
J013095D02CCGTGGGCCGGTGGGCCCGNONE
J023091G12CCGTGGGCCGGTGGGCCCGNONE
J065207J17CCGTGGGCCGGTGGGCCCGNONE
J100067G13CCGTGGGCCGGTGGGCCCGNONE
J100089L11CCGTGGGCCGGTGGGCCCGNONE
Os03g0769600AK100054ACCGGCCCATCTResB-like family protein.
Os03g0774200AK065851ACCGGCCCNONE
AK119532ACCGGCCCSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3).
J013041L15ACCGGCCCNONE
J023107I03ACCGGCCCNONE
J065156I19ACCGGCCCNONE
J065176L07ACCGGCCCNONE
J100066F15ACCGGCCCNONE
Os03g0822900AK099787GGCTGGGCCGGTZinc finger, BED-type predicted domain containing protein.
J013042C24GGCTGGGCCGGTNONE
J013096O21GGCTGGGCCGGTNONE
J023109I23GGCTGGGCCGGTNONE
J033106N09GGCTGGGCCGGTNONE
J033107H03GGCTGGGCCGGTNONE
J033118G03GGCTGGGCCGGTNONE
J033145I24GGCTGGGCCGGTNONE
J065138D15GGCTGGGCCGGTNONE
J065140L13GGCTGGGCCGGTNONE
J065179M13GGCTGGGCCGGTNONE
J065200F05GGCTGGGCCGGTNONE
J075104F20GGCTGGGCCGGTNONE
J075143A15GGCTGGGCCGGTNONE
J075197J11GGCTGGGCCGGTNONE
Os03g0846400AK067706GGGCCGGTNONE
AK070549GGGCCGGTPeptidase, trypsin-like serine and cysteine domain containing protein.
Os04g0253000005-012-H08ACCGGCCCACCNONE
009-095-D01ACCGGCCCACCNONE
016-090-D11ACCGGCCCACCNONE
AK073668ACCGGCCCACCSimilar to Histone H1.
J013088G23ACCGGCCCACCNONE
J013162C07ACCGGCCCACCNONE
J023031N06ACCGGCCCACCNONE
J023039N07ACCGGCCCACCNONE
J023083I01ACCGGCCCACCNONE
J023083O14ACCGGCCCACCNONE
J023122B19ACCGGCCCACCNONE
J023133L08ACCGGCCCACCNONE
J033052L06ACCGGCCCACCNONE
J033080E10ACCGGCCCACCNONE
J090032L14ACCGGCCCACCNONE
J100022N05ACCGGCCCACCNONE
J100029A08ACCGGCCCACCNONE
J100029H18ACCGGCCCACCNONE
J100066D09ACCGGCCCACCNONE
J100077M22ACCGGCCCACCNONE
Os04g0378200AK103076ACCGGCCCAAACSterile alpha motif SAM domain containing protein.
J033118E02ACCGGCCCAAACNONE
J065065F15ACCGGCCCAAACNONE
J090080I24ACCGGCCCAAACNONE
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2).
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE
Os04g0551800016-049-G12GTTTGGGCCGGTNONE
AK121568GTTTGGGCCGGTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha).
J013073O06GTTTGGGCCGGTNONE
J013111B11GTTTGGGCCGGTNONE
J013121H23GTTTGGGCCGGTNONE
J023012A17GTTTGGGCCGGTNONE
J023092M05GTTTGGGCCGGTNONE
J033026P14GTTTGGGCCGGTNONE
J033033C10GTTTGGGCCGGTNONE
J033033M10GTTTGGGCCGGTNONE
J033035C24GTTTGGGCCGGTNONE
J033052E19GTTTGGGCCGGTNONE
J033140K19GTTTGGGCCGGTNONE
J065036F18GTTTGGGCCGGTNONE
J065067L12GTTTGGGCCGGTNONE
J065095G09GTTTGGGCCGGTNONE
J065115B08GTTTGGGCCGGTNONE
J065218E24GTTTGGGCCGGTNONE
J090002N13GTTTGGGCCGGTNONE
J090008B12GTTTGGGCCGGTNONE
J090016F24GTTTGGGCCGGTNONE
J090019H14GTTTGGGCCGGTNONE
J090020G20GTTTGGGCCGGTNONE
J090029L18GTTTGGGCCGGTNONE
J090057C23GTTTGGGCCGGTNONE
J090073H23GTTTGGGCCGGTNONE
J090081C16GTTTGGGCCGGTNONE
J090081E21GTTTGGGCCGGTNONE
J090084L14GTTTGGGCCGGTNONE
J090086M01GTTTGGGCCGGTNONE
J090089E16GTTTGGGCCGGTNONE
J100031P12GTTTGGGCCGGTNONE
J100090N23GTTTGGGCCGGTNONE
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein.
