version

Summary of AAACG(C/G) (All List)

Organism Oryza sativa
PPDB Motif AAACG(C/G)
Description function unknown
Total Entry Count 2680

Entry Sequences (2680 entries)

LocusGene modelSequenceDescription
Os01g0146200J090080H03AAACGGCCCConserved hypothetical protein.
Os01g0148700006-099-B04CATGGGCCGTTTNONE
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein.
AK109379CATGGGCCGTTTNONE
J023101J18CATGGGCCGTTTNONE
J033036D19CATGGGCCGTTTNONE
J033051P05CATGGGCCGTTTNONE
J033061D21CATGGGCCGTTTNONE
J033071M06CATGGGCCGTTTNONE
J033072D18CATGGGCCGTTTNONE
J033073M13CATGGGCCGTTTNONE
J033084N02CATGGGCCGTTTNONE
J065092C13CATGGGCCGTTTNONE
J080017H24CATGGGCCGTTTNONE
J080032E16CATGGGCCGTTTNONE
J080077J07CATGGGCCGTTTNONE
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE
006-081-C11GTGGGTCCAACGGCCCAGCNONE
009-050-D04GTGGGTCCAACGGCCCAGCNONE
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein.
J023058M18GTGGGTCCAACGGCCCAGCNONE
J023112H22GTGGGTCCAACGGCCCAGCNONE
J065048P05GTGGGTCCAACGGCCCAGCNONE
J100068N20GTGGGTCCAACGGCCCAGCNONE
J100073A02GTGGGTCCAACGGCCCAGCNONE
Os01g0159600013-096-A02AAACGGCCNONE
AK064055AAACGGCCSmall hydrophilic plant seed protein family protein.
AK122153AAACGGCCNONE
J033073N07AAACGGCCNONE
J033088A13AAACGGCCNONE
J033143J06AAACGGCCNONE
J053031D05AAACGGCCNONE
J053037K14AAACGGCCNONE
J053045E08AAACGGCCNONE
J053062D01AAACGGCCNONE
J053083H22AAACGGCCNONE
J053089G12AAACGGCCNONE
J053089G24AAACGGCCNONE
J053099O13AAACGGCCNONE
J065070H11AAACGGCCNONE
J075013L17AAACGGCCNONE
J075021L24AAACGGCCNONE
J075033B10AAACGGCCNONE
J075034G01AAACGGCCNONE
J075035A11AAACGGCCNONE
J075045F22AAACGGCCNONE
J075046N02AAACGGCCNONE
J075047K11AAACGGCCNONE
J075058N15AAACGGCCNONE
J075059E22AAACGGCCNONE
J075061G22AAACGGCCNONE
J075078E12AAACGGCCNONE
J075079B08AAACGGCCNONE
J075090K12AAACGGCCNONE
J075096P05AAACGGCCNONE
J075097G05AAACGGCCNONE
J075097O15AAACGGCCNONE
J075101J04AAACGGCCNONE
J075104K17AAACGGCCNONE
J075110F15AAACGGCCNONE
J075118D23AAACGGCCNONE
J075118E10AAACGGCCNONE
J075137K22AAACGGCCNONE
J075138P08AAACGGCCNONE
J075142E22AAACGGCCNONE
J075147K12AAACGGCCNONE
J075149D12AAACGGCCNONE
J075152A15AAACGGCCNONE
J075152H08AAACGGCCNONE
J075156C11AAACGGCCNONE
J075156H20AAACGGCCNONE
J075162I01AAACGGCCNONE
J075166H16AAACGGCCNONE
J075186F11AAACGGCCNONE
J075189F22AAACGGCCNONE
J075190E16AAACGGCCNONE
J075193O11AAACGGCCNONE
Os01g0184500AK060699GGCCCGTTDEAD/DEAH box helicase, N-terminal domain containing protein.
Os01g0219100J065130F20AACGGGCCNONE
J065208O10AACGGGCCSFT2-like family protein.
Os01g0219500AK106863TTTTGGGCCGTTNONE
AK109524TTTTGGGCCGTTPlant lipid transfer protein/Par allergen family protein.
J075053J18TTTTGGGCCGTTNONE
J080023G09TTTTGGGCCGTTNONE
J080051F19TTTTGGGCCGTTNONE
J080085H15TTTTGGGCCGTTNONE
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2.
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE
Os01g0246100AK120732CACGGCCCGTTProtein of unknown function DUF902, CREBbp domain containing protein.
Os01g0266400009-169-A06GGCCGTTTNONE
AK121188GGCCGTTTConserved hypothetical protein.
J023085H22GGCCGTTTNONE
J080301K14GGCCGTTTNONE
J080303B07GGCCGTTTNONE
J080303H21GGCCGTTTNONE
J080308F24GGCCGTTTNONE
Os01g0276500006-030-E04AACGGGCCNONE
AK061002AACGGGCCSimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)].
AK099335AACGGGCCNONE
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein.
Os01g0295900J065076G19GGCCCGTTNONE
Os01g0349400AK064941AAACGGCCNONE
AK100195AAACGGCCNONE
AK105047AAACGGCCNONE
AK122182AAACGGCCSimilar to Serine/threonine protein phosphatase PP1 (EC 3.1.3.16) (Fragment).
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE
012-094-B11AACGGGCCCGGCCCATGNONE
015-096-C04AACGGGCCCGGCCCATGNONE
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein.
AK099005AACGGGCCCGGCCCATGNONE
J013109B04AACGGGCCCGGCCCATGNONE
J033057L14AACGGGCCCGGCCCATGNONE
J090072H04AACGGGCCCGGCCCATGNONE
J100030A14AACGGGCCCGGCCCATGNONE
Os01g0530366J075001P06AACGGGCCCAGTTNONE
J075001P06GCCGGCCCATATAACGGGCCNONE
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein.
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein.
J075030G13AACGGGCCCAGTTNONE
J075030G13GCCGGCCCATATAACGGGCCNONE
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase.
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE
Os01g0593700Os01g0593700AAACGGCCCAATSulphate anion transporter family protein.
Os01g0596700AK107371AACGGGCCCCACGFBD domain containing protein.
Os01g0611000003-117-E07GGCCCGTTNONE
006-051-D01GGCCCGTTNONE
006-085-B10GGCCCGTTNONE
012-092-F03GGCCCGTTNONE
AK060682GGCCCGTTNONE
AK072500GGCCCGTTSimilar to Unidentified precursor.
AK105921GGCCCGTTNONE
J023001D07GGCCCGTTNONE
J023075J23GGCCCGTTNONE
J023127H12GGCCCGTTNONE
J033024H20GGCCCGTTNONE
J033025H03GGCCCGTTNONE
J065057F11GGCCCGTTNONE
J065096C07GGCCCGTTNONE
J065103A08GGCCCGTTNONE
J065137L11GGCCCGTTNONE
J065179I16GGCCCGTTNONE
J065197P22GGCCCGTTNONE
J075089M08GGCCCGTTNONE
J090008N14GGCCCGTTNONE
J090011K16GGCCCGTTNONE
J090075K24GGCCCGTTNONE
J090079E08GGCCCGTTNONE
Os01g0621600AK100122AAACGGCCProtein of unknown function DUF1221 domain containing protein.
Os01g0636500012-066-G03GGGGCCCGTTNONE
AK073853GGGGCCCGTTSimilar to Polygalacturonase PG2.
AK104990GGGGCCCGTTNONE
J033072D05GGGGCCCGTTNONE
Os01g0640800AK065688TCTGGCCCGTTConserved hypothetical protein 48 family protein.
J013042L10TCTGGCCCGTTNONE
J013121H08TCTGGCCCGTTNONE
Os01g0642900009-109-F01AAACGGCCCATATNONE
AK063836AAACGGCCCATATSingle-strand binding protein/Primosomal replication protein n family protein.
AK073560AAACGGCCCATATNONE
J033043K18AAACGGCCCATATNONE
J100023C05AAACGGCCCATATNONE
J100038C15AAACGGCCCATATNONE
J100039C23AAACGGCCCATATNONE
Os01g0685900AK064024AACGGGCCNONE
AK102005AACGGGCCSimilar to 65kD microtubule associated protein.
Os01g0704700AK100296GGCCCGTTSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2.
Os01g0705700003-130-H06AAACGGCCNONE
AK064946AAACGGCCSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116).
J013000P16AAACGGCCNONE
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein.
Os01g0732200015-078-D03GGGCCGTTTNONE
AK067563GGGCCGTTTGTP-binding protein, HSR1-related domain containing protein.
J013111I12GGGCCGTTTNONE
J033113N16GGGCCGTTTNONE
J033124C05GGGCCGTTTNONE
Os01g0752300AK121755GGCCCGTTSimilar to 60S ribosomal protein L18a-1.
J013049F10GGCCCGTTNONE
J013088L10GGCCCGTTNONE
J023020B21GGCCCGTTNONE
J023038M01GGCCCGTTNONE
J033058H15GGCCCGTTNONE
J033088C04GGCCCGTTNONE
J033115N19GGCCCGTTNONE
J033131H04GGCCCGTTNONE
J065067E05GGCCCGTTNONE
J065085C07GGCCCGTTNONE
J065095D12GGCCCGTTNONE
J065124B19GGCCCGTTNONE
J065181H07GGCCCGTTNONE
J065197B09GGCCCGTTNONE
J075090K22GGCCCGTTNONE
J075101P17GGCCCGTTNONE
J075181F13GGCCCGTTNONE
J075190H19GGCCCGTTNONE
J090004P17GGCCCGTTNONE
J090066I03GGCCCGTTNONE
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein.
Os01g0836400AK073540TCAGGCCCGTTSAC3/GANP family protein.
J023019D11TCAGGCCCGTTNONE
J023139O22TCAGGCCCGTTNONE
J033042J20TCAGGCCCGTTNONE
J033046M18TCAGGCCCGTTNONE
J033124J09TCAGGCCCGTTNONE
J090015E05TCAGGCCCGTTNONE
J090076J09TCAGGCCCGTTNONE
Os01g0838300J090017B22AGTGGGCCGTTGNONE
J090061B04AGTGGGCCGTTGNONE
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein.
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
Os01g0853600AK107747AACGGGCCGTANONE
AK108628AACGGGCCGTANONE
AK120975AACGGGCCGTAConserved hypothetical protein.
J023041K02AACGGGCCGTANONE
Os01g0863166J065007F23AACGGGCCGTGNONE
J065007F23AACGGGCCGTGNONE
J065007F23CACGGCCCGTTNONE
J065124H21AACGGGCCGTGConserved hypothetical protein.
J065124H21AACGGGCCGTGConserved hypothetical protein.
J065124H21CACGGCCCGTTConserved hypothetical protein.
Os01g0869200AK073453AAACGGCCMg2+ transporter protein, CorA-like family protein.
Os01g0880800AK059526AAACGGCCNONE
AK101524AAACGGCCNONE
AK120809AAACGGCCSimilar to Acyl-[acyl-carrier-protein] desaturase, chloroplast precursor (EC 1.14.19.2) (Stearoyl-ACP desaturase).
J065112H13AAACGGCCNONE
J090098J11AAACGGCCNONE
Os01g0881100AK109822GCGGCCCAAACGGCCEpsin, N-terminal domain containing protein.
Os01g0885200AK059113AACGGCCCNONE
Os01g0888900AK120651AAACGGCCConserved hypothetical protein.
J013157C10AAACGGCCNONE
J065019H01AAACGGCCNONE
J065182E10AAACGGCCNONE
J065195D16AAACGGCCNONE
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog).
J013034A14AAACGGCCCAAAANONE
J013063O14AAACGGCCCAAAANONE
J023023D20AAACGGCCCAAAANONE
J075121J02AAACGGCCCAAAANONE
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein.
Os02g0103700009-031-C12AACGGCCCACCANONE
AK062502AACGGCCCACCANONE
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA).
J033086N17AACGGCCCACCANONE
J065161I07AACGGCCCACCANONE
J065184G15AACGGCCCACCANONE
J075123E02AACGGCCCACCANONE
Os02g0104800AK070860AACGGGCCConserved hypothetical protein.
J023002G20AACGGGCCNONE
J023022J19AACGGGCCNONE
J023067K03AACGGGCCNONE
J023108G24AACGGGCCNONE
J033075B01AACGGGCCNONE
J033087I15AACGGGCCNONE
J065087I11AACGGGCCNONE
J065194E02AACGGGCCNONE
Os02g0115900AF006825ATCTCGGCCCGTTNONE
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein.
AK119653ATCTCGGCCCGTTNONE
Os02g0122000AK121653AACGGGCCSimilar to P18.
J023034M04AACGGGCCNONE
J033023M01AACGGGCCNONE
J033061I03AACGGGCCNONE
J033075B04AACGGGCCNONE
J065035D09AACGGGCCNONE
J065103D15AACGGGCCNONE
J065146O07AACGGGCCNONE
J065193L20AACGGGCCNONE
J090015G02AACGGGCCNONE
J090059G13AACGGGCCNONE
J090068F14AACGGGCCNONE
J090087H22AACGGGCCNONE
J100017D08AACGGGCCNONE
J100029H10AACGGGCCNONE
J100029I17AACGGGCCNONE
J100059H12AACGGGCCNONE
J100060H07AACGGGCCNONE
Os02g0123200016-017-F04AAACGGCCCGGTNONE
J033057C03AAACGGCCCGGTNONE
J033087C11AAACGGCCCGGTNONE
J033108J20AAACGGCCCGGTNONE
J043015P08AAACGGCCCGGTNONE
Os02g0163600AK068043AACGGGCCCGCConserved hypothetical protein.
J013131O20AACGGGCCCGCNONE
J065006E03AACGGGCCCGCNONE
Os02g0180700AK070746GGCCCGTTSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44).
Os02g0186500AK068056AAACGGCCCACTSimilar to Protein kinase-like protein.
AK099031AAACGGCCCACTNONE
J013111A12AAACGGCCCACTNONE
J013127K13AAACGGCCCACTNONE
J013132O11AAACGGCCCACTNONE
J023056A11AAACGGCCCACTNONE
J023078M08AAACGGCCCACTNONE
J033081F07AAACGGCCCACTNONE
J090079E24AAACGGCCCACTNONE
J090097I02AAACGGCCCACTNONE
Os02g0188500AK102004AAACGGCCCAAAANONE
AK106917AAACGGCCCAAAAUbiquitin domain containing protein.
J090039N13AAACGGCCCAAAANONE
Os02g0220600AK061944CAAGGCCCGTTElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma).
