version

Summary of ACGGGC (All List)

Organism Oryza sativa
PPDB Motif ACGGGC
Description function unknown
Total Entry Count 7029

Entry Sequences (7029 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein.
J013000E05CACGTGGGGCCCGCANONE
J013027D08CACGTGGGGCCCGCANONE
J013045K12CACGTGGGGCCCGCANONE
J023119M03CACGTGGGGCCCGCANONE
J065081F02CACGTGGGGCCCGCANONE
J065180C08CACGTGGGGCCCGCANONE
J065211M06CACGTGGGGCCCGCANONE
J075073J06CACGTGGGGCCCGCANONE
J075123A18CACGTGGGGCCCGCANONE
J075124A07CACGTGGGGCCCGCANONE
J075187B05CACGTGGGGCCCGCANONE
Os01g0102700009-009-A07CCCACGGGNONE
AK063774CCCACGGGTranslocon-associated beta family protein.
AK099081CCCACGGGNONE
AK099360CCCACGGGNONE
J013096O20CCCACGGGNONE
J023002P14CCCACGGGNONE
J033046F10CCCACGGGNONE
J033084K08CCCACGGGNONE
J065011H22CCCACGGGNONE
J090017O18CCCACGGGNONE
J090047F15CCCACGGGNONE
J090049G20CCCACGGGNONE
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE
006-049-C10CGCGTGGGCCCGGANONE
006-054-E02CGCGTGGGCCCGGANONE
011-035-H02CGCGTGGGCCCGGANONE
011-036-E04CGCGTGGGCCCGGANONE
012-047-C08CGCGTGGGCCCGGANONE
012-079-F08CGCGTGGGCCCGGANONE
012-097-C02CGCGTGGGCCCGGANONE
012-100-A07CGCGTGGGCCCGGANONE
013-015-H05CGCGTGGGCCCGGANONE
013-047-A03CGCGTGGGCCCGGANONE
013-051-B05CGCGTGGGCCCGGANONE
013-061-G02CGCGTGGGCCCGGANONE
013-077-H02CGCGTGGGCCCGGANONE
015-005-D04CGCGTGGGCCCGGANONE
015-064-B06CGCGTGGGCCCGGANONE
015-072-D02CGCGTGGGCCCGGANONE
016-073-E09CGCGTGGGCCCGGANONE
016-088-H03CGCGTGGGCCCGGANONE
AK062063CGCGTGGGCCCGGANONE
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment).
AK102277CGCGTGGGCCCGGANONE
AK119645CGCGTGGGCCCGGANONE
AY341828CGCGTGGGCCCGGANONE
J013036O08CGCGTGGGCCCGGANONE
J013037M17CGCGTGGGCCCGGANONE
J013039B11CGCGTGGGCCCGGANONE
J013039L20CGCGTGGGCCCGGANONE
J013047B20CGCGTGGGCCCGGANONE
J013048E23CGCGTGGGCCCGGANONE
J013051E12CGCGTGGGCCCGGANONE
J013051F12CGCGTGGGCCCGGANONE
J013056B05CGCGTGGGCCCGGANONE
J013057N24CGCGTGGGCCCGGANONE
J013064D21CGCGTGGGCCCGGANONE
J013065G24CGCGTGGGCCCGGANONE
J013075L13CGCGTGGGCCCGGANONE
J013075L24CGCGTGGGCCCGGANONE
J013092F04CGCGTGGGCCCGGANONE
J013092F10CGCGTGGGCCCGGANONE
J013092M16CGCGTGGGCCCGGANONE
J013096K06CGCGTGGGCCCGGANONE
J013111F10CGCGTGGGCCCGGANONE
J013120B17CGCGTGGGCCCGGANONE
J013120P07CGCGTGGGCCCGGANONE
J013122F18CGCGTGGGCCCGGANONE
J013122H23CGCGTGGGCCCGGANONE
J013126I15CGCGTGGGCCCGGANONE
J013126L17CGCGTGGGCCCGGANONE
J013129C15CGCGTGGGCCCGGANONE
J013146A04CGCGTGGGCCCGGANONE
J013146A06CGCGTGGGCCCGGANONE
J013153F01CGCGTGGGCCCGGANONE
J013156O06CGCGTGGGCCCGGANONE
J013162D05CGCGTGGGCCCGGANONE
J023008N04CGCGTGGGCCCGGANONE
J023010D06CGCGTGGGCCCGGANONE
J023011I23CGCGTGGGCCCGGANONE
J023023I15CGCGTGGGCCCGGANONE
J023025C08CGCGTGGGCCCGGANONE
J023029H02CGCGTGGGCCCGGANONE
J023033C18CGCGTGGGCCCGGANONE
J023037D21CGCGTGGGCCCGGANONE
J023049F17CGCGTGGGCCCGGANONE
J023052B15CGCGTGGGCCCGGANONE
J023061D03CGCGTGGGCCCGGANONE
J023062M01CGCGTGGGCCCGGANONE
J023089D24CGCGTGGGCCCGGANONE
J023109J20CGCGTGGGCCCGGANONE
J023109M21CGCGTGGGCCCGGANONE
J023120N04CGCGTGGGCCCGGANONE
J023122A04CGCGTGGGCCCGGANONE
J023134F23CGCGTGGGCCCGGANONE
J023149E20CGCGTGGGCCCGGANONE
J033022A12CGCGTGGGCCCGGANONE
J033022C04CGCGTGGGCCCGGANONE
J033024K06CGCGTGGGCCCGGANONE
J033026F23CGCGTGGGCCCGGANONE
J033029J19CGCGTGGGCCCGGANONE
J033040H20CGCGTGGGCCCGGANONE
J033042P21CGCGTGGGCCCGGANONE
J033043F14CGCGTGGGCCCGGANONE
J033044G11CGCGTGGGCCCGGANONE
J033052L10CGCGTGGGCCCGGANONE
J033052O03CGCGTGGGCCCGGANONE
J033052P03CGCGTGGGCCCGGANONE
J033079B20CGCGTGGGCCCGGANONE
J033089D21CGCGTGGGCCCGGANONE
J033094P04CGCGTGGGCCCGGANONE
J033103N02CGCGTGGGCCCGGANONE
J033110J19CGCGTGGGCCCGGANONE
J033114E17CGCGTGGGCCCGGANONE
J033115K04CGCGTGGGCCCGGANONE
J033119I06CGCGTGGGCCCGGANONE
J033121L10CGCGTGGGCCCGGANONE
J033123H14CGCGTGGGCCCGGANONE
J033136H10CGCGTGGGCCCGGANONE
J033139L07CGCGTGGGCCCGGANONE
J033143G23CGCGTGGGCCCGGANONE
J043021F16CGCGTGGGCCCGGANONE
J080304G01CGCGTGGGCCCGGANONE
J080305H24CGCGTGGGCCCGGANONE
J080309B11CGCGTGGGCCCGGANONE
J080315N09CGCGTGGGCCCGGANONE
J080319J20CGCGTGGGCCCGGANONE
J090014D01CGCGTGGGCCCGGANONE
J090067F08CGCGTGGGCCCGGANONE
J090079P18CGCGTGGGCCCGGANONE
J090082K13CGCGTGGGCCCGGANONE
J090093K17CGCGTGGGCCCGGANONE
J090099G18CGCGTGGGCCCGGANONE
J100022K14CGCGTGGGCCCGGANONE
J100052G17CGCGTGGGCCCGGANONE
Os01g0134200AK059156CCCACGGGNONE
Os01g0144600006-037-H02ACCGGGCCCACANONE
006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE
006-037-H02TGTGGGCCCGCACGCCACNONE
AK061501ACCGGGCCCACAConserved hypothetical protein.
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein.
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein.
AK102823ACCGGGCCCACANONE
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE
AK102823TGTGGGCCCGCACGCCACNONE
J033108P10ACCGGGCCCACANONE
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE
J033108P10TGTGGGCCCGCACGCCACNONE
J043026K08ACCGGGCCCACANONE
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE
J043026K08TGTGGGCCCGCACGCCACNONE
J090009H21ACCGGGCCCACANONE
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE
J090009H21TGTGGGCCCGCACGCCACNONE
Os01g0146200J090080H03CGGGCCGTAConserved hypothetical protein.
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE
006-081-C11CCCGTGGGCCCCACACNONE
009-050-D04CCCGTGGGCCCCACACNONE
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein.
J023058M18CCCGTGGGCCCCACACNONE
J023112H22CCCGTGGGCCCCACACNONE
J065048P05CCCGTGGGCCCCACACNONE
J100068N20CCCGTGGGCCCCACACNONE
J100073A02CCCGTGGGCCCCACACNONE
Os01g0166800AK073783ATCTCGGCCCGGCConserved hypothetical protein.
AK099378ATCTCGGCCCGGCNONE
J033026H10ATCTCGGCCCGGCNONE
J033067O18ATCTCGGCCCGGCNONE
J033108A17ATCTCGGCCCGGCNONE
J065015J11ATCTCGGCCCGGCNONE
J065204P09ATCTCGGCCCGGCNONE
Os01g0175100AK071289GACGGCCCGKv1.4 voltage-gated K+ channel family protein.
AK071289GCCCACGGGKv1.4 voltage-gated K+ channel family protein.
J023088B10GACGGCCCGNONE
J023088B10GCCCACGGGNONE
J065122H15GACGGCCCGNONE
J065122H15GCCCACGGGNONE
J065140B19GACGGCCCGNONE
J065140B19GCCCACGGGNONE
J100031E12GACGGCCCGNONE
J100031E12GCCCACGGGNONE
J100068J03GACGGCCCGNONE
J100068J03GCCCACGGGNONE
J100083E12GACGGCCCGNONE
J100083E12GCCCACGGGNONE
Os01g0184500AK060699GGCCCGTTDEAD/DEAH box helicase, N-terminal domain containing protein.
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein.
AK102544CACTGACAGCCCGGGCCCACCNONE
J023047L21CACTGACAGCCCGGGCCCACCNONE
J023135I09CACTGACAGCCCGGGCCCACCNONE
J033028G17CACTGACAGCCCGGGCCCACCNONE
J065164L07CACTGACAGCCCGGGCCCACCNONE
J065193F22CACTGACAGCCCGGGCCCACCNONE
J075035I10CACTGACAGCCCGGGCCCACCNONE
J075168H15CACTGACAGCCCGGGCCCACCNONE
Os01g0185200009-146-B06CCCGTGGGCCCACCCNONE
009-146-B06GCGGGCCCACACNONE
009-163-F01CCCGTGGGCCCACCCNONE
009-163-F01GCGGGCCCACACNONE
AK062984CCCGTGGGCCCACCCNONE
AK062984GCGGGCCCACACNONE
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein.
AK065125GCGGGCCCACACGlutamyl-tRNA synthetase, class Ic family protein.
AK105222CCCGTGGGCCCACCCNONE
AK105222GCGGGCCCACACNONE
AK111284CCCGTGGGCCCACCCNONE
AK111284GCGGGCCCACACNONE
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein.
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein.
Os01g0219100J065130F20AACGGGCCNONE
J065208O10AACGGGCCSFT2-like family protein.
Os01g0224100011-010-A11CTGGGGCCCGNONE
011-034-B03CTGGGGCCCGNONE
011-067-G07CTGGGGCCCGNONE
015-017-C02CTGGGGCCCGNONE
015-090-E01CTGGGGCCCGNONE
AK101054CTGGGGCCCGNONE
AK106517CTGGGGCCCGSimilar to DNA binding protein-like protein.
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE
013-082-F05ATATGGGCCGGGCCGAGNONE
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B).
J065005L22ATATGGGCCGGGCCGAGNONE
J065023E21ATATGGGCCGGGCCGAGNONE
J065036H21ATATGGGCCGGGCCGAGNONE
J065037M24ATATGGGCCGGGCCGAGNONE
J065049L04ATATGGGCCGGGCCGAGNONE
J065072F17ATATGGGCCGGGCCGAGNONE
J065085H10ATATGGGCCGGGCCGAGNONE
J065109N19ATATGGGCCGGGCCGAGNONE
J065117M19ATATGGGCCGGGCCGAGNONE
J065144C15ATATGGGCCGGGCCGAGNONE
J065159G24ATATGGGCCGGGCCGAGNONE
J065164N14ATATGGGCCGGGCCGAGNONE
J075025K16ATATGGGCCGGGCCGAGNONE
J075057L05ATATGGGCCGGGCCGAGNONE
J075070I16ATATGGGCCGGGCCGAGNONE
J075089D10ATATGGGCCGGGCCGAGNONE
J075138F10ATATGGGCCGGGCCGAGNONE
J090018C11ATATGGGCCGGGCCGAGNONE
J100018L19ATATGGGCCGGGCCGAGNONE
J100024B14ATATGGGCCGGGCCGAGNONE
J100048L02ATATGGGCCGGGCCGAGNONE
J100055A22ATATGGGCCGGGCCGAGNONE
J100069K01ATATGGGCCGGGCCGAGNONE
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase.
AK122130ACCGGGCCCACAANONE
Os01g0244400J075054J20GCCCACGGGProtein of unknown function DUF1618 domain containing protein.
J075101O11GCCCACGGGNONE
J075123K08GCCCACGGGNONE
Os01g0246100AK120732CACGGCCCGTTProtein of unknown function DUF902, CREBbp domain containing protein.
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein.
Os01g0253500J100088F12CGGGCCCCACGTConserved hypothetical protein.
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3).
AY789530CGTGTGGGGCCCGGANONE
Os01g0271700J065184P16CGGGCCGAANONE
J065184P16CGGGCCGAAANONE
J075182E21CGGGCCGAANONE
J075182E21CGGGCCGAAANONE
J075191M19CGGGCCGAANONE
J075191M19CGGGCCGAAANONE
J090021E22CGGGCCGAANONE
J090021E22CGGGCCGAAANONE
Os01g0276500006-030-E04AACGGGCCNONE
AK061002AACGGGCCSimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)].
AK099335AACGGGCCNONE
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein.
J065013K07GCGGGCCCACTTGTCAGTGNONE
J065040E15GCGGGCCCACTTGTCAGTGNONE
J065127F12GCGGGCCCACTTGTCAGTGNONE
J075155K23GCGGGCCCACTTGTCAGTGNONE
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein.
Os01g0286600AB057749GCCCACGGGSimilar to Plastidal protoporphyrinogen oxidase.
Os01g0295900J065076G19GGCCCGTTNONE
Os01g0327400AK068063CCCACGGGSimilar to Peroxidase (Fragment).
AK099241CCCACGGGNONE
J013129I12CCCACGGGNONE
J033114B18CCCACGGGNONE
J065025P08CCCACGGGNONE
J100042P06CCCACGGGNONE
J100067A20CCCACGGGNONE
Os01g0327600AK120216CTCGGCCCGNONE
AK121799CTCGGCCCGConserved hypothetical protein.
J065081I07CTCGGCCCGNONE
J065082D04CTCGGCCCGNONE
J065082G10CTCGGCCCGNONE
J065085G24CTCGGCCCGNONE
J065105J24CTCGGCCCGNONE
J065128D18CTCGGCCCGNONE
J065155D13CTCGGCCCGNONE
J065200C11CTCGGCCCGNONE
Os01g0331100J090084H20GGGGCCCGCCCACTCCNONE
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein.
J023041L20GCGGGCCCATGGGCCATNONE
J043003M03GCGGGCCCATGGGCCATNONE
J075094C04GCGGGCCCATGGGCCATNONE
J090026M16GCGGGCCCATGGGCCATNONE
J100023F23GCGGGCCCATGGGCCATNONE
Y11189GCGGGCCCATGGGCCATNONE
Os01g0382450J065084M05CACGGCCCGHypothetical protein.
J065155G18CACGGCCCGNONE
Os01g0506200AK073118CCCGGGCCCCGCCCCACATetratricopeptide-like helical domain containing protein.
J065002A07CCCGGGCCCCGCCCCACANONE
J065079J08CCCGGGCCCCGCCCCACANONE
J065167M18CCCGGGCCCCGCCCCACANONE
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE
012-094-B11AACGGGCCCGGCCCATGNONE
015-096-C04AACGGGCCCGGCCCATGNONE
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein.
AK099005AACGGGCCCGGCCCATGNONE
J013109B04AACGGGCCCGGCCCATGNONE
J033057L14AACGGGCCCGGCCCATGNONE
J090072H04AACGGGCCCGGCCCATGNONE
J100030A14AACGGGCCCGGCCCATGNONE
Os01g0530366J075001P06AACGGGCCCAGTTNONE
J075001P06GCCGGCCCATATAACGGGCCNONE
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein.
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein.
J075030G13AACGGGCCCAGTTNONE
J075030G13GCCGGCCCATATAACGGGCCNONE
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1.
Os01g0564300AK064825CCCGTGGGPeptidylprolyl isomerase, FKBP-type domain containing protein.
Os01g0571300016-074-C10GCTTTCCCCCCGTGGGNONE
AK064271GCTTTCCCCCCGTGGGSimilar to Heat shock transcription factor 31 (Fragment).
Os01g0580300AK063468GCGGGCCCCACCTGTCConserved hypothetical protein.
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase.
AK069484CCCACGGGSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase.
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE
J023019D12CCCACGGGNONE
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE
J023036F15CCCACGGGNONE
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE
J023095O16CCCACGGGNONE
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE
J033102M15CCCACGGGNONE
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE
J043013I06CCCACGGGNONE
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE
J065083M21CCCACGGGNONE
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE
J065176A17CCCACGGGNONE
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE
AJ251563TGCGGGCCCCACTGACAGNONE
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel.
AK104055TGCGGGCCCCACTGACAGNONE
AK104419TGCGGGCCCCACTGACAGNONE
J023057A07TGCGGGCCCCACTGACAGNONE
J023068C08TGCGGGCCCCACTGACAGNONE
J023148E24TGCGGGCCCCACTGACAGNONE
J090045O22TGCGGGCCCCACTGACAGNONE
J090045P03TGCGGGCCCCACTGACAGNONE
J090050C18TGCGGGCCCCACTGACAGNONE
J100023F01TGCGGGCCCCACTGACAGNONE
J100051I18TGCGGGCCCCACTGACAGNONE
J100060P17TGCGGGCCCCACTGACAGNONE
Os01g0588700AK066951CTCGGCCCGGTProtein of unknown function DUF572 family protein.
AK071911CTCGGCCCGGTNONE
J013059D18CTCGGCCCGGTNONE
J013090C12CTCGGCCCGGTNONE
J090043F17CTCGGCCCGGTNONE
Os01g0596700AK107371AACGGGCCCCACGFBD domain containing protein.
Os01g0611000003-117-E07GGCCCGTTNONE
006-051-D01GGCCCGTTNONE
006-085-B10GGCCCGTTNONE
012-092-F03GGCCCGTTNONE
AK060682GGCCCGTTNONE
AK072500GGCCCGTTSimilar to Unidentified precursor.
AK105921GGCCCGTTNONE
J023001D07GGCCCGTTNONE
J023075J23GGCCCGTTNONE
J023127H12GGCCCGTTNONE
J033024H20GGCCCGTTNONE
J033025H03GGCCCGTTNONE
J065057F11GGCCCGTTNONE
J065096C07GGCCCGTTNONE
J065103A08GGCCCGTTNONE
J065137L11GGCCCGTTNONE
J065179I16GGCCCGTTNONE
J065197P22GGCCCGTTNONE
J075089M08GGCCCGTTNONE
J090008N14GGCCCGTTNONE
J090011K16GGCCCGTTNONE
J090075K24GGCCCGTTNONE
J090079E08GGCCCGTTNONE
Os01g0612600004-008-D07TGCGGGCCCCACTGACNONE
009-057-C09TGCGGGCCCCACTGACNONE
009-130-C01TGCGGGCCCCACTGACNONE
AK062906TGCGGGCCCCACTGACNONE
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein.