AK104273ACATGGGCCGGTNONE
Os04g0658300AK067399TAATGGGCCGGTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA).
Os04g0668900AF085174ACCGGCCCACCNONE
AK067891ACCGGCCCACCSimilar to Plastid terminal oxidase.
Os04g0678800AK072212ACCGGCCCGTTN-acetylglucosaminylphosphatidylinositol deacetylase family protein.
AK099065ACCGGCCCGTTNONE
Os04g0682300AK061384TTGTGGGCCGGTSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2).
AK104004TTGTGGGCCGGTNONE
J033102P12TTGTGGGCCGGTNONE
J100038F01TTGTGGGCCGGTNONE
Os05g0180700J100062K04GCTGGGCCGGTConserved hypothetical protein.
Os05g0223300AK069616ACCGGCCCATTTSimilar to RNA-binding protein.
J080093O15ACCGGCCCATTTNONE
J090061N02ACCGGCCCATTTNONE
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein.
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE
Os05g0227800AK110997AACGGGCCGGTCCAAGCCCAAHomeodomain-like containing protein.
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein.
AK106958GCGTGGGCCGGTNONE
AK109539GCGTGGGCCGGTNONE
J023083K23GCGTGGGCCGGTNONE
Os05g0295900AK069962AACTGGGCCGGTConserved hypothetical protein.
Os05g0377000Os05g0377000ACCGGCCCATCASimilar to Acyl carrier protein (ACP).
Os05g0397700AK067298GGCCGGGCCGGGCCGGTSecY protein family protein.
Os05g0424700AK107848GGGCCGGTSimilar to Copper transporter 1.
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein.
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein.
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE
Os05g0499800016-065-G04ACCGGCCCNONE
AK064392ACCGGCCCNONE
AK103146ACCGGCCCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
J023075J11ACCGGCCCNONE
J033120I02ACCGGCCCNONE
Os05g0502800016-060-H05CCCATCCACCGGCCCGCANONE
AK064242CCCATCCACCGGCCCGCANONE
AK065486CCCATCCACCGGCCCGCANAF1 domain containing protein.
Os05g0508500009-110-H08GGGCCGGTNONE
009-135-B09GGGCCGGTNONE
009-165-D10GGGCCGGTNONE
AB053294GGGCCGGTNONE
AK059385GGGCCGGTNONE
AK106758GGGCCGGTSimilar to Thioredoxin H.
J013121L08GGGCCGGTNONE
J023069L24GGGCCGGTNONE
J023146O17GGGCCGGTNONE
J043030D01GGGCCGGTNONE
J065084D15GGGCCGGTNONE
J090046E10GGGCCGGTNONE
J090078J10GGGCCGGTNONE
Os05g0509200AK061566ACTGGGCCGGTNADH dehydrogenase (ubiquinone), 24 kDa subunit family protein.
AK099007ACTGGGCCGGTNONE
AK100226ACTGGGCCGGTNONE
J013114B12ACTGGGCCGGTNONE
J023048D09ACTGGGCCGGTNONE
Os05g0512500009-036-D05GTGGTGGGCCGGTNONE
AK062441GTGGTGGGCCGGTCT20 family protein.
J080003C10GTGGTGGGCCGGTNONE
J080046G11GTGGTGGGCCGGTNONE
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A.