AK103901GGCCCGTTACAGCCCAACANONE
AK104946CAAGGCCCGTTNONE
D89802CAAGGCCCGTTNONE
J013042L22CAAGGCCCGTTNONE
J013056A14CAAGGCCCGTTNONE
J013058O03GGCCCGTTACAGCCCAACANONE
J013120G13CAAGGCCCGTTNONE
J013124E21GGCCCGTTACAGCCCAACANONE
J013155K19CAAGGCCCGTTNONE
J023002B10CAAGGCCCGTTNONE
J023023L03GGCCCGTTACAGCCCAACANONE
J023023L21GGCCCGTTACAGCCCAACANONE
J023061N01GGCCCGTTACAGCCCAACANONE
J023065O09GGCCCGTTACAGCCCAACANONE
J023080J19CAAGGCCCGTTNONE
J023081C08CAAGGCCCGTTNONE
J023090H05CAAGGCCCGTTNONE
J023091M07CAAGGCCCGTTNONE
J023106J17GGCCCGTTACAGCCCAACANONE
J023115F09CAAGGCCCGTTNONE
J023119N08GGCCCGTTACAGCCCAACANONE
J033025I23CAAGGCCCGTTNONE
J033026G12CAAGGCCCGTTNONE
J033035E15CAAGGCCCGTTNONE
J033040N13CAAGGCCCGTTNONE
J033046C17CAAGGCCCGTTNONE
J033058A19GGCCCGTTACAGCCCAACANONE
J033069F02CAAGGCCCGTTNONE
J033071B16CAAGGCCCGTTNONE
J033071N22CAAGGCCCGTTNONE
J033088J02CAAGGCCCGTTNONE
J033092N24CAAGGCCCGTTNONE
J033093I09CAAGGCCCGTTNONE
J033098O13GGCCCGTTACAGCCCAACANONE
J033100M18GGCCCGTTACAGCCCAACANONE
J033125A21GGCCCGTTACAGCCCAACANONE
J033126G06CAAGGCCCGTTNONE
J033148C12GGCCCGTTACAGCCCAACANONE
J043003G15CAAGGCCCGTTNONE
J043010M11CAAGGCCCGTTNONE
J043017F03GGCCCGTTACAGCCCAACANONE
J043024O20CAAGGCCCGTTNONE
J043032J02GGCCCGTTACAGCCCAACANONE
J053047N10GGCCCGTTACAGCCCAACANONE
J053089P04GGCCCGTTACAGCCCAACANONE
J065051K09GGCCCGTTACAGCCCAACANONE
J065064H24GGCCCGTTACAGCCCAACANONE
J065092N03CAAGGCCCGTTNONE
J080004D17CAAGGCCCGTTNONE
J080010L09CAAGGCCCGTTNONE
J080021I11CAAGGCCCGTTNONE
J080022L01CAAGGCCCGTTNONE
J080029B01CAAGGCCCGTTNONE
J080032D11CAAGGCCCGTTNONE
J080039B11CAAGGCCCGTTNONE
J080040K17CAAGGCCCGTTNONE
J080041B21CAAGGCCCGTTNONE
J080052L24CAAGGCCCGTTNONE
J080054M12CAAGGCCCGTTNONE
J080057B15CAAGGCCCGTTNONE
J080078G15CAAGGCCCGTTNONE
J080078H06CAAGGCCCGTTNONE
J080079M03CAAGGCCCGTTNONE
J080088H16CAAGGCCCGTTNONE
J080093C11CAAGGCCCGTTNONE
J080095K09CAAGGCCCGTTNONE
J080095O20CAAGGCCCGTTNONE
J090001L06GGCCCGTTACAGCCCAACANONE
J090009J19CAAGGCCCGTTNONE
J090017C24GGCCCGTTACAGCCCAACANONE
J090040D04CAAGGCCCGTTNONE
J090052E14CAAGGCCCGTTNONE
J090058G15GGCCCGTTACAGCCCAACANONE
J090058H23GGCCCGTTACAGCCCAACANONE
J090061G20GGCCCGTTACAGCCCAACANONE
J090063B14CAAGGCCCGTTNONE
J090069N23GGCCCGTTACAGCCCAACANONE
J090071A08GGCCCGTTACAGCCCAACANONE
J090071K04CAAGGCCCGTTNONE
J090074A08GGCCCGTTACAGCCCAACANONE
J090075E12CAAGGCCCGTTNONE
J090077B15GGCCCGTTACAGCCCAACANONE
J090081K06GGCCCGTTACAGCCCAACANONE
J090083I05GGCCCGTTACAGCCCAACANONE
J090087A06CAAGGCCCGTTNONE
J090091O22GGCCCGTTACAGCCCAACANONE
J090094P03CAAGGCCCGTTNONE
J090097L10GGCCCGTTACAGCCCAACANONE
J090098M14CAAGGCCCGTTNONE
J100026B11GGCCCGTTACAGCCCAACANONE
J100044M01GGCCCGTTACAGCCCAACANONE
J100046F10GGCCCGTTACAGCCCAACANONE
J100051K14GGCCCGTTACAGCCCAACANONE
J100060D22GGCCCGTTACAGCCCAACANONE
J100060H18GGCCCGTTACAGCCCAACANONE
J100070I06GGCCCGTTACAGCCCAACANONE
J100071C04GGCCCGTTACAGCCCAACANONE
J100078M13GGCCCGTTACAGCCCAACANONE
J100080E17GGCCCGTTACAGCCCAACANONE
J100083I09GGCCCGTTACAGCCCAACANONE
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein.
Os02g0245000AK119770GGCCGGGCGGCCCGTTNONE
AK119874GGCCGGGCGGCCCGTTSWAP/Surp domain containing protein.
J065038L11GGCCGGGCGGCCCGTTNONE
J100059I06GGCCGGGCGGCCCGTTNONE
J100076C23GGCCGGGCGGCCCGTTNONE
J100081P08GGCCGGGCGGCCCGTTNONE
J100084C13GGCCGGGCGGCCCGTTNONE
Os02g0321000AK121840TAATGGGCCGTTTTetratricopeptide-like helical domain containing protein.
Os02g0445700011-046-C10AACGGGCCGTGNONE
011-046-C10CACGGCCCGTTNONE
011-046-C10GGCCCGGCCCGTTNONE
Os02g0467200014-053-H06GGCCCGTTNONE
AK063704GGCCCGTTConserved hypothetical protein.
J065197J05GGCCCGTTNONE
Os02g0565000AK120665AACGGGCCHomeodomain-like containing protein.
J100070C12AACGGGCCNONE
J100074L08AACGGGCCNONE
Os02g0586900013-044-D08AACGGGCCCAGANONE
014-087-D07AACGGGCCCAGANONE
AK063583AACGGGCCCAGASimilar to Glycine rich protein (Fragment).
AK105378AACGGGCCCAGANONE
Os02g0602300AK065609AACGGGCCGTGNONE
AK065609AACGGGCCGTGNONE
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
J013092L08AACGGGCCGTGNONE
J013092L08AACGGGCCGTGNONE
J090040I23AACGGGCCGTGNONE
J090040I23AACGGGCCGTGNONE
Os02g0606900J023065M01AACGGGCCNONE
J075046E14AACGGGCCNONE
Os02g0612900AK071108AAACGGCCSimilar to Temperature stress-induced lipocalin.
J013045F10AAACGGCCNONE
J023078B21AAACGGCCNONE
Os02g0628600J100044L04AACGGCCCGTranscriptional factor B3 family protein.
Os02g0629900AK108563AGCCCAAAAACGGCCCConserved hypothetical protein.
J065138O07AGCCCAAAAACGGCCCNONE
Os02g0644000AK070079AAACGGCCSimilar to C13 endopeptidase NP1 (Fragment).
Os02g0646200009-031-C03AACGGCCCATGNONE
AK071507AACGGCCCATGZinc finger, B-box domain containing protein.
J023090D24AACGGCCCATGNONE
Os02g0646400AK067828AGTGGGCCGTTSimilar to Glutaredoxin.
J013120N01AGTGGGCCGTTNONE
J065021N01AGTGGGCCGTTNONE
J065021N02AGTGGGCCGTTNONE
J065053O18AGTGGGCCGTTNONE
J090067J17AGTGGGCCGTTNONE
Os02g0668500006-056-A05CCAACGGCCCAGGNONE
AK060958CCAACGGCCCAGGNONE
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein.
J023117I15CCAACGGCCCAGGNONE
J065013J03CCAACGGCCCAGGNONE
J065021P16CCAACGGCCCAGGNONE
J065044B07CCAACGGCCCAGGNONE
J065059E23CCAACGGCCCAGGNONE
J065087N20CCAACGGCCCAGGNONE
J065185I04CCAACGGCCCAGGNONE
J065190G19CCAACGGCCCAGGNONE
J065199C15CCAACGGCCCAGGNONE
J065213L12CCAACGGCCCAGGNONE
J080305C01CCAACGGCCCAGGNONE
J080308C07CCAACGGCCCAGGNONE
J080310F02CCAACGGCCCAGGNONE
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein.
Os02g0678300J075035C01AACGGCCCATGGlucose-methanol-choline oxidoreductase domain containing protein.
J075148E09AACGGCCCATGNONE
J080024A08AACGGCCCATGNONE
J080063C14AACGGCCCATGNONE
J080072L04AACGGCCCATGNONE
J080074H15AACGGCCCATGNONE
J080080E22AACGGCCCATGNONE
J080086H10AACGGCCCATGNONE
J080093B21AACGGCCCATGNONE
J080094G01AACGGCCCATGNONE
J080306H24AACGGCCCATGNONE
Os02g0697200015-013-B10AACGGGCCCACANONE
AK059475AACGGGCCCACANONE
AK102993AACGGGCCCACAConserved hypothetical protein.
J033079I18AACGGGCCCACANONE
J033082A14AACGGGCCCACANONE
J065047H08AACGGGCCCACANONE
J065131M14AACGGGCCCACANONE
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein.
J090039P20CAACGGCCCGGCCCATTTNONE
Os02g0708300009-007-C06GGCCCGTTNONE
009-007-C06GGCCCGTTNONE
009-162-G06GGCCCGTTNONE
009-162-G06GGCCCGTTNONE
014-048-F12GGCCCGTTNONE
014-048-F12GGCCCGTTNONE
AK066348GGCCCGTTConserved hypothetical protein.
AK066348GGCCCGTTConserved hypothetical protein.
J013059F24GGCCCGTTNONE
J013059F24GGCCCGTTNONE
J023104H14GGCCCGTTNONE
J023104H14GGCCCGTTNONE
J053052O22GGCCCGTTNONE
J053052O22GGCCCGTTNONE
J053063A05GGCCCGTTNONE
J053063A05GGCCCGTTNONE
J053093P09GGCCCGTTNONE
J053093P09GGCCCGTTNONE
J065012F24GGCCCGTTNONE
J065012F24GGCCCGTTNONE
J065063P09GGCCCGTTNONE
J065063P09GGCCCGTTNONE
J065088F12GGCCCGTTNONE
J065088F12GGCCCGTTNONE
J065094I11GGCCCGTTNONE
J065094I11GGCCCGTTNONE
J065099H19GGCCCGTTNONE
J065099H19GGCCCGTTNONE
J065116H07GGCCCGTTNONE
J065116H07GGCCCGTTNONE
J065137N07GGCCCGTTNONE
J065137N07GGCCCGTTNONE
J065137N11GGCCCGTTNONE
J065137N11GGCCCGTTNONE
J065159L22GGCCCGTTNONE
J065159L22GGCCCGTTNONE
J065159P11GGCCCGTTNONE
J065159P11GGCCCGTTNONE
J065178F17GGCCCGTTNONE
J065178F17GGCCCGTTNONE
J065181E07GGCCCGTTNONE
J065181E07GGCCCGTTNONE
J075014L16GGCCCGTTNONE
J075014L16GGCCCGTTNONE
J075030P11GGCCCGTTNONE
J075030P11GGCCCGTTNONE
J075042K24GGCCCGTTNONE
J075042K24GGCCCGTTNONE
J075077I15GGCCCGTTNONE
J075077I15GGCCCGTTNONE
J075087P06GGCCCGTTNONE
J075087P06GGCCCGTTNONE
J075089F20GGCCCGTTNONE
J075089F20GGCCCGTTNONE
J075093B07GGCCCGTTNONE
J075093B07GGCCCGTTNONE
J075115J23GGCCCGTTNONE
J075115J23GGCCCGTTNONE
J075176O19GGCCCGTTNONE
J075176O19GGCCCGTTNONE
J075178A04GGCCCGTTNONE
J075178A04GGCCCGTTNONE
J075178J02GGCCCGTTNONE
J075178J02GGCCCGTTNONE
J090027L02GGCCCGTTNONE
J090027L02GGCCCGTTNONE
J100033M12GGCCCGTTNONE
J100033M12GGCCCGTTNONE
J100065O08GGCCCGTTNONE
J100065O08GGCCCGTTNONE
Os02g0712400J065037K01AAACGGCCGTTTNONE
J065083P10AAACGGCCGTTTNONE
J065184E08AAACGGCCGTTTNONE
J100033E07AAACGGCCGTTTNONE
J100040I16AAACGGCCGTTTNONE
J100076M16AAACGGCCGTTTNONE
Os02g0712500003-128-B04GGCCGTTTNONE
AK100094GGCCGTTTProtein of unknown function DUF23 family protein.
J023003P08GGCCGTTTNONE
J033070I23GGCCGTTTNONE
J065019B12GGCCGTTTNONE
J065021D22GGCCGTTTNONE
J065063H05GGCCGTTTNONE
J065103B14GGCCGTTTNONE
J065136I12GGCCGTTTNONE
J065195F24GGCCGTTTNONE
J090045N11GGCCGTTTNONE
Os02g0717100014-089-G06TACGGCCCGTTNONE
AK063741TACGGCCCGTTEsterase/lipase/thioesterase domain containing protein.
J065052A22TACGGCCCGTTNONE
Os02g0717800009-009-B02AAATGGGCCGTTTNONE
J065185P06AAATGGGCCGTTTNONE
J100061J04AAATGGGCCGTTTNONE
J100064M21AAATGGGCCGTTTNONE
Os02g0740300AK067833GGCCCGTTAAA ATPase domain containing protein.
Os02g0744000AK064898AACGGGCCConserved hypothetical protein.
AK104827AACGGGCCNONE
J013000L12AACGGGCCNONE
J013156N02AACGGGCCNONE
J065001H14AACGGGCCNONE
J065038D18AACGGGCCNONE
J065039I18AACGGGCCNONE
J065047C13AACGGGCCNONE
J065053J09AACGGGCCNONE
J065064G03AACGGGCCNONE
J065066M05AACGGGCCNONE
J065068O10AACGGGCCNONE
J065090H22AACGGGCCNONE
J065113L19AACGGGCCNONE
J065121M02AACGGGCCNONE
J065122K23AACGGGCCNONE
J065138C12AACGGGCCNONE
J065153E14AACGGGCCNONE
J065156N12AACGGGCCNONE
J065158L20AACGGGCCNONE
J065166I06AACGGGCCNONE
J065174L15AACGGGCCNONE
J065175N03AACGGGCCNONE
J090092C23AACGGGCCNONE
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein.
J023132N16AACGGCCCAACCNONE
J033069F17AACGGCCCAACCNONE
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like.
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22).
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin.
AK121481ATCCAACGGCCCAGGNONE
J023149K16ATCCAACGGCCCAGGNONE
J033098A18ATCCAACGGCCCAGGNONE
J065017E05ATCCAACGGCCCAGGNONE
J065088E24ATCCAACGGCCCAGGNONE
J080305N16ATCCAACGGCCCAGGNONE
J080306F22ATCCAACGGCCCAGGNONE
J080306P07ATCCAACGGCCCAGGNONE
J080318H06ATCCAACGGCCCAGGNONE
J090013M21ATCCAACGGCCCAGGNONE
J100029G11ATCCAACGGCCCAGGNONE
Os02g0767500005-017-F10AACGGGCCCCACACGNONE
AB016065AACGGGCCCCACACGNONE
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter.
J013020K11AACGGGCCCCACACGNONE
J013066I18AACGGGCCCCACACGNONE
J023012D02AACGGGCCCCACACGNONE
J023020J16AACGGGCCCCACACGNONE
J023022H13AACGGGCCCCACACGNONE
J023044N15AACGGGCCCCACACGNONE
J023067E15AACGGGCCCCACACGNONE
J023079C06AACGGGCCCCACACGNONE
J023080B07AACGGGCCCCACACGNONE
J023081G11AACGGGCCCCACACGNONE
J023091H22AACGGGCCCCACACGNONE
J023092J03AACGGGCCCCACACGNONE
J023114D02AACGGGCCCCACACGNONE
J023121J15AACGGGCCCCACACGNONE
J023128G10AACGGGCCCCACACGNONE
J023132B15AACGGGCCCCACACGNONE
J023140G10AACGGGCCCCACACGNONE
J023142B10AACGGGCCCCACACGNONE
J033026C15AACGGGCCCCACACGNONE
J033029F21AACGGGCCCCACACGNONE
J033037I09AACGGGCCCCACACGNONE
J033046D11AACGGGCCCCACACGNONE
J033081L20AACGGGCCCCACACGNONE
J033097J19AACGGGCCCCACACGNONE
J033125D19AACGGGCCCCACACGNONE
J033125I04AACGGGCCCCACACGNONE
J033141M21AACGGGCCCCACACGNONE
J033143K08AACGGGCCCCACACGNONE
J053091N01AACGGGCCCCACACGNONE
J065093C20AACGGGCCCCACACGNONE
J065104K11AACGGGCCCCACACGNONE
J065143L16AACGGGCCCCACACGNONE
J065205I23AACGGGCCCCACACGNONE
J090057C12AACGGGCCCCACACGNONE
J090075P11AACGGGCCCCACACGNONE
Os02g0777800AK066978GGCCGTTTSimilar to Avr9/Cf-9 induced kinase 1.
Os02g0777950J090078H24AAACGGCCCATAAConserved hypothetical protein.
Os02g0788500006-024-A02AAACGGCCCAAGNONE
006-031-G02AAACGGCCCAAGNONE
006-081-F11AAACGGCCCAAGNONE
006-082-H05AAACGGCCCAAGNONE
AK061452AAACGGCCCAAGConserved hypothetical protein.
AK104117AAACGGCCCAAGNONE
AK104526AAACGGCCCAAGNONE
J075024D11AAACGGCCCAAGNONE
J075056B12AAACGGCCCAAGNONE
J075108H12AAACGGCCCAAGNONE
J075156P10AAACGGCCCAAGNONE
J075197A19AAACGGCCCAAGNONE
Os02g0788800AK066747AACGGGCCAmino acid/polyamine transporter II family protein.
Os02g0791400009-106-F11AACGGGCCGGANONE
AK062787AACGGGCCGGACytochrome oxidase c, subunit VIb family protein.