J013065E14TGCGGGCCCCACTGACNONE
J013073D14TGCGGGCCCCACTGACNONE
J023014A21TGCGGGCCCCACTGACNONE
J023073M13TGCGGGCCCCACTGACNONE
J023079F02TGCGGGCCCCACTGACNONE
J023083B16TGCGGGCCCCACTGACNONE
J023090G19TGCGGGCCCCACTGACNONE
J023095F15TGCGGGCCCCACTGACNONE
J023119H11TGCGGGCCCCACTGACNONE
J033040B01TGCGGGCCCCACTGACNONE
J033044F13TGCGGGCCCCACTGACNONE
J033081E23TGCGGGCCCCACTGACNONE
J033121K07TGCGGGCCCCACTGACNONE
J033124D11TGCGGGCCCCACTGACNONE
J033131N22TGCGGGCCCCACTGACNONE
J065179E10TGCGGGCCCCACTGACNONE
J090020A13TGCGGGCCCCACTGACNONE
J090045K17TGCGGGCCCCACTGACNONE
J090047M24TGCGGGCCCCACTGACNONE
J090064G23TGCGGGCCCCACTGACNONE
J090084G08TGCGGGCCCCACTGACNONE
J090086F18TGCGGGCCCCACTGACNONE
J100032D09TGCGGGCCCCACTGACNONE
J100037O18TGCGGGCCCCACTGACNONE
J100042B03TGCGGGCCCCACTGACNONE
J100061D06TGCGGGCCCCACTGACNONE
J100061I03TGCGGGCCCCACTGACNONE
J100063B17TGCGGGCCCCACTGACNONE
Os01g0623900J090025M21CCACGGCCCGNONE
J090082F22CCACGGCCCGNONE
J090084L02CCACGGCCCGSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein).
Os01g0636500012-066-G03GGGGCCCGTTNONE
AK073853GGGGCCCGTTSimilar to Polygalacturonase PG2.
AK104990GGGGCCCGTTNONE
J033072D05GGGGCCCGTTNONE
Os01g0640800AK065688TCTGGCCCGTTConserved hypothetical protein 48 family protein.
J013042L10TCTGGCCCGTTNONE
J013121H08TCTGGCCCGTTNONE
Os01g0642900009-109-F01TCGGCCCGNONE
AK063836TCGGCCCGSingle-strand binding protein/Primosomal replication protein n family protein.
AK073560TCGGCCCGNONE
J033043K18TCGGCCCGNONE
J100023C05TCGGCCCGNONE
J100038C15TCGGCCCGNONE
J100039C23TCGGCCCGNONE
Os01g0645000AK108658GCGGGCCCCACGSimilar to TIS11 protein (dTIS11).
Os01g0658500AK058491GCGGGCCCAACProtein of unknown function DUF852, eukaryotic family protein.
AK069050GCGGGCCCAACNONE
J043036P22GCGGGCCCAACNONE
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein.
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE
013-097-A02GCGTCGCGCGGGCCCCACCNONE
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE
014-011-C01GCGTCGCGCGGGCCCCACCNONE
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein.
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein.
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE
J065156F10GCGTCGCGCGGGCCCCACCNONE
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE
J065163D22GCGTCGCGCGGGCCCCACCNONE
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE
J065197J04GCGTCGCGCGGGCCCCACCNONE
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE
J075122C02GCGTCGCGCGGGCCCCACCNONE
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE
J100047L16GCGTCGCGCGGGCCCCACCNONE
Os01g0672400AK060901GGGGCCCGCNONE
AK061329GGGGCCCGCDrought induced 19 family protein.
AK101922GGGGCCCGCNONE
Os01g0672700AK121375TCTCGGCCCGDNA polymerase, beta-like region domain containing protein.
J023127C22TCTCGGCCCGNONE
J033092B05TCTCGGCCCGNONE
J033129P21TCTCGGCCCGNONE
J065079H18TCTCGGCCCGNONE
Os01g0684800AK073525GCCCACGGGProtein prenyltransferase domain containing protein.
Os01g0685900AK064024AACGGGCCNONE
AK102005AACGGGCCSimilar to 65kD microtubule associated protein.
Os01g0688200AK120982GCGGGCCCACAAlpha/beta hydrolase family protein.
Os01g0700500AK072715CGGGCCCATCCCytochrome P450 family protein.
AK119264CGGGCCCATCCNONE
Os01g0704700AK100296GGCCCGTTSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2.
Os01g0707300AK059962TGCGGGCCCACCTNONE
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13).
Os01g0714600006-072-F05CCCGTGGGNONE
AK059855CCCGTGGGConserved hypothetical protein.
Os01g0720700J033124M22TCCGGGCCCACGCNONE
J065006G21TCCGGGCCCACGCNONE
J065025M24TCCGGGCCCACGCNONE
J065041J02TCCGGGCCCACGCNONE
J065044B14TCCGGGCCCACGCNONE
J065061J06TCCGGGCCCACGCNONE
J065116L21TCCGGGCCCACGCNONE
J075030F18TCCGGGCCCACGCNONE
J075034K17TCCGGGCCCACGCNONE
J075063I02TCCGGGCCCACGCNONE
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase.
J075188L15TCCGGGCCCACGCNONE
J075197B17TCCGGGCCCACGCNONE
Os01g0723000AK073592TTGTGGGCCCGSimilar to Elongation factor EF-2 (Fragment).
AK102586TTGTGGGCCCGNONE
J033048F11TTGTGGGCCCGNONE
J033098E24TTGTGGGCCCGNONE
Os01g0725100J075035B02CTTGGGCCCGCANONE
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein.
AK065692TTTCGGCCCGConserved hypothetical protein.
Os01g0729900AK064793CGGGCCCAGGNONE
AK065503CGGGCCCAGGConserved hypothetical protein.
AK104681CGGGCCCAGGNONE
AK120504CGGGCCCAGGNONE
Os01g0730300AK101207GGTGGGGCGGGCCCCHAD-superfamily hydrolase subfamily IIB protein.
AK109542GGTGGGGCGGGCCCCNONE
Os01g0752300AK121755GGCCCGTTSimilar to 60S ribosomal protein L18a-1.
J013049F10GGCCCGTTNONE
J013088L10GGCCCGTTNONE
J023020B21GGCCCGTTNONE
J023038M01GGCCCGTTNONE
J033058H15GGCCCGTTNONE
J033088C04GGCCCGTTNONE
J033115N19GGCCCGTTNONE
J033131H04GGCCCGTTNONE
J065067E05GGCCCGTTNONE
J065085C07GGCCCGTTNONE
J065095D12GGCCCGTTNONE
J065124B19GGCCCGTTNONE
J065181H07GGCCCGTTNONE
J065197B09GGCCCGTTNONE
J075090K22GGCCCGTTNONE
J075101P17GGCCCGTTNONE
J075181F13GGCCCGTTNONE
J075190H19GGCCCGTTNONE
J090004P17GGCCCGTTNONE
J090066I03GGCCCGTTNONE
Os01g0753800AK121555TCGGCCCGGCConserved hypothetical protein.
J013075H19TCGGCCCGGCNONE
J013130F24TCGGCCCGGCNONE
J033033I01TCGGCCCGGCNONE
Os01g0754000014-081-F07CGGGCCGTGGNONE
AK063730CGGGCCGTGGConserved hypothetical protein.
J065219A11CGGGCCGTGGNONE
J075136N13CGGGCCGTGGNONE
J100051G01CGGGCCGTGGNONE
J100053M22CGGGCCGTGGNONE
Os01g0757400AB110177GCGGGCCCCACCAACNONE
AK058626GCGGGCCCCACCAACNONE
AK102585GCGGGCCCCACCAACNONE
AK105474GCGGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
J033098E22GCGGGCCCCACCAACNONE
J033105O19GCGGGCCCCACCAACNONE
J065019C21GCGGGCCCCACCAACNONE
J090082H11GCGGGCCCCACCAACNONE
J100050B19GCGGGCCCCACCAACNONE
J100078H19GCGGGCCCCACCAACNONE
Os01g0764600AK060621CGGATCGGGCCGAGFosfomycin resistance kinase FomA family protein.
J013111L18CGGATCGGGCCGAGNONE
J013134N08CGGATCGGGCCGAGNONE
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein.
AK102809GGGGCCCGGGSimilar to Nt-gh3 deduced protein.
Os01g0767600AK070672CCCGGGCCCCConserved hypothetical protein.
AK070672GGGGCCCACGGGConserved hypothetical protein.
J013131M12CCCGGGCCCCNONE
J013131M12GGGGCCCACGGGNONE
J023027B15CCCGGGCCCCNONE
J023027B15GGGGCCCACGGGNONE
J023059I06CCCGGGCCCCNONE
J023059I06GGGGCCCACGGGNONE
J023095L05CCCGGGCCCCNONE
J023095L05GGGGCCCACGGGNONE
J033033E20CCCGGGCCCCNONE
J033033E20GGGGCCCACGGGNONE
J033105F24CCCGGGCCCCNONE
J033105F24GGGGCCCACGGGNONE
J033148N05CCCGGGCCCCNONE
J033148N05GGGGCCCACGGGNONE
J065060H14CCCGGGCCCCNONE
J065060H14GGGGCCCACGGGNONE
J090093E17CCCGGGCCCCNONE
J090093E17GGGGCCCACGGGNONE
Os01g0770500AK071653ACCGGGCCCCNONE
AK099603ACCGGGCCCCSimilar to ABC transporter ATP-binding protein.
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein.
Os01g0798500006-106-C11CTGGGGCCCGCANONE
AK061244CTGGGGCCCGCANONE
AK068219CTGGGGCCCGCAMalate synthase-like family protein.
J065199O16CTGGGGCCCGCANONE
Os01g0801000AK064082CACGGCCCGGCCNONE
AK101426CACGGCCCGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18).
Os01g0807000AK109751TGTTGGGCCCGConserved hypothetical protein.
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein.
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE
Os01g0818600AK066550TGTGGGCCCGGTLeucine rich repeat, N-terminal domain containing protein.
Os01g0821800015-005-A04CCCGTGGGCTNONE
AK073951CCCGTGGGCTNONE
AK103171CCCGTGGGCTNONE
AK119168CCCGTGGGCTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein.
J023031A22CCCGTGGGCTNONE
J033098N09CCCGTGGGCTNONE
J033121G11CCCGTGGGCTNONE
J090030L03CCCGTGGGCTNONE
Os01g0835500AK100241GCGGGCCCACTSimilar to Respiratory burst oxidase protein.
Os01g0836400AK073540TCAGGCCCGTTSAC3/GANP family protein.
J023019D11TCAGGCCCGTTNONE
J023139O22TCAGGCCCGTTNONE
J033042J20TCAGGCCCGTTNONE
J033046M18TCAGGCCCGTTNONE
J033124J09TCAGGCCCGTTNONE
J090015E05TCAGGCCCGTTNONE
J090076J09TCAGGCCCGTTNONE
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein.
J065005C19CGGGTGGGCCCGGCNONE
J065025H20CGGGTGGGCCCGGCNONE
J065061E22CGGGTGGGCCCGGCNONE
J065065F14CGGGTGGGCCCGGCNONE
J065083O21CGGGTGGGCCCGGCNONE
J065201G05CGGGTGGGCCCGGCNONE
Os01g0848900AK065438CCCGTGGGConserved hypothetical protein.
J013025A05CCCGTGGGNONE
J053026J20CCCGTGGGNONE
J053027B19CCCGTGGGNONE
J053033A12CCCGTGGGNONE
J053039K16CCCGTGGGNONE
J053039K17CCCGTGGGNONE
J053051N18CCCGTGGGNONE
J053053B06CCCGTGGGNONE
J053060A12CCCGTGGGNONE
J053074L18CCCGTGGGNONE
J053083E22CCCGTGGGNONE
J053086P22CCCGTGGGNONE
J053095G12CCCGTGGGNONE
J100018E11CCCGTGGGNONE
Os01g0852500015-058-H06TGTGGGGCCCGNONE
AK069637TGTGGGGCCCGELM2 domain containing protein.
AK100453TGTGGGGCCCGNONE
Os01g0853600AK107747AACGGGCCGTANONE
AK108628AACGGGCCGTANONE
AK120975AACGGGCCGTAConserved hypothetical protein.
J023041K02AACGGGCCGTANONE
Os01g0853800006-033-H02CTCGGCCCGNONE
006-037-A10CTCGGCCCGNONE
006-038-F10CTCGGCCCGNONE
006-054-E01CTCGGCCCGNONE
006-067-E10CTCGGCCCGNONE
012-015-G05CTCGGCCCGNONE
AK069147CTCGGCCCGC2 calcium/lipid-binding region, CaLB domain containing protein.
AK105929CTCGGCCCGNONE
AK106144CTCGGCCCGNONE
AK106186CTCGGCCCGNONE
J023007P09CTCGGCCCGNONE
J023007P10CTCGGCCCGNONE
J065084L10CTCGGCCCGNONE
J065179B10CTCGGCCCGNONE
J065186D16CTCGGCCCGNONE
J075040I08CTCGGCCCGNONE
J075043K21CTCGGCCCGNONE
J075051J08CTCGGCCCGNONE
J075061D24CTCGGCCCGNONE
J075095H04CTCGGCCCGNONE
J075145J12CTCGGCCCGNONE
J075148O18CTCGGCCCGNONE
J075187J05CTCGGCCCGNONE
J090042A20CTCGGCCCGNONE
J100025K01CTCGGCCCGNONE
Os01g0856500AK103981TGGATGGGCTACTGGGCCCGNONE
Os01g0856900AK107570CGGACGGCCCGGTGlycoside hydrolase, starch-binding domain containing protein.
J065081B03CGGACGGCCCGGTNONE
J075028J03CGGACGGCCCGGTNONE
J075052C05CGGACGGCCCGGTNONE
J075199J04CGGACGGCCCGGTNONE
J090052L20CGGACGGCCCGGTNONE
J090075L24CGGACGGCCCGGTNONE
Os01g0863166J065007F23AACGGGCCGTGNONE
J065007F23AACGGGCCGTGNONE
J065007F23CACGGCCCGGCCNONE
J065007F23CACGGCCCGTTNONE
J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065124H21AACGGGCCGTGConserved hypothetical protein.
J065124H21AACGGGCCGTGConserved hypothetical protein.
J065124H21CACGGCCCGGCCConserved hypothetical protein.
J065124H21CACGGCCCGTTConserved hypothetical protein.
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein.
Os01g0863300014-030-D08CCCCCACGGGNONE
AK111571CCCCCACGGGSimilar to MCB2 protein.
J013071A13CCCCCACGGGNONE
J075060E09CCCCCACGGGNONE
J075138C14CCCCCACGGGNONE
J075150M17CCCCCACGGGNONE
Os01g0865100016-066-A05TCCGGGCCCCACCNONE
AK065779TCCGGGCCCCACCNONE
AK071410TCCGGGCCCCACCSimilar to Uricase (Fragment).
J013039E23TCCGGGCCCCACCNONE
J023024I07TCCGGGCCCCACCNONE
J065160J15TCCGGGCCCCACCNONE
J090052J17TCCGGGCCCCACCNONE
Os01g0866300006-029-F08GGCCGGGCCCACTNONE
006-074-E10GGCCGGGCCCACTNONE
006-079-E11GGCCGGGCCCACTNONE
009-048-A05GGCCGGGCCCACTNONE
AK059875GGCCGGGCCCACTNONE
J043005O17GGCCGGGCCCACTNONE
Os01g0866500AK111757CGGGCCGTGGSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase).
J023060L20CGGGCCGTGGNONE
J023143G12CGGGCCGTGGNONE
Os01g0870100AK067564GTGGCCCACGGGProtein of unknown function DUF1012 family protein.
AK072312GTGGCCCACGGGNONE
AK103428CTCGGCCCGCACGCCTCNONE
AK103428GTGGCCCACGGGNONE
Os01g0877500AK101067CTCGGCCCGProtein of unknown function UPF0054 family protein.
AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein.
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE
AF047428CGTGGACCGGGCCCATGNONE
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein.
J023082D05CGTGGACCGGGCCCATGNONE
J065062L19CGTGGACCGGGCCCATGNONE
J065116H15CGTGGACCGGGCCCATGNONE
J065194N09CGTGGACCGGGCCCATGNONE
J100074C19CGTGGACCGGGCCCATGNONE
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein.
Os01g0908400009-140-E01TCTCGGCCCGNONE
AK062957TCTCGGCCCGConserved hypothetical protein.
AK099301TCTCGGCCCGNONE
J065123M13TCTCGGCCCGNONE
J075020O14TCTCGGCCCGNONE
J075136L21TCTCGGCCCGNONE
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1.
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein.
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2).
J090051E20TTTTGGGCCGGGCCCAAACNONE
J090056H03TTTTGGGCCGGGCCCAAACNONE
J090058L14TTTTGGGCCGGGCCCAAACNONE
J090058P16TTTTGGGCCGGGCCCAAACNONE
J090076C19TTTTGGGCCGGGCCCAAACNONE
J100086P14TTTTGGGCCGGGCCCAAACNONE
Os01g0918200009-034-H02GCGGGCCCACTNONE
AK062434GCGGGCCCACTSimilar to Ubiquitin-like protein SMT3.
AK103092GCGGGCCCACTNONE
J065093P18GCGGGCCCACTNONE
J065137C15GCGGGCCCACTNONE
J065156G01GCGGGCCCACTNONE
J065206H16GCGGGCCCACTNONE
J065209D03GCGGGCCCACTNONE
J075073K05GCGGGCCCACTNONE
J075099B17GCGGGCCCACTNONE
J075166N04GCGGGCCCACTNONE
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit).
J013039J22CCCGGGCCCACGTGTCNONE
J013109E03CCCGGGCCCACGTGTCNONE
J023081J12CCCGGGCCCACGTGTCNONE
J023091E24CCCGGGCCCACGTGTCNONE
J033022A01CCCGGGCCCACGTGTCNONE
J033074C13CCCGGGCCCACGTGTCNONE
J065199E03CCCGGGCCCACGTGTCNONE
J075172O04CCCGGGCCCACGTGTCNONE
J090007G18CCCGGGCCCACGTGTCNONE
J090052B17CCCGGGCCCACGTGTCNONE
J090074H01CCCGGGCCCACGTGTCNONE
J100043J09CCCGGGCCCACGTGTCNONE
J100059J05CCCGGGCCCACGTGTCNONE
Os01g0924000004-020-C09CGGGCCCACAANONE
005-014-A06CGGGCCCACAANONE
009-085-G12CGGGCCCACAANONE
009-123-A08CGGGCCCACAANONE
009-134-A05CGGGCCCACAANONE
009-137-F06CGGGCCCACAANONE
016-016-B08CGGGCCCACAANONE
AF050674CGGGCCCACAANONE
AK061690CGGGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment).
AK120797CGGGCCCACAANONE
J013040A15CGGGCCCACAANONE
J013104L20CGGGCCCACAANONE
J013127E12CGGGCCCACAANONE
J013158O05CGGGCCCACAANONE
J023012E09CGGGCCCACAANONE
J023126L23CGGGCCCACAANONE
J023143B03CGGGCCCACAANONE
J065005B16CGGGCCCACAANONE
J065101J15CGGGCCCACAANONE
J065105K16CGGGCCCACAANONE
J065155K16CGGGCCCACAANONE
J065171M17CGGGCCCACAANONE
J065182F07CGGGCCCACAANONE
J065187D10CGGGCCCACAANONE
J065194I24CGGGCCCACAANONE
J065207E24CGGGCCCACAANONE
J075001C24CGGGCCCACAANONE
J075090O10CGGGCCCACAANONE
J075095H17CGGGCCCACAANONE
J075109M24CGGGCCCACAANONE
J075123C18CGGGCCCACAANONE
J075148G22CGGGCCCACAANONE
J090009B09CGGGCCCACAANONE
J090075K17CGGGCCCACAANONE
J090081H23CGGGCCCACAANONE
J090097H21CGGGCCCACAANONE
J100063P14CGGGCCCACAANONE
Os01g0931300012-055-E05AGTGGGCCCGNONE
AK068196AGTGGGCCCGTafazzin family protein.
AK099213AGTGGGCCCGNONE
Os01g0952600AK067525ACCGGGCCCACCCNONE
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment).
Os01g0953100AK064981CGGGCCCATCTNONE
AK068882CGGGCCCATCTProtein of unknown function DUF594 family protein.
J013001C07CGGGCCCATCTNONE
J013169K14CGGGCCCATCTNONE
J033114G07CGGGCCCATCTNONE
J065035K15CGGGCCCATCTNONE
J065082E12CGGGCCCATCTNONE
Os01g0954400003-009-F12CGGGCCGTCNONE
012-080-B09CGGGCCGTCNONE
AK065709CGGGCCGTCSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor.