Os05g0540100AB021666ACCGGCCCNONE
AK060623ACCGGCCCNONE
AK103819ACCGGCCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a).
Os05g0553700006-100-D08ACCGGGCCGGTNONE
AK099747ACCGGGCCGGTNONE
AK101606ACCGGGCCGGTNONE
AK103396ACCGGGCCGGTSimilar to Syntaxin 71 (AtSYP71).
J033022M23ACCGGGCCGGTNONE
J090086G01ACCGGGCCGGTNONE
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein.
Os05g0576300015-055-B11ACCGGCCCCACCNONE
AK106354ACCGGCCCCACCZinc finger, CCCH-type domain containing protein.
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE
Os06g0136000AK060303ACCGGCCCAATSimilar to Hypersensitive-induced reaction protein 4.
AK102678ACCGGCCCAATNONE
J075185K19ACCGGCCCAATNONE
J090028C16ACCGGCCCAATNONE
J090099N12ACCGGCCCAATNONE
J100070O10ACCGGCCCAATNONE
Os06g0232000006-109-B11ACCGGCCCACCNONE
011-080-C04ACCGGCCCACCNONE
016-019-G01ACCGGCCCACCNONE
AB110192ACCGGCCCACCNONE
AK068966ACCGGCCCACCNONE
AK071776ACCGGCCCACCConserved hypothetical protein.
AK106053ACCGGCCCACCNONE
J013146K14ACCGGCCCACCNONE
J023013A10ACCGGCCCACCNONE
J023029O20ACCGGCCCACCNONE
J023110G05ACCGGCCCACCNONE
J023135H04ACCGGCCCACCNONE
J033125H14ACCGGCCCACCNONE
J043009N01ACCGGCCCACCNONE
J090096E06ACCGGCCCACCNONE
J100070G19ACCGGCCCACCNONE
Os06g0236200J075111M01ACCGGCCCACACConserved hypothetical protein.
J075171D01ACCGGCCCACACNONE
Os06g0332500009-108-G06ACCGGCCCAGTNONE
009-119-F06ACCGGCCCAGTNONE
AK121262ACCGGCCCAGTConserved hypothetical protein.
J023104L05ACCGGCCCAGTNONE
J033022F22ACCGGCCCAGTNONE
Os06g0348800AF318581GCGCGCGACCGGCCCNONE
AK061946GCGCGCGACCGGCCCNONE
AK065184GCGCGCGACCGGCCCNONE
AK098909GCGCGCGACCGGCCCNONE
AK098915GCGCGCGACCGGCCCHomeodomain-like containing protein.
AK122161GCGCGCGACCGGCCCNONE
J013002D22GCGCGCGACCGGCCCNONE
J013002F22GCGCGCGACCGGCCCNONE
J013002I19GCGCGCGACCGGCCCNONE
J013022A07GCGCGCGACCGGCCCNONE
J013135J08GCGCGCGACCGGCCCNONE
J033147G01GCGCGCGACCGGCCCNONE
J075012G19GCGCGCGACCGGCCCNONE
J075049L03GCGCGCGACCGGCCCNONE
J075068G02GCGCGCGACCGGCCCNONE
J075145E15GCGCGCGACCGGCCCNONE
J075145J09GCGCGCGACCGGCCCNONE
J075155B11GCGCGCGACCGGCCCNONE
J075173E22GCGCGCGACCGGCCCNONE
J075180B11GCGCGCGACCGGCCCNONE
J075195D12GCGCGCGACCGGCCCNONE
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein.
AK121899GCAGCCCACCCGACTGGGCCGGTNONE
Os06g0530200009-042-B02ACCGGCCCAGCNONE
009-050-E10ACCGGCCCAGCNONE
009-060-F07ACCGGCCCAGCNONE
009-117-H08ACCGGCCCAGCNONE
009-129-C10ACCGGCCCAGCNONE
AK073116ACCGGCCCAGCConserved hypothetical protein.