Os02g0801900006-113-E02AACGGGCCGTGNONE
006-113-E02AACGGGCCGTGNONE
006-113-E02CACGGCCCGTTNONE
AK109488AACGGGCCGTGNONE
AK109488AACGGGCCGTGNONE
AK109488CACGGCCCGTTNONE
AK109498AACGGGCCGTGConserved hypothetical protein.
AK109498AACGGGCCGTGConserved hypothetical protein.
AK109498CACGGCCCGTTConserved hypothetical protein.
J065007D19AACGGGCCGTGNONE
J065007D19AACGGGCCGTGNONE
J065007D19CACGGCCCGTTNONE
J065035G11AACGGGCCGTGNONE
J065035G11AACGGGCCGTGNONE
J065035G11CACGGCCCGTTNONE
J065044E05AACGGGCCGTGNONE
J065044E05AACGGGCCGTGNONE
J065044E05CACGGCCCGTTNONE
J065112N01AACGGGCCGTGNONE
J065112N01AACGGGCCGTGNONE
J065112N01CACGGCCCGTTNONE
J065143B03AACGGGCCGTGNONE
J065143B03AACGGGCCGTGNONE
J065143B03CACGGCCCGTTNONE
J065159A16AACGGGCCGTGNONE
J065159A16AACGGGCCGTGNONE
J065159A16CACGGCCCGTTNONE
J090007K23AACGGGCCGTGNONE
J090007K23AACGGGCCGTGNONE
J090007K23CACGGCCCGTTNONE
J090045N09AACGGGCCGTGNONE
J090045N09AACGGGCCGTGNONE
J090045N09CACGGCCCGTTNONE
J090049L20AACGGGCCGTGNONE
J090049L20AACGGGCCGTGNONE
J090049L20CACGGCCCGTTNONE
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein.
J065055C02AGTTGGGCCGTTGGNONE
J065098A17AGTTGGGCCGTTGGNONE
J065119B13AGTTGGGCCGTTGGNONE
J065146F10AGTTGGGCCGTTGGNONE
J065209G06AGTTGGGCCGTTGGNONE
J080001K12AGTTGGGCCGTTGGNONE
J080004O17AGTTGGGCCGTTGGNONE
J080005P21AGTTGGGCCGTTGGNONE
J080009M18AGTTGGGCCGTTGGNONE
J080013O18AGTTGGGCCGTTGGNONE
J080014B04AGTTGGGCCGTTGGNONE
J080014O21AGTTGGGCCGTTGGNONE
J080015B04AGTTGGGCCGTTGGNONE
J080016B17AGTTGGGCCGTTGGNONE
J080017G09AGTTGGGCCGTTGGNONE
J080022A17AGTTGGGCCGTTGGNONE
J080024M10AGTTGGGCCGTTGGNONE
J080025F17AGTTGGGCCGTTGGNONE
J080025O16AGTTGGGCCGTTGGNONE
J080029H09AGTTGGGCCGTTGGNONE
J080030G24AGTTGGGCCGTTGGNONE
J080031E02AGTTGGGCCGTTGGNONE
J080032A18AGTTGGGCCGTTGGNONE
J080032G24AGTTGGGCCGTTGGNONE
J080033C05AGTTGGGCCGTTGGNONE
J080033N19AGTTGGGCCGTTGGNONE
J080035H10AGTTGGGCCGTTGGNONE
J080035L05AGTTGGGCCGTTGGNONE
J080042N09AGTTGGGCCGTTGGNONE
J080044C14AGTTGGGCCGTTGGNONE
J080048K16AGTTGGGCCGTTGGNONE
J080050L07AGTTGGGCCGTTGGNONE
J080051L06AGTTGGGCCGTTGGNONE
J080051P22AGTTGGGCCGTTGGNONE
J080053D09AGTTGGGCCGTTGGNONE
J080053J15AGTTGGGCCGTTGGNONE
J080053O12AGTTGGGCCGTTGGNONE
J080057L01AGTTGGGCCGTTGGNONE
J080062E08AGTTGGGCCGTTGGNONE
J080062I09AGTTGGGCCGTTGGNONE
J080063A21AGTTGGGCCGTTGGNONE
J080063E04AGTTGGGCCGTTGGNONE
J080063E08AGTTGGGCCGTTGGNONE
J080064D15AGTTGGGCCGTTGGNONE
J080064N15AGTTGGGCCGTTGGNONE
J080068F13AGTTGGGCCGTTGGNONE
J080070L16AGTTGGGCCGTTGGNONE
J080072O17AGTTGGGCCGTTGGNONE
J080075A07AGTTGGGCCGTTGGNONE
J080076H10AGTTGGGCCGTTGGNONE
J080077K19AGTTGGGCCGTTGGNONE
J080078E19AGTTGGGCCGTTGGNONE
J080082A02AGTTGGGCCGTTGGNONE
J080083O05AGTTGGGCCGTTGGNONE
J080091I07AGTTGGGCCGTTGGNONE
J080094K10AGTTGGGCCGTTGGNONE
J080094N03AGTTGGGCCGTTGGNONE
J080096F09AGTTGGGCCGTTGGNONE
J080097O04AGTTGGGCCGTTGGNONE
J090037B19AGTTGGGCCGTTGGNONE
J100017A13AGTTGGGCCGTTGGNONE
J100068N22AGTTGGGCCGTTGGNONE
J100072C06AGTTGGGCCGTTGGNONE
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein.
J075055J16GCAGCCCATACAACGGGCCCAACTNONE
Os03g0108000014-001-C09AACGGGCCGAGNONE
AK102520AACGGGCCGAGSimilar to Dual specificity phosphatase Cdc25 (EC 3.1.3.48) (Arath;CDC25).
J023083K07AACGGGCCGAGNONE
J023110F13AACGGGCCGAGNONE
J033095O09AACGGGCCGAGNONE
J065219M15AACGGGCCGAGNONE
J075009G03AACGGGCCGAGNONE
J080301C17AACGGGCCGAGNONE
J080301I02AACGGGCCGAGNONE
J080301O05AACGGGCCGAGNONE
J080305C08AACGGGCCGAGNONE
J080305D11AACGGGCCGAGNONE
J080311B05AACGGGCCGAGNONE
J080316A17AACGGGCCGAGNONE
J080317K12AACGGGCCGAGNONE
J100087M06AACGGGCCGAGNONE
Os03g0122200009-052-H10GGCCGTTTNONE
AB042934GGCCGTTTNONE
AK065033GGCCGTTTSimilar to 50S ribosomal protein L11.
J013001H03GGCCGTTTNONE
J023149C23GGCCGTTTNONE
J065025J15GGCCGTTTNONE
J065093D22GGCCGTTTNONE
Os03g0135700AK060029GGCCGTTTNONE
AK103779GGCCGTTTSimilar to Transcriptional activator Rb homolog (Fragment).
J033145C17GGCCGTTTNONE
J043021B17GGCCGTTTNONE
Os03g0136200004-011-E10AACGGGCCTTGNONE
006-067-A08AACGGGCCTTGNONE
011-007-E02AACGGGCCTTGNONE
011-099-H10AACGGGCCTTGNONE
012-044-D08AACGGGCCTTGNONE
013-045-G12AACGGGCCTTGNONE
013-062-C09AACGGGCCTTGNONE
013-072-F09AACGGGCCTTGNONE
013-085-B12AACGGGCCTTGNONE
013-097-E09AACGGGCCTTGNONE
013-097-F09AACGGGCCTTGNONE
014-013-C09AACGGGCCTTGNONE
014-082-D08AACGGGCCTTGNONE
015-071-A09AACGGGCCTTGNONE
AF042333AACGGGCCTTGNONE
AK060887AACGGGCCTTGNONE
AK121681AACGGGCCTTG24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2).
J013073N14AACGGGCCTTGNONE
J013123F01AACGGGCCTTGNONE
J023050A02AACGGGCCTTGNONE
J033046H22AACGGGCCTTGNONE
J033070A11AACGGGCCTTGNONE
J065059G11AACGGGCCTTGNONE
J065068F10AACGGGCCTTGNONE
J065164A10AACGGGCCTTGNONE
J075031F07AACGGGCCTTGNONE
J075054J01AACGGGCCTTGNONE
J075086M04AACGGGCCTTGNONE
J075118K23AACGGGCCTTGNONE
J075122A09AACGGGCCTTGNONE
J075123D06AACGGGCCTTGNONE
J075129A22AACGGGCCTTGNONE
J075161E07AACGGGCCTTGNONE
J075179H04AACGGGCCTTGNONE
J075181C06AACGGGCCTTGNONE
J075186A12AACGGGCCTTGNONE
J090014H16AACGGGCCTTGNONE
J090045G17AACGGGCCTTGNONE
J090048B09AACGGGCCTTGNONE
J090052J23AACGGGCCTTGNONE
J090052K22AACGGGCCTTGNONE
J090059F10AACGGGCCTTGNONE
J090080F19AACGGGCCTTGNONE
J100039J08AACGGGCCTTGNONE
J100044K02AACGGGCCTTGNONE
J100051E16AACGGGCCTTGNONE
J100053F08AACGGGCCTTGNONE
J100056F07AACGGGCCTTGNONE
J100058A10AACGGGCCTTGNONE
Os03g0142900011-054-A05CAACGGCCCATTNONE
AK067103CAACGGCCCATTNONE
AK120438CAACGGCCCATTProtein of unknown function DUF946, plant family protein.
J013097D18CAACGGCCCATTNONE
J013098E18CAACGGCCCATTNONE
J013099I17CAACGGCCCATTNONE
J013108C09CAACGGCCCATTNONE
J023045J15CAACGGCCCATTNONE
J033034E13CAACGGCCCATTNONE
J033095F07CAACGGCCCATTNONE
J033102N22CAACGGCCCATTNONE
J065016C14CAACGGCCCATTNONE
J065034E13CAACGGCCCATTNONE
J065065F21CAACGGCCCATTNONE
J065159M09CAACGGCCCATTNONE
J075012C13CAACGGCCCATTNONE
J075017P18CAACGGCCCATTNONE
J075018M03CAACGGCCCATTNONE
J075021H19CAACGGCCCATTNONE
J075070K23CAACGGCCCATTNONE
J075077B18CAACGGCCCATTNONE
J075085E20CAACGGCCCATTNONE
J075090N23CAACGGCCCATTNONE
J075137M16CAACGGCCCATTNONE
J075151E03CAACGGCCCATTNONE
J090042L02CAACGGCCCATTNONE
J090060C21CAACGGCCCATTNONE
J090089I17CAACGGCCCATTNONE
J100024L19CAACGGCCCATTNONE
J100025A06CAACGGCCCATTNONE
J100033C24CAACGGCCCATTNONE
J100052J17CAACGGCCCATTNONE
J100063H10CAACGGCCCATTNONE
J100073P04CAACGGCCCATTNONE
J100075D01CAACGGCCCATTNONE
J100077J17CAACGGCCCATTNONE
J100087F03CAACGGCCCATTNONE
J100087F09CAACGGCCCATTNONE
Os03g0143000AK073102AAACGGCCCGTTSAM (and some other nucleotide) binding motif domain containing protein.
J033051I24AAACGGCCCGTTNONE
Os03g0145600015-010-B10GGCCCGTTNONE
AK106243GGCCCGTTQuinonprotein alcohol dehydrogenase-like domain containing protein.
Os03g0146400AK111974CACGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment).
AK111974GGCCCGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment).
AK120554CACGGCCCGTTNONE
AK120554GGCCCGGCCCGTTNONE
J075060J10CACGGCCCGTTNONE
J075060J10GGCCCGGCCCGTTNONE
Os03g0210400AK065966AACGGGCCProtein prenyltransferase domain containing protein.
Os03g0213600AK100407AAACGGCCCGConserved hypothetical protein.
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein.
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein.
Os03g0222100AK070688GGCCGTTTSimilar to Topoisomerase-like protein.
J023057E15GGCCGTTTNONE
J023099M24GGCCGTTTNONE
J023147F14GGCCGTTTNONE
Os03g0231600AK105963AAACGGCCSimilar to Branched-chain-amino-acid aminotransferase 3, chloroplast precursor (EC 2.6.1.42) (Atbcat-3).
AK120579AAACGGCCNONE
Os03g0242300AK065146GGCCCGTTConserved hypothetical protein.
J013002A22GGCCCGTTNONE
J023088H11GGCCCGTTNONE
J065083M12GGCCCGTTNONE
J065169P06GGCCCGTTNONE
J100037B08GGCCCGTTNONE
Os03g0245200003-116-E09AACGGGCCNONE
AK062288AACGGGCCProtein of unknown function DUF1210 family protein.
J075022G03AACGGGCCNONE
J075088C24AACGGGCCNONE
J075110L07AACGGGCCNONE
J075112K01AACGGGCCNONE
J075131F24AACGGGCCNONE
J075149D10AACGGGCCNONE
Os03g0248600AK073611AACGGGCCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
AK099342AACGGGCCNONE
AK099342CCAACGGCCCGGCNONE
AK104877AACGGGCCNONE
AK104877CCAACGGCCCGGCNONE
J013026L10AACGGGCCNONE
J013026L10CCAACGGCCCGGCNONE
J013055P12AACGGGCCNONE
J013055P12CCAACGGCCCGGCNONE
J023091A14AACGGGCCNONE
J023091A14CCAACGGCCCGGCNONE
J033034G07AACGGGCCNONE
J033034G07CCAACGGCCCGGCNONE
J033048H19AACGGGCCNONE
J033048H19CCAACGGCCCGGCNONE
J033128D07AACGGGCCNONE
J033128D07CCAACGGCCCGGCNONE
J065060L24AACGGGCCNONE
J065060L24CCAACGGCCCGGCNONE
J065176A19AACGGGCCNONE
J065176A19CCAACGGCCCGGCNONE
J090018K08AACGGGCCNONE
J090018K08CCAACGGCCCGGCNONE
J090023C03AACGGGCCNONE
J090023C03CCAACGGCCCGGCNONE
Os03g0252800AK065537AAACGGCCCNONE
AK067765AAACGGCCCAminotransferase, class I and II domain containing protein.
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein.
Os03g0265400006-022-A01TAATGGGCCGTTTNONE
006-033-E05TAATGGGCCGTTTNONE
006-035-A03TAATGGGCCGTTTNONE
006-057-D09TAATGGGCCGTTTNONE
006-058-D03TAATGGGCCGTTTNONE
006-061-B04TAATGGGCCGTTTNONE
006-076-C01TAATGGGCCGTTTNONE
006-089-C09TAATGGGCCGTTTNONE
006-092-D01TAATGGGCCGTTTNONE
006-100-D06TAATGGGCCGTTTNONE
009-014-G04TAATGGGCCGTTTNONE
009-060-C06TAATGGGCCGTTTNONE
009-098-A06TAATGGGCCGTTTNONE
AK061468TAATGGGCCGTTTNONE
AK104116TAATGGGCCGTTTNONE
AK104424TAATGGGCCGTTTNONE
AK120527TAATGGGCCGTTTSimilar to 50S ribosomal protein L4, chloroplast precursor (R-protein L4).
J013127C20TAATGGGCCGTTTNONE
J023031E11TAATGGGCCGTTTNONE
J023150F18TAATGGGCCGTTTNONE
J033037G14TAATGGGCCGTTTNONE
J065073K02TAATGGGCCGTTTNONE
J065085P13TAATGGGCCGTTTNONE
J065161B21TAATGGGCCGTTTNONE
J065197G23TAATGGGCCGTTTNONE
Os03g0276500011-014-A06AACGGCCCAAGNONE
012-043-E04AACGGCCCAAGNONE
012-096-G01AACGGCCCAAGNONE
014-005-A07AACGGCCCAAGNONE
014-031-F09AACGGCCCAAGNONE
014-040-C09AACGGCCCAAGNONE
014-092-G02AACGGCCCAAGNONE
AK072830AACGGCCCAAGNONE
AK099275AACGGCCCAAGNONE
AK109474AACGGCCCAAGSimilar to Heat shock protein 70.