AK104335CGGGCCGTCNONE
J013039J02CGGGCCGTCNONE
J033081E17CGGGCCGTCNONE
J075058B02CGGGCCGTCNONE
J075067K19CGGGCCGTCNONE
J075120E23CGGGCCGTCNONE
J075147I16CGGGCCGTCNONE
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein.
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein.
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE
Os02g0104800AK070860AACGGGCCConserved hypothetical protein.
J023002G20AACGGGCCNONE
J023022J19AACGGGCCNONE
J023067K03AACGGGCCNONE
J023108G24AACGGGCCNONE
J033075B01AACGGGCCNONE
J033087I15AACGGGCCNONE
J065087I11AACGGGCCNONE
J065194E02AACGGGCCNONE
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase.
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC 1.11.1.6) (CAT-A).
AK099231CCCGGGCCCACCANONE
AK099923CCCGGGCCCACCANONE
X61626CCCGGGCCCACCANONE
Os02g0115900AF006825ATCTCGGCCCGTTNONE
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein.
AK119653ATCTCGGCCCGTTNONE
Os02g0118400012-047-C10CGGGCCCCNONE
AK064002CGGGCCCCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75).
AK101004CGGGCCCCNONE
J065022L23CGGGCCCCNONE
J065087F24CGGGCCCCNONE
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52).
J033107H09GTTTGGGCCCGGCCCACCTNONE
J075175F09GTTTGGGCCCGGCCCACCTNONE
J090011H05GTTTGGGCCCGGCCCACCTNONE
J090091O05GTTTGGGCCCGGCCCACCTNONE
Os02g0121100012-035-F06CGGGCCCACGCGTNONE
013-031-H05CGGGCCCACGCGTNONE
013-058-E11CGGGCCCACGCGTNONE
014-010-D01CGGGCCCACGCGTNONE
AK070711CGGGCCCACGCGTConserved hypothetical protein.
AK119758CGGGCCCACGCGTNONE
J013033G12CGGGCCCACGCGTNONE
J023007M16CGGGCCCACGCGTNONE
J023020K20CGGGCCCACGCGTNONE
J023061H10CGGGCCCACGCGTNONE
J033027H20CGGGCCCACGCGTNONE
J033051E18CGGGCCCACGCGTNONE
J090005F12CGGGCCCACGCGTNONE
J090017A20CGGGCCCACGCGTNONE
J090018G11CGGGCCCACGCGTNONE
J090062C18CGGGCCCACGCGTNONE
J100027N10CGGGCCCACGCGTNONE
J100032L14CGGGCCCACGCGTNONE
J100045C14CGGGCCCACGCGTNONE
J100061M09CGGGCCCACGCGTNONE
J100062K11CGGGCCCACGCGTNONE
J100064H11CGGGCCCACGCGTNONE
J100074H16CGGGCCCACGCGTNONE
J100082N01CGGGCCCACGCGTNONE
Os02g0122000AK121653AACGGGCCSimilar to P18.
J023034M04AACGGGCCNONE
J033023M01AACGGGCCNONE
J033061I03AACGGGCCNONE
J033075B04AACGGGCCNONE
J065035D09AACGGGCCNONE
J065103D15AACGGGCCNONE
J065146O07AACGGGCCNONE
J065193L20AACGGGCCNONE
J090015G02AACGGGCCNONE
J090059G13AACGGGCCNONE
J090068F14AACGGGCCNONE
J090087H22AACGGGCCNONE
J100017D08AACGGGCCNONE
J100029H10AACGGGCCNONE
J100029I17AACGGGCCNONE
J100059H12AACGGGCCNONE
J100060H07AACGGGCCNONE
Os02g0123200016-017-F04AAACGGCCCGGTNONE
J033057C03AAACGGCCCGGTNONE
J033087C11AAACGGCCCGGTNONE
J033108J20AAACGGCCCGGTNONE
J043015P08AAACGGCCCGGTNONE
Os02g0137800AK060530ACCGGGCCCCACCCCCCAConserved hypothetical protein.
AK101629ACCGGGCCCCACCCCCCANONE
J065195A10ACCGGGCCCCACCCCCCANONE
Os02g0149700AK103492CGGGCCGAGExo70 exocyst complex subunit family protein.
Os02g0163600AK068043AACGGGCCCGCConserved hypothetical protein.
J013131O20AACGGGCCCGCNONE
J065006E03AACGGGCCCGCNONE
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein.
Os02g0180100005-013-B11TCATGGGCCCGNONE
AK067359TCATGGGCCCGPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein.
AK104700TCATGGGCCCGNONE
J013090O22TCATGGGCCCGNONE
J013099P19TCATGGGCCCGNONE
J090041M21TCATGGGCCCGNONE
J090049C14TCATGGGCCCGNONE
Os02g0180700AK070746GGCCCGTTSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44).
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein.
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein.
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein.
J075117E23CACGGCCCGGCCCAAATTGGGCNONE
J075117F23CACGGCCCGGCCCAAATTGGGCNONE
J075144M12CACGGCCCGGCCCAAATTGGGCNONE
J075145H10CACGGCCCGGCCCAAATTGGGCNONE
J075186B15CACGGCCCGGCCCAAATTGGGCNONE
Os02g0192700004-020-H12CCCGTGGGCCGGCNONE
006-024-H06CCCGTGGGCCGGCNONE
006-042-F06CCCGTGGGCCGGCNONE
006-050-D04CCCGTGGGCCGGCNONE
006-059-E10CCCGTGGGCCGGCNONE
006-070-B02CCCGTGGGCCGGCNONE
006-084-A09CCCGTGGGCCGGCNONE
006-114-E11CCCGTGGGCCGGCNONE
006-117-E05CCCGTGGGCCGGCNONE
009-126-D11CCCGTGGGCCGGCNONE
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase.
AK065909CCCGTGGGCCGGCNONE
J013043E11CCCGTGGGCCGGCNONE
J065038I09CCCGTGGGCCGGCNONE
J065078C12CCCGTGGGCCGGCNONE
J065122O14CCCGTGGGCCGGCNONE
J065198H04CCCGTGGGCCGGCNONE
Os02g0193500009-092-G09CTCGGCCCGGCCCNONE
AK101237CTCGGCCCGGCCCHypothetical protein.
J033031K13CTCGGCCCGGCCCNONE
J033034P12CTCGGCCCGGCCCNONE
J080304L19CTCGGCCCGGCCCNONE
J100059N21CTCGGCCCGGCCCNONE
Os02g0197600003-113-H08CCCGGGCCCACCCNONE
003-129-H06CCCGGGCCCACCCNONE
006-021-H09CCCGGGCCCACCCNONE
006-022-B05CCCGGGCCCACCCNONE
006-022-G12CCCGGGCCCACCCNONE
006-023-A02CCCGGGCCCACCCNONE
006-023-C02CCCGGGCCCACCCNONE
006-023-G09CCCGGGCCCACCCNONE
006-024-D12CCCGGGCCCACCCNONE
006-025-C09CCCGGGCCCACCCNONE
006-025-E01CCCGGGCCCACCCNONE
006-026-A11CCCGGGCCCACCCNONE
006-026-A12CCCGGGCCCACCCNONE
006-028-E11CCCGGGCCCACCCNONE
006-028-G03CCCGGGCCCACCCNONE
006-029-A09CCCGGGCCCACCCNONE
006-029-A12CCCGGGCCCACCCNONE
006-029-D01CCCGGGCCCACCCNONE
006-029-F12CCCGGGCCCACCCNONE
006-029-G12CCCGGGCCCACCCNONE
006-030-A08CCCGGGCCCACCCNONE
006-030-C09CCCGGGCCCACCCNONE
006-030-G06CCCGGGCCCACCCNONE
006-031-D06CCCGGGCCCACCCNONE
006-032-C01CCCGGGCCCACCCNONE
006-034-B07CCCGGGCCCACCCNONE
006-035-G01CCCGGGCCCACCCNONE
006-036-H12CCCGGGCCCACCCNONE
006-040-C01CCCGGGCCCACCCNONE
006-041-G12CCCGGGCCCACCCNONE
006-041-H02CCCGGGCCCACCCNONE
006-041-H11CCCGGGCCCACCCNONE
006-042-B01CCCGGGCCCACCCNONE
006-042-F10CCCGGGCCCACCCNONE
006-043-C04CCCGGGCCCACCCNONE
006-044-D10CCCGGGCCCACCCNONE
006-048-D11CCCGGGCCCACCCNONE
006-049-D07CCCGGGCCCACCCNONE
006-050-H05CCCGGGCCCACCCNONE
006-051-D10CCCGGGCCCACCCNONE
006-051-E05CCCGGGCCCACCCNONE
006-053-C07CCCGGGCCCACCCNONE
006-054-B10CCCGGGCCCACCCNONE
006-054-C12CCCGGGCCCACCCNONE
006-054-G08CCCGGGCCCACCCNONE
006-055-D12CCCGGGCCCACCCNONE
006-056-C04CCCGGGCCCACCCNONE
006-056-H06CCCGGGCCCACCCNONE
006-057-E07CCCGGGCCCACCCNONE
006-058-C12CCCGGGCCCACCCNONE
006-059-B06CCCGGGCCCACCCNONE
006-059-B09CCCGGGCCCACCCNONE
006-059-D05CCCGGGCCCACCCNONE
006-060-D07CCCGGGCCCACCCNONE
006-061-D01CCCGGGCCCACCCNONE
006-061-G09CCCGGGCCCACCCNONE
006-062-A12CCCGGGCCCACCCNONE
006-062-D04CCCGGGCCCACCCNONE
006-062-G01CCCGGGCCCACCCNONE
006-063-C10CCCGGGCCCACCCNONE
006-064-A10CCCGGGCCCACCCNONE
006-067-E04CCCGGGCCCACCCNONE
006-067-H11CCCGGGCCCACCCNONE
006-069-G08CCCGGGCCCACCCNONE
006-071-G06CCCGGGCCCACCCNONE
006-073-E06CCCGGGCCCACCCNONE
006-074-B12CCCGGGCCCACCCNONE
006-074-F06CCCGGGCCCACCCNONE
006-074-H01CCCGGGCCCACCCNONE
006-076-D12CCCGGGCCCACCCNONE
006-077-C08CCCGGGCCCACCCNONE
006-083-H01CCCGGGCCCACCCNONE
006-083-H09CCCGGGCCCACCCNONE
006-084-C02CCCGGGCCCACCCNONE
006-086-D05CCCGGGCCCACCCNONE
006-086-E09CCCGGGCCCACCCNONE
006-087-D04CCCGGGCCCACCCNONE
006-087-E12CCCGGGCCCACCCNONE
006-088-A01CCCGGGCCCACCCNONE
006-088-H09CCCGGGCCCACCCNONE
006-089-G01CCCGGGCCCACCCNONE
006-090-G01CCCGGGCCCACCCNONE
006-092-H10CCCGGGCCCACCCNONE
006-096-G12CCCGGGCCCACCCNONE
006-097-C04CCCGGGCCCACCCNONE
006-098-B06CCCGGGCCCACCCNONE
006-099-A02CCCGGGCCCACCCNONE
006-099-B05CCCGGGCCCACCCNONE
006-100-F02CCCGGGCCCACCCNONE
006-100-F07CCCGGGCCCACCCNONE
006-104-A01CCCGGGCCCACCCNONE
006-107-F06CCCGGGCCCACCCNONE
006-109-A05CCCGGGCCCACCCNONE
006-110-G03CCCGGGCCCACCCNONE
006-111-A06CCCGGGCCCACCCNONE
006-111-C12CCCGGGCCCACCCNONE
006-112-B03CCCGGGCCCACCCNONE
006-113-A02CCCGGGCCCACCCNONE
006-113-H06CCCGGGCCCACCCNONE
006-115-D11CCCGGGCCCACCCNONE
006-116-F11CCCGGGCCCACCCNONE
006-117-A10CCCGGGCCCACCCNONE
006-117-C01CCCGGGCCCACCCNONE
006-117-D08CCCGGGCCCACCCNONE
006-118-B12CCCGGGCCCACCCNONE
006-118-D08CCCGGGCCCACCCNONE
006-118-E11CCCGGGCCCACCCNONE
006-118-H08CCCGGGCCCACCCNONE
006-119-C10CCCGGGCCCACCCNONE
006-120-H11CCCGGGCCCACCCNONE
009-025-G09CCCGGGCCCACCCNONE
009-061-H06CCCGGGCCCACCCNONE
009-070-E02CCCGGGCCCACCCNONE
009-077-A07CCCGGGCCCACCCNONE
009-114-A07CCCGGGCCCACCCNONE
009-115-G02CCCGGGCCCACCCNONE
009-123-C06CCCGGGCCCACCCNONE
009-125-H03CCCGGGCCCACCCNONE
009-127-H11CCCGGGCCCACCCNONE
009-136-G03CCCGGGCCCACCCNONE
009-154-B05CCCGGGCCCACCCNONE
009-162-B02CCCGGGCCCACCCNONE
009-176-D09CCCGGGCCCACCCNONE
009-178-F10CCCGGGCCCACCCNONE
009-190-F05CCCGGGCCCACCCNONE
009-200-C08CCCGGGCCCACCCNONE
011-064-H10CCCGGGCCCACCCNONE
AK060143CCCGGGCCCACCCNONE
AK060970CCCGGGCCCACCCNONE
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein.
AK104096CCCGGGCCCACCCNONE
AK104215CCCGGGCCCACCCNONE
AK104348CCCGGGCCCACCCNONE
AK104385CCCGGGCCCACCCNONE
AK104392CCCGGGCCCACCCNONE
AK104446CCCGGGCCCACCCNONE
AK104458CCCGGGCCCACCCNONE
AK104469CCCGGGCCCACCCNONE
AK104522CCCGGGCCCACCCNONE
AK104535CCCGGGCCCACCCNONE
AK104557CCCGGGCCCACCCNONE
AK104636CCCGGGCCCACCCNONE
AK104646CCCGGGCCCACCCNONE
AK104734CCCGGGCCCACCCNONE
AK106085CCCGGGCCCACCCNONE
AK109398CCCGGGCCCACCCNONE
AK119554CCCGGGCCCACCCNONE
J013044I21CCCGGGCCCACCCNONE
J013090N21CCCGGGCCCACCCNONE
J013130I24CCCGGGCCCACCCNONE
J023038D09CCCGGGCCCACCCNONE
J023064C23CCCGGGCCCACCCNONE
J023088A09CCCGGGCCCACCCNONE
J023105K12CCCGGGCCCACCCNONE
J065022M15CCCGGGCCCACCCNONE
J075062L23CCCGGGCCCACCCNONE
J075069B05CCCGGGCCCACCCNONE
J075072D15CCCGGGCCCACCCNONE
J075090E24CCCGGGCCCACCCNONE
J075126D14CCCGGGCCCACCCNONE
J075154L21CCCGGGCCCACCCNONE
J075165F23CCCGGGCCCACCCNONE
J075166D04CCCGGGCCCACCCNONE
J080003O05CCCGGGCCCACCCNONE
J080005L07CCCGGGCCCACCCNONE
J080008K15CCCGGGCCCACCCNONE
J080009A07CCCGGGCCCACCCNONE
J080009F05CCCGGGCCCACCCNONE
J080010M06CCCGGGCCCACCCNONE
J080011E06CCCGGGCCCACCCNONE
J080011H20CCCGGGCCCACCCNONE
J080018I05CCCGGGCCCACCCNONE
J080021N17CCCGGGCCCACCCNONE
J080036E20CCCGGGCCCACCCNONE
J080040E22CCCGGGCCCACCCNONE
J080044D19CCCGGGCCCACCCNONE
J080045C21CCCGGGCCCACCCNONE
J080047B08CCCGGGCCCACCCNONE
J080048E24CCCGGGCCCACCCNONE
J080053D19CCCGGGCCCACCCNONE
J080053N09CCCGGGCCCACCCNONE
J080054A19CCCGGGCCCACCCNONE
J080061O16CCCGGGCCCACCCNONE
J080064P15CCCGGGCCCACCCNONE
J080065M06CCCGGGCCCACCCNONE
J080067G11CCCGGGCCCACCCNONE
J080072M09CCCGGGCCCACCCNONE
J080079I15CCCGGGCCCACCCNONE
J080082I12CCCGGGCCCACCCNONE
J080083K21CCCGGGCCCACCCNONE
J080096H12CCCGGGCCCACCCNONE
J080096J10CCCGGGCCCACCCNONE
J080097O13CCCGGGCCCACCCNONE
J080305P05CCCGGGCCCACCCNONE
J080311C21CCCGGGCCCACCCNONE
J080317C16CCCGGGCCCACCCNONE
Os02g0198200J075078L15CGTGGGGCCCGCANONE
J075097G10CGTGGGGCCCGCANONE
J075099N12CGTGGGGCCCGCANONE
J075142K24CGTGGGGCCCGCANONE
J075199K14CGTGGGGCCCGCANONE
Os02g0220600AK061944CAAGGCCCGTTElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma).
AK103901GGCCCGTTACAGCCCAACANONE
AK104946CAAGGCCCGTTNONE
D89802CAAGGCCCGTTNONE
J013042L22CAAGGCCCGTTNONE
J013056A14CAAGGCCCGTTNONE
J013058O03GGCCCGTTACAGCCCAACANONE
J013120G13CAAGGCCCGTTNONE
J013124E21GGCCCGTTACAGCCCAACANONE
J013155K19CAAGGCCCGTTNONE
J023002B10CAAGGCCCGTTNONE
J023023L03GGCCCGTTACAGCCCAACANONE
J023023L21GGCCCGTTACAGCCCAACANONE
J023061N01GGCCCGTTACAGCCCAACANONE
J023065O09GGCCCGTTACAGCCCAACANONE
J023080J19CAAGGCCCGTTNONE
J023081C08CAAGGCCCGTTNONE
J023090H05CAAGGCCCGTTNONE
J023091M07CAAGGCCCGTTNONE
J023106J17GGCCCGTTACAGCCCAACANONE
J023115F09CAAGGCCCGTTNONE
J023119N08GGCCCGTTACAGCCCAACANONE
J033025I23CAAGGCCCGTTNONE
J033026G12CAAGGCCCGTTNONE
J033035E15CAAGGCCCGTTNONE
J033040N13CAAGGCCCGTTNONE
J033046C17CAAGGCCCGTTNONE
J033058A19GGCCCGTTACAGCCCAACANONE
J033069F02CAAGGCCCGTTNONE
J033071B16CAAGGCCCGTTNONE
J033071N22CAAGGCCCGTTNONE
J033088J02CAAGGCCCGTTNONE
J033092N24CAAGGCCCGTTNONE
J033093I09CAAGGCCCGTTNONE
J033098O13GGCCCGTTACAGCCCAACANONE
J033100M18GGCCCGTTACAGCCCAACANONE
J033125A21GGCCCGTTACAGCCCAACANONE
J033126G06CAAGGCCCGTTNONE
J033148C12GGCCCGTTACAGCCCAACANONE
J043003G15CAAGGCCCGTTNONE
J043010M11CAAGGCCCGTTNONE
J043017F03GGCCCGTTACAGCCCAACANONE
J043024O20CAAGGCCCGTTNONE
J043032J02GGCCCGTTACAGCCCAACANONE
J053047N10GGCCCGTTACAGCCCAACANONE
J053089P04GGCCCGTTACAGCCCAACANONE
J065051K09GGCCCGTTACAGCCCAACANONE
J065064H24GGCCCGTTACAGCCCAACANONE
J065092N03CAAGGCCCGTTNONE
J080004D17CAAGGCCCGTTNONE
J080010L09CAAGGCCCGTTNONE
J080021I11CAAGGCCCGTTNONE
J080022L01CAAGGCCCGTTNONE
J080029B01CAAGGCCCGTTNONE
J080032D11CAAGGCCCGTTNONE
J080039B11CAAGGCCCGTTNONE
J080040K17CAAGGCCCGTTNONE
J080041B21CAAGGCCCGTTNONE
J080052L24CAAGGCCCGTTNONE
J080054M12CAAGGCCCGTTNONE
J080057B15CAAGGCCCGTTNONE
J080078G15CAAGGCCCGTTNONE
J080078H06CAAGGCCCGTTNONE
J080079M03CAAGGCCCGTTNONE
J080088H16CAAGGCCCGTTNONE
J080093C11CAAGGCCCGTTNONE
J080095K09CAAGGCCCGTTNONE
J080095O20CAAGGCCCGTTNONE
J090001L06GGCCCGTTACAGCCCAACANONE
J090009J19CAAGGCCCGTTNONE
J090017C24GGCCCGTTACAGCCCAACANONE
J090040D04CAAGGCCCGTTNONE
J090052E14CAAGGCCCGTTNONE
J090058G15GGCCCGTTACAGCCCAACANONE
J090058H23GGCCCGTTACAGCCCAACANONE
J090061G20GGCCCGTTACAGCCCAACANONE
J090063B14CAAGGCCCGTTNONE
J090069N23GGCCCGTTACAGCCCAACANONE
J090071A08GGCCCGTTACAGCCCAACANONE
J090071K04CAAGGCCCGTTNONE
J090074A08GGCCCGTTACAGCCCAACANONE
J090075E12CAAGGCCCGTTNONE
J090077B15GGCCCGTTACAGCCCAACANONE
J090081K06GGCCCGTTACAGCCCAACANONE
J090083I05GGCCCGTTACAGCCCAACANONE
J090087A06CAAGGCCCGTTNONE
J090091O22GGCCCGTTACAGCCCAACANONE
J090094P03CAAGGCCCGTTNONE
J090097L10GGCCCGTTACAGCCCAACANONE
J090098M14CAAGGCCCGTTNONE
J100026B11GGCCCGTTACAGCCCAACANONE
J100044M01GGCCCGTTACAGCCCAACANONE
J100046F10GGCCCGTTACAGCCCAACANONE
J100051K14GGCCCGTTACAGCCCAACANONE
J100060D22GGCCCGTTACAGCCCAACANONE
J100060H18GGCCCGTTACAGCCCAACANONE
J100070I06GGCCCGTTACAGCCCAACANONE
J100071C04GGCCCGTTACAGCCCAACANONE
J100078M13GGCCCGTTACAGCCCAACANONE
J100080E17GGCCCGTTACAGCCCAACANONE
J100083I09GGCCCGTTACAGCCCAACANONE
Os02g0245000AK119770GGCCGGGCGGCCCGTTNONE
AK119874GGCCGGGCGGCCCGTTSWAP/Surp domain containing protein.