AK104077ACCGGCCCAGCNONE
J065032N16ACCGGCCCAGCNONE
J065153K07ACCGGCCCAGCNONE
J065169N18ACCGGCCCAGCNONE
J065190H18ACCGGCCCAGCNONE
J075127E14ACCGGCCCAGCNONE
J090008F20ACCGGCCCAGCNONE
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator.
AK122052CTGGGCTTGGTGGGCCGGTNONE
Os06g0647900AK073750ACCGGCCCAGATConserved hypothetical protein.
J033029K17ACCGGCCCAGATNONE
J033070L21ACCGGCCCAGATNONE
Os06g0650100009-016-C02ACCGGCCCACCTNONE
AK062354ACCGGCCCACCTSimilar to Polyubiquitin gene (Fragment).
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein.
J065114J19AATGGGCCGGGCCGGTNONE
Os07g0169600006-027-F04ACCGGCCCNONE
006-043-C10ACCGGCCCNONE
006-070-A04ACCGGCCCNONE
006-081-F03ACCGGCCCNONE
006-104-F02ACCGGCCCNONE
012-006-D12ACCGGCCCNONE
AK060318ACCGGCCCNONE
AK121818ACCGGCCC2OG-Fe(II) oxygenase domain containing protein.
J023065K01ACCGGCCCNONE
J023086G17ACCGGCCCNONE
J023093G16ACCGGCCCNONE
J033024N04ACCGGCCCNONE
J033099A15ACCGGCCCNONE
J033107B14ACCGGCCCNONE
J043026F14ACCGGCCCNONE
J065043P20ACCGGCCCNONE
J075118L16ACCGGCCCNONE
J075162M22ACCGGCCCNONE
J080004K13ACCGGCCCNONE
J080024D10ACCGGCCCNONE
J080037C21ACCGGCCCNONE
J080039M17ACCGGCCCNONE
J080040A03ACCGGCCCNONE
J080044A07ACCGGCCCNONE
J080045I07ACCGGCCCNONE
J080052L06ACCGGCCCNONE
J080053A20ACCGGCCCNONE
J080060L15ACCGGCCCNONE
J080060N22ACCGGCCCNONE
J080062L23ACCGGCCCNONE
J080069B19ACCGGCCCNONE
J080086K15ACCGGCCCNONE
J080089H16ACCGGCCCNONE
J080089I23ACCGGCCCNONE
J080094P07ACCGGCCCNONE
J090032L18ACCGGCCCNONE
J100044E09ACCGGCCCNONE
J100045O03ACCGGCCCNONE
J100066B11ACCGGCCCNONE
J100069J24ACCGGCCCNONE
Os07g0422100013-054-G11ACCGGCCCGGGNONE
AK063592ACCGGCCCGGGNONE
J065165K10ACCGGCCCGGGNONE
J075021B01ACCGGCCCGGGNONE
J075087H22ACCGGCCCGGGNONE
J075118C10ACCGGCCCGGGNONE
J075134N03ACCGGCCCGGGNONE
J075151F23ACCGGCCCGGGNONE
U57639ACCGGCCCGGGAWPM-19-like family protein.
Os07g0462700009-033-D05ATTGGGCCGGTNONE
AK073834ATTGGGCCGGTNONE
AK104968ATTGGGCCGGTThioesterase superfamily domain containing protein.
J065104G16ATTGGGCCGGTNONE
J065197C14ATTGGGCCGGTNONE
J065213E17ATTGGGCCGGTNONE
J065215D11ATTGGGCCGGTNONE
J075001J15ATTGGGCCGGTNONE
J075026M11ATTGGGCCGGTNONE
J075142G03ATTGGGCCGGTNONE
J075178H04ATTGGGCCGGTNONE
J100069P18ATTGGGCCGGTNONE
Os07g0572500AK108612ACCGGCCCConserved hypothetical protein.
AK108612ACCGGCCCAACCConserved hypothetical protein.
Os07g0589400AK072501CACGTGGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein.
AK072501GGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein.