J013036E08AACGGCCCAAGNONE
J013047P03AACGGCCCAAGNONE
J013048H14AACGGCCCAAGNONE
J013060E24AACGGCCCAAGNONE
J013093N10AACGGCCCAAGNONE
J013123K11AACGGCCCAAGNONE
J013153C09AACGGCCCAAGNONE
J023010D20AACGGCCCAAGNONE
J023027O13AACGGCCCAAGNONE
J023029B01AACGGCCCAAGNONE
J023063G14AACGGCCCAAGNONE
J023083D09AACGGCCCAAGNONE
J023091M13AACGGCCCAAGNONE
J023121M10AACGGCCCAAGNONE
J023126D10AACGGCCCAAGNONE
J023139H01AACGGCCCAAGNONE
J023145B18AACGGCCCAAGNONE
J033029G15AACGGCCCAAGNONE
J033050K13AACGGCCCAAGNONE
J033057L09AACGGCCCAAGNONE
J033092M15AACGGCCCAAGNONE
J065007N14AACGGCCCAAGNONE
J065038E07AACGGCCCAAGNONE
J065043A09AACGGCCCAAGNONE
J065100C19AACGGCCCAAGNONE
J065117C02AACGGCCCAAGNONE
J065213I04AACGGCCCAAGNONE
J090001F01AACGGCCCAAGNONE
J090025D07AACGGCCCAAGNONE
J090037C11AACGGCCCAAGNONE
J090047N11AACGGCCCAAGNONE
J090053O05AACGGCCCAAGNONE
J090070F11AACGGCCCAAGNONE
J090082O16AACGGCCCAAGNONE
J090085F20AACGGCCCAAGNONE
J090096N08AACGGCCCAAGNONE
Os03g0278200AK103544AAACGGCCCGNAD-dependent epimerase/dehydratase family protein.
Os03g0278900006-049-H12TACGGCCCGTTNONE
006-082-A07TACGGCCCGTTNONE
009-169-C04TACGGCCCGTTNONE
AK066019TACGGCCCGTTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein.
AK105925TACGGCCCGTTNONE
AY224460TACGGCCCGTTNONE
J065021K17TACGGCCCGTTNONE
J065141H24TACGGCCCGTTNONE
J065142J20TACGGCCCGTTNONE
J065152J03TACGGCCCGTTNONE
J065163A13TACGGCCCGTTNONE
J065191I21TACGGCCCGTTNONE
J065193K12TACGGCCCGTTNONE
J075003D01TACGGCCCGTTNONE
J075017D24TACGGCCCGTTNONE
J075060F20TACGGCCCGTTNONE
J075154C11TACGGCCCGTTNONE
J075173F04TACGGCCCGTTNONE
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein.
Os03g0302200AK120853AACGGGCCZinc finger, RING-type domain containing protein.
J023023P20AACGGGCCNONE
J023064E11AACGGGCCNONE
J033036C20AACGGGCCNONE
J043029P08AACGGGCCNONE
J065124C11AACGGGCCNONE
J090001K02AACGGGCCNONE
J090021D03AACGGGCCNONE
J090034D03AACGGGCCNONE
J090062J10AACGGGCCNONE
J100037A15AACGGGCCNONE
J100067M23AACGGGCCNONE
Os03g0309000AK070071AAACGGCCVirulence factor, pectin lyase fold family protein.
Os03g0319300006-021-E05AACGGGCCGGTNONE
006-022-H12AACGGGCCGGTNONE
009-187-E02AACGGGCCGGTNONE
AF042840AACGGGCCGGTNONE
AK059756AACGGGCCGGTCalmodulin (CaM).
AK070090AACGGGCCGGTNONE
J065017J02AACGGGCCGGTNONE
J065028G17AACGGGCCGGTNONE
J065045N09AACGGGCCGGTNONE
J065078F21AACGGGCCGGTNONE
J065091H01AACGGGCCGGTNONE
J065112B19AACGGGCCGGTNONE
J065186E08AACGGGCCGGTNONE
J065199G12AACGGGCCGGTNONE
J075030K07AACGGGCCGGTNONE
J075050B02AACGGGCCGGTNONE
J075057G07AACGGGCCGGTNONE
J075070F01AACGGGCCGGTNONE
J075093N12AACGGGCCGGTNONE
J075095K13AACGGGCCGGTNONE
J075102D14AACGGGCCGGTNONE
J075103B17AACGGGCCGGTNONE
J075114K05AACGGGCCGGTNONE
J075142F18AACGGGCCGGTNONE
J075154L11AACGGGCCGGTNONE
J075185F08AACGGGCCGGTNONE
J090012A14AACGGGCCGGTNONE
J090044L10AACGGGCCGGTNONE
J100044C12AACGGGCCGGTNONE
J100088J19AACGGGCCGGTNONE
Os03g0322600009-180-H12AACGGGCCNONE
AK067222AACGGGCCHypothetical protein.
J065017H05AACGGGCCNONE
J065118G12AACGGGCCNONE
J065175F07AACGGGCCNONE
J065175N14AACGGGCCNONE
Os03g0332400AK103161GGCCGTTTSimilar to Hydroxyacylglutathione hydrolase cytoplasmic (EC 3.1.2.6) (Glyoxalase II) (Glx II).
J033121D04GGCCGTTTNONE
J065090F18GGCCGTTTNONE
J100065F07GGCCGTTTNONE
J100085G24GGCCGTTTNONE
Os03g0332700AK072820AAACGGCCCATAASimilar to ABC Transporter, ATP binding component.
Os03g0335100AK107094CTTGGGCCGTTConserved hypothetical protein.
Os03g0338600AK066604AACGGGCCGAtRNA pseudouridine synthase family protein.
Os03g0344100009-166-F10TCCAACGGGCCNONE
AK061903TCCAACGGGCCNONE
AK065547TCCAACGGGCCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''.
J023095G24TCCAACGGGCCNONE
J033087C06TCCAACGGGCCNONE
J053073I09TCCAACGGGCCNONE
J065189D11TCCAACGGGCCNONE
J090032B15TCCAACGGGCCNONE
Os03g0359700AK060778AAACGGCCCArmadillo-like helical domain containing protein.
AK109309AAACGGCCCNONE
J013106M15AAACGGCCCNONE
J023099J09AAACGGCCCNONE
J023112C23AAACGGCCCNONE
J065190A21AAACGGCCCNONE
J065206O20AAACGGCCCNONE
J090027N12AAACGGCCCNONE
Os03g0360700006-032-A11GGCCCGTTNONE
AK068764GGCCCGTTSimilar to Protein-methionine-S-oxide reductase, PilB family.
AK109429GGCCCGTTNONE
AY224463GGCCCGTTNONE
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK068704GACAGGTGGGCCCGTTNONE
J013159M16GACAGGTGGGCCCGTTNONE
J090067F01GACAGGTGGGCCCGTTNONE
J090083F21GACAGGTGGGCCCGTTNONE
J100040M08GACAGGTGGGCCCGTTNONE
J100048C03GACAGGTGGGCCCGTTNONE
J100056M07GACAGGTGGGCCCGTTNONE
J100062N22GACAGGTGGGCCCGTTNONE
J100086L07GACAGGTGGGCCCGTTNONE
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein.
J023010L17CAACGGCCCCACATGTCAGTGGNONE
Os03g0440900006-025-H04AAACGGCCNONE
006-047-H07AAACGGCCNONE
006-060-H12AAACGGCCNONE
006-070-A03AAACGGCCNONE
006-092-C02AAACGGCCNONE
006-094-G10AAACGGCCNONE
014-077-B09AAACGGCCNONE
AK061730AAACGGCCSimilar to LRR protein.
AK069710AAACGGCCNONE
J013027E23AAACGGCCNONE
J023031G03AAACGGCCNONE
J065166J18AAACGGCCNONE
J075034K19AAACGGCCNONE
J075046I24AAACGGCCNONE
J075176D13AAACGGCCNONE
J090060I21AAACGGCCNONE
J100025G01AAACGGCCNONE
J100025O12AAACGGCCNONE
J100041L24AAACGGCCNONE
J100057B08AAACGGCCNONE
J100060J12AAACGGCCNONE
Os03g0598200AK068322AACGGGCCNop14-like protein family protein.
Os03g0639800AK103237AGTGGGCCGTTSnf7 family protein.
J023036L02AGTGGGCCGTTNONE
J033108L13AGTGGGCCGTTNONE
Os03g0685600AK111863GGGCCGTTWD40-like domain containing protein.
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit.
Os03g0726900AK072553GGCCCGTTTGGGCCACConserved hypothetical protein.
AK100280GGCCCGTTTGGGCCACNONE
Os03g0735300AK071715AAACGGCCAlba, DNA/RNA-binding protein family protein.
J065100I07AAACGGCCNONE
Os03g0750000AK071321AAACGGCCUniversal stress protein (Usp) family protein.
J023088M23AAACGGCCNONE
J065163N07AAACGGCCNONE
J075006P15AAACGGCCNONE
J075007N13AAACGGCCNONE
J075018H04AAACGGCCNONE
J075025E04AAACGGCCNONE
J075036K02AAACGGCCNONE
J075049I06AAACGGCCNONE
J075050F19AAACGGCCNONE
J075055M07AAACGGCCNONE
J075070D11AAACGGCCNONE
J075072A01AAACGGCCNONE
J075081I23AAACGGCCNONE
J075083G08AAACGGCCNONE
J075095B03AAACGGCCNONE
J075099I22AAACGGCCNONE
J075122G06AAACGGCCNONE
J075130C13AAACGGCCNONE
J075143H06AAACGGCCNONE
J075154E20AAACGGCCNONE
J075174D01AAACGGCCNONE
J075175E01AAACGGCCNONE
J075185H11AAACGGCCNONE
J080005K09AAACGGCCNONE
J080006M06AAACGGCCNONE
J080009M15AAACGGCCNONE
J080013J23AAACGGCCNONE
J080014L22AAACGGCCNONE
J080018B22AAACGGCCNONE
J080023C20AAACGGCCNONE
J080025B08AAACGGCCNONE
J080025C17AAACGGCCNONE
J080025D21AAACGGCCNONE
J080027A19AAACGGCCNONE
J080030K08AAACGGCCNONE
J080034I08AAACGGCCNONE
J080034P08AAACGGCCNONE
J080039E04AAACGGCCNONE
J080041J05AAACGGCCNONE
J080043G01AAACGGCCNONE
J080044M21AAACGGCCNONE
J080045J24AAACGGCCNONE
J080045M10AAACGGCCNONE
J080047E17AAACGGCCNONE
J080047I12AAACGGCCNONE
J080052I15AAACGGCCNONE
J080060L19AAACGGCCNONE
J080062M06AAACGGCCNONE
J080064F23AAACGGCCNONE
J080068L14AAACGGCCNONE
J080070H15AAACGGCCNONE
J080071P16AAACGGCCNONE
J080076H11AAACGGCCNONE
J080076L20AAACGGCCNONE
J080077H05AAACGGCCNONE
J080079E17AAACGGCCNONE
J080089N23AAACGGCCNONE
J080095J09AAACGGCCNONE
J080096M12AAACGGCCNONE
J080097E11AAACGGCCNONE
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein.
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE
Os03g0770100AK108776AACGGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
Os03g0772800009-023-E05CAACGGCCCAACANONE
009-059-F12CAACGGCCCAACANONE
009-114-B08CAACGGCCCAACANONE
009-115-G09CAACGGCCCAACANONE
009-151-D08CAACGGCCCAACANONE
009-158-A10CAACGGCCCAACANONE
009-191-H02CAACGGCCCAACANONE
009-192-E05CAACGGCCCAACANONE
009-197-F11CAACGGCCCAACANONE
AK059576CAACGGCCCAACANONE
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein.
J023087H20CAACGGCCCAACANONE
J023105P14CAACGGCCCAACANONE
J033026P15CAACGGCCCAACANONE
J033042K10CAACGGCCCAACANONE
J033133C09CAACGGCCCAACANONE
J065123K13CAACGGCCCAACANONE
J075190D03CAACGGCCCAACANONE
J080310M14CAACGGCCCAACANONE
J080317L14CAACGGCCCAACANONE
J100067J19CAACGGCCCAACANONE
J100079H21CAACGGCCCAACANONE
Os03g0792500011-040-A04GGCCCGTTNONE
013-014-E06GGCCCGTTNONE
AK068848GGCCCGTTSimilar to Zinc finger POZ domain protein (Fragment).
AK100829GGCCCGTTNONE
Os03g0797000AK073440AACGGGCCSimilar to Indole synthase.
Os03g0799000013-010-A07GGCCGTTTCGGCCNONE
013-081-H02GGCCGTTTCGGCCNONE
AK067840GGCCGTTTCGGCCSimilar to Histone H1.
AK099211GGCCGTTTCGGCCNONE
J065066F23GGCCGTTTCGGCCNONE
J065138O20GGCCGTTTCGGCCNONE
J065163G22GGCCGTTTCGGCCNONE
J065211J01GGCCGTTTCGGCCNONE
J080027D02GGCCGTTTCGGCCNONE
J080029E20GGCCGTTTCGGCCNONE
J080045D03GGCCGTTTCGGCCNONE
J080060G13GGCCGTTTCGGCCNONE
J080067E14GGCCGTTTCGGCCNONE
J080067J04GGCCGTTTCGGCCNONE
J080067J21GGCCGTTTCGGCCNONE
J080068L09GGCCGTTTCGGCCNONE
J080077E15GGCCGTTTCGGCCNONE
J080078B03GGCCGTTTCGGCCNONE
J080086H09GGCCGTTTCGGCCNONE
J090095G02GGCCGTTTCGGCCNONE
J100058H04GGCCGTTTCGGCCNONE
Os03g0822900AK099787AACGGGCCZinc finger, BED-type predicted domain containing protein.
J013042C24AACGGGCCNONE
J013096O21AACGGGCCNONE
J023109I23AACGGGCCNONE
J033106N09AACGGGCCNONE
J033107H03AACGGGCCNONE
J033118G03AACGGGCCNONE
J033145I24AACGGGCCNONE
J065138D15AACGGGCCNONE
J065140L13AACGGGCCNONE
J065179M13AACGGGCCNONE
J065200F05AACGGGCCNONE
J075104F20AACGGGCCNONE
J075143A15AACGGGCCNONE
J075197J11AACGGGCCNONE
Os03g0831100AK103115AACGGCCCGGCCArmadillo-like helical domain containing protein.
J033119F15AACGGCCCGGCCNONE
J065011M19AACGGCCCGGCCNONE
J075019I08AACGGCCCGGCCNONE
J075047A01AACGGCCCGGCCNONE
J075096P21AACGGCCCGGCCNONE
J075121I05AACGGCCCGGCCNONE
J075121I07AACGGCCCGGCCNONE
J090063F13AACGGCCCGGCCNONE
J090068F16AACGGCCCGGCCNONE
J090094E14AACGGCCCGGCCNONE
Os03g0833700011-060-A10TCATGGGCCGTTTNONE
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein.
Os03g0844100AK067164AAACGGCCSimilar to Pti1 kinase-like protein.
Os03g0851300013-070-G05AAACGGCCNONE
AK071162AAACGGCCProteasome component region PCI domain containing protein.
AK073581AAACGGCCNONE
AK104846AAACGGCCNONE
AK105457AAACGGCCNONE
J033030N18AAACGGCCNONE
Os04g0194500AK121164CAACGGCCCCCACSimilar to ABC transporter-like protein.
Os04g0208400AK069629AACGGGCCGTGCyclin-like F-box domain containing protein.
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK070110ATCCAACGGCCCCACCNONE
AK099145ATCCAACGGCCCCACCNONE
J065045A03ATCCAACGGCCCCACCNONE
Os04g0272400AK121455GGGCCGTTProtein of unknown function DUF266, plant family protein.
J023142P15GGGCCGTTNONE
Os04g0381000AK105435AAACGGCCDynamin family protein.
J075003I06AAACGGCCNONE
Os04g0418000006-025-C05AAACGGCCCATTTNONE
006-025-C05AACGGGCCNONE
006-025-D11AAACGGCCCATTTNONE
006-025-D11AACGGGCCNONE
006-045-F02AAACGGCCCATTTNONE
006-045-F02AACGGGCCNONE
006-060-B04AAACGGCCCATTTNONE
006-060-B04AACGGGCCNONE
006-063-E03AAACGGCCCATTTNONE
006-063-E03AACGGGCCNONE
006-070-G08AAACGGCCCATTTNONE
006-070-G08AACGGGCCNONE
006-072-H05AAACGGCCCATTTNONE
006-072-H05AACGGGCCNONE
AK061030AAACGGCCCATTTNONE
AK061030AACGGGCCNONE
AK099124AAACGGCCCATTTNONE
AK099124AACGGGCCNONE
AK106155AAACGGCCCATTTConserved hypothetical protein.
AK106155AACGGGCCConserved hypothetical protein.
AK119714AAACGGCCCATTTNONE
AK119714AACGGGCCNONE
J023039I07AAACGGCCCATTTNONE
J023039I07AACGGGCCNONE
J065025N03AAACGGCCCATTTNONE
J065025N03AACGGGCCNONE
Os04g0444900AK063657GGCCCGTTSimilar to Alfin-1.