J065038L11GGCCGGGCGGCCCGTTNONE
J100059I06GGCCGGGCGGCCCGTTNONE
J100076C23GGCCGGGCGGCCCGTTNONE
J100081P08GGCCGGGCGGCCCGTTNONE
J100084C13GGCCGGGCGGCCCGTTNONE
Os02g0266500AK100307TCGGCCCGSimilar to RASPBERRY3.
Os02g0299200AK105486CGGGCCCACAIQ calmodulin-binding region domain containing protein.
Os02g0301100006-029-F04GGGTGGGCCCGGCNONE
012-005-F07GGGTGGGCCCGGCNONE
013-093-H10GGGTGGGCCCGGCNONE
015-042-B01GGGTGGGCCCGGCNONE
016-017-F09GGGTGGGCCCGGCNONE
016-079-B07GGGTGGGCCCGGCNONE
016-079-G03GGGTGGGCCCGGCNONE
016-087-F11GGGTGGGCCCGGCNONE
AK071676GGGTGGGCCCGGCNONE
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein.
AK104411GGGTGGGCCCGGCNONE
AK104467GGGTGGGCCCGGCNONE
J023069G02GGGTGGGCCCGGCNONE
J023108F17GGGTGGGCCCGGCNONE
J033042B04GGGTGGGCCCGGCNONE
J033128D06GGGTGGGCCCGGCNONE
J033138I12GGGTGGGCCCGGCNONE
J053064K16GGGTGGGCCCGGCNONE
J065088A12GGGTGGGCCCGGCNONE
J065102L08GGGTGGGCCCGGCNONE
J065104L14GGGTGGGCCCGGCNONE
J065117M20GGGTGGGCCCGGCNONE
J065117N14GGGTGGGCCCGGCNONE
J065120H23GGGTGGGCCCGGCNONE
J065135F06GGGTGGGCCCGGCNONE
J065138J17GGGTGGGCCCGGCNONE
J065138P06GGGTGGGCCCGGCNONE
J065156G16GGGTGGGCCCGGCNONE
J065163M20GGGTGGGCCCGGCNONE
J065176A14GGGTGGGCCCGGCNONE
J065182C02GGGTGGGCCCGGCNONE
J065200C05GGGTGGGCCCGGCNONE
J065213J22GGGTGGGCCCGGCNONE
J065217D24GGGTGGGCCCGGCNONE
J075009H03GGGTGGGCCCGGCNONE
J075020D10GGGTGGGCCCGGCNONE
J075026L24GGGTGGGCCCGGCNONE
J075028L01GGGTGGGCCCGGCNONE
J075057O09GGGTGGGCCCGGCNONE
J075089A20GGGTGGGCCCGGCNONE
J075094J15GGGTGGGCCCGGCNONE
J075103B11GGGTGGGCCCGGCNONE
J075143L13GGGTGGGCCCGGCNONE
J075153K15GGGTGGGCCCGGCNONE
J075161P22GGGTGGGCCCGGCNONE
J075166J06GGGTGGGCCCGGCNONE
J075177G06GGGTGGGCCCGGCNONE
J075198N06GGGTGGGCCCGGCNONE
Os02g0301400AK121646CCCACGGGThioredoxin-like fold domain containing protein.
J033028E10CCCACGGGNONE
J033058J23CCCACGGGNONE
Os02g0316200AK073932GTGTGGGGGCCCGCACyclin-like F-box domain containing protein.
AK105757GTGTGGGGGCCCGCANONE
J023039G03GTGTGGGGGCCCGCANONE
J033076K03GTGTGGGGGCCCGCANONE
J075157J22GTGTGGGGGCCCGCANONE
J090097K02GTGTGGGGGCCCGCANONE
J100053F10GTGTGGGGGCCCGCANONE
Os02g0326700AK064977GGCCGGGCCCCACGRhomboid-like protein family protein.
Os02g0438700012-040-C07GCGGGCCCCACACNONE
AK062610GCGGGCCCCACACNONE
AK105276GCGGGCCCCACACConserved hypothetical protein.
J065104J01GCGGGCCCCACACNONE
Os02g0445700011-046-C10AACGGGCCGTGNONE
011-046-C10CACGGCCCGTTNONE
011-046-C10CGGGCCGTGNONE
011-046-C10GCCGGGCCGTGNONE
011-046-C10GGCCCGGCCCGTTNONE
Os02g0461900009-042-C04GGTGGGCCCGACTCGACNONE
AF140492GGTGGGCCCGACTCGACNONE
AK072619GGTGGGCCCGACTCGACNONE
AK104969GGTGGGCCCGACTCGACConserved hypothetical protein.
AK119466GGTGGGCCCGACTCGACNONE
Os02g0467200014-053-H06GGCCCGTTNONE
AK063704GGCCCGTTConserved hypothetical protein.
J065197J05GGCCCGTTNONE
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27.
J013089A06AAGGCCCAGCCCACGGGNONE
J065068E01AAGGCCCAGCCCACGGGNONE
J065217F15AAGGCCCAGCCCACGGGNONE
Os02g0509500009-117-G07GGGGCCCGCGTGCGNONE
009-122-G08GGGGCCCGCGTGCGNONE
AK105187GGGGCCCGCGTGCGConserved hypothetical protein.
J065025C04GGGGCCCGCGTGCGNONE
J065030F10GGGGCCCGCGTGCGNONE
J065112P22GGGGCCCGCGTGCGNONE
J065116I22GGGGCCCGCGTGCGNONE
J065127F24GGGGCCCGCGTGCGNONE
J065176E11GGGGCCCGCGTGCGNONE
J065186F02GGGGCCCGCGTGCGNONE
J075041F12GGGGCCCGCGTGCGNONE
J075118L20GGGGCCCGCGTGCGNONE
J075181D20GGGGCCCGCGTGCGNONE
J090023P12GGGGCCCGCGTGCGNONE
Os02g0510100AK058487ATCTGGGCCCGCNONE
AK122107ATCTGGGCCCGCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F).
J033126F06ATCTGGGCCCGCNONE
J053077L04ATCTGGGCCCGCNONE
J065010C11ATCTGGGCCCGCNONE
J075104O14ATCTGGGCCCGCNONE
J080003G03ATCTGGGCCCGCNONE
J080014K05ATCTGGGCCCGCNONE
J080026F03ATCTGGGCCCGCNONE
J080027O05ATCTGGGCCCGCNONE
J080037K15ATCTGGGCCCGCNONE
J080039D24ATCTGGGCCCGCNONE
J080043G19ATCTGGGCCCGCNONE
J080047P05ATCTGGGCCCGCNONE
J080048D22ATCTGGGCCCGCNONE
J080049F23ATCTGGGCCCGCNONE
J080062A21ATCTGGGCCCGCNONE
J080063H20ATCTGGGCCCGCNONE
J080067P15ATCTGGGCCCGCNONE
J080068P19ATCTGGGCCCGCNONE
J080079J15ATCTGGGCCCGCNONE
J080092K19ATCTGGGCCCGCNONE
J080096M04ATCTGGGCCCGCNONE
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor.
Os02g0521300AK120851GGGGCCCGCC2 domain containing protein.
Os02g0527300AK101934TCCGGGCCCCGCCGAGATSimilar to Heat shock transcription factor 31 (Fragment).
J013047O11TCCGGGCCCCGCCGAGATNONE
J033073P11TCCGGGCCCCGCCGAGATNONE
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog.
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein.
Os02g0565000AK120665AACGGGCCHomeodomain-like containing protein.
J100070C12AACGGGCCNONE
J100074L08AACGGGCCNONE
Os02g0575900AK102188CGGGCCCATTExo70 exocyst complex subunit family protein.
J033032M01CGGGCCCATTNONE
J033086P19CGGGCCCATTNONE
J033148L20CGGGCCCATTNONE
J100040L08CGGGCCCATTNONE
Os02g0586900013-044-D08AACGGGCCCAGANONE
014-087-D07AACGGGCCCAGANONE
AK063583AACGGGCCCAGASimilar to Glycine rich protein (Fragment).
AK105378AACGGGCCCAGANONE
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE
AK058978CCCACCCGGGCCCACACNONE
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein.
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE
AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
AK099539GACGGCCCGGATCCGACCCGCNONE
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein.
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein.
AK106801GACGGCCCGGATCCGACCCGCNONE
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
AK121758GACGGCCCGGATCCGACCCGCNONE
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
AK121891GACGGCCCGGATCCGACCCGCNONE
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J013059H01GACGGCCCGGATCCGACCCGCNONE
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J013092F08GACGGCCCGGATCCGACCCGCNONE
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J013146J04GACGGCCCGGATCCGACCCGCNONE
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J023001K12GACGGCCCGGATCCGACCCGCNONE
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J023002H16GACGGCCCGGATCCGACCCGCNONE
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J023013B10GACGGCCCGGATCCGACCCGCNONE
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J023081I22GACGGCCCGGATCCGACCCGCNONE
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J023084K19GACGGCCCGGATCCGACCCGCNONE
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J023150E24GACGGCCCGGATCCGACCCGCNONE
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J033023B18GACGGCCCGGATCCGACCCGCNONE
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J033025F18GACGGCCCGGATCCGACCCGCNONE
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J033048P08GACGGCCCGGATCCGACCCGCNONE
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J033060M24GACGGCCCGGATCCGACCCGCNONE
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J033070G06GACGGCCCGGATCCGACCCGCNONE
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J033088P12GACGGCCCGGATCCGACCCGCNONE
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J033105C13GACGGCCCGGATCCGACCCGCNONE
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J043009N18GACGGCCCGGATCCGACCCGCNONE
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J065103G21GACGGCCCGGATCCGACCCGCNONE
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J075039H15GACGGCCCGGATCCGACCCGCNONE
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090014K10GACGGCCCGGATCCGACCCGCNONE
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090022N02GACGGCCCGGATCCGACCCGCNONE
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090033F18GACGGCCCGGATCCGACCCGCNONE
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090033I04GACGGCCCGGATCCGACCCGCNONE
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090041F11GACGGCCCGGATCCGACCCGCNONE
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090045P20GACGGCCCGGATCCGACCCGCNONE
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090054B01GACGGCCCGGATCCGACCCGCNONE
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090055M12GACGGCCCGGATCCGACCCGCNONE
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090071K09GACGGCCCGGATCCGACCCGCNONE
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090098O16GACGGCCCGGATCCGACCCGCNONE
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J090099P15GACGGCCCGGATCCGACCCGCNONE
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
J100050I16GACGGCCCGGATCCGACCCGCNONE
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE
Os02g0602300AK065609AACGGGCCGTGNONE
AK065609AACGGGCCGTGNONE
AK065609CACGGCCCGNONE
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
AK066929CACGGCCCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
J013092L08AACGGGCCGTGNONE
J013092L08AACGGGCCGTGNONE
J013092L08CACGGCCCGNONE
J090040I23AACGGGCCGTGNONE
J090040I23AACGGGCCGTGNONE
J090040I23CACGGCCCGNONE
Os02g0605600016-017-B02GATCCGACGGCCCGNONE
AK066104GATCCGACGGCCCGLUC7 related family protein.
J013052G16GATCCGACGGCCCGNONE
J043022E03GATCCGACGGCCCGNONE
J065105P10GATCCGACGGCCCGNONE
Os02g0606800AK073760CCCGGGCCCACAIsochorismatase hydrolase family protein.
J100033B19CCCGGGCCCACANONE
J100047E15CCCGGGCCCACANONE
J100058A18CCCGGGCCCACANONE
J100068L14CCCGGGCCCACANONE
J100089I02CCCGGGCCCACANONE
Os02g0606900J023065M01AACGGGCCNONE
J075046E14AACGGGCCNONE
Os02g0614400016-088-D04ACCGGGCCCAATNONE
AK071805ACCGGGCCCAATConserved hypothetical protein.
J023108N22ACCGGGCCCAATNONE
Os02g0626100005-017-F11CTCGGCCCGCANONE
AK058306CTCGGCCCGCANONE
Os02g0628600J100044L04AACGGCCCGTranscriptional factor B3 family protein.
Os02g0629000009-047-E10CCCGGGCCCCACCCGNONE
AK062480CCCGGGCCCCACCCGProtein of unknown function DUF584 family protein.
Os02g0631000AK068667ACCGGGCCCCConserved hypothetical protein.
J013159L03ACCGGGCCCCNONE
J023119O20ACCGGGCCCCNONE
J090098N20ACCGGGCCCCNONE
Os02g0633400AK073723CACGGCCCGSimilar to 61 kDa protein homolog.
J100031K17CACGGCCCGNONE
Os02g0634900006-032-G12AGCCGTTGGCCCGTGGGNONE
006-033-E09AGCCGTTGGCCCGTGGGNONE
006-117-F10AGCCGTTGGCCCGTGGGNONE
006-118-E01AGCCGTTGGCCCGTGGGNONE
013-056-G08AGCCGTTGGCCCGTGGGNONE
AK059769AGCCGTTGGCCCGTGGGNONE
AK068583AGCCGTTGGCCCGTGGGNONE
AK072855AGCCGTTGGCCCGTGGGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
AK106210AGCCGTTGGCCCGTGGGNONE
J023138P05AGCCGTTGGCCCGTGGGNONE
J023143J07AGCCGTTGGCCCGTGGGNONE
J033022O09AGCCGTTGGCCCGTGGGNONE
J033111L02AGCCGTTGGCCCGTGGGNONE
J033135O03AGCCGTTGGCCCGTGGGNONE
J065005K19AGCCGTTGGCCCGTGGGNONE
J065044C17AGCCGTTGGCCCGTGGGNONE
J065116K09AGCCGTTGGCCCGTGGGNONE
J065119O21AGCCGTTGGCCCGTGGGNONE
J075014L05AGCCGTTGGCCCGTGGGNONE
J075109H16AGCCGTTGGCCCGTGGGNONE
J075117D04AGCCGTTGGCCCGTGGGNONE
Os02g0669500AK111117CCACGGCCCGProtein of unknown function DUF241, plant family protein.
Os02g0672600AK070286GGCCGGGCCGTGSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2.
AK070286TATTGGGCCCGCSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2.
AK101174GGCCGGGCCGTGNONE
AK101174TATTGGGCCCGCNONE
Os02g0672700AK059611CCCGTGGGDNA-directed RNA polymerase, subunit C11/M/9 family protein.
AK099179CCCGTGGGNONE
J023098L23CCCGTGGGNONE
J065042J21CCCGTGGGNONE
J065187L09CCCGTGGGNONE
J065190O10CCCGTGGGNONE
J080041G14CCCGTGGGNONE
J080078K08CCCGTGGGNONE
J080089D20CCCGTGGGNONE
J080094D04CCCGTGGGNONE
Os02g0679700AK108178GACGGCCCGGGProtein of unknown function DUF623, plant domain containing protein.
J075112F23GACGGCCCGGGNONE
Os02g0686300AK066567AGAGTGGGCCCGConserved hypothetical protein.
Os02g0697200015-013-B10AACGGGCCCACANONE
AK059475AACGGGCCCACANONE
AK102993AACGGGCCCACAConserved hypothetical protein.
J033079I18AACGGGCCCACANONE
J033082A14AACGGGCCCACANONE
J065047H08AACGGGCCCACANONE
J065131M14AACGGGCCCACANONE
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein.
J090039P20CAACGGCCCGGCCCATTTNONE
Os02g0708100AK059630TCGTGGGCCCGCNONE
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5).
Os02g0708300009-007-C06GGCCCGTTNONE
009-007-C06GGCCCGTTNONE
009-162-G06GGCCCGTTNONE
009-162-G06GGCCCGTTNONE
014-048-F12GGCCCGTTNONE
014-048-F12GGCCCGTTNONE
AK066348GGCCCGTTConserved hypothetical protein.
AK066348GGCCCGTTConserved hypothetical protein.
J013059F24GGCCCGTTNONE
J013059F24GGCCCGTTNONE
J023104H14GGCCCGTTNONE
J023104H14GGCCCGTTNONE
J053052O22GGCCCGTTNONE
J053052O22GGCCCGTTNONE
J053063A05GGCCCGTTNONE
J053063A05GGCCCGTTNONE
J053093P09GGCCCGTTNONE
J053093P09GGCCCGTTNONE
J065012F24GGCCCGTTNONE
J065012F24GGCCCGTTNONE
J065063P09GGCCCGTTNONE
J065063P09GGCCCGTTNONE
J065088F12GGCCCGTTNONE
J065088F12GGCCCGTTNONE
J065094I11GGCCCGTTNONE
J065094I11GGCCCGTTNONE
J065099H19GGCCCGTTNONE
J065099H19GGCCCGTTNONE
J065116H07GGCCCGTTNONE
J065116H07GGCCCGTTNONE
J065137N07GGCCCGTTNONE
J065137N07GGCCCGTTNONE
J065137N11GGCCCGTTNONE
J065137N11GGCCCGTTNONE
J065159L22GGCCCGTTNONE
J065159L22GGCCCGTTNONE
J065159P11GGCCCGTTNONE
J065159P11GGCCCGTTNONE
J065178F17GGCCCGTTNONE
J065178F17GGCCCGTTNONE
J065181E07GGCCCGTTNONE
J065181E07GGCCCGTTNONE
J075014L16GGCCCGTTNONE
J075014L16GGCCCGTTNONE
J075030P11GGCCCGTTNONE
J075030P11GGCCCGTTNONE
J075042K24GGCCCGTTNONE
J075042K24GGCCCGTTNONE
J075077I15GGCCCGTTNONE
J075077I15GGCCCGTTNONE
J075087P06GGCCCGTTNONE
J075087P06GGCCCGTTNONE
J075089F20GGCCCGTTNONE
J075089F20GGCCCGTTNONE
J075093B07GGCCCGTTNONE
J075093B07GGCCCGTTNONE
J075115J23GGCCCGTTNONE
J075115J23GGCCCGTTNONE
J075176O19GGCCCGTTNONE
J075176O19GGCCCGTTNONE
J075178A04GGCCCGTTNONE
J075178A04GGCCCGTTNONE
J075178J02GGCCCGTTNONE
J075178J02GGCCCGTTNONE
J090027L02GGCCCGTTNONE
J090027L02GGCCCGTTNONE
J100033M12GGCCCGTTNONE
J100033M12GGCCCGTTNONE
J100065O08GGCCCGTTNONE
J100065O08GGCCCGTTNONE
Os02g0709300009-054-A02CGGGCCGTCNONE
AK109446CGGGCCGTCConserved hypothetical protein.