AK104617CACGTGGGCCGGTNONE
AK104617GGGCCGGTNONE
AK104756CACGTGGGCCGGTNONE
AK104756GGGCCGGTNONE
Os07g0606500AK068811ACCGGCCCNONE
AK121873ACCGGCCCNONE
J013159C05ACCGGCCCNONE
J075158B14ACCGGCCCNONE
Os07g0607200AK065746ACCGGCCCATTTProtein of unknown function DUF751 family protein.
J065037B15ACCGGCCCATTTNONE
J065042E20ACCGGCCCATTTNONE
J065161I08ACCGGCCCATTTNONE
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES).
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE
Os08g0118900AK109749TTATGGGCCGGTAdenylate kinase family protein.
Os08g0427900AK103217ACCGGCCCACASimilar to Hin19 (Fragment).
AK109208ACCGGCCCACANONE
J080005C08ACCGGCCCACANONE
J080010B10ACCGGCCCACANONE
J080013C21ACCGGCCCACANONE
J080022L12ACCGGCCCACANONE
J080029C08ACCGGCCCACANONE
J080029G09ACCGGCCCACANONE
J080035L14ACCGGCCCACANONE
J080040M20ACCGGCCCACANONE
J080043M18ACCGGCCCACANONE
J080045K15ACCGGCCCACANONE
J080048I17ACCGGCCCACANONE
J080051P16ACCGGCCCACANONE
J080053L16ACCGGCCCACANONE
J080059P14ACCGGCCCACANONE
J080063E13ACCGGCCCACANONE
J080075N18ACCGGCCCACANONE
J080077E05ACCGGCCCACANONE
J080080H23ACCGGCCCACANONE
J080081L16ACCGGCCCACANONE
J080083F17ACCGGCCCACANONE
J080085C23ACCGGCCCACANONE
J080086A12ACCGGCCCACANONE
J080088N06ACCGGCCCACANONE
J080092G10ACCGGCCCACANONE
J080093F04ACCGGCCCACANONE
J080094C03ACCGGCCCACANONE
J090032L12ACCGGCCCACANONE
Os08g0468400011-057-F06ACCGGCCCAATGGGCCATNONE
AK063363ACCGGCCCAATGGGCCATHEC/Ndc80p family protein.
J100048N11ACCGGCCCAATGGGCCATNONE
Os08g0522500006-026-A04ACCGGCCCATCTNONE
006-037-B02ACCGGCCCATCTNONE
006-047-E11ACCGGCCCATCTNONE
015-049-E10ACCGGCCCATCTNONE
AK060080ACCGGCCCATCTNONE
AK102814ACCGGCCCATCTNONE
AK104718ACCGGCCCATCTNONE
AK106190ACCGGCCCATCTGlycoside hydrolase, family 19 protein.
J013068H02ACCGGCCCATCTNONE
J033108M05ACCGGCCCATCTNONE
J033116M13ACCGGCCCATCTNONE
J065211H04ACCGGCCCATCTNONE
J075195H03ACCGGCCCATCTNONE
J075195I24ACCGGCCCATCTNONE
Os08g0567200AK067161ACCGGCCCNONE
J013094H15ACCGGCCCNONE
J065209H08ACCGGCCCNONE
Os09g0325100J080009O19ACCGGCCCNONE
J080011H14ACCGGCCCConserved hypothetical protein.
J080014F14ACCGGCCCNONE
J080014M09ACCGGCCCNONE
J080014N20ACCGGCCCNONE
J080018K13ACCGGCCCNONE
J080023C08ACCGGCCCNONE
J080023C09ACCGGCCCNONE
J080023K14ACCGGCCCNONE
J080025I09ACCGGCCCNONE
J080030J04ACCGGCCCNONE
J080039D08ACCGGCCCNONE
J080039L17ACCGGCCCNONE
J080041B13ACCGGCCCNONE
J080041P21ACCGGCCCNONE
J080042J21ACCGGCCCNONE
J080042L19ACCGGCCCNONE
J080045F07ACCGGCCCNONE
J080047B10ACCGGCCCNONE
J080051F23ACCGGCCCNONE
J080053D15ACCGGCCCNONE
J080053K02ACCGGCCCNONE
J080058K18ACCGGCCCNONE
J080061M13ACCGGCCCNONE
J080064M24ACCGGCCCNONE
J080067H07ACCGGCCCNONE
J080080B21ACCGGCCCNONE
J080080D18ACCGGCCCNONE
J080082G07ACCGGCCCNONE
J080088B01ACCGGCCCNONE
J080088E09ACCGGCCCNONE
J080093L01ACCGGCCCNONE
Os09g0458400AK070055ACCGGCCCAGAConserved hypothetical protein.