AK098960GGCCCGTTNONE
J065037L14GGCCCGTTNONE
J065037P22GGCCCGTTNONE
J065173O15GGCCCGTTNONE
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor.
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE
009-147-H12ATCTGGGCCGGGCCGTTTNONE
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein.
J013130N24ATCTGGGCCGGGCCGTTTNONE
J065019D10ATCTGGGCCGGGCCGTTTNONE
J065168O21ATCTGGGCCGGGCCGTTTNONE
J075051G06ATCTGGGCCGGGCCGTTTNONE
J075148G11ATCTGGGCCGGGCCGTTTNONE
Os04g0462500006-073-E08GGCCGTTTNONE
AK062065GGCCGTTTNONE
AK071311GGCCGTTTSimilar to 14-3-3-like protein GF14-6.
AK071822GGCCGTTTNONE
AK099243GGCCGTTTNONE
AK101938GGCCGTTTNONE
J013056F02GGCCGTTTNONE
J023020E08GGCCGTTTNONE
J023085B16GGCCGTTTNONE
J023117D08GGCCGTTTNONE
J023133K12GGCCGTTTNONE
J033025G04GGCCGTTTNONE
J033052A15GGCCGTTTNONE
J033074G16GGCCGTTTNONE
J033090A16GGCCGTTTNONE
J033122A07GGCCGTTTNONE
J033133G09GGCCGTTTNONE
J065002F16GGCCGTTTNONE
J065030M09GGCCGTTTNONE
J065056B11GGCCGTTTNONE
J065115I10GGCCGTTTNONE
J065120O09GGCCGTTTNONE
J065124G21GGCCGTTTNONE
J075031C14GGCCGTTTNONE
J075040H07GGCCGTTTNONE
J075047F04GGCCGTTTNONE
J075065F14GGCCGTTTNONE
J075066G20GGCCGTTTNONE
J075105D01GGCCGTTTNONE
J075147B04GGCCGTTTNONE
J075149A12GGCCGTTTNONE
J075172D07GGCCGTTTNONE
J075190J11GGCCGTTTNONE
J090038H18GGCCGTTTNONE
J090087G05GGCCGTTTNONE
J100025A10GGCCGTTTNONE
J100025O10GGCCGTTTNONE
J100027D02GGCCGTTTNONE
J100027P06GGCCGTTTNONE
J100032K04GGCCGTTTNONE
J100056D21GGCCGTTTNONE
J100060J08GGCCGTTTNONE
J100063N19GGCCGTTTNONE
J100064C14GGCCGTTTNONE
J100064K18GGCCGTTTNONE
J100070L21GGCCGTTTNONE
J100072M17GGCCGTTTNONE
J100074F21GGCCGTTTNONE
J100087E05GGCCGTTTNONE
U65956GGCCGTTTNONE
Os04g0462900006-094-A02CACGGCCCGTTNONE
006-097-F05CACGGCCCGTTNONE
009-129-A10CACGGCCCGTTNONE
015-042-F07CACGGCCCGTTNONE
AK058481CACGGCCCGTTNONE
AK059483CACGGCCCGTTNONE
AK061324CACGGCCCGTTNONE
AK099100CACGGCCCGTTNONE
AK102579CACGGCCCGTTNONE
AK106322CACGGCCCGTTSimilar to Prohibitin.
J065059J20CACGGCCCGTTNONE
J065085I02CACGGCCCGTTNONE
J065118N23CACGGCCCGTTNONE
J065208K24CACGGCCCGTTNONE
J075053B14CACGGCCCGTTNONE
J075097M22CACGGCCCGTTNONE
J075184B07CACGGCCCGTTNONE
J075194A15CACGGCCCGTTNONE
J080315G03CACGGCCCGTTNONE
J090088H19CACGGCCCGTTNONE
Os04g0508000AK071432AACGGGCCProtein of unknown function DUF231, plant domain containing protein.
Os04g0508100009-180-A02GGCCCGTTNONE
AK121759GGCCCGTTConserved hypothetical protein.
J023007G10GGCCCGTTNONE
J033089A17GGCCCGTTNONE
J065193E13GGCCCGTTNONE
J075025M02GGCCCGTTNONE
J075027J10GGCCCGTTNONE
J075030N03GGCCCGTTNONE
J075045I20GGCCCGTTNONE
J075065E04GGCCCGTTNONE
J075134M16GGCCCGTTNONE
J075140B10GGCCCGTTNONE
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein.
J023117E20AACGGGCCGGGCCGGCCCAGTANONE
J023150D11AACGGGCCGGGCCGGCCCAGTANONE
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein.
J013057N16CCACCAACGGCCCAGATNONE
Os04g0551300AK103502AACGGCCCAGCSimilar to Growth regulator like protein.
Os04g0560100006-090-B07CCAACGGCCCNONE
AK071033CCAACGGCCCNONE
AK106001CCAACGGCCCCytochrome P450 family protein.
J023063N21CCAACGGCCCNONE
J023078O09CCAACGGCCCNONE
J090062K20CCAACGGCCCNONE
Os04g0574500AK110934GGCCGTTTSimilar to Growth-regulating factor 3.
J065101K11GGCCGTTTNONE
J065207F18GGCCGTTTNONE
Os04g0591000006-090-E02AACGGGCCGAANONE
AK072902AACGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J065061E23AACGGGCCGAANONE
Os04g0612600AB042115AACGGGCCAGANONE
AK060707AACGGGCCAGASimilar to Coatomer-like protein, epsilon subunit.
AK099008AACGGGCCAGANONE
AK104427AACGGGCCAGANONE
J023043H02AACGGGCCAGANONE
J033033I23AACGGGCCAGANONE
J033067P21AACGGGCCAGANONE
J033088M21AACGGGCCAGANONE
J033133M08AACGGGCCAGANONE
J043030I16AACGGGCCAGANONE
J075049H08AACGGGCCAGANONE
Os04g0626400006-050-B09AACGGCCCGCANONE
006-072-C12AACGGCCCGCANONE
006-092-C11AACGGCCCGCANONE
AK059851AACGGCCCGCACalycin-like family protein.
AK100069AACGGCCCGCANONE
AK104062AACGGCCCGCANONE
AK104663AACGGCCCGCANONE
Os04g0635800006-033-E07CACGGCCCGTTNONE
011-067-A08CACGGCCCGTTNONE
AK060110CACGGCCCGTTNONE
AK099507CACGGCCCGTTGCN5-related N-acetyltransferase domain containing protein.
AK104741CACGGCCCGTTNONE
AK120021CACGGCCCGTTNONE
J013029B17CACGGCCCGTTNONE
J013134M07CACGGCCCGTTNONE
J013149N18CACGGCCCGTTNONE
J013153L10CACGGCCCGTTNONE
J033131F08CACGGCCCGTTNONE
J043010E02CACGGCCCGTTNONE
J065031J05CACGGCCCGTTNONE
J065031J06CACGGCCCGTTNONE
J075030K04CACGGCCCGTTNONE
J075178K05CACGGCCCGTTNONE
J080001B10CACGGCCCGTTNONE
J080003N19CACGGCCCGTTNONE
J080005F20CACGGCCCGTTNONE
J080005G16CACGGCCCGTTNONE
J080007N02CACGGCCCGTTNONE
J080009J04CACGGCCCGTTNONE
J080017D04CACGGCCCGTTNONE
J080020M22CACGGCCCGTTNONE
J080021A15CACGGCCCGTTNONE
J080021F21CACGGCCCGTTNONE
J080023P05CACGGCCCGTTNONE
J080024P22CACGGCCCGTTNONE
J080027C20CACGGCCCGTTNONE
J080029K03CACGGCCCGTTNONE
J080035M18CACGGCCCGTTNONE
J080039F22CACGGCCCGTTNONE
J080039J03CACGGCCCGTTNONE
J080039L03CACGGCCCGTTNONE
J080039P14CACGGCCCGTTNONE
J080042E12CACGGCCCGTTNONE
J080047D19CACGGCCCGTTNONE
J080047M21CACGGCCCGTTNONE
J080049N03CACGGCCCGTTNONE
J080056J12CACGGCCCGTTNONE
J080060B10CACGGCCCGTTNONE
J080062K08CACGGCCCGTTNONE
J080064L07CACGGCCCGTTNONE
J080069C15CACGGCCCGTTNONE
J080074H06CACGGCCCGTTNONE
J080086O14CACGGCCCGTTNONE
J080090C20CACGGCCCGTTNONE
J080090L14CACGGCCCGTTNONE
J080095G08CACGGCCCGTTNONE
J080097C07CACGGCCCGTTNONE
J090011F03CACGGCCCGTTNONE
J090082O17CACGGCCCGTTNONE
Os04g0636900011-028-G03AAACGGCCCAGTTNONE
012-040-G03AAACGGCCCAGTTNONE
AK058405AAACGGCCCAGTTNONE
AK065789AAACGGCCCAGTTNONE
AK101408AAACGGCCCAGTTNONE
AK119286AAACGGCCCAGTTNONE
J013042J24AAACGGCCCAGTTNONE
J033037I12AAACGGCCCAGTTNONE
J043031B12AAACGGCCCAGTTNONE
J065152N10AAACGGCCCAGTTNONE
J090060K17AAACGGCCCAGTTNONE
J090083K14AAACGGCCCAGTTNONE
J100046O13AAACGGCCCAGTTNONE
J100066G22AAACGGCCCAGTTNONE
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein.
J013021B22CAACGGCCCAAAANONE
J065054D12CAACGGCCCAAAANONE
J065135I05CAACGGCCCAAAANONE
J065198F14CAACGGCCCAAAANONE
J090027O06CAACGGCCCAAAANONE
Os04g0668900AF085174AAACGGCCNONE
AK067891AAACGGCCSimilar to Plastid terminal oxidase.
Os04g0678800AK072212ACCGGCCCGTTN-acetylglucosaminylphosphatidylinositol deacetylase family protein.
AK099065ACCGGCCCGTTNONE
Os04g0692200006-047-H10AACGGGCCNONE
006-107-D08AACGGGCCNONE
009-122-B09AACGGGCCNONE
AK059807AACGGGCCNONE
AK060875AACGGGCCNONE
AK071726AACGGGCCConserved hypothetical protein.
J023110I24AACGGGCCNONE
J033091O06AACGGGCCNONE
J053027N16AACGGGCCNONE
J053089E19AACGGGCCNONE
J053098H12AACGGGCCNONE
J053099N13AACGGGCCNONE
J075031B15AACGGGCCNONE
J080013D12AACGGGCCNONE
J080013H05AACGGGCCNONE
J080013H07AACGGGCCNONE
J080088I03AACGGGCCNONE
Os05g0116100006-049-G01AACGGGCCNONE
006-064-F09AACGGGCCNONE
006-082-A03AACGGGCCNONE
006-092-G06AACGGGCCNONE
006-102-F09AACGGGCCNONE
AB037970AACGGGCCNONE
AK061836AACGGGCCNONE
AK070895AACGGGCCDehydroascorbate reductase.
AY074786AACGGGCCNONE
J013022K21AACGGGCCNONE
J013154A03AACGGGCCNONE
J023074C02AACGGGCCNONE
J023091I19AACGGGCCNONE
J023135M05AACGGGCCNONE
J065027L11AACGGGCCNONE
J065065A08AACGGGCCNONE
J065120A08AACGGGCCNONE
J065174A05AACGGGCCNONE
J065184O22AACGGGCCNONE
J065191D07AACGGGCCNONE
J065209D04AACGGGCCNONE
J075014F11AACGGGCCNONE
J075036D03AACGGGCCNONE
J075157D23AACGGGCCNONE
J080007F15AACGGGCCNONE
J080008N12AACGGGCCNONE
J080010F22AACGGGCCNONE
J080011C19AACGGGCCNONE
J080011F12AACGGGCCNONE
J080012E11AACGGGCCNONE
J080015B12AACGGGCCNONE
J080015O16AACGGGCCNONE
J080016G24AACGGGCCNONE
J080016K13AACGGGCCNONE
J080018A02AACGGGCCNONE
J080018H03AACGGGCCNONE
J080022M01AACGGGCCNONE
J080023D20AACGGGCCNONE
J080023I01AACGGGCCNONE
J080023J05AACGGGCCNONE
J080024A09AACGGGCCNONE
J080024I09AACGGGCCNONE
J080025A10AACGGGCCNONE
J080025G04AACGGGCCNONE
J080027D21AACGGGCCNONE
J080029M05AACGGGCCNONE
J080030J01AACGGGCCNONE
J080034D10AACGGGCCNONE
J080036F18AACGGGCCNONE
J080038N11AACGGGCCNONE
J080039B07AACGGGCCNONE
J080039E01AACGGGCCNONE
J080039K11AACGGGCCNONE
J080040B09AACGGGCCNONE
J080040G11AACGGGCCNONE
J080041H08AACGGGCCNONE
J080041H19AACGGGCCNONE
J080041O20AACGGGCCNONE
J080042C15AACGGGCCNONE
J080043C16AACGGGCCNONE
J080043F18AACGGGCCNONE
J080044B17AACGGGCCNONE
J080044N10AACGGGCCNONE
J080044O07AACGGGCCNONE
J080045H15AACGGGCCNONE
J080045I03AACGGGCCNONE
J080046A05AACGGGCCNONE
J080048I06AACGGGCCNONE
J080049L04AACGGGCCNONE
J080049M09AACGGGCCNONE
J080050G11AACGGGCCNONE
J080051G20AACGGGCCNONE
J080053C09AACGGGCCNONE
J080053I05AACGGGCCNONE
J080053P18AACGGGCCNONE
J080054K10AACGGGCCNONE
J080054P14AACGGGCCNONE
J080057L05AACGGGCCNONE
J080062K11AACGGGCCNONE
J080063C19AACGGGCCNONE
J080065B03AACGGGCCNONE
J080066E15AACGGGCCNONE
J080066H05AACGGGCCNONE
J080066I05AACGGGCCNONE
J080068O11AACGGGCCNONE
J080070L22AACGGGCCNONE
J080071I12AACGGGCCNONE
J080071N20AACGGGCCNONE
J080072D10AACGGGCCNONE
J080072I10AACGGGCCNONE
J080074G03AACGGGCCNONE
J080076E23AACGGGCCNONE
J080076N03AACGGGCCNONE
J080077N23AACGGGCCNONE
J080084B13AACGGGCCNONE
J080084F07AACGGGCCNONE
J080085J15AACGGGCCNONE
J080085P20AACGGGCCNONE
J080090F21AACGGGCCNONE
J080093H16AACGGGCCNONE
J080093J01AACGGGCCNONE
J080093L04AACGGGCCNONE
J080097E24AACGGGCCNONE
J090012G04AACGGGCCNONE
J090054K05AACGGGCCNONE
Os05g0120800AK066865AAACGGCCCATATConserved hypothetical protein.
AK066865GGCCGTTTConserved hypothetical protein.
Os05g0148300009-031-A08TGTTGGGCCGTTNONE
AK062421TGTTGGGCCGTTRibosomal protein S27, mitochondrial family protein.
Os05g0148600003-016-C11GGTGGGGCCCGTTNONE
AK066168GGTGGGGCCCGTTNONE
AK104336GGTGGGGCCCGTTSimilar to Na+/H+ antiporter.
AY360145GGTGGGGCCCGTTNONE
J013055J22GGTGGGGCCCGTTNONE
J013057M24GGTGGGGCCCGTTNONE
J013074N03GGTGGGGCCCGTTNONE
J013158A22GGTGGGGCCCGTTNONE
J075118H09GGTGGGGCCCGTTNONE
Os05g0149900AK072901AACGGGCCNONE
AK101105AACGGGCCNONE
AK105677AACGGGCCNONE
J023145E04AACGGGCCNONE
Os05g0156200AK071622TCCGGGCCGTTConserved hypothetical protein.
J023099E19TCCGGGCCGTTNONE
J090025C09TCCGGGCCGTTNONE
J090071K23TCCGGGCCGTTNONE
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein.
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE
Os05g0227800AK110997AACGGGCCGGTCCAAGCCCAAHomeodomain-like containing protein.
Os05g0297900AK071238AACGGGCCSimilar to Signal peptidase 18 subunit (Fragment).
J013159C03AACGGGCCNONE
J023041J06AACGGGCCNONE
J023085B09AACGGGCCNONE
J033031J11AACGGGCCNONE
J065010C22AACGGGCCNONE
J065032E10AACGGGCCNONE
J065141O18AACGGGCCNONE
J065155K04AACGGGCCNONE
Os05g0304200009-059-H05TCGGCCCGTTNONE
AK099372TCGGCCCGTTNONE
AK112073TCGGCCCGTTPAP fibrillin family protein.
Os05g0328000AK107977TCTGGCCCGTTCGGCCCGConserved hypothetical protein.