Os02g0717100014-089-G06TACGGCCCGTTNONE
AK063741TACGGCCCGTTEsterase/lipase/thioesterase domain containing protein.
J065052A22TACGGCCCGTTNONE
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV.
Os02g0731500J065098J18CGGGCCCCAWPM-19-like family protein.
J065123G07CGGGCCCCNONE
Os02g0731700AK072346AGTGGGCCCGCSimilar to CONSTANS-like 1 protein.
AK120314AGTGGGCCCGCNONE
Os02g0740300AK067833GGCCCGTTAAA ATPase domain containing protein.
Os02g0741900009-042-A12CGGGCCGAGNONE
AK068461CGGGCCGAGConserved hypothetical protein.
J065203C15CGGGCCGAGNONE
Os02g0744000AK064898AACGGGCCConserved hypothetical protein.
AK064898AGCCCACGGGConserved hypothetical protein.
AK104827AACGGGCCNONE
AK104827AGCCCACGGGNONE
J013000L12AACGGGCCNONE
J013000L12AGCCCACGGGNONE
J013156N02AACGGGCCNONE
J013156N02AGCCCACGGGNONE
J065001H14AACGGGCCNONE
J065001H14AGCCCACGGGNONE
J065038D18AACGGGCCNONE
J065038D18AGCCCACGGGNONE
J065039I18AACGGGCCNONE
J065039I18AGCCCACGGGNONE
J065047C13AACGGGCCNONE
J065047C13AGCCCACGGGNONE
J065053J09AACGGGCCNONE
J065053J09AGCCCACGGGNONE
J065064G03AACGGGCCNONE
J065064G03AGCCCACGGGNONE
J065066M05AACGGGCCNONE
J065066M05AGCCCACGGGNONE
J065068O10AACGGGCCNONE
J065068O10AGCCCACGGGNONE
J065090H22AACGGGCCNONE
J065090H22AGCCCACGGGNONE
J065113L19AACGGGCCNONE
J065113L19AGCCCACGGGNONE
J065121M02AACGGGCCNONE
J065121M02AGCCCACGGGNONE
J065122K23AACGGGCCNONE
J065122K23AGCCCACGGGNONE
J065138C12AACGGGCCNONE
J065138C12AGCCCACGGGNONE
J065153E14AACGGGCCNONE
J065153E14AGCCCACGGGNONE
J065156N12AACGGGCCNONE
J065156N12AGCCCACGGGNONE
J065158L20AACGGGCCNONE
J065158L20AGCCCACGGGNONE
J065166I06AACGGGCCNONE
J065166I06AGCCCACGGGNONE
J065174L15AACGGGCCNONE
J065174L15AGCCCACGGGNONE
J065175N03AACGGGCCNONE
J065175N03AGCCCACGGGNONE
J090092C23AACGGGCCNONE
J090092C23AGCCCACGGGNONE
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein.
J033075P05TACGGCCCGGCCCAATANONE
J065054F02TACGGCCCGGCCCAATANONE
J065124N03TACGGCCCGGCCCAATANONE
J090001H12TACGGCCCGGCCCAATANONE
J100057J01TACGGCCCGGCCCAATANONE
J100062F12TACGGCCCGGCCCAATANONE
Os02g0756200AK063454CGGGCCCATGGNONE
AK101655CGGGCCCATGGSimilar to Phi-1 protein.
J065104L21CGGGCCCATGGNONE
J065141A07CGGGCCCATGGNONE
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like.
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22).
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE
Os02g0767100011-054-E05AATTGGGCCCGNONE
AK063351AATTGGGCCCGNONE
AK103640AATTGGGCCCGConserved hypothetical protein.
J090022G11AATTGGGCCCGNONE
J090072L18AATTGGGCCCGNONE
Os02g0767500005-017-F10AACGGGCCCCACACGNONE
005-017-F10CGGGCCCACANONE
AB016065AACGGGCCCCACACGNONE
AB016065CGGGCCCACANONE
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter.
AK069611CGGGCCCACAMitochondrial phosphate transporter.
J013020K11AACGGGCCCCACACGNONE
J013020K11CGGGCCCACANONE
J013066I18AACGGGCCCCACACGNONE
J013066I18CGGGCCCACANONE
J023012D02AACGGGCCCCACACGNONE
J023012D02CGGGCCCACANONE
J023020J16AACGGGCCCCACACGNONE
J023020J16CGGGCCCACANONE
J023022H13AACGGGCCCCACACGNONE
J023022H13CGGGCCCACANONE
J023044N15AACGGGCCCCACACGNONE
J023044N15CGGGCCCACANONE
J023067E15AACGGGCCCCACACGNONE
J023067E15CGGGCCCACANONE
J023079C06AACGGGCCCCACACGNONE
J023079C06CGGGCCCACANONE
J023080B07AACGGGCCCCACACGNONE
J023080B07CGGGCCCACANONE
J023081G11AACGGGCCCCACACGNONE
J023081G11CGGGCCCACANONE
J023091H22AACGGGCCCCACACGNONE
J023091H22CGGGCCCACANONE
J023092J03AACGGGCCCCACACGNONE
J023092J03CGGGCCCACANONE
J023114D02AACGGGCCCCACACGNONE
J023114D02CGGGCCCACANONE
J023121J15AACGGGCCCCACACGNONE
J023121J15CGGGCCCACANONE
J023128G10AACGGGCCCCACACGNONE
J023128G10CGGGCCCACANONE
J023132B15AACGGGCCCCACACGNONE
J023132B15CGGGCCCACANONE
J023140G10AACGGGCCCCACACGNONE
J023140G10CGGGCCCACANONE
J023142B10AACGGGCCCCACACGNONE
J023142B10CGGGCCCACANONE
J033026C15AACGGGCCCCACACGNONE
J033026C15CGGGCCCACANONE
J033029F21AACGGGCCCCACACGNONE
J033029F21CGGGCCCACANONE
J033037I09AACGGGCCCCACACGNONE
J033037I09CGGGCCCACANONE
J033046D11AACGGGCCCCACACGNONE
J033046D11CGGGCCCACANONE
J033081L20AACGGGCCCCACACGNONE
J033081L20CGGGCCCACANONE
J033097J19AACGGGCCCCACACGNONE
J033097J19CGGGCCCACANONE
J033125D19AACGGGCCCCACACGNONE
J033125D19CGGGCCCACANONE
J033125I04AACGGGCCCCACACGNONE
J033125I04CGGGCCCACANONE
J033141M21AACGGGCCCCACACGNONE
J033141M21CGGGCCCACANONE
J033143K08AACGGGCCCCACACGNONE
J033143K08CGGGCCCACANONE
J053091N01AACGGGCCCCACACGNONE
J053091N01CGGGCCCACANONE
J065093C20AACGGGCCCCACACGNONE
J065093C20CGGGCCCACANONE
J065104K11AACGGGCCCCACACGNONE
J065104K11CGGGCCCACANONE
J065143L16AACGGGCCCCACACGNONE
J065143L16CGGGCCCACANONE
J065205I23AACGGGCCCCACACGNONE
J065205I23CGGGCCCACANONE
J090057C12AACGGGCCCCACACGNONE
J090057C12CGGGCCCACANONE
J090075P11AACGGGCCCCACACGNONE
J090075P11CGGGCCCACANONE
Os02g0771500006-096-D12CCCGTGGGACCCACNONE
009-011-G02CCCGTGGGACCCACNONE
AK062335CCCGTGGGACCCACNONE
AK106018CCCGTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type).
Os02g0773300AK071811GGGGCCCGCPyridoxal phosphate-dependent deaminase family protein.
J013056D10GGGGCCCGCNONE
J013096G18GGGGCCCGCNONE
Os02g0778200AK065948GCGGGCCCCAGAminoacyl-tRNA synthetase, class I family protein.
Os02g0788800AK066747AACGGGCCAmino acid/polyamine transporter II family protein.
Os02g0791400009-106-F11AACGGGCCGGANONE
AK062787AACGGGCCGGACytochrome oxidase c, subunit VIb family protein.
Os02g0792900AK068367TCGGCCCGGGTMS membrane protein/tumour differentially expressed protein family protein.
AK104731TCGGCCCGGGNONE
AK106174TCGGCCCGGGNONE
AK119191TCGGCCCGGGNONE
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein.
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE
Os02g0801900006-113-E02AACGGGCCGTGNONE
006-113-E02AACGGGCCGTGNONE
006-113-E02CACGGCCCGGCCNONE
006-113-E02CACGGCCCGTTNONE
006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
AK109488AACGGGCCGTGNONE
AK109488AACGGGCCGTGNONE
AK109488CACGGCCCGGCCNONE
AK109488CACGGCCCGTTNONE
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
AK109498AACGGGCCGTGConserved hypothetical protein.
AK109498AACGGGCCGTGConserved hypothetical protein.
AK109498CACGGCCCGGCCConserved hypothetical protein.
AK109498CACGGCCCGTTConserved hypothetical protein.
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein.
J065007D19AACGGGCCGTGNONE
J065007D19AACGGGCCGTGNONE
J065007D19CACGGCCCGGCCNONE
J065007D19CACGGCCCGTTNONE
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065035G11AACGGGCCGTGNONE
J065035G11AACGGGCCGTGNONE
J065035G11CACGGCCCGGCCNONE
J065035G11CACGGCCCGTTNONE
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065044E05AACGGGCCGTGNONE
J065044E05AACGGGCCGTGNONE
J065044E05CACGGCCCGGCCNONE
J065044E05CACGGCCCGTTNONE
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065112N01AACGGGCCGTGNONE
J065112N01AACGGGCCGTGNONE
J065112N01CACGGCCCGGCCNONE
J065112N01CACGGCCCGTTNONE
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065143B03AACGGGCCGTGNONE
J065143B03AACGGGCCGTGNONE
J065143B03CACGGCCCGGCCNONE
J065143B03CACGGCCCGTTNONE
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J065159A16AACGGGCCGTGNONE
J065159A16AACGGGCCGTGNONE
J065159A16CACGGCCCGGCCNONE
J065159A16CACGGCCCGTTNONE
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J090007K23AACGGGCCGTGNONE
J090007K23AACGGGCCGTGNONE
J090007K23CACGGCCCGGCCNONE
J090007K23CACGGCCCGTTNONE
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J090045N09AACGGGCCGTGNONE
J090045N09AACGGGCCGTGNONE
J090045N09CACGGCCCGGCCNONE
J090045N09CACGGCCCGTTNONE
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
J090049L20AACGGGCCGTGNONE
J090049L20AACGGGCCGTGNONE
J090049L20CACGGCCCGGCCNONE
J090049L20CACGGCCCGTTNONE
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin).
J023105C08CAGGTGGGCCCGNONE
J033030H07CAGGTGGGCCCGNONE
J033050M24CAGGTGGGCCCGNONE
J033069B10CAGGTGGGCCCGNONE
J033121A16CAGGTGGGCCCGNONE
J053023M14CAGGTGGGCCCGNONE
J053033A15CAGGTGGGCCCGNONE
J053054H14CAGGTGGGCCCGNONE
J053055H24CAGGTGGGCCCGNONE
J053082B18CAGGTGGGCCCGNONE
J065001N03CAGGTGGGCCCGNONE
J065011O16CAGGTGGGCCCGNONE
J065026K24CAGGTGGGCCCGNONE
J065056C09CAGGTGGGCCCGNONE
J065067H11CAGGTGGGCCCGNONE
J065097E19CAGGTGGGCCCGNONE
J065118O11CAGGTGGGCCCGNONE
J065124N09CAGGTGGGCCCGNONE
J065143A02CAGGTGGGCCCGNONE
J065213P06CAGGTGGGCCCGNONE
J065215E24CAGGTGGGCCCGNONE
J075051B11CAGGTGGGCCCGNONE
J075065K05CAGGTGGGCCCGNONE
J080306E10CAGGTGGGCCCGNONE
J090042I16CAGGTGGGCCCGNONE
J090066J24CAGGTGGGCCCGNONE
J090092K17CAGGTGGGCCCGNONE
J100029A17CAGGTGGGCCCGNONE
J100052N08CAGGTGGGCCCGNONE
J100071I23CAGGTGGGCCCGNONE
Os02g0814300AK111376CGGGCCGAAACytochrome c, monohaem domain containing protein.
J065063I24CGGGCCGAAANONE
Os02g0817500AK072707CGGGCCCCACCACKCNAB voltage-gated K+ channel, beta subunit family protein.
AK104135CGGGCCCCACCACNONE
U46758CGGGCCCCACCACNONE
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein.
J075055J16GCAGCCCATACAACGGGCCCAACTNONE
Os02g0824400AK121390TCGGCCCGConserved hypothetical protein.
J023128P21TCGGCCCGNONE
J053097O16TCGGCCCGNONE
J065012I02TCGGCCCGNONE
J065049C06TCGGCCCGNONE
J065051H02TCGGCCCGNONE
J065069A13TCGGCCCGNONE
J065082E04TCGGCCCGNONE
J065102N09TCGGCCCGNONE
J065157O10TCGGCCCGNONE
J065188N23TCGGCCCGNONE
J065190J11TCGGCCCGNONE
J065202M09TCGGCCCGNONE
Os02g0824500AK111296CGGGCCGASimilar to Remorin.
J065048M11CGGGCCGANONE
J065081F01CGGGCCGANONE
Os02g0826200AK070787CTCGGCCCGdTDP-4-dehydrorhamnose reductase family protein.
J075022D14CTCGGCCCGNONE
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa.
AK103235GCGGGCCCCACGTGTCNONE
Os03g0102200AK120183TCGGCCCGGCCCGGTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5).
J013034D10TCGGCCCGGCCCGGTNONE
J065116C05TCGGCCCGGCCCGGTNONE
J065120N21TCGGCCCGGCCCGGTNONE
J090049D24TCGGCCCGGCCCGGTNONE
Os03g0108000014-001-C09AACGGGCCGAGNONE
AK102520AACGGGCCGAGSimilar to Dual specificity phosphatase Cdc25 (EC 3.1.3.48) (Arath;CDC25).
J023083K07AACGGGCCGAGNONE
J023110F13AACGGGCCGAGNONE
J033095O09AACGGGCCGAGNONE
J065219M15AACGGGCCGAGNONE
J075009G03AACGGGCCGAGNONE
J080301C17AACGGGCCGAGNONE
J080301I02AACGGGCCGAGNONE
J080301O05AACGGGCCGAGNONE
J080305C08AACGGGCCGAGNONE
J080305D11AACGGGCCGAGNONE
J080311B05AACGGGCCGAGNONE
J080316A17AACGGGCCGAGNONE
J080317K12AACGGGCCGAGNONE
J100087M06AACGGGCCGAGNONE
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor.
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein.
J013047E20CCACGGCCCGGCCCAACTNONE
J065026F21CCACGGCCCGGCCCAACTNONE
J065047B03CCACGGCCCGGCCCAACTNONE
J065054J12CCACGGCCCGGCCCAACTNONE
J065079M24CCACGGCCCGGCCCAACTNONE
J065093M07CCACGGCCCGGCCCAACTNONE
J065153F02CCACGGCCCGGCCCAACTNONE
J065155E21CCACGGCCCGGCCCAACTNONE
J065179H15CCACGGCCCGGCCCAACTNONE
J075019N02CCACGGCCCGGCCCAACTNONE
J075089E01CCACGGCCCGGCCCAACTNONE
J090066I18CCACGGCCCGGCCCAACTNONE
J090087K20CCACGGCCCGGCCCAACTNONE
J100079F05CCACGGCCCGGCCCAACTNONE
Os03g0114300AK121970CGGGCCCCAProtein kinase-like domain containing protein.
Os03g0125800AK100164CCCACGGGNONE
AK102496CCCACGGGProtein of unknown function DUF21 domain containing protein.
Os03g0129100003-009-E09CACGGCCCGCACCGCNONE
AF384030CACGGCCCGCACCGCNONE
AK098993CACGGCCCGCACCGCSeven transmembrane protein MLO2.
AK111990CACGGCCCGCACCGCNONE
J013098A12CACGGCCCGCACCGCNONE
J023020M16CACGGCCCGCACCGCNONE
J043001L02CACGGCCCGCACCGCNONE
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein.
Os03g0136200004-011-E10AACGGGCCTTGNONE
006-067-A08AACGGGCCTTGNONE
011-007-E02AACGGGCCTTGNONE
011-099-H10AACGGGCCTTGNONE
012-044-D08AACGGGCCTTGNONE
013-045-G12AACGGGCCTTGNONE
013-062-C09AACGGGCCTTGNONE
013-072-F09AACGGGCCTTGNONE
013-085-B12AACGGGCCTTGNONE
013-097-E09AACGGGCCTTGNONE
013-097-F09AACGGGCCTTGNONE
014-013-C09AACGGGCCTTGNONE
014-082-D08AACGGGCCTTGNONE
015-071-A09AACGGGCCTTGNONE
AF042333AACGGGCCTTGNONE
AK060887AACGGGCCTTGNONE
AK121681AACGGGCCTTG24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2).
J013073N14AACGGGCCTTGNONE
J013123F01AACGGGCCTTGNONE
J023050A02AACGGGCCTTGNONE
J033046H22AACGGGCCTTGNONE
J033070A11AACGGGCCTTGNONE
J065059G11AACGGGCCTTGNONE
J065068F10AACGGGCCTTGNONE
J065164A10AACGGGCCTTGNONE
J075031F07AACGGGCCTTGNONE
J075054J01AACGGGCCTTGNONE
J075086M04AACGGGCCTTGNONE
J075118K23AACGGGCCTTGNONE
J075122A09AACGGGCCTTGNONE
J075123D06AACGGGCCTTGNONE
J075129A22AACGGGCCTTGNONE
J075161E07AACGGGCCTTGNONE
J075179H04AACGGGCCTTGNONE
J075181C06AACGGGCCTTGNONE
J075186A12AACGGGCCTTGNONE
J090014H16AACGGGCCTTGNONE
J090045G17AACGGGCCTTGNONE
J090048B09AACGGGCCTTGNONE
J090052J23AACGGGCCTTGNONE
J090052K22AACGGGCCTTGNONE
J090059F10AACGGGCCTTGNONE
J090080F19AACGGGCCTTGNONE
J100039J08AACGGGCCTTGNONE
J100044K02AACGGGCCTTGNONE
J100051E16AACGGGCCTTGNONE
J100053F08AACGGGCCTTGNONE
J100056F07AACGGGCCTTGNONE
J100058A10AACGGGCCTTGNONE
Os03g0137500006-040-G01GCCGGGCCGTANONE
015-054-G04GCCGGGCCGTANONE
AK060148GCCGGGCCGTANONE
AK073584GCCGGGCCGTANONE
AK100231GCCGGGCCGTASimilar to VDAC3.1.
J013146L24GCCGGGCCGTANONE
J023022O09GCCGGGCCGTANONE
J023049J19GCCGGGCCGTANONE
J023133L05GCCGGGCCGTANONE
J023143P12GCCGGGCCGTANONE
J033040B12GCCGGGCCGTANONE
J033050O14GCCGGGCCGTANONE
J033066G05GCCGGGCCGTANONE
J065007J18GCCGGGCCGTANONE
J100067H13GCCGGGCCGTANONE
Os03g0138600Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein.
Os03g0143000AK073102AAACGGCCCGTTSAM (and some other nucleotide) binding motif domain containing protein.
J033051I24AAACGGCCCGTTNONE
Os03g0145600015-010-B10GGCCCGTTNONE
AK106243GGCCCGTTQuinonprotein alcohol dehydrogenase-like domain containing protein.
Os03g0145900J013045K15GACGGCCCGNONE
J013051O08GACGGCCCGNONE
J065054C08GACGGCCCGNONE
J075053J16GACGGCCCGNONE
Os03g0146400AK111974CACGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment).
AK111974GCCGGGCCGTGSimilar to Lethal leaf-spot 1 (Fragment).
AK111974GGCCCGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment).
AK120554CACGGCCCGTTNONE
AK120554GCCGGGCCGTGNONE
AK120554GGCCCGGCCCGTTNONE
J075060J10CACGGCCCGTTNONE
J075060J10GCCGGGCCGTGNONE
J075060J10GGCCCGGCCCGTTNONE
Os03g0148000AK110468GCCGGGCCCACAProtein of unknown function DUF677 family protein.