AK120321ACCGGCCCAGANONE
J065064N11ACCGGCCCAGANONE
J065083J06ACCGGCCCAGANONE
J065121D24ACCGGCCCAGANONE
J065156I22ACCGGCCCAGANONE
J065163J24ACCGGCCCAGANONE
J075001I02ACCGGCCCAGANONE
J090088O06ACCGGCCCAGANONE
Os09g0477700AK121644ATATGGGCCGGTConserved hypothetical protein.
Os09g0527700AK111128ACCGGCCCAACCSimilar to Auxin-induced protein IAA4.
J065124H12ACCGGCCCAACCNONE
J065181I07ACCGGCCCAACCNONE
J065207G14ACCGGCCCAACCNONE
Os09g0532700AK069946GCCCCACCGGCCCACGGAlpha/beta hydrolase family protein.
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein.
AK120040TCATGGGCCCATCACCGGCCCACANONE
J023047I06TCATGGGCCCATCACCGGCCCACANONE
J033064L23TCATGGGCCCATCACCGGCCCACANONE
J033117I01TCATGGGCCCATCACCGGCCCACANONE
J033123I18TCATGGGCCCATCACCGGCCCACANONE
J053026H17TCATGGGCCCATCACCGGCCCACANONE
J053078G05TCATGGGCCCATCACCGGCCCACANONE
J065102A09TCATGGGCCCATCACCGGCCCACANONE
J065113G11TCATGGGCCCATCACCGGCCCACANONE
J065207F20TCATGGGCCCATCACCGGCCCACANONE
J075027K21TCATGGGCCCATCACCGGCCCACANONE
Os11g0303200J023135L01GGGCCGGTNONE
J075074O21GGGCCGGTNONE
Os11g0549655J065008P04AGATGGGCTAATTGGGCCGGTGGCCCGGCNONE
J065148G18AGATGGGCTAATTGGGCCGGTGGCCCGGCMaf-like protein family protein.
Os12g0228900J033132F01CATGGGCCGGTNONE
J043003P05CATGGGCCGGTNONE
J065079N16CATGGGCCGGTNONE
J065141L03CATGGGCCGGTNONE
J075001I21CATGGGCCGGTNONE
J075032L11CATGGGCCGGTNONE
J075126O12CATGGGCCGGTNONE
J100079E06CATGGGCCGGTNONE
Os12g0274200009-166-H09ACCGGCCCAGCCNONE
AK063071ACCGGCCCAGCCLipolytic enzyme, G-D-S-L family protein.
Os12g0297500AK072331GGGCCGGTGlycoside hydrolase, starch-binding domain containing protein.
Os12g0533500AK068646ACCGGCCCATCCACCCACTTGConserved hypothetical protein.
J013158L10ACCGGCCCATCCACCCACTTGNONE
J065083J02ACCGGCCCATCCACCCACTTGNONE
J075079D02ACCGGCCCATCCACCCACTTGNONE
J100037H16ACCGGCCCATCCACCCACTTGNONE
J100075P13ACCGGCCCATCCACCCACTTGNONE
Os12g0557800AK121691AAATGGGCCGGTGGGCCGTGProtein prenyltransferase domain containing protein.
J013095M03AAATGGGCCGGTGGGCCGTGNONE
J033071H11AAATGGGCCGGTGGGCCGTGNONE
J065101B02AAATGGGCCGGTGGGCCGTGNONE
Os12g0597500AK101904ACCGGCCCACCNONE
AK103799ACCGGCCCACCAmidase, hydantoinase/carbamoylase family protein.
J065206A02ACCGGCCCACCNONE
J100078O15ACCGGCCCACCNONE


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.