J065005I02TCTGGCCCGTTCGGCCCGNONE
J065049M05TCTGGCCCGTTCGGCCCGNONE
J080005F01TCTGGCCCGTTCGGCCCGNONE
J080005H15TCTGGCCCGTTCGGCCCGNONE
J080005K23TCTGGCCCGTTCGGCCCGNONE
J080007O03TCTGGCCCGTTCGGCCCGNONE
J080013H09TCTGGCCCGTTCGGCCCGNONE
J080024C02TCTGGCCCGTTCGGCCCGNONE
J080026M22TCTGGCCCGTTCGGCCCGNONE
J080029K21TCTGGCCCGTTCGGCCCGNONE
J080032K04TCTGGCCCGTTCGGCCCGNONE
J080034M16TCTGGCCCGTTCGGCCCGNONE
J080037G11TCTGGCCCGTTCGGCCCGNONE
J080040L01TCTGGCCCGTTCGGCCCGNONE
J080041D13TCTGGCCCGTTCGGCCCGNONE
J080043G20TCTGGCCCGTTCGGCCCGNONE
J080046H17TCTGGCCCGTTCGGCCCGNONE
J080048A05TCTGGCCCGTTCGGCCCGNONE
J080064C21TCTGGCCCGTTCGGCCCGNONE
J080067E15TCTGGCCCGTTCGGCCCGNONE
J080071P05TCTGGCCCGTTCGGCCCGNONE
J080074H16TCTGGCCCGTTCGGCCCGNONE
J080076A18TCTGGCCCGTTCGGCCCGNONE
J080076D20TCTGGCCCGTTCGGCCCGNONE
J080077J15TCTGGCCCGTTCGGCCCGNONE
J080085J11TCTGGCCCGTTCGGCCCGNONE
J080086E08TCTGGCCCGTTCGGCCCGNONE
J080088I23TCTGGCCCGTTCGGCCCGNONE
J080088I24TCTGGCCCGTTCGGCCCGNONE
J080089D05TCTGGCCCGTTCGGCCCGNONE
J080093B04TCTGGCCCGTTCGGCCCGNONE
J080093D07TCTGGCCCGTTCGGCCCGNONE
J080094A09TCTGGCCCGTTCGGCCCGNONE
J080096I12TCTGGCCCGTTCGGCCCGNONE
J080097L23TCTGGCCCGTTCGGCCCGNONE
Os05g0408300AK068553AAACGGCCConserved hypothetical protein.
Os05g0408900006-053-D03CCCGGCCCGTTNONE
AF024512CCCGGCCCGTTNONE
AK058950CCCGGCCCGTTNONE
AK059821CCCGGCCCGTTNONE
AK064944CCCGGCCCGTTSimilar to 1-D-deoxyxylulose 5-phosphate synthase.
AK104851CCCGGCCCGTTNONE
AK106750CCCGGCCCGTTNONE
Os05g0413200006-067-C03AACGGGCCNONE
006-080-C03AACGGGCCNONE
006-095-G10AACGGGCCNONE
006-115-G11AACGGGCCNONE
013-040-E05AACGGGCCNONE
AB104732AACGGGCCNONE
AK122099AACGGGCCBeta-tubulin.
J033087H20AACGGGCCNONE
J033117C18AACGGGCCNONE
J033125G10AACGGGCCNONE
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor.
Os05g0435800AK067138AAACGGCCSimilar to Subtilisin-like protease.
J013096L15AAACGGCCNONE
J023003D11AAACGGCCNONE
Os05g0437300AK102760AAACGGCCHnRNP-L/PTB/hephaestus splicing factor family protein.
Os05g0443300Os05g0443300GGCCCGTTSec23/Sec24 trunk region domain containing protein.
Os05g0481900AK106744GGCCGTTTNONE
AK119626GGCCGTTTAuxin Efflux Carrier family protein.
Os05g0501300006-075-B11ATCTGGGCCGTTGNONE
006-083-H08ATCTGGGCCGTTGNONE
AK059889ATCTGGGCCGTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein).
J043030K02ATCTGGGCCGTTGNONE
Os05g0526300AK099438AACGGGCCNONE
Os05g0536900009-033-D11AATGGGCCCGTTNONE
AK105140AATGGGCCCGTTSimilar to RAB7A.
Os05g0567500AK073046CGGGCCGTTGNONE
AK121133CGGGCCGTTGDNA glycosylase family protein.
J023075P20CGGGCCGTTGNONE
Os05g0571600Os05g0571600GGGGCCCGTTConserved hypothetical protein.
Os05g0592800AK067627CAACGGCCCAGASimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2).
AK070388CAACGGCCCAGANONE
AK104323CAACGGCCCAGANONE
Os05g0594100006-034-F04TCCGGGCCGTTGNONE
006-061-A02TCCGGGCCGTTGNONE
009-081-E02TCCGGGCCGTTGNONE
AK060122TCCGGGCCGTTGNONE
AK106130TCCGGGCCGTTGSimilar to GDA2 protein.
J023010C07TCCGGGCCGTTGNONE
J023098J20TCCGGGCCGTTGNONE
J023117G22TCCGGGCCGTTGNONE
J023127J08TCCGGGCCGTTGNONE
J033117G03TCCGGGCCGTTGNONE
J033124I03TCCGGGCCGTTGNONE
J043015K15TCCGGGCCGTTGNONE
Os05g0595100014-099-H02GGCCGTTTNONE
015-074-F02GGCCGTTTNONE
015-085-E10GGCCGTTTNONE
016-007-E01GGCCGTTTNONE
016-017-A05GGCCGTTTNONE
016-029-D07GGCCGTTTNONE
016-037-A03GGCCGTTTNONE
AB087745GGCCGTTTSimilar to UDPglucose 4-epimerase-like protein.
AK066249GGCCGTTTNONE
D21120GGCCGTTTNONE
J013051I17GGCCGTTTNONE
J065040G16GGCCGTTTNONE
J075017N14GGCCGTTTNONE
J075021P07GGCCGTTTNONE
J075089K07GGCCGTTTNONE
J075106A18GGCCGTTTNONE
J075122M09GGCCGTTTNONE
J075123O04GGCCGTTTNONE
J075133K19GGCCGTTTNONE
J075168G10GGCCGTTTNONE
Os06g0104000AK068490ACTGGGCCGTTConserved hypothetical protein.
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein.
Os06g0115300009-165-C05CCACCAACGGCCCNONE
AK058833CCACCAACGGCCCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment).
J065135L09CCACCAACGGCCCNONE
J075002E09CCACCAACGGCCCNONE
J075015K23CCACCAACGGCCCNONE
J075043B06CCACCAACGGCCCNONE
J075057O21CCACCAACGGCCCNONE
J075085L21CCACCAACGGCCCNONE
J075134N20CCACCAACGGCCCNONE
J075155O22CCACCAACGGCCCNONE
J075198N22CCACCAACGGCCCNONE
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein.
Os06g0128400AK064390AACGGGCCCAGATNONE
AK121983AACGGGCCCAGATWD40-like domain containing protein.
Os06g0136000AK060303AACGGGCCGTGSimilar to Hypersensitive-induced reaction protein 4.
AK102678AACGGGCCGTGNONE
J075185K19AACGGGCCGTGNONE
J090028C16AACGGGCCGTGNONE
J090099N12AACGGGCCGTGNONE
J100070O10AACGGGCCGTGNONE
Os06g0140100011-063-A02TCCAACGGCCCGTTNONE
AK063371TCCAACGGCCCGTTLeucine carboxyl methyltransferase family protein.
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like.
AK099019CAACGGCCCACAGCCCACGGNONE
J013118A14CAACGGCCCACAGCCCACGGNONE
Os06g0225200005-009-B07AAATGGGCCGTTNONE
AK067095AAATGGGCCGTTMitochodrial transcription termination factor-related family protein.
AK104692AAATGGGCCGTTNONE
J013096A05AAATGGGCCGTTNONE
J090092C03AAATGGGCCGTTNONE
Os06g0248200Os06g0248200AACGGGCCCAAAANONE
Os06g0248300AK070175GGCCCGTTNONE
AK070362GGCCCGTTConserved hypothetical protein.
J023025O21GGCCCGTTNONE
J023049B05GGCCCGTTNONE
J023133G04GGCCCGTTNONE
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein.
J013107E23CCAACGGCCCAGATCTCTCCGCNONE
J013129K13CCAACGGCCCAGATCTCTCCGCNONE
J023010F22CCAACGGCCCAGATCTCTCCGCNONE
J023120K19CCAACGGCCCAGATCTCTCCGCNONE
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein.
J013122F01ATCCAACGGCCCACGGGNONE
J023080N12ATCCAACGGCCCACGGGNONE
J023120F03ATCCAACGGCCCACGGGNONE
J065013B18ATCCAACGGCCCACGGGNONE
J065039P21ATCCAACGGCCCACGGGNONE
J065089E06ATCCAACGGCCCACGGGNONE
J065095N19ATCCAACGGCCCACGGGNONE
J065119H03ATCCAACGGCCCACGGGNONE
J065121D18ATCCAACGGCCCACGGGNONE
J065149G04ATCCAACGGCCCACGGGNONE
J075012J04ATCCAACGGCCCACGGGNONE
J075021G13ATCCAACGGCCCACGGGNONE
J075106I23ATCCAACGGCCCACGGGNONE
J075107F19ATCCAACGGCCCACGGGNONE
J075152J22ATCCAACGGCCCACGGGNONE
J075186J20ATCCAACGGCCCACGGGNONE
J075188F16ATCCAACGGCCCACGGGNONE
J080001G06ATCCAACGGCCCACGGGNONE
J080002O09ATCCAACGGCCCACGGGNONE
J080006E10ATCCAACGGCCCACGGGNONE
J080006F24ATCCAACGGCCCACGGGNONE
J080012L07ATCCAACGGCCCACGGGNONE
J080016A10ATCCAACGGCCCACGGGNONE
J080017D11ATCCAACGGCCCACGGGNONE
J080017I04ATCCAACGGCCCACGGGNONE
J080017I10ATCCAACGGCCCACGGGNONE
J080020P06ATCCAACGGCCCACGGGNONE
J080024A20ATCCAACGGCCCACGGGNONE
J080027B10ATCCAACGGCCCACGGGNONE
J080027E03ATCCAACGGCCCACGGGNONE
J080027I01ATCCAACGGCCCACGGGNONE
J080027K20ATCCAACGGCCCACGGGNONE
J080041L12ATCCAACGGCCCACGGGNONE
J080043D21ATCCAACGGCCCACGGGNONE
J080044K11ATCCAACGGCCCACGGGNONE
J080048I08ATCCAACGGCCCACGGGNONE
J080049M12ATCCAACGGCCCACGGGNONE
J080050C14ATCCAACGGCCCACGGGNONE
J080050N21ATCCAACGGCCCACGGGNONE
J080053F04ATCCAACGGCCCACGGGNONE
J080054O16ATCCAACGGCCCACGGGNONE
J080058O21ATCCAACGGCCCACGGGNONE
J080059M11ATCCAACGGCCCACGGGNONE
J080061A11ATCCAACGGCCCACGGGNONE
J080063B15ATCCAACGGCCCACGGGNONE
J080063F22ATCCAACGGCCCACGGGNONE
J080066M18ATCCAACGGCCCACGGGNONE
J080068D12ATCCAACGGCCCACGGGNONE
J080070D22ATCCAACGGCCCACGGGNONE
J080071B06ATCCAACGGCCCACGGGNONE
J080072B17ATCCAACGGCCCACGGGNONE
J080081O04ATCCAACGGCCCACGGGNONE
J080089H05ATCCAACGGCCCACGGGNONE
J080093K13ATCCAACGGCCCACGGGNONE
J080095I05ATCCAACGGCCCACGGGNONE
J080097F19ATCCAACGGCCCACGGGNONE
J080304C03ATCCAACGGCCCACGGGNONE
J080304H11ATCCAACGGCCCACGGGNONE
J080308M21ATCCAACGGCCCACGGGNONE
J080313O15ATCCAACGGCCCACGGGNONE
J090020N23ATCCAACGGCCCACGGGNONE
J100023C12ATCCAACGGCCCACGGGNONE
Os06g0573600AK105619GGCCCGTTNONE
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE
016-065-C02AACGGGCCGTGNONE
016-065-C02AACGGGCCGTGNONE
016-065-C02CACGGCCCGTTNONE
AK068592AACGGCCCGTGGGCCGCANONE
AK068592AACGGGCCGTGNONE
AK068592AACGGGCCGTGNONE
AK068592CACGGCCCGTTNONE
AK073844AACGGCCCGTGGGCCGCANONE
AK073844AACGGGCCGTGNONE
AK073844AACGGGCCGTGNONE
AK073844CACGGCCCGTTNONE
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein.
AK106549AACGGGCCGTGConserved hypothetical protein.
AK106549AACGGGCCGTGConserved hypothetical protein.
AK106549CACGGCCCGTTConserved hypothetical protein.
J013154A14AACGGCCCGTGGGCCGCANONE
J013154A14AACGGGCCGTGNONE
J013154A14AACGGGCCGTGNONE
J013154A14CACGGCCCGTTNONE
J100049K24AACGGCCCGTGGGCCGCANONE
J100049K24AACGGGCCGTGNONE
J100049K24AACGGGCCGTGNONE
J100049K24CACGGCCCGTTNONE
J100059C18AACGGCCCGTGGGCCGCANONE
J100059C18AACGGGCCGTGNONE
J100059C18AACGGGCCGTGNONE
J100059C18CACGGCCCGTTNONE
J100082N13AACGGCCCGTGGGCCGCANONE
J100082N13AACGGGCCGTGNONE
J100082N13AACGGGCCGTGNONE
J100082N13CACGGCCCGTTNONE
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator.
AK122052CAACGGCCCAAAANONE
Os06g0593100AK060274AACGGCCCATGASimilar to UDP-galactose/UDP-glucose transporter.
AK071175AACGGCCCATGANONE
Os06g0607800012-010-G03CAACGGCCCGNONE
AB070254CAACGGCCCGNONE
AK063158CAACGGCCCGSimilar to 26S proteasome regulatory complex subunit p42D.
AK066695CAACGGCCCGNONE
J013074G13CAACGGCCCGNONE
J090015C16CAACGGCCCGNONE
J090069H10CAACGGCCCGNONE
Os06g0622700AK107021CCAGGCCCGTTEukaryotic transcription factor, DNA-binding domain containing protein.
J065053P05CCAGGCCCGTTNONE
J065100L18CCAGGCCCGTTNONE
J065129N15CCAGGCCCGTTNONE
J065152M08CCAGGCCCGTTNONE
J065198M12CCAGGCCCGTTNONE
J090077J22CCAGGCCCGTTNONE
J100024G23CCAGGCCCGTTNONE
J100027L01CCAGGCCCGTTNONE
J100047C06CCAGGCCCGTTNONE
J100055D01CCAGGCCCGTTNONE
J100067M05CCAGGCCCGTTNONE
J100077M16CCAGGCCCGTTNONE
J100078M22CCAGGCCCGTTNONE
Os06g0648200009-150-E06CTCGGCCCGTTNONE
014-034-H10CTCGGCCCGTTNONE
015-035-E11CTCGGCCCGTTNONE
AK063001CTCGGCCCGTTNONE
AK063675CTCGGCCCGTTNONE
AK106303CTCGGCCCGTTConserved hypothetical protein.
Os06g0660400AK111110AACGGGCCConserved hypothetical protein.
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein.
Os06g0666400AK108002GGCCGTTTVQ domain containing protein.
J065043C22GGCCGTTTNONE
J065120O19GGCCGTTTNONE
J075197D23GGCCGTTTNONE
J100030E22GGCCGTTTNONE
J100031I22GGCCGTTTNONE
J100072I12GGCCGTTTNONE
Os06g0675700AK065487AAACGGCCNONE
AK119824AAACGGCCSimilar to High pI alpha-glucosidase.
Os06g0681000009-105-G11CCAGGCCCGTTNONE
AK062780CCAGGCCCGTTConserved hypothetical protein.
J100021E01CCAGGCCCGTTNONE
Os06g0715000AK107114AACGGGCCCGGTConserved hypothetical protein.
Os07g0105300AK107419AACGGGCCConserved hypothetical protein.
AK109521AACGGGCCNONE
Os07g0114550J090025L18AACGGCCCATGTHypothetical protein.
Os07g0142000AK059877AAACGGCCCReticulon family protein.
AK099414AAACGGCCCNONE
Os07g0158900AK064980CACGGCCCGTTCyclin-like F-box domain containing protein.
Os07g0164500J013094M18AACGGGCCNONE
J013153L05AACGGGCCNONE
J023011J18AACGGGCCNONE
J023106H21AACGGGCCNONE
J033105F10AACGGGCCNONE
J065210M20AACGGGCCSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase).