Os03g0151800AK064955CGGGCCCACACNONE
AK098874CGGGCCCACACNONE
AK098980CGGGCCCACACNONE
AK099712CGGGCCCACACNONE
AK099889CGGGCCCACACNONE
AK121641CGGGCCCACACSimilar to Cell division control protein 48 homolog A (AtCDC48a).
J013001A05CGGGCCCACACNONE
J013001D04CGGGCCCACACNONE
J013121O12CGGGCCCACACNONE
Os03g0156500011-075-F02CGGGCCCACGTGNONE
012-077-G10CGGGCCCACGTGNONE
AK103466CGGGCCCACGTGLupus La protein family protein.
J013088H17CGGGCCCACGTGNONE
J013135G21CGGGCCCACGTGNONE
J033050E10CGGGCCCACGTGNONE
J033050J01CGGGCCCACGTGNONE
J033129N23CGGGCCCACGTGNONE
J065085L16CGGGCCCACGTGNONE
J065101B19CGGGCCCACGTGNONE
J065167N03CGGGCCCACGTGNONE
J090009O21CGGGCCCACGTGNONE
J090049D11CGGGCCCACGTGNONE
J100017F23CGGGCCCACGTGNONE
J100040E12CGGGCCCACGTGNONE
J100055O18CGGGCCCACGTGNONE
J100061K08CGGGCCCACGTGNONE
J100072M05CGGGCCCACGTGNONE
J100077B08CGGGCCCACGTGNONE
J100086G03CGGGCCCACGTGNONE
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein.
AK106245CGCGCGACGCGGGCCGAGNONE
J075144I02CGCGCGACGCGGGCCGAGNONE
Os03g0160900J065071D24CGGGCCCAACTNONE
J065132L03CGGGCCCAACTHypothetical protein.
J075189L19CGGGCCCAACTNONE
Os03g0161000AK121425CCCCCACGGGTTTCGGCCNONE
J023135K12CCCCCACGGGTTTCGGCCNONE
Os03g0162200009-031-E05CGGGCCGANONE
013-049-D04CGGGCCGANONE
013-082-E03CGGGCCGANONE
014-039-G04CGGGCCGANONE
014-098-G11CGGGCCGANONE
AK061605CGGGCCGANONE
AK121533CGGGCCGASimilar to Histone H2A.
J033024D06CGGGCCGANONE
J033030P21CGGGCCGANONE
J065063C20CGGGCCGANONE
J065064A18CGGGCCGANONE
J065147G02CGGGCCGANONE
J065204K06CGGGCCGANONE
J090004C22CGGGCCGANONE
J090014K02CGGGCCGANONE
J090074E10CGGGCCGANONE
J090086L09CGGGCCGANONE
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein.
J100070K07CCCGTGGGCCGTGGNONE
Os03g0168200AK099530GGACGGCCCGGTConserved hypothetical protein.
Os03g0171700J065192H12CCCGGGCCCACTBasic helix-loop-helix dimerisation region bHLH domain containing protein.
J065192H12TCGGCCCGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os03g0181500AK100798CCTGGGCCCGCNONE
Os03g0183300003-107-A07CACGGCCCGNONE
003-113-H10CACGGCCCGNONE
003-118-G01CACGGCCCGNONE
006-028-A09CACGGCCCGNONE
006-047-D01CACGGCCCGNONE
006-052-D04CACGGCCCGNONE
006-087-H06CACGGCCCGNONE
006-089-B03CACGGCCCGNONE
006-092-D08CACGGCCCGNONE
006-093-E07CACGGCCCGNONE
009-029-H07CACGGCCCGNONE
009-067-B05CACGGCCCGNONE
009-091-F04CACGGCCCGNONE
009-101-C10CACGGCCCGNONE
009-113-A06CACGGCCCGNONE
009-140-E12CACGGCCCGNONE
009-145-E10CACGGCCCGNONE
009-196-F02CACGGCCCGNONE
011-054-E07CACGGCCCGNONE
012-074-E10CACGGCCCGNONE
012-076-E11CACGGCCCGNONE
014-006-C07CACGGCCCGNONE
014-085-G11CACGGCCCGNONE
015-049-C04CACGGCCCGNONE
015-062-E10CACGGCCCGNONE
016-063-E02CACGGCCCGNONE
AK058349CACGGCCCGHypothetical protein.
AK105922CACGGCCCGNONE
AK106163CACGGCCCGNONE
AK119553CACGGCCCGNONE
AY831395CACGGCCCGNONE
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein.
AK065264CTTGGGCCCGCNAD-dependent epimerase/dehydratase family protein.
Os03g0189100AK066877CGGGCCCCConserved hypothetical protein.
J065040J15CGGGCCCCNONE
J065152H18CGGGCCCCNONE
J065152K18CGGGCCCCNONE
J090030C10CGGGCCCCNONE
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein.
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE
009-081-A03TACGGCCCGGTNONE
009-159-B02AGTGGGCCCGGCCCNONE
009-159-B02TACGGCCCGGTNONE
AK070573AGTGGGCCCGGCCCGRIM-19 family protein.
AK070573TACGGCCCGGTGRIM-19 family protein.
J023056B01AGTGGGCCCGGCCCNONE
J023056B01TACGGCCCGGTNONE
J023075G06AGTGGGCCCGGCCCNONE
J023075G06TACGGCCCGGTNONE
J033048K16AGTGGGCCCGGCCCNONE
J033048K16TACGGCCCGGTNONE
J033048L16AGTGGGCCCGGCCCNONE
J033048L16TACGGCCCGGTNONE
J053031H23AGTGGGCCCGGCCCNONE
J053031H23TACGGCCCGGTNONE
J065002H14AGTGGGCCCGGCCCNONE
J065002H14TACGGCCCGGTNONE
J065006G22AGTGGGCCCGGCCCNONE
J065006G22TACGGCCCGGTNONE
J065032G13AGTGGGCCCGGCCCNONE
J065032G13TACGGCCCGGTNONE
J065056A09AGTGGGCCCGGCCCNONE
J065056A09TACGGCCCGGTNONE
J065078I01AGTGGGCCCGGCCCNONE
J065078I01TACGGCCCGGTNONE
J065095G01AGTGGGCCCGGCCCNONE
J065095G01TACGGCCCGGTNONE
J065095I18AGTGGGCCCGGCCCNONE
J065095I18TACGGCCCGGTNONE
J065134M18AGTGGGCCCGGCCCNONE
J065134M18TACGGCCCGGTNONE
J065158P07AGTGGGCCCGGCCCNONE
J065158P07TACGGCCCGGTNONE
J065165K17AGTGGGCCCGGCCCNONE
J065165K17TACGGCCCGGTNONE
J065181J12AGTGGGCCCGGCCCNONE
J065181J12TACGGCCCGGTNONE
J065189N09AGTGGGCCCGGCCCNONE
J065189N09TACGGCCCGGTNONE
J065200D13AGTGGGCCCGGCCCNONE
J065200D13TACGGCCCGGTNONE
J065202H20AGTGGGCCCGGCCCNONE
J065202H20TACGGCCCGGTNONE
J065215K20AGTGGGCCCGGCCCNONE
J065215K20TACGGCCCGGTNONE
J075049N19AGTGGGCCCGGCCCNONE
J075049N19TACGGCCCGGTNONE
J075147J16AGTGGGCCCGGCCCNONE
J075147J16TACGGCCCGGTNONE
J090081E19AGTGGGCCCGGCCCNONE
J090081E19TACGGCCCGGTNONE
J100017C16AGTGGGCCCGGCCCNONE
J100017C16TACGGCCCGGTNONE
J100039M16AGTGGGCCCGGCCCNONE
J100039M16TACGGCCCGGTNONE
J100043E23AGTGGGCCCGGCCCNONE
J100043E23TACGGCCCGGTNONE
J100063L12AGTGGGCCCGGCCCNONE
J100063L12TACGGCCCGGTNONE
J100079F22AGTGGGCCCGGCCCNONE
J100079F22TACGGCCCGGTNONE
Os03g0192700012-005-H03GGTGGGCCCGNONE
012-006-B05GGTGGGCCCGNONE
012-006-E07GGTGGGCCCGNONE
012-051-D10GGTGGGCCCGNONE
014-089-H06GGTGGGCCCGNONE
015-034-C05GGTGGGCCCGNONE
015-042-C06GGTGGGCCCGNONE
015-059-E09GGTGGGCCCGNONE
015-096-A08GGTGGGCCCGNONE
016-030-D06GGTGGGCCCGNONE
016-053-H07GGTGGGCCCGNONE
016-064-D02GGTGGGCCCGNONE
AB012107GGTGGGCCCGNONE
AK058750GGTGGGCCCGSimilar to Myo-inositol-1-phosphate synthase.
AK103501GGTGGGCCCGNONE
J023102F09GGTGGGCCCGNONE
J023103H09GGTGGGCCCGNONE
J023107F22GGTGGGCCCGNONE
J033031E17GGTGGGCCCGNONE
J033090C03GGTGGGCCCGNONE
J033090C17GGTGGGCCCGNONE
J033091K19GGTGGGCCCGNONE
J033131B11GGTGGGCCCGNONE
J033133D04GGTGGGCCCGNONE
J053050C09GGTGGGCCCGNONE
J053078O12GGTGGGCCCGNONE
J075037B10GGTGGGCCCGNONE
J090021M23GGTGGGCCCGNONE
Os03g0195900J065063O15ATTGGGCCCGNONE
Os03g0199500J065099N05CCCGGGCCCCNONE
J065099N05CCCGTGGGNONE
J065152P14CCCGGGCCCCConserved hypothetical protein.
J065152P14CCCGTGGGConserved hypothetical protein.
J080009C14CCCGGGCCCCNONE
J080009C14CCCGTGGGNONE
J080011K01CCCGGGCCCCNONE
J080011K01CCCGTGGGNONE
J080015H12CCCGGGCCCCNONE
J080015H12CCCGTGGGNONE
J080022K05CCCGGGCCCCNONE
J080022K05CCCGTGGGNONE
J080034G01CCCGGGCCCCNONE
J080034G01CCCGTGGGNONE
J080038I04CCCGGGCCCCNONE
J080038I04CCCGTGGGNONE
J080039F20CCCGGGCCCCNONE
J080039F20CCCGTGGGNONE
J080042J22CCCGGGCCCCNONE
J080042J22CCCGTGGGNONE
J080042N23CCCGGGCCCCNONE
J080042N23CCCGTGGGNONE
J080043E07CCCGGGCCCCNONE
J080043E07CCCGTGGGNONE
J080050A12CCCGGGCCCCNONE
J080050A12CCCGTGGGNONE
J080050C11CCCGGGCCCCNONE
J080050C11CCCGTGGGNONE
J080052B01CCCGGGCCCCNONE
J080052B01CCCGTGGGNONE
J080052H22CCCGGGCCCCNONE
J080052H22CCCGTGGGNONE
J080060E02CCCGGGCCCCNONE
J080060E02CCCGTGGGNONE
J080063K24CCCGGGCCCCNONE
J080063K24CCCGTGGGNONE
J080067I07CCCGGGCCCCNONE
J080067I07CCCGTGGGNONE
J080081H22CCCGGGCCCCNONE
J080081H22CCCGTGGGNONE
J080085J10CCCGGGCCCCNONE
J080085J10CCCGTGGGNONE
J080089E20CCCGGGCCCCNONE
J080089E20CCCGTGGGNONE
J080092N04CCCGGGCCCCNONE
J080092N04CCCGTGGGNONE
J080093B01CCCGGGCCCCNONE
J080093B01CCCGTGGGNONE
J080093N04CCCGGGCCCCNONE
J080093N04CCCGTGGGNONE
J080097B03CCCGGGCCCCNONE
J080097B03CCCGTGGGNONE
Os03g0205500Os03g0205500CGGGCCGTCCCytochrome b5 domain containing protein.
Os03g0206400AK066494GGGTGGGCCCGCConserved hypothetical protein.
AK107011GGGTGGGCCCGCNONE
J065162G04GGGTGGGCCCGCNONE
Os03g0210400AK065966AACGGGCCProtein prenyltransferase domain containing protein.
Os03g0213600AK100407AAACGGCCCGConserved hypothetical protein.
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter.
AK099306TCCGGCCCGTGGGCCGCNONE
AY342321TCCGGCCCGTGGGCCGCNONE
J023066K08TCCGGCCCGTGGGCCGCNONE
J100032N19TCCGGCCCGTGGGCCGCNONE
Os03g0219200011-045-E01CCCGTGGGCNONE
AK073785CCCGTGGGCSimilar to Superoxide dismutase (EC 1.15.1.1).
J033068D19CCCGTGGGCNONE
J043009H23CCCGTGGGCNONE
Os03g0222100AK070688CCCGGGCCCACTSimilar to Topoisomerase-like protein.
J023057E15CCCGGGCCCACTNONE
J023099M24CCCGGGCCCACTNONE
J023147F14CCCGGGCCCACTNONE
Os03g0240700009-086-G10TAATGGGCCCGGCCCAAACNONE
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein.
J023112A13TAATGGGCCCGGCCCAAACNONE
J043022A01TAATGGGCCCGGCCCAAACNONE
J065106A01TAATGGGCCCGGCCCAAACNONE
J075023P22TAATGGGCCCGGCCCAAACNONE
J075138I21TAATGGGCCCGGCCCAAACNONE
J075173L02TAATGGGCCCGGCCCAAACNONE
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE
AK059292GTTTGGGCCGGGCCCATTANONE
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp.
AK121552GTTTGGGCCGGGCCCATTANONE
J023131D06GTTTGGGCCGGGCCCATTANONE
J033033E14GTTTGGGCCGGGCCCATTANONE
J033105B01GTTTGGGCCGGGCCCATTANONE
J033114L18GTTTGGGCCGGGCCCATTANONE
J033132N24GTTTGGGCCGGGCCCATTANONE
J065032H03GTTTGGGCCGGGCCCATTANONE
J065115J20GTTTGGGCCGGGCCCATTANONE
J065150C05GTTTGGGCCGGGCCCATTANONE
J080302A11GTTTGGGCCGGGCCCATTANONE
J080302H16GTTTGGGCCGGGCCCATTANONE
J080305M12GTTTGGGCCGGGCCCATTANONE
J080306F13GTTTGGGCCGGGCCCATTANONE
J080312A06GTTTGGGCCGGGCCCATTANONE
J090088P09GTTTGGGCCGGGCCCATTANONE
Os03g0242300AK065146GGCCCGTTConserved hypothetical protein.
J013002A22GGCCCGTTNONE
J023088H11GGCCCGTTNONE
J065083M12GGCCCGTTNONE
J065169P06GGCCCGTTNONE
J100037B08GGCCCGTTNONE
Os03g0244700011-100-F11CCCACGGGCCCACCTNONE
015-065-B06CCCACGGGCCCACCTNONE
AK100399CCCACGGGCCCACCTNONE
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein.
J023086N09CCCACGGGCCCACCTNONE
J100032P14CCCACGGGCCCACCTNONE
Os03g0245200003-116-E09AACGGGCCNONE
AK062288AACGGGCCProtein of unknown function DUF1210 family protein.
J075022G03AACGGGCCNONE
J075088C24AACGGGCCNONE
J075110L07AACGGGCCNONE
J075112K01AACGGGCCNONE
J075131F24AACGGGCCNONE
J075149D10AACGGGCCNONE
Os03g0248600AK073611AACGGGCCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
AK099342AACGGGCCNONE
AK099342CCAACGGCCCGGCNONE
AK104877AACGGGCCNONE
AK104877CCAACGGCCCGGCNONE
J013026L10AACGGGCCNONE
J013026L10CCAACGGCCCGGCNONE
J013055P12AACGGGCCNONE
J013055P12CCAACGGCCCGGCNONE
J023091A14AACGGGCCNONE
J023091A14CCAACGGCCCGGCNONE
J033034G07AACGGGCCNONE
J033034G07CCAACGGCCCGGCNONE
J033048H19AACGGGCCNONE
J033048H19CCAACGGCCCGGCNONE
J033128D07AACGGGCCNONE
J033128D07CCAACGGCCCGGCNONE
J065060L24AACGGGCCNONE
J065060L24CCAACGGCCCGGCNONE
J065176A19AACGGGCCNONE
J065176A19CCAACGGCCCGGCNONE
J090018K08AACGGGCCNONE
J090018K08CCAACGGCCCGGCNONE
J090023C03AACGGGCCNONE
J090023C03CCAACGGCCCGGCNONE
Os03g0250400AK121385CGGGCCGTAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein.
J023108J02CGGGCCGTANONE
J023127J05CGGGCCGTANONE
J023128E15CGGGCCGTANONE
J075058L21CGGGCCGTANONE
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein.
Os03g0261800AK060717CCCCCACGGGNONE
AK121181CCCCCACGGGConserved hypothetical protein.
J023084D19CCCCCACGGGNONE
J065127D11CCCCCACGGGNONE
J065179G15CCCCCACGGGNONE
J090050I07CCCCCACGGGNONE
Os03g0265300011-009-B11CACGGCCCGNONE
AK101498CACGGCCCGMitochondrial substrate carrier family protein.
J043024D03CACGGCCCGNONE
J065096I09CACGGCCCGNONE
J100071C08CACGGCCCGNONE
Os03g0268300AK102684TGCGGGCCCCSimilar to Digalactosyldiacylglycerol synthase 2.
J013043J22TGCGGGCCCCNONE
J013057J23TGCGGGCCCCNONE
J013149I10TGCGGGCCCCNONE
J013149M20TGCGGGCCCCNONE
J013151D14TGCGGGCCCCNONE
J013162O11TGCGGGCCCCNONE
J023001F12TGCGGGCCCCNONE
J023031B21TGCGGGCCCCNONE
J023080A07TGCGGGCCCCNONE
J023081N04TGCGGGCCCCNONE
J023090C08TGCGGGCCCCNONE
J023134G05TGCGGGCCCCNONE
J023139G17TGCGGGCCCCNONE
J023143I10TGCGGGCCCCNONE
J023147D04TGCGGGCCCCNONE
J023147O15TGCGGGCCCCNONE
J033102K23TGCGGGCCCCNONE
J033106C17TGCGGGCCCCNONE
J075033G19TGCGGGCCCCNONE
J075039J18TGCGGGCCCCNONE
J075050K20TGCGGGCCCCNONE
J075075J03TGCGGGCCCCNONE
J075080E16TGCGGGCCCCNONE
J075086L08TGCGGGCCCCNONE
J075091K19TGCGGGCCCCNONE
J075099O20TGCGGGCCCCNONE
J075104I06TGCGGGCCCCNONE
J075137C16TGCGGGCCCCNONE
J075152G03TGCGGGCCCCNONE
J075176N12TGCGGGCCCCNONE
J100086K11TGCGGGCCCCNONE
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein.
J013157P04GCGGGCCCACCCACCGCACGCGNONE
J075041K23GCGGGCCCACCCACCGCACGCGNONE
Os03g0275700AK111329CCCGTGGGConserved hypothetical protein.
Os03g0277500014-019-A09CTCGGCCCGNONE
AK063650CTCGGCCCGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein.
J065043F18CTCGGCCCGNONE
J065092A08CTCGGCCCGNONE
J065122E17CTCGGCCCGNONE
J065182K12CTCGGCCCGNONE
J065197H15CTCGGCCCGNONE
J075115A05CTCGGCCCGNONE
Os03g0278200AK103544AAACGGCCCGNAD-dependent epimerase/dehydratase family protein.
AK103544GCGGGCCCCACCACNAD-dependent epimerase/dehydratase family protein.
Os03g0278400015-014-G10GCTGGGCCCGGGNONE
AK070052GCTGGGCCCGGGSimilar to ADP ribosylation GTPase-like protein (Fragment).
AY224461GCTGGGCCCGGGNONE
J065218E15GCTGGGCCCGGGNONE
J075115A06GCTGGGCCCGGGNONE
J075134I05GCTGGGCCCGGGNONE
J100032D08GCTGGGCCCGGGNONE
J100044O13GCTGGGCCCGGGNONE
J100051G15GCTGGGCCCGGGNONE
J100052O21GCTGGGCCCGGGNONE
J100071A12GCTGGGCCCGGGNONE
Os03g0278900006-049-H12TACGGCCCGTTNONE
006-082-A07TACGGCCCGTTNONE
009-169-C04TACGGCCCGTTNONE
AK066019TACGGCCCGTTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein.
AK105925TACGGCCCGTTNONE
AY224460TACGGCCCGTTNONE
J065021K17TACGGCCCGTTNONE
J065141H24TACGGCCCGTTNONE
J065142J20TACGGCCCGTTNONE
J065152J03TACGGCCCGTTNONE
J065163A13TACGGCCCGTTNONE
J065191I21TACGGCCCGTTNONE
J065193K12TACGGCCCGTTNONE
J075003D01TACGGCCCGTTNONE
J075017D24TACGGCCCGTTNONE
J075060F20TACGGCCCGTTNONE
J075154C11TACGGCCCGTTNONE
J075173F04TACGGCCCGTTNONE
Os03g0279200009-097-C06CGGGCCCACCACNONE
013-007-B07CGGGCCCACCACNONE
AK121750CGGGCCCACCACSimilar to Histone H2A.
J033087I02CGGGCCCACCACNONE
J065002G20CGGGCCCACCACNONE
J065102M04CGGGCCCACCACNONE
J065139A02CGGGCCCACCACNONE
J075109D21CGGGCCCACCACNONE
J075191L12CGGGCCCACCACNONE
J090096C03CGGGCCCACCACNONE
J100036C23CGGGCCCACCACNONE
Os03g0284000Os03g0284000CACGGCCCGGCCConserved hypothetical protein.
Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein.
Os03g0284500012-066-D02CGGGCCCCTCGCGCGNONE
AK105295CGGGCCCCTCGCGCGNONE
AK121300CGGGCCCCTCGCGCGHAD-superfamily subfamily IIA hydrolase, CECR5 protein.
Os03g0287900009-074-B07GCGGGCCCCACGTNONE
014-027-E07GCGGGCCCCACGTNONE
AK063663GCGGGCCCCACGTSimilar to Protein disulfide isomerase.
J065009N21GCGGGCCCCACGTNONE
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein.
Os03g0293500015-054-D06GCGGGCCCCANONE
AK101594GCGGGCCCCASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC) (Fragment).
AK119500GCGGGCCCCANONE
J033051F01GCGGGCCCCANONE
J090058D14GCGGGCCCCANONE
J100037N18GCGGGCCCCANONE
J100042J23GCGGGCCCCANONE
J100053E20GCGGGCCCCANONE
J100060G07GCGGGCCCCANONE
U27350GCGGGCCCCANONE
Os03g0294200AK069285CCCGGGCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase.
AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase.
Os03g0295700AK067856ACCGGGCCCCConserved hypothetical protein.
Os03g0298900006-028-C11CCCGTGGGACCCACNONE
AK060996CCCGTGGGACCCACHypothetical protein.
Os03g0302200AK120853AACGGGCCZinc finger, RING-type domain containing protein.
J023023P20AACGGGCCNONE
J023064E11AACGGGCCNONE
J033036C20AACGGGCCNONE
J043029P08AACGGGCCNONE
J065124C11AACGGGCCNONE
J090001K02AACGGGCCNONE
J090021D03AACGGGCCNONE
J090034D03AACGGGCCNONE
J090062J10AACGGGCCNONE
J100037A15AACGGGCCNONE
J100067M23AACGGGCCNONE
Os03g0302700006-099-F12ATCTCGGCCCGNONE
AK112010ATCTCGGCCCGZinc finger, RING-type domain containing protein.
AK121656ATCTCGGCCCGNONE
J075090A19ATCTCGGCCCGNONE
J075148M06ATCTCGGCCCGNONE
Os03g0302800AK061293GCGGGCCCCACCCCCCAConserved hypothetical protein.
Os03g0312300AK111364GACGGCCCGGCProtein of unknown function DUF26 domain containing protein.
Os03g0319300006-021-E05AACGGGCCGGTNONE
006-022-H12AACGGGCCGGTNONE
009-187-E02AACGGGCCGGTNONE
AF042840AACGGGCCGGTNONE
AK059756AACGGGCCGGTCalmodulin (CaM).
AK070090AACGGGCCGGTNONE
J065017J02AACGGGCCGGTNONE
J065028G17AACGGGCCGGTNONE
J065045N09AACGGGCCGGTNONE
J065078F21AACGGGCCGGTNONE
J065091H01AACGGGCCGGTNONE
J065112B19AACGGGCCGGTNONE
J065186E08AACGGGCCGGTNONE
J065199G12AACGGGCCGGTNONE
J075030K07AACGGGCCGGTNONE
J075050B02AACGGGCCGGTNONE
J075057G07AACGGGCCGGTNONE
J075070F01AACGGGCCGGTNONE
J075093N12AACGGGCCGGTNONE
J075095K13AACGGGCCGGTNONE
J075102D14AACGGGCCGGTNONE
J075103B17AACGGGCCGGTNONE
J075114K05AACGGGCCGGTNONE
J075142F18AACGGGCCGGTNONE
J075154L11AACGGGCCGGTNONE
J075185F08AACGGGCCGGTNONE
J090012A14AACGGGCCGGTNONE
J090044L10AACGGGCCGGTNONE
J100044C12AACGGGCCGGTNONE
J100088J19AACGGGCCGGTNONE
Os03g0322600009-180-H12AACGGGCCNONE
AK067222AACGGGCCHypothetical protein.
J065017H05AACGGGCCNONE
J065118G12AACGGGCCNONE
J065175F07AACGGGCCNONE
J065175N14AACGGGCCNONE
Os03g0336200AK059473CCCGTGGGCNONE
AK070466CCCGTGGGCTranscription factor RF2b.
AY466471CCCGTGGGCNONE
Os03g0338600AK066604AACGGGCCGAtRNA pseudouridine synthase family protein.
Os03g0340500012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE
AK099406TGTGGGGCCCACGGGTCAGTGGNONE
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13).
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE
Os03g0340700011-070-H05CGGGCCGAGTTGGGCCTANONE
AK100470CGGGCCGAGTTGGGCCTATetratricopeptide-like helical domain containing protein.
J013158I08CGGGCCGAGTTGGGCCTANONE
J023009H24CGGGCCGAGTTGGGCCTANONE
J023031L20CGGGCCGAGTTGGGCCTANONE
J023093E24CGGGCCGAGTTGGGCCTANONE
J023105J11CGGGCCGAGTTGGGCCTANONE
J100059O05CGGGCCGAGTTGGGCCTANONE
J100075G03CGGGCCGAGTTGGGCCTANONE
J100086J06CGGGCCGAGTTGGGCCTANONE
Os03g0342900006-032-D01CCCGTGGGCCCCACNONE
006-033-E10CCCGTGGGCCCCACNONE
006-051-G06CCCGTGGGCCCCACNONE
006-053-E05CCCGTGGGCCCCACNONE
006-056-B05CCCGTGGGCCCCACNONE
006-058-F04CCCGTGGGCCCCACNONE
006-059-E05CCCGTGGGCCCCACNONE
006-060-F10CCCGTGGGCCCCACNONE
006-104-D12CCCGTGGGCCCCACNONE
009-129-C12CCCGTGGGCCCCACNONE
AK060136CCCGTGGGCCCCACNONE
AK060980CCCGTGGGCCCCACNONE
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein.
AK104244CCCGTGGGCCCCACNONE
AK104391CCCGTGGGCCCCACNONE
AK104590CCCGTGGGCCCCACNONE
AK104744CCCGTGGGCCCCACNONE
AK106100CCCGTGGGCCCCACNONE
J013000E10CCCGTGGGCCCCACNONE
J075027O22CCCGTGGGCCCCACNONE
J075052J03CCCGTGGGCCCCACNONE
J075066E15CCCGTGGGCCCCACNONE
J075095C17CCCGTGGGCCCCACNONE
J075118N05CCCGTGGGCCCCACNONE
J075187K22CCCGTGGGCCCCACNONE
J090026L04CCCGTGGGCCCCACNONE
J090059G16CCCGTGGGCCCCACNONE
J100055P20CCCGTGGGCCCCACNONE
J100062A10CCCGTGGGCCCCACNONE
J100068G20CCCGTGGGCCCCACNONE
Os03g0344100009-166-F10TATGGGCCCGNONE
009-166-F10TCCAACGGGCCNONE
AK061903TATGGGCCCGNONE
AK061903TCCAACGGGCCNONE
AK065547TATGGGCCCGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''.
AK065547TCCAACGGGCCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''.
J023095G24TATGGGCCCGNONE
J023095G24TCCAACGGGCCNONE
J033087C06TATGGGCCCGNONE
J033087C06TCCAACGGGCCNONE
J053073I09TATGGGCCCGNONE
J053073I09TCCAACGGGCCNONE
J065189D11TATGGGCCCGNONE
J065189D11TCCAACGGGCCNONE
J090032B15TATGGGCCCGNONE
J090032B15TCCAACGGGCCNONE
Os03g0356484009-038-H01ACCGGGCCCCACANONE
AK105146ACCGGGCCCCACATetratricopeptide-like helical domain containing protein.
J065204G11ACCGGGCCCCACANONE
Os03g0360700006-032-A11GGCCCGTTNONE
AK068764GGCCCGTTSimilar to Protein-methionine-S-oxide reductase, PilB family.
AK109429GGCCCGTTNONE
AY224463GGCCCGTTNONE
Os03g0372900AK100417GAAGCCCACGGGCyclin-like F-box domain containing protein.
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein.
J023020L05GGCCGGGCCCCACCCGNONE
J023026H16GGCCGGGCCCCACCCGNONE
J033025P22GGCCGGGCCCCACCCGNONE
J075016I21GGCCGGGCCCCACCCGNONE
J090015G21GGCCGGGCCCCACCCGNONE
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein.
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK068704GACAGGTGGGCCCGTTNONE
J013159M16GACAGGTGGGCCCGTTNONE
J090067F01GACAGGTGGGCCCGTTNONE
J090083F21GACAGGTGGGCCCGTTNONE
J100040M08GACAGGTGGGCCCGTTNONE
J100048C03GACAGGTGGGCCCGTTNONE
J100056M07GACAGGTGGGCCCGTTNONE
J100062N22GACAGGTGGGCCCGTTNONE
J100086L07GACAGGTGGGCCCGTTNONE
Os03g0383100AK107106CCCGGGCCGAAAConserved hypothetical protein.
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like.
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE
Os03g0390400009-175-E06TCCGGGCCCATTTNONE
013-040-G01TCCGGGCCCATTTNONE
014-050-G05TCCGGGCCCATTTNONE
AB025187TCCGGGCCCATTTSimilar to Cytochrome c oxidase subunit 6b.
AK120174TCCGGGCCCATTTNONE
J013033A17TCCGGGCCCATTTNONE
J023028J08TCCGGGCCCATTTNONE
J023061N05TCCGGGCCCATTTNONE
J023077A03TCCGGGCCCATTTNONE
J023086E01TCCGGGCCCATTTNONE
J033022A08TCCGGGCCCATTTNONE
J033040F24TCCGGGCCCATTTNONE
J075073I24TCCGGGCCCATTTNONE
J075081H01TCCGGGCCCATTTNONE
J075175N19TCCGGGCCCATTTNONE
J100025M03TCCGGGCCCATTTNONE
J100036J06TCCGGGCCCATTTNONE
J100045O18TCCGGGCCCATTTNONE
J100062G15TCCGGGCCCATTTNONE
J100090N19TCCGGGCCCATTTNONE
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment).
J023014O18CGTGTGGGCCCGGGCCCGGANONE
J023036P06CGTGTGGGCCCGGGCCCGGANONE
J023145E24CGTGTGGGCCCGGGCCCGGANONE
J033142I11CGTGTGGGCCCGGGCCCGGANONE
J043003A10CGTGTGGGCCCGGGCCCGGANONE
J075023H21CGTGTGGGCCCGGGCCCGGANONE
J075145O10CGTGTGGGCCCGGGCCCGGANONE
J075149A03CGTGTGGGCCCGGGCCCGGANONE
J090099B09CGTGTGGGCCCGGGCCCGGANONE
J100017L14CGTGTGGGCCCGGGCCCGGANONE
J100050K18CGTGTGGGCCCGGGCCCGGANONE
J100063P16CGTGTGGGCCCGGGCCCGGANONE
Os03g0410700J065102A22AACTGGGCCCGNONE
Os03g0410900J065067F10CGGGCCCAGTTNONE
J065073D08CGGGCCCAGTTNONE
J065176C06CGGGCCCAGTTNONE
J065189O13CGGGCCCAGTTNONE
J065214E05CGGGCCCAGTTNONE
J080007H09CGGGCCCAGTTNONE
J080012B19CGGGCCCAGTTNONE
J080020J16CGGGCCCAGTTNONE
J080038J22CGGGCCCAGTTNONE
J080045I09CGGGCCCAGTTNONE
J080059M16CGGGCCCAGTTNONE
J080060C19CGGGCCCAGTTNONE
J080080P22CGGGCCCAGTTNONE
J080083C03CGGGCCCAGTTNONE
J080093M17CGGGCCCAGTTNONE
J100029F12CGGGCCCAGTTLike-Sm ribonucleoprotein, core family protein.
Os03g0413000009-180-E02CGGGCCCACCCNONE
009-188-B06CGGGCCCACCCNONE
AK060225CGGGCCCACCCNONE
AY062181CGGGCCCACCCSimilar to Potential histone-like transcription factor.
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39.
J023106M18CCGATCCGACGGCCCGNONE
J065178J05CCGATCCGACGGCCCGNONE
J065196F10CCGATCCGACGGCCCGNONE
Os03g0588700Os03g0588700GCGGGCCCCACACConserved hypothetical protein.
Os03g0598200AK068322AACGGGCCNop14-like protein family protein.
Os03g0616300AK066372CCCACGGGSimilar to DNA polymerase kappa (EC 2.7.7.7) (DINB protein) (DINP). Splice isoform 4.
AK102930CCCACGGGNONE
J013064K08CCCACGGGNONE
J013102J23CCCACGGGNONE
J033114G19CCCACGGGNONE
J075037A20CCCACGGGNONE
J075131B16CCCACGGGNONE
Os03g0625900AK101109CGGGCCCAAAAWD40-like domain containing protein.
Os03g0626250J075100A11CGGGCCCATCANONE
J075134H15CGGGCCCATCANONE
J075142J02CGGGCCCATCANONE
J075181A14CGGGCCCATCANONE
J075192K17CGGGCCCATCANONE
J090046B06CGGGCCCATCANONE
Os03g0628900009-062-G01ATTTGGGCCCGGGNONE
AK103619ATTTGGGCCCGGGPrefoldin domain containing protein.
J033133L23ATTTGGGCCCGGGNONE
J100039C17ATTTGGGCCCGGGNONE
J100048I07ATTTGGGCCCGGGNONE
J100062E19ATTTGGGCCCGGGNONE
J100063B11ATTTGGGCCCGGGNONE
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment).
J065038L22CCCGGGCCCCACCTGTCNONE
J065185C13CCCGGGCCCCACCTGTCNONE
Os03g0648400005-003-D07CCCGGGCCCAGCNONE
006-048-C12CCCGGGCCCAGCNONE
006-049-A03CCCGGGCCCAGCNONE
011-008-F07CCCGGGCCCAGCNONE
011-039-A07CCCGGGCCCAGCNONE
011-044-D10CCCGGGCCCAGCNONE
011-099-C01CCCGGGCCCAGCNONE
012-051-B09CCCGGGCCCAGCNONE
012-051-D08CCCGGGCCCAGCNONE
012-056-G07CCCGGGCCCAGCNONE
012-062-A01CCCGGGCCCAGCNONE
012-079-C03CCCGGGCCCAGCNONE
014-003-A06CCCGGGCCCAGCNONE
015-010-D02CCCGGGCCCAGCNONE
AK102263CCCGGGCCCAGCSimilar to DnaJ protein homolog (DNAJ-1).
AK103763CCCGGGCCCAGCNONE
AK105028CCCGGGCCCAGCNONE
AY224432CCCGGGCCCAGCNONE
J013043H01CCCGGGCCCAGCNONE
J013134K10CCCGGGCCCAGCNONE
J023037D18CCCGGGCCCAGCNONE
J023077K20CCCGGGCCCAGCNONE
J023105M19CCCGGGCCCAGCNONE
J023131M09CCCGGGCCCAGCNONE
J033022F05CCCGGGCCCAGCNONE
J033051J22CCCGGGCCCAGCNONE
J033061D03CCCGGGCCCAGCNONE
J033084H04CCCGGGCCCAGCNONE
J033088M01CCCGGGCCCAGCNONE
J033119H12CCCGGGCCCAGCNONE
J033131C18CCCGGGCCCAGCNONE
J043030C06CCCGGGCCCAGCNONE
J080032A08CCCGGGCCCAGCNONE
J090008C11CCCGGGCCCAGCNONE
J090014D24CCCGGGCCCAGCNONE
J090024C20CCCGGGCCCAGCNONE
J090024H08CCCGGGCCCAGCNONE
J090029F10CCCGGGCCCAGCNONE
J090032K16CCCGGGCCCAGCNONE
J090034L14CCCGGGCCCAGCNONE
J090035C20CCCGGGCCCAGCNONE
J090044H05CCCGGGCCCAGCNONE
J090048M09CCCGGGCCCAGCNONE
J090056I15CCCGGGCCCAGCNONE
J090062B01CCCGGGCCCAGCNONE
J090076F06CCCGGGCCCAGCNONE
J090077A02CCCGGGCCCAGCNONE
J090084E21CCCGGGCCCAGCNONE
J090084J09CCCGGGCCCAGCNONE
J090086G11CCCGGGCCCAGCNONE
J090092C20CCCGGGCCCAGCNONE
J100018G14CCCGGGCCCAGCNONE
J100018I22CCCGGGCCCAGCNONE
J100024N14CCCGGGCCCAGCNONE
J100032K09CCCGGGCCCAGCNONE
J100036F09CCCGGGCCCAGCNONE
J100041M04CCCGGGCCCAGCNONE
J100042H05CCCGGGCCCAGCNONE
J100043P19CCCGGGCCCAGCNONE
J100044B04CCCGGGCCCAGCNONE
J100049L24CCCGGGCCCAGCNONE
J100050M21CCCGGGCCCAGCNONE
J100057F24CCCGGGCCCAGCNONE
J100063I11CCCGGGCCCAGCNONE
J100064J24CCCGGGCCCAGCNONE
J100070B13CCCGGGCCCAGCNONE
J100076A13CCCGGGCCCAGCNONE
J100081C20CCCGGGCCCAGCNONE
J100081L09CCCGGGCCCAGCNONE
J100084G23CCCGGGCCCAGCNONE
J100088H02CCCGGGCCCAGCNONE
Os03g0654800013-068-E05TCGGCCCGNONE
AK103330TCGGCCCGHypothetical protein.
J033125N05TCGGCCCGNONE
J065171F15TCGGCCCGNONE
J100056J05TCGGCCCGNONE
J100069D02TCGGCCCGNONE
Os03g0656900AK066416GACGGCCCGNusB/RsmB/TIM44 domain containing protein.
J065157L23GACGGCCCGNONE
J065166P22GACGGCCCGNONE
Os03g0659900AK067560GCGGGCCCCASimilar to S3 self-incompatibility locus-linked pollen 3.15 protein.
J090029C14GCGGGCCCCANONE
Os03g0666200AK102364GCGGGCCCACTCTPleckstrin homology-type domain containing protein.
J033097E16GCGGGCCCACTCTNONE
Os03g0668900AK108369TCGGCCCGConserved hypothetical protein.
Os03g0669200J013037D23GCGGGCCCCACGTNONE
J023026K09GCGGGCCCCACGTNONE
J075008E21GCGGGCCCCACGTNONE
J075061B21GCGGGCCCCACGTNONE
J075151B13GCGGGCCCCACGTNONE
J075195L02GCGGGCCCCACGTNONE
J090061B07GCGGGCCCCACGTNONE
Os03g0698900013-074-A08CGGGCCCCACCAACNONE
AK073303CGGGCCCCACCAACAlkaline phytoceramidase family protein.