J090060F05AACGGGCCNONE
J090061C13AACGGGCCNONE
J090074K15AACGGGCCNONE
Os07g0169600006-027-F04AGATGGGCCGTTGNONE
006-043-C10AGATGGGCCGTTGNONE
006-070-A04AGATGGGCCGTTGNONE
006-081-F03AGATGGGCCGTTGNONE
006-104-F02AGATGGGCCGTTGNONE
012-006-D12AGATGGGCCGTTGNONE
AK060318AGATGGGCCGTTGNONE
AK121818AGATGGGCCGTTG2OG-Fe(II) oxygenase domain containing protein.
J023065K01AGATGGGCCGTTGNONE
J023086G17AGATGGGCCGTTGNONE
J023093G16AGATGGGCCGTTGNONE
J033024N04AGATGGGCCGTTGNONE
J033099A15AGATGGGCCGTTGNONE
J033107B14AGATGGGCCGTTGNONE
J043026F14AGATGGGCCGTTGNONE
J065043P20AGATGGGCCGTTGNONE
J075118L16AGATGGGCCGTTGNONE
J075162M22AGATGGGCCGTTGNONE
J080004K13AGATGGGCCGTTGNONE
J080024D10AGATGGGCCGTTGNONE
J080037C21AGATGGGCCGTTGNONE
J080039M17AGATGGGCCGTTGNONE
J080040A03AGATGGGCCGTTGNONE
J080044A07AGATGGGCCGTTGNONE
J080045I07AGATGGGCCGTTGNONE
J080052L06AGATGGGCCGTTGNONE
J080053A20AGATGGGCCGTTGNONE
J080060L15AGATGGGCCGTTGNONE
J080060N22AGATGGGCCGTTGNONE
J080062L23AGATGGGCCGTTGNONE
J080069B19AGATGGGCCGTTGNONE
J080086K15AGATGGGCCGTTGNONE
J080089H16AGATGGGCCGTTGNONE
J080089I23AGATGGGCCGTTGNONE
J080094P07AGATGGGCCGTTGNONE
J090032L18AGATGGGCCGTTGNONE
J100044E09AGATGGGCCGTTGNONE
J100045O03AGATGGGCCGTTGNONE
J100066B11AGATGGGCCGTTGNONE
J100069J24AGATGGGCCGTTGNONE
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein.
J013110O09TCTGGGCCGTTTGGGCCGAANONE
J033041I12TCTGGGCCGTTTGGGCCGAANONE
J033046D05TCTGGGCCGTTTGGGCCGAANONE
J033101K24TCTGGGCCGTTTGGGCCGAANONE
J090009F10TCTGGGCCGTTTGGGCCGAANONE
J090095B17TCTGGGCCGTTTGGGCCGAANONE
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein.
AK103440TTCGGCCCAAACGGCCCAGANONE
Os07g0222800009-072-E05AAACGGCCCAGCNONE
AK060442AAACGGCCCAGCNONE
AK100823AAACGGCCCAGCAcyl carrier protein-like protein.
AK103131AAACGGCCCAGCNONE
AY224456AAACGGCCCAGCNONE
J075026H13AAACGGCCCAGCNONE
J075142G06AAACGGCCCAGCNONE
J100033K08AAACGGCCCAGCNONE
Os07g0301200AB110202AACGGGCCGTGNONE
AK073463AACGGGCCGTGSimilar to RNA helicase (Fragment).
Os07g0408500AK103596AAACGGCCSimilar to Rac GTPase activating protein 3 (Fragment).
Os07g0516200AK061373AACGGGCCSimilar to Endoribonuclease, L-PSP family.
AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family.
Os07g0516900009-108-C10GGCCGTTTNONE
AK062798GGCCGTTTNONE
Os07g0565600AK071983CCTGGGCCGTTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38).
AK107481CCTGGGCCGTTNONE
Os07g0565700006-106-C01AACGGGCCNONE
AK111937AACGGGCCNONE
AK112115AACGGGCCAlpha/beta hydrolase family protein.
Os07g0570700AK065242AAACGGCCCATTARibosome recycling factor family protein.
J013002I12AAACGGCCCATTANONE
Os07g0574800006-097-G09GGCCGTTTNONE
013-077-E02GGCCGTTTNONE
014-010-B04GGCCGTTTNONE
AK067721GGCCGTTTTubulin alpha-1 chain.
AK069140GGCCGTTTNONE
AK104900GGCCGTTTNONE
J013037J23GGCCGTTTNONE
J013045O05GGCCGTTTNONE
J013056A21GGCCGTTTNONE
J013119N24GGCCGTTTNONE
J023036H19GGCCGTTTNONE
J023036K16GGCCGTTTNONE
J023067J23GGCCGTTTNONE
J023075H08GGCCGTTTNONE
J023084K13GGCCGTTTNONE
J023097O10GGCCGTTTNONE
J033093K22GGCCGTTTNONE
J033105L08GGCCGTTTNONE
J065219H05GGCCGTTTNONE
J075010N07GGCCGTTTNONE
J075130I08GGCCGTTTNONE
J090014E16GGCCGTTTNONE
J090025K17GGCCGTTTNONE
J090030L19GGCCGTTTNONE
J090035J05GGCCGTTTNONE
J090036B17GGCCGTTTNONE
J090037A15GGCCGTTTNONE
J090064C17GGCCGTTTNONE
J090069L18GGCCGTTTNONE
J090073N11GGCCGTTTNONE
J090077F23GGCCGTTTNONE
J090099F02GGCCGTTTNONE
J100029N06GGCCGTTTNONE
J100056I04GGCCGTTTNONE
J100061A13GGCCGTTTNONE
J100062B10GGCCGTTTNONE
J100062J17GGCCGTTTNONE
J100072F22GGCCGTTTNONE
J100072J22GGCCGTTTNONE
J100076C03GGCCGTTTNONE
X91808GGCCGTTTNONE
Z11931GGCCGTTTNONE
Os07g0589400AK072501GGCCCGTTQuinonprotein alcohol dehydrogenase-like domain containing protein.
AK104617GGCCCGTTNONE
AK104756GGCCCGTTNONE
Os07g0602000AK071832GGGCCGTTTCCACGCCACSimilar to NADPH HC toxin reductase (Fragment).
J023121D11GGGCCGTTTCCACGCCACNONE
J023138E01GGGCCGTTTCCACGCCACNONE
J023149O13GGGCCGTTTCCACGCCACNONE
J090074M19GGGCCGTTTCCACGCCACNONE
Os07g0606600AK111621AAACGGCCNONE
AK112118AAACGGCCSimilar to Nuclear factor Y transcription factor subunit B homolog.
J080301F22AAACGGCCNONE
Os07g0623300AK070292AACTGGGCCCGTTSimilar to Splicing factor SC35.
J023050C05AACTGGGCCCGTTNONE
J090025O12AACTGGGCCCGTTNONE
Os07g0626100009-127-G03AACGGGCCAGANONE
AK062899AACGGGCCAGASimilar to 50S ribosomal protein L7/L12.
Os07g0656400011-061-F11CAACGGCCCATAConserved hypothetical protein.
Os07g0668200AK059051CAACGGCCCATCANONE
AK101682CAACGGCCCATCAConserved hypothetical protein.
AK102839CAACGGCCCATCANONE
Os07g0673900J080092A21CCACGGCCGTTTNONE
Os07g0674100AB183706AACGGCCCACGGUDP-glucuronic acid decarboxylase.
AK099614AACGGCCCACGGNONE
J013050E02AACGGCCCACGGNONE
J065162F06AACGGCCCACGGNONE
J065180F10AACGGCCCACGGNONE
J090049F09AACGGCCCACGGNONE
J100064L11AACGGCCCACGGNONE
Os08g0116500009-007-E05AACGGGCCGGANONE
009-074-C07AACGGGCCGGANONE
009-098-A07AACGGGCCGGANONE
009-100-C03AACGGGCCGGANONE
009-136-E04AACGGGCCGGANONE
009-138-B08AACGGGCCGGANONE
009-144-B06AACGGGCCGGANONE
009-184-E04AACGGGCCGGANONE
009-189-F01AACGGGCCGGANONE
013-006-E05AACGGGCCGGANONE
013-015-C10AACGGGCCGGANONE
013-019-F09AACGGGCCGGANONE
013-020-C01AACGGGCCGGANONE
013-021-F05AACGGGCCGGANONE
013-035-D08AACGGGCCGGANONE
013-038-C09AACGGGCCGGANONE
013-054-B07AACGGGCCGGANONE
013-061-G10AACGGGCCGGANONE
013-074-B01AACGGGCCGGANONE
013-079-B06AACGGGCCGGANONE
013-099-B09AACGGGCCGGANONE
013-099-G11AACGGGCCGGANONE
014-023-F04AACGGGCCGGANONE
014-032-C07AACGGGCCGGANONE
014-045-E02AACGGGCCGGANONE
014-085-C02AACGGGCCGGANONE
014-087-F04AACGGGCCGGANONE
014-089-C04AACGGGCCGGANONE
014-090-E01AACGGGCCGGANONE
014-094-G11AACGGGCCGGANONE
014-097-B07AACGGGCCGGANONE
015-024-A12AACGGGCCGGANONE
015-032-C06AACGGGCCGGANONE
016-053-E09AACGGGCCGGANONE
016-081-F10AACGGGCCGGANONE
AK058240AACGGGCCGGASimilar to 60S acidic ribosomal protein P1 (L12).
J023079C09AACGGGCCGGANONE
J023107O19AACGGGCCGGANONE
J053029K21AACGGGCCGGANONE
J053073P11AACGGGCCGGANONE
J053074B04AACGGGCCGGANONE
J053078M14AACGGGCCGGANONE
J065001E12AACGGGCCGGANONE
J065006J12AACGGGCCGGANONE
J065015C06AACGGGCCGGANONE
J065025D13AACGGGCCGGANONE
J065029A04AACGGGCCGGANONE
J065031D23AACGGGCCGGANONE
J065032E24AACGGGCCGGANONE
J065034P16AACGGGCCGGANONE
J065043B04AACGGGCCGGANONE
J065044A15AACGGGCCGGANONE
J065062D18AACGGGCCGGANONE
J065079G13AACGGGCCGGANONE
J065080A19AACGGGCCGGANONE
J065080A20AACGGGCCGGANONE
J065089N19AACGGGCCGGANONE
J065111O07AACGGGCCGGANONE
J065115N15AACGGGCCGGANONE
J065131A04AACGGGCCGGANONE
J065138H02AACGGGCCGGANONE
J065139K10AACGGGCCGGANONE
J065144A02AACGGGCCGGANONE
J065155J17AACGGGCCGGANONE
J065159D18AACGGGCCGGANONE
J065159I18AACGGGCCGGANONE
J065167H12AACGGGCCGGANONE
J065174C22AACGGGCCGGANONE
J065184A05AACGGGCCGGANONE
J065188M15AACGGGCCGGANONE
J065191D23AACGGGCCGGANONE
J065203C07AACGGGCCGGANONE
J065207C23AACGGGCCGGANONE
J065207L16AACGGGCCGGANONE
J065212F01AACGGGCCGGANONE
J065212F05AACGGGCCGGANONE
J075037B07AACGGGCCGGANONE
J075042F15AACGGGCCGGANONE
J075059J03AACGGGCCGGANONE
J075068M18AACGGGCCGGANONE
J075079E13AACGGGCCGGANONE
J075081F12AACGGGCCGGANONE
J075083I05AACGGGCCGGANONE
J075123K23AACGGGCCGGANONE
J075142F16AACGGGCCGGANONE
J075156N03AACGGGCCGGANONE
J075162K05AACGGGCCGGANONE
J075171E08AACGGGCCGGANONE
J075177N03AACGGGCCGGANONE
J075182K17AACGGGCCGGANONE
J075186K02AACGGGCCGGANONE
J075191K05AACGGGCCGGANONE
J080011E10AACGGGCCGGANONE
J080016M21AACGGGCCGGANONE
J080017A17AACGGGCCGGANONE
J080031O09AACGGGCCGGANONE
J080039G21AACGGGCCGGANONE
J080041B01AACGGGCCGGANONE
J080050G20AACGGGCCGGANONE
J080054A12AACGGGCCGGANONE
J080058O08AACGGGCCGGANONE
J080061N04AACGGGCCGGANONE
J080064L23AACGGGCCGGANONE
J080064P05AACGGGCCGGANONE
J080069I17AACGGGCCGGANONE
J080070E07AACGGGCCGGANONE
J080071B20AACGGGCCGGANONE
J080074L08AACGGGCCGGANONE
J080076N08AACGGGCCGGANONE
J080081A14AACGGGCCGGANONE
J080081J17AACGGGCCGGANONE
J080085N14AACGGGCCGGANONE
J080090B09AACGGGCCGGANONE
J080097L11AACGGGCCGGANONE
J080306H13AACGGGCCGGANONE
J080307H13AACGGGCCGGANONE
J080311F12AACGGGCCGGANONE
J080316L23AACGGGCCGGANONE
J080318H02AACGGGCCGGANONE
J090016L15AACGGGCCGGANONE
J090019I02AACGGGCCGGANONE
J090031G21AACGGGCCGGANONE
J090066C15AACGGGCCGGANONE
J100032I02AACGGGCCGGANONE
J100032N07AACGGGCCGGANONE
J100032N16AACGGGCCGGANONE
J100041P21AACGGGCCGGANONE
J100048M04AACGGGCCGGANONE
J100048M14AACGGGCCGGANONE
J100063B08AACGGGCCGGANONE
J100088E20AACGGGCCGGANONE
J100090I08AACGGGCCGGANONE
Os08g0120000006-042-E02AAACGGCCCAACANONE
006-051-F06AAACGGCCCAACANONE
006-052-G03AAACGGCCCAACANONE
006-095-B11AAACGGCCCAACANONE
AB017427AAACGGCCCAACANONE
AB017428AAACGGCCCAACANONE
AK059789AAACGGCCCAACANONE
AK059815AAACGGCCCAACASuccinate dehydrogenase iron-protein subunit (SDHB).
AK099077AAACGGCCCAACANONE
AK102607AAACGGCCCAACANONE
AK104303AAACGGCCCAACANONE
AK104304AAACGGCCCAACANONE
AK104421AAACGGCCCAACANONE
D10414AAACGGCCCAACANONE
J013170D08AAACGGCCCAACANONE
J023086D16AAACGGCCCAACANONE
J033099B04AAACGGCCCAACANONE
J065042P05AAACGGCCCAACANONE
J065144E22AAACGGCCCAACANONE
J065162J20AAACGGCCCAACANONE
J065196N13AAACGGCCCAACANONE
J090013B11AAACGGCCCAACANONE
Os08g0133600AK073987AACGGGCCCAGGNONE
AK105436AACGGGCCCAGGConserved hypothetical protein.
Os08g0143500006-072-G06TTTTGGGCCGTTNONE
016-053-H02TTTTGGGCCGTTNONE
AK061094TTTTGGGCCGTTNONE
AK071122TTTTGGGCCGTTGlycosyl transferase, family 14 protein.
J023081E17TTTTGGGCCGTTNONE
J023106O18TTTTGGGCCGTTNONE
J043001N22TTTTGGGCCGTTNONE
J065062D05TTTTGGGCCGTTNONE
J065099M15TTTTGGGCCGTTNONE
J065180K12TTTTGGGCCGTTNONE
J090045L23TTTTGGGCCGTTNONE
J100088K05TTTTGGGCCGTTNONE
Os08g0164100AK108589GGCCGTTTProtein of unknown function DUF295 family protein.
Os08g0172800AK111113AACGGGCCGGGConserved hypothetical protein.
Os08g0302000AK106760AAACGGCCCAACSimilar to Peroxidase 40 precursor (EC 1.11.1.7) (Atperox P40).
Os08g0309300Os08g0309300AAACGGCCSimilar to AtRer1B.
Os08g0328300AK102227CACGGCCCGTTNONE
AK105392CACGGCCCGTTENT domain containing protein.
Os08g0346400003-103-D08AACGGGCCNONE
009-135-G12AACGGGCCNONE
AK059644AACGGGCCNONE
AK062928AACGGGCCNONE
AK103873AACGGGCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1).
J033149L11AACGGGCCNONE
J065137E08AACGGGCCNONE
J065194M22AACGGGCCNONE
J075083O16AACGGGCCNONE
Os08g0398000AK101910GGCCGTTTABC transporter related domain containing protein.
Os08g0406500016-001-C06AGGTGGGCCCGTTNONE
AK064160AGGTGGGCCCGTTTRAF-like domain containing protein.