AK103953CGGGCCCCACCAACNONE
J033024P22CGGGCCCCACCAACNONE
J065194N16CGGGCCCCACCAACNONE
J065195O11CGGGCCCCACCAACNONE
J075020F03CGGGCCCCACCAACNONE
J075032P18CGGGCCCCACCAACNONE
J075037H13CGGGCCCCACCAACNONE
J075147I01CGGGCCCCACCAACNONE
J075187B13CGGGCCCCACCAACNONE
J100043G08CGGGCCCCACCAACNONE
J100060L06CGGGCCCCACCAACNONE
J100063O21CGGGCCCCACCAACNONE
J100066O13CGGGCCCCACCAACNONE
J100072K20CGGGCCCCACCAACNONE
J100083G21CGGGCCCCACCAACNONE
J100085D07CGGGCCCCACCAACNONE
Os03g0701000J075172J23CCCGGGCCCACCCGNONE
Os03g0701700011-034-E06CCCGTGGGCCACNONE
AF013979CCCGTGGGCCACNONE
AK065161CCCGTGGGCCACSimilar to Ethylene receptor.
AK067813CCCGTGGGCCACNONE
J013002C04CCCGTGGGCCACNONE
J013035M07CCCGTGGGCCACNONE
J013049B10CCCGTGGGCCACNONE
J013065F11CCCGTGGGCCACNONE
J013072K18CCCGTGGGCCACNONE
J013073P08CCCGTGGGCCACNONE
J013098F08CCCGTGGGCCACNONE
J013154M13CCCGTGGGCCACNONE
J023001H02CCCGTGGGCCACNONE
J023003D16CCCGTGGGCCACNONE
J023014P17CCCGTGGGCCACNONE
J023036A22CCCGTGGGCCACNONE
J023038N01CCCGTGGGCCACNONE
J023042E11CCCGTGGGCCACNONE
J023058O05CCCGTGGGCCACNONE
J023084D05CCCGTGGGCCACNONE
J023088O17CCCGTGGGCCACNONE
J023138O11CCCGTGGGCCACNONE
J023147A10CCCGTGGGCCACNONE
J033029G18CCCGTGGGCCACNONE
J033031N13CCCGTGGGCCACNONE
J033090D09CCCGTGGGCCACNONE
J033091I06CCCGTGGGCCACNONE
J033096B20CCCGTGGGCCACNONE
J033101A19CCCGTGGGCCACNONE
J033135D03CCCGTGGGCCACNONE
J043001L13CCCGTGGGCCACNONE
J043020A13CCCGTGGGCCACNONE
J053071K24CCCGTGGGCCACNONE
J053092L14CCCGTGGGCCACNONE
J053099F19CCCGTGGGCCACNONE
J065009P22CCCGTGGGCCACNONE
J065046A22CCCGTGGGCCACNONE
J065099K22CCCGTGGGCCACNONE
J065112O22CCCGTGGGCCACNONE
J065119K11CCCGTGGGCCACNONE
J065212B11CCCGTGGGCCACNONE
J090022A11CCCGTGGGCCACNONE
J090054F15CCCGTGGGCCACNONE
J090076B20CCCGTGGGCCACNONE
J090099M22CCCGTGGGCCACNONE
J100032L01CCCGTGGGCCACNONE
J100065H13CCCGTGGGCCACNONE
Os03g0701900AK068404TTTCGGCCCGConserved hypothetical protein.
Os03g0702000011-023-H12CCCACGGGNONE
AK105398CCCACGGGNONE
AK119905CCCACGGGUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK121682CCCACGGGNONE
J033070B15CCCACGGGNONE
J033117B11CCCACGGGNONE
Os03g0703300016-074-H01CTCGGCCCGGANONE
AK073831CTCGGCCCGGACalponin-like actin-binding domain containing protein.
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein.
AK098968AACTGGGCCCGGTTGGGCCAGNONE
Os03g0726900AK072553GGCCCGTTTGGGCCACConserved hypothetical protein.
AK100280GGCCCGTTTGGGCCACNONE
Os03g0736300AK104929GGGACCCGTGGGGCNONE
Os03g0736600AK060375GGGGCCCGGTCCAGAConserved hypothetical protein.
Os03g0736700AK060219CCACGGCCCGNONE
Os03g0737600014-094-E01CTCCCCCACGGGNONE
014-094-E01TACTGGGCCGGGCCGANONE
AB038234CTCCCCCACGGGNONE
AB038234TACTGGGCCGGGCCGANONE
AK101854CTCCCCCACGGGCyclin H-1.
AK101854TACTGGGCCGGGCCGACyclin H-1.
AK105468CTCCCCCACGGGNONE
AK105468TACTGGGCCGGGCCGANONE
J033069N12CTCCCCCACGGGNONE
J033069N12TACTGGGCCGGGCCGANONE
J043017A22CTCCCCCACGGGNONE
J043017A22TACTGGGCCGGGCCGANONE
J065154A20CTCCCCCACGGGNONE
J065154A20TACTGGGCCGGGCCGANONE
Os03g0740700011-093-H12CGGGCCGATGGGCCGANONE
AK102723CGGGCCGATGGGCCGAProtein similar to CwfJ, C-terminal 1 domain containing protein.
J013059N19CGGGCCGATGGGCCGANONE
J013126N16CGGGCCGATGGGCCGANONE
J033105J16CGGGCCGATGGGCCGANONE
J090059D19CGGGCCGATGGGCCGANONE
Os03g0746000AK073682GACGGCCCGCAConserved hypothetical protein.
AK111472GACGGCCCGCANONE
J090083F05GACGGCCCGCANONE
Os03g0748500AK110695TCCGGGCCGAANONE
Os03g0752800AB041020GGGGCCCGGGCCGGCNONE
AF058697GGGGCCCGGGCCGGCMADS14 protein.
AF139664GGGGCCCGGGCCGGCNONE
AK121171GGGGCCCGGGCCGGCNONE
AY332478GGGGCCCGGGCCGGCNONE
AY551916GGGGCCCGGGCCGGCNONE
J023081C04GGGGCCCGGGCCGGCNONE
Os03g0755000AK068540ACCGGGCCCATACSimilar to Serine/threonine kinase (Fragment).
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein.
J013095D02CCGTGGGCCGGTGGGCCCGNONE
J023091G12CCGTGGGCCGGTGGGCCCGNONE
J065207J17CCGTGGGCCGGTGGGCCCGNONE
J100067G13CCGTGGGCCGGTGGGCCCGNONE
J100089L11CCGTGGGCCGGTGGGCCCGNONE
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D).
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D).
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein.
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE
Os03g0780600AK120180CCCGTGGGCCCCACGTNONE
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin).
J013033M18CCCGTGGGCCCCACGTNONE
J033022G05CCCGTGGGCCCCACGTNONE
J033028A16CCCGTGGGCCCCACGTNONE
J033050M08CCCGTGGGCCCCACGTNONE
J090053F04CCCGTGGGCCCCACGTNONE
J090064E19CCCGTGGGCCCCACGTNONE
J090083J24CCCGTGGGCCCCACGTNONE
J100024I23CCCGTGGGCCCCACGTNONE
Os03g0780800AK059874GGCCCGGGCCCACCACNONE
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein.
J065214L21GGCCCGGGCCCACCACNONE
J075178I24GGCCCGGGCCCACCACNONE
J075197K14GGCCCGGGCCCACCACNONE
Os03g0789200015-015-H03CCCGGGCCCACCANONE
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein.
AY224542CCCGGGCCCACCANONE
J023110P10CCCGGGCCCACCANONE
J075039H19CCCGGGCCCACCANONE
Os03g0792500011-040-A04GGCCCGTTNONE
013-014-E06GGCCCGTTNONE
AK068848GGCCCGTTSimilar to Zinc finger POZ domain protein (Fragment).
AK100829GGCCCGTTNONE
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein.
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE
Os03g0796800J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein.
J065024O22TGTGGGCCCGCConserved hypothetical protein.
Os03g0797000AK073440AACGGGCCSimilar to Indole synthase.
Os03g0798600AK121716TCTGGGCCCGSimilar to 40S ribosomal protein S15 (Fragment).
J013120B18TCTGGGCCCGNONE
J033079G18TCTGGGCCCGNONE
J043038B19TCTGGGCCCGNONE
J065091E15TCTGGGCCCGNONE
J065092P10TCTGGGCCCGNONE
J065189F18TCTGGGCCCGNONE
J065189L12TCTGGGCCCGNONE
J075021B11TCTGGGCCCGNONE
J075022L15TCTGGGCCCGNONE
J075046G12TCTGGGCCCGNONE
J075080H15TCTGGGCCCGNONE
J090045H01TCTGGGCCCGNONE
J090077H16TCTGGGCCCGNONE
J090083D22TCTGGGCCCGNONE
J100021D24TCTGGGCCCGNONE
J100023G04TCTGGGCCCGNONE
J100049J23TCTGGGCCCGNONE
J100075K23TCTGGGCCCGNONE
J100077G22TCTGGGCCCGNONE
Os03g0807200011-031-F07CGGGCCGTGNONE
011-031-F07GTTTGGGCCGGGCCGTCNONE
AK063932CGGGCCGTGNONE
AK063932GTTTGGGCCGGGCCGTCNONE
AK103496CGGGCCGTGProtein of unknown function DUF1639 family protein.
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein.
J033131A04CGGGCCGTGNONE
J033131A04GTTTGGGCCGGGCCGTCNONE
J065109O03CGGGCCGTGNONE
J065109O03GTTTGGGCCGGGCCGTCNONE
J080001M11CGGGCCGTGNONE
J080001M11GTTTGGGCCGGGCCGTCNONE
J080002H18CGGGCCGTGNONE
J080002H18GTTTGGGCCGGGCCGTCNONE
J080005I08CGGGCCGTGNONE
J080005I08GTTTGGGCCGGGCCGTCNONE
J080006B05CGGGCCGTGNONE
J080006B05GTTTGGGCCGGGCCGTCNONE
J080006D17CGGGCCGTGNONE
J080006D17GTTTGGGCCGGGCCGTCNONE
J080007M19CGGGCCGTGNONE
J080007M19GTTTGGGCCGGGCCGTCNONE
J080011E07CGGGCCGTGNONE
J080011E07GTTTGGGCCGGGCCGTCNONE
J080012H06CGGGCCGTGNONE
J080012H06GTTTGGGCCGGGCCGTCNONE
J080014D08CGGGCCGTGNONE
J080014D08GTTTGGGCCGGGCCGTCNONE
J080017D06CGGGCCGTGNONE
J080017D06GTTTGGGCCGGGCCGTCNONE
J080017K17CGGGCCGTGNONE
J080017K17GTTTGGGCCGGGCCGTCNONE
J080020B17CGGGCCGTGNONE
J080020B17GTTTGGGCCGGGCCGTCNONE
J080021O05CGGGCCGTGNONE
J080021O05GTTTGGGCCGGGCCGTCNONE
J080021O15CGGGCCGTGNONE
J080021O15GTTTGGGCCGGGCCGTCNONE
J080023I18CGGGCCGTGNONE
J080023I18GTTTGGGCCGGGCCGTCNONE
J080025A21CGGGCCGTGNONE
J080025A21GTTTGGGCCGGGCCGTCNONE
J080027P22CGGGCCGTGNONE
J080027P22GTTTGGGCCGGGCCGTCNONE
J080028M22CGGGCCGTGNONE
J080028M22GTTTGGGCCGGGCCGTCNONE
J080029B09CGGGCCGTGNONE
J080029B09GTTTGGGCCGGGCCGTCNONE
J080029M07CGGGCCGTGNONE
J080029M07GTTTGGGCCGGGCCGTCNONE
J080029M17CGGGCCGTGNONE
J080029M17GTTTGGGCCGGGCCGTCNONE
J080030H23CGGGCCGTGNONE
J080030H23GTTTGGGCCGGGCCGTCNONE
J080030K16CGGGCCGTGNONE
J080030K16GTTTGGGCCGGGCCGTCNONE
J080030L19CGGGCCGTGNONE
J080030L19GTTTGGGCCGGGCCGTCNONE
J080031A12CGGGCCGTGNONE
J080031A12GTTTGGGCCGGGCCGTCNONE
J080031N21CGGGCCGTGNONE
J080031N21GTTTGGGCCGGGCCGTCNONE
J080032G05CGGGCCGTGNONE
J080032G05GTTTGGGCCGGGCCGTCNONE
J080032P20CGGGCCGTGNONE
J080032P20GTTTGGGCCGGGCCGTCNONE
J080033H20CGGGCCGTGNONE
J080033H20GTTTGGGCCGGGCCGTCNONE
J080034H22CGGGCCGTGNONE
J080034H22GTTTGGGCCGGGCCGTCNONE
J080034J03CGGGCCGTGNONE
J080034J03GTTTGGGCCGGGCCGTCNONE
J080034J16CGGGCCGTGNONE
J080034J16GTTTGGGCCGGGCCGTCNONE
J080034N01CGGGCCGTGNONE
J080034N01GTTTGGGCCGGGCCGTCNONE
J080035K20CGGGCCGTGNONE
J080035K20GTTTGGGCCGGGCCGTCNONE
J080036I04CGGGCCGTGNONE
J080036I04GTTTGGGCCGGGCCGTCNONE
J080036I19CGGGCCGTGNONE
J080036I19GTTTGGGCCGGGCCGTCNONE
J080036O21CGGGCCGTGNONE
J080036O21GTTTGGGCCGGGCCGTCNONE
J080038D06CGGGCCGTGNONE
J080038D06GTTTGGGCCGGGCCGTCNONE
J080039J15CGGGCCGTGNONE
J080039J15GTTTGGGCCGGGCCGTCNONE
J080039P18CGGGCCGTGNONE
J080039P18GTTTGGGCCGGGCCGTCNONE
J080041H20CGGGCCGTGNONE
J080041H20GTTTGGGCCGGGCCGTCNONE
J080041M11CGGGCCGTGNONE
J080041M11GTTTGGGCCGGGCCGTCNONE
J080042F14CGGGCCGTGNONE
J080042F14GTTTGGGCCGGGCCGTCNONE
J080043G10CGGGCCGTGNONE
J080043G10GTTTGGGCCGGGCCGTCNONE
J080043J02CGGGCCGTGNONE
J080043J02GTTTGGGCCGGGCCGTCNONE
J080044C19CGGGCCGTGNONE
J080044C19GTTTGGGCCGGGCCGTCNONE
J080044G11CGGGCCGTGNONE
J080044G11GTTTGGGCCGGGCCGTCNONE
J080045M03CGGGCCGTGNONE
J080045M03GTTTGGGCCGGGCCGTCNONE
J080045N07CGGGCCGTGNONE
J080045N07GTTTGGGCCGGGCCGTCNONE
J080047K14CGGGCCGTGNONE
J080047K14GTTTGGGCCGGGCCGTCNONE
J080049I21CGGGCCGTGNONE
J080049I21GTTTGGGCCGGGCCGTCNONE
J080050A06CGGGCCGTGNONE
J080050A06GTTTGGGCCGGGCCGTCNONE
J080050I16CGGGCCGTGNONE
J080050I16GTTTGGGCCGGGCCGTCNONE
J080050N16CGGGCCGTGNONE
J080050N16GTTTGGGCCGGGCCGTCNONE
J080052C23CGGGCCGTGNONE
J080052C23GTTTGGGCCGGGCCGTCNONE
J080052D18CGGGCCGTGNONE
J080052D18GTTTGGGCCGGGCCGTCNONE
J080052F20CGGGCCGTGNONE
J080052F20GTTTGGGCCGGGCCGTCNONE
J080052F23CGGGCCGTGNONE
J080052F23GTTTGGGCCGGGCCGTCNONE
J080053M03CGGGCCGTGNONE
J080053M03GTTTGGGCCGGGCCGTCNONE
J080054G13CGGGCCGTGNONE
J080054G13GTTTGGGCCGGGCCGTCNONE
J080054H12CGGGCCGTGNONE
J080054H12GTTTGGGCCGGGCCGTCNONE
J080055N03CGGGCCGTGNONE
J080055N03GTTTGGGCCGGGCCGTCNONE
J080056E07CGGGCCGTGNONE
J080056E07GTTTGGGCCGGGCCGTCNONE
J080057L04CGGGCCGTGNONE
J080057L04GTTTGGGCCGGGCCGTCNONE
J080063O19CGGGCCGTGNONE
J080063O19GTTTGGGCCGGGCCGTCNONE
J080064E21CGGGCCGTGNONE
J080064E21GTTTGGGCCGGGCCGTCNONE
J080065D18CGGGCCGTGNONE
J080065D18GTTTGGGCCGGGCCGTCNONE
J080065F18CGGGCCGTGNONE
J080065F18GTTTGGGCCGGGCCGTCNONE
J080065H14CGGGCCGTGNONE
J080065H14GTTTGGGCCGGGCCGTCNONE
J080065K15CGGGCCGTGNONE
J080065K15GTTTGGGCCGGGCCGTCNONE
J080065M24CGGGCCGTGNONE
J080065M24GTTTGGGCCGGGCCGTCNONE
J080066B18CGGGCCGTGNONE
J080066B18GTTTGGGCCGGGCCGTCNONE
J080066B19CGGGCCGTGNONE
J080066B19GTTTGGGCCGGGCCGTCNONE
J080071H19CGGGCCGTGNONE
J080071H19GTTTGGGCCGGGCCGTCNONE
J080072E18CGGGCCGTGNONE
J080072E18GTTTGGGCCGGGCCGTCNONE
J080074K21CGGGCCGTGNONE
J080074K21GTTTGGGCCGGGCCGTCNONE
J080075B06CGGGCCGTGNONE
J080075B06GTTTGGGCCGGGCCGTCNONE
J080076H07CGGGCCGTGNONE
J080076H07GTTTGGGCCGGGCCGTCNONE
J080079D16CGGGCCGTGNONE
J080079D16GTTTGGGCCGGGCCGTCNONE
J080082B20CGGGCCGTGNONE
J080082B20GTTTGGGCCGGGCCGTCNONE
J080084N16CGGGCCGTGNONE
J080084N16GTTTGGGCCGGGCCGTCNONE
J080085L07CGGGCCGTGNONE
J080085L07GTTTGGGCCGGGCCGTCNONE
J080086L04CGGGCCGTGNONE
J080086L04GTTTGGGCCGGGCCGTCNONE
J080086M07CGGGCCGTGNONE
J080086M07GTTTGGGCCGGGCCGTCNONE
J080087D02CGGGCCGTGNONE
J080087D02GTTTGGGCCGGGCCGTCNONE
J080087D15CGGGCCGTGNONE
J080087D15GTTTGGGCCGGGCCGTCNONE
J080087J19CGGGCCGTGNONE
J080087J19GTTTGGGCCGGGCCGTCNONE
J080088G20CGGGCCGTGNONE
J080088G20GTTTGGGCCGGGCCGTCNONE
J080092M15CGGGCCGTGNONE
J080092M15GTTTGGGCCGGGCCGTCNONE
J080093O10CGGGCCGTGNONE
J080093O10GTTTGGGCCGGGCCGTCNONE
J080095L09CGGGCCGTGNONE
J080095L09GTTTGGGCCGGGCCGTCNONE
J080096A18CGGGCCGTGNONE
J080096A18GTTTGGGCCGGGCCGTCNONE
J080097C03CGGGCCGTGNONE
J080097C03GTTTGGGCCGGGCCGTCNONE
J090019J07CGGGCCGTGNONE
J090019J07GTTTGGGCCGGGCCGTCNONE
J090024N12CGGGCCGTGNONE
J090024N12GTTTGGGCCGGGCCGTCNONE
J090049I09CGGGCCGTGNONE
J090049I09GTTTGGGCCGGGCCGTCNONE
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein.
AK070287GACACGTGGGGCCCGGCNONE
J023049O16GACACGTGGGGCCCGGCNONE
J100025I21GACACGTGGGGCCCGGCNONE
J100035K21GACACGTGGGGCCCGGCNONE
Os03g0822700005-010-E01GACGGCCCGGCCCNONE
005-010-E01TCCGGGCCCACCANONE
006-088-H12GACGGCCCGGCCCNONE
006-088-H12TCCGGGCCCACCANONE
AK061682GACGGCCCGGCCCNONE
AK061682TCCGGGCCCACCANONE
AK101448GACGGCCCGGCCCArmadillo-like helical domain containing protein.
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein.
J023091N05GACGGCCCGGCCCNONE
J023091N05TCCGGGCCCACCANONE
Os03g0822900AK099787AACGGGCCZinc finger, BED-type predicted domain containing protein.
AK099787CGGGCCCAGAZinc finger, BED-type predicted domain containing protein.
J013042C24AACGGGCCNONE
J013042C24CGGGCCCAGANONE