Os08g0442300006-067-F05AACGGGCCNONE
AK059843AACGGGCCNONE
AK071719AACGGGCCSimilar to Calcineurin-like protein.
AK102411AACGGGCCNONE
J023108H11AACGGGCCNONE
J033092P05AACGGGCCNONE
J075109C09AACGGGCCNONE
J090070B02AACGGGCCNONE
J090076M14AACGGGCCNONE
J100064B16AACGGGCCNONE
Os08g0463900AK120178TTCGTGGGCCGTTTConserved hypothetical protein.
J013033H06TTCGTGGGCCGTTTNONE
J075006G17TTCGTGGGCCGTTTNONE
Os08g0465300AK108076AACTGGGCCGTTConserved hypothetical protein.
Os08g0475100AK105839AAACGGCCEsterase/lipase/thioesterase domain containing protein.
Os08g0497300AK068384AAACGGCCNONE
AK070235AAACGGCCCellular retinaldehyde binding/alpha-tocopherol transport family protein.
Os08g0507400015-083-F04GGGCCGTTNONE
AK067905GGGCCGTTCytochrome P450 family protein.
AK099637GGGCCGTTNONE
J013059L23GGGCCGTTNONE
J013124B09GGGCCGTTNONE
Os08g0525600AK103172TCCGGGCCGTTSimilar to Peptidylprolyl isomerase; FK506-binding protein.
Os08g0535400004-001-H10CGGGCCGTTNONE
AK071527CGGGCCGTTZinc finger, DHHC-type domain containing protein.
J023107B02CGGGCCGTTNONE
Os08g0535600AK121683CCCGGCCCGGCCCGTTZinc finger, Tim10/DDP-type family protein.
J065077E05CCCGGCCCGGCCCGTTNONE
J075088M24CCCGGCCCGGCCCGTTNONE
J075140B03CCCGGCCCGGCCCGTTNONE
J090014B14CCCGGCCCGGCCCGTTNONE
Os08g0546300AK064717TGATGGGCCGTTTConserved hypothetical protein.
AK119794TGATGGGCCGTTTNONE
D10982TGATGGGCCGTTTNONE
J080044B21TGATGGGCCGTTTNONE
Os08g0548300AK073266TGATGGGCCGTTTZinc finger, RING-type domain containing protein.
J013030C19TGATGGGCCGTTTNONE
J033029A20TGATGGGCCGTTTNONE
J033050L14TGATGGGCCGTTTNONE
J033058F03TGATGGGCCGTTTNONE
J033110K01TGATGGGCCGTTTNONE
J033123D21TGATGGGCCGTTTNONE
Os08g0549300009-008-F01AAACGGCCCATCCNONE
009-033-G10AAACGGCCCATCCNONE
AK120938AAACGGCCCATCCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III).
D10420AAACGGCCCATCCNONE
J023037A21AAACGGCCCATCCNONE
J023066D20AAACGGCCCATCCNONE
J033099K13AAACGGCCCATCCNONE
J065116C14AAACGGCCCATCCNONE
J075009K15AAACGGCCCATCCNONE
J075071P13AAACGGCCCATCCNONE
J075080D18AAACGGCCCATCCNONE
J075124F24AAACGGCCCATCCNONE
J075198F23AAACGGCCCATCCNONE
J080006B15AAACGGCCCATCCNONE
J090078H13AAACGGCCCATCCNONE
J090089J09AAACGGCCCATCCNONE
J100017A03AAACGGCCCATCCNONE
J100023G03AAACGGCCCATCCNONE
Os09g0129600J065058B14GGCCCGTTSite-specific recombinase family protein.
J065215K24GGCCCGTTNONE
Os09g0267600003-130-C11GGCCGTTTNONE
AK065728GGCCGTTTSnf7 family protein.
J013036O11GGCCGTTTNONE
J013110D08GGCCGTTTNONE
J033095H15GGCCGTTTNONE
J065073F24GGCCGTTTNONE
J065116E02GGCCGTTTNONE
J080319E18GGCCGTTTNONE
Os09g0319701009-048-G04GGCCCGTTConserved hypothetical protein.
009-189-D04GGCCCGTTNONE
J065037N18GGCCCGTTNONE
J065093P03GGCCCGTTNONE
J065184L12GGCCCGTTNONE
J075002G04GGCCCGTTNONE
J075033A17GGCCCGTTNONE
J075095M15GGCCCGTTNONE
J075180N24GGCCCGTTNONE
Os09g0325300011-005-H08TCGGCCCAAACTTGGGCCGGCCCGTTNONE
AK068435TCGGCCCAAACTTGGGCCGGCCCGTTConserved hypothetical protein.
AK073998TCGGCCCAAACTTGGGCCGGCCCGTTNONE
J033071H21TCGGCCCAAACTTGGGCCGGCCCGTTNONE
J065214H05TCGGCCCAAACTTGGGCCGGCCCGTTNONE
Os09g0338400AK059171AACGGGCCGAANONE
AK068798AACGGGCCGAANONE
AK072043AACGGGCCGAANONE
AK098947AACGGGCCGAASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1).
Os09g0397100J075141L14AACGGGCCGGANONE
J100063H17AACGGGCCGGAConserved hypothetical protein.
Os09g0407900016-010-E10GGCCGTTTNONE
AK070971GGCCGTTTPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein.
J033140K02GGCCGTTTNONE
J033142K02GGCCGTTTNONE
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein.
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE
Os09g0437900AK107833GGCCCGTTSimilar to Adrenodoxin.
Os09g0439500AK067780AACGGGCCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor.
Os09g0454900011-052-B02AAACGGCCCGNONE
016-025-D09AAACGGCCCGNONE
AK102152AAACGGCCCGCurculin-like (mannose-binding) lectin domain containing protein.
J033086D22AAACGGCCCGNONE
Os09g0461800009-087-C07CGGGCCGTTTNONE
AK062676CGGGCCGTTTEsterase/lipase/thioesterase domain containing protein.
Os09g0477700AK121644CTTGGGCCGTTConserved hypothetical protein.
Os09g0485800AK108749GTTTGGGCCGTTTConserved hypothetical protein.
J065137H03GTTTGGGCCGTTTNONE
Os09g0498600AK066995CCCGGCCCGTTNONE
Os09g0559800AK071542CGGGCCGTTSimilar to Transporter-like protein.
J013063N24CGGGCCGTTNONE
Os09g0567000012-071-E09AAACGGCCNONE
013-099-E05AAACGGCCNONE
AK065613AAACGGCCConserved hypothetical protein.
J013026M04AAACGGCCNONE
J023103F04AAACGGCCNONE
J033119N04AAACGGCCNONE
J065011I19AAACGGCCNONE
J065042A10AAACGGCCNONE
J100023F16AAACGGCCNONE
Os11g0115800AK106102TCGGCCCGTTConserved hypothetical protein.
J065057N13TCGGCCCGTTNONE
Os11g0139100009-099-H06AAACGGCCCAGTTNONE
AK121443AAACGGCCCAGTTSimilar to 50S ribosomal protein L24.
J023140O18AAACGGCCCAGTTNONE
J023143M23AAACGGCCCAGTTNONE
J033079G04AAACGGCCCAGTTNONE
J043004D20AAACGGCCCAGTTNONE
J065097F05AAACGGCCCAGTTNONE
Os11g0157100012-010-F03GGAGTGGGCCTGAAACGGGCCNONE
J013028H01GGAGTGGGCCTGAAACGGGCCNONE
J013061L19GGAGTGGGCCTGAAACGGGCCNONE
J033044L03GGAGTGGGCCTGAAACGGGCCNONE
J033064P09GGAGTGGGCCTGAAACGGGCCNONE
J033076A10GGAGTGGGCCTGAAACGGGCCNONE
J033076K22GGAGTGGGCCTGAAACGGGCCNONE
J033084J05GGAGTGGGCCTGAAACGGGCCNONE
J033145A22GGAGTGGGCCTGAAACGGGCCNONE
J033148L19GGAGTGGGCCTGAAACGGGCCNONE
J065027P20GGAGTGGGCCTGAAACGGGCCNONE
J065085D16GGAGTGGGCCTGAAACGGGCCNONE
J065091L03GGAGTGGGCCTGAAACGGGCCNONE
J065195C18GGAGTGGGCCTGAAACGGGCCNONE
J090018N23GGAGTGGGCCTGAAACGGGCCNONE
J090048A10GGAGTGGGCCTGAAACGGGCCNONE
J090048M03GGAGTGGGCCTGAAACGGGCCNONE
J090066L11GGAGTGGGCCTGAAACGGGCCNONE
J090075G16GGAGTGGGCCTGAAACGGGCCNONE
J090083G23GGAGTGGGCCTGAAACGGGCCNONE
J090087E24GGAGTGGGCCTGAAACGGGCCNONE
J090096H16GGAGTGGGCCTGAAACGGGCCNONE
Os11g0199600AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein.
AK120040TCGGCCCATTAACGGCCCACGTNONE
J023047I06TCGGCCCATTAACGGCCCACGTNONE
J033064L23TCGGCCCATTAACGGCCCACGTNONE
J033117I01TCGGCCCATTAACGGCCCACGTNONE
J033123I18TCGGCCCATTAACGGCCCACGTNONE
J053026H17TCGGCCCATTAACGGCCCACGTNONE
J053078G05TCGGCCCATTAACGGCCCACGTNONE
J065102A09TCGGCCCATTAACGGCCCACGTNONE
J065113G11TCGGCCCATTAACGGCCCACGTNONE
J065207F20TCGGCCCATTAACGGCCCACGTNONE
J075027K21TCGGCCCATTAACGGCCCACGTNONE
Os11g0206300016-010-D02CGGGCCGTTGGATNONE
AK064170CGGGCCGTTGGATMitochodrial transcription termination factor-related family protein.
Os11g0209100016-063-F03TCCGGCCCGTTNONE
AK064391TCCGGCCCGTTCyclin-like F-box domain containing protein.
J075027K02TCCGGCCCGTTNONE
J075154K15TCCGGCCCGTTNONE
Os11g0216400Os11g0216400AACGGGCCCCACTCTProteinase inhibitor, propeptide domain containing protein.
Os11g0231400AK108047GGGCCGTTCCAGCCCAACCProtein of unknown function DUF295 family protein.
Os11g0444900009-136-A09GGCCGTTTNONE
009-154-A11GGCCGTTTNONE
AF493074GGCCGTTTOcticosapeptide/Phox/Bem1p domain containing protein.
J053033M12GGCCGTTTNONE
J053074N04GGCCGTTTNONE
J053075A20GGCCGTTTNONE
J053095D10GGCCGTTTNONE
J065034G24GGCCGTTTNONE
J065102M17GGCCGTTTNONE
J065214D08GGCCGTTTNONE
J075010E19GGCCGTTTNONE
J075010L20GGCCGTTTNONE
J075017G03GGCCGTTTNONE
J075098J18GGCCGTTTNONE
J075130C14GGCCGTTTNONE
J075132P21GGCCGTTTNONE
J075134G15GGCCGTTTNONE
J075145F02GGCCGTTTNONE
J075182B15GGCCGTTTNONE
J075186G06GGCCGTTTNONE
J100045J19GGCCGTTTNONE
J100061O07GGCCGTTTNONE
J100090H07GGCCGTTTNONE
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A.
J075053H03GCCGGCCCAAACGGCCCACGAANONE
J075062F23GCCGGCCCAAACGGCCCACGAANONE
J090029D08GCCGGCCCAAACGGCCCACGAANONE
Os11g0484500AK059546AACGGGCCNONE
Os11g0497000AK111924GCTGGGCCGTTSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a).
J065090J11GCTGGGCCGTTNONE
J065097A08GCTGGGCCGTTNONE
J065123J10GCTGGGCCGTTNONE
J075096F04GCTGGGCCGTTNONE
J080065C15GCTGGGCCGTTNONE
J090033J04GCTGGGCCGTTNONE
J090072N23GCTGGGCCGTTNONE
J100021E08GCTGGGCCGTTNONE
J100063H21GCTGGGCCGTTNONE
Os11g0544700AF464904AACGGGCCGGANONE
AK072844AACGGGCCGGARepressor protein.
J023143I16AACGGGCCGGANONE
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE
J075044E18CTGGCCCAACGGCCCACGANONE
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein.
Os11g0615700AB026561AACGGCCCGNONE
AK059521AACGGCCCGNONE
AK103487AACGGCCCGProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5).
J033055A14AACGGCCCGNONE
J065044A11AACGGCCCGNONE
J065090I02AACGGCCCGNONE
J065104I09AACGGCCCGNONE
J065187J10AACGGCCCGNONE
J075024E07AACGGCCCGNONE
J075025O13AACGGCCCGNONE
J090062N12AACGGCCCGNONE
J090087G06AACGGCCCGNONE
J090098K11AACGGCCCGNONE
Os11g0621400009-043-B05AAACGGCCNONE
AK062468AAACGGCCConserved hypothetical protein.
Os11g0641500AK103094AAACGGCCCupredoxin domain containing protein.
J065012G11AAACGGCCNONE
Os11g0657200AK059959GGCCCGTT2OG-Fe(II) oxygenase domain containing protein.
Os11g0657300009-101-D07AACGGGCCNONE
AK062752AACGGGCCSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF).
Os11g0660000AK066709CACGGCCCGTTSodium/calcium exchanger membrane region domain containing protein.
AK066709GGCCCGGCCCGTTSodium/calcium exchanger membrane region domain containing protein.
J013074O18CACGGCCCGTTNONE
J013074O18GGCCCGGCCCGTTNONE
J023081H12CACGGCCCGTTNONE
J023081H12GGCCCGGCCCGTTNONE
J065072E24CACGGCCCGTTNONE
J065072E24GGCCCGGCCCGTTNONE
J065186K08CACGGCCCGTTNONE
J065186K08GGCCCGGCCCGTTNONE
J075079E19CACGGCCCGTTNONE
J075079E19GGCCCGGCCCGTTNONE
J075093J05CACGGCCCGTTNONE
J075093J05GGCCCGGCCCGTTNONE
J075124I21CACGGCCCGTTNONE
J075124I21GGCCCGGCCCGTTNONE
J075187F09CACGGCCCGTTNONE
J075187F09GGCCCGGCCCGTTNONE
J090037O16CACGGCCCGTTNONE
J090037O16GGCCCGGCCCGTTNONE
Os11g0689100AK073759CCATGGGCCGTTDisease resistance protein family protein.
AK108692CCATGGGCCGTTNONE
Os11g0703000AK108011AAACGGCCThaumatin, pathogenesis-related family protein.
J100084D12AAACGGCCNONE
Os12g0124400AK071024AACGGGCCExostosin-like family protein.
Os12g0141400AK071576AAACGGCCCGHypothetical protein.
J023105A17AAACGGCCCGNONE
Os12g0165200AK110577AAACGGCCCAAAHSP20-like chaperone domain containing protein.
Os12g0190100AK109819AACGGGCCSimilar to Auxin-independent growth promoter-like protein.
Os12g0194700AK121912AACGGCCCAGATDNA-directed RNA polymerase, 13 to 16 kDa subunit family protein.
J033106A07AACGGCCCAGATNONE
Os12g0194800011-016-B07ATCTGGGCCGTTNONE
AK101810ATCTGGGCCGTTtRNA pseudouridine synthase family protein.
AK107780ATCTGGGCCGTTNONE
J043034C07ATCTGGGCCGTTNONE
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein.
J033065K09TCCAACGGCCCACGAANONE
Os12g0231000AK120737AACGGGCCTGF-beta receptor, type I/II extracellular region family protein.
Os12g0235800AK071066CAACGGCCCACCCSimilar to Argininosuccinate synthase (Fragment).
Os12g0540900AK060440TCCGGCCCGTTNONE
AK102417TCCGGCCCGTTSimilar to Tryptophanyl-tRNA synthetase (EC 6.1.1.2) (Tryptophan--tRNA ligase) (TrpRS).
D10401TCCGGCCCGTTNONE
J023088E16TCCGGCCCGTTNONE
Os12g0557800AK121691AACGGGCCGTGProtein prenyltransferase domain containing protein.
J013095M03AACGGGCCGTGNONE
J033071H11AACGGGCCGTGNONE
J065101B02AACGGGCCGTGNONE
Os12g0573000AK067552AACGGCCCACGGCCCACGTHypothetical protein.
AK069292AACGGCCCACGGCCCACGTNONE
Os12g0592200Os12g0592200AAACGGCCConserved hypothetical protein.
Os12g0614300J100063C15CGGGCCGTTGConserved hypothetical protein.
Os12g0636600AK111056AATTGGGCCGTTConserved hypothetical protein.
AK111056GGCCCGTTConserved hypothetical protein.


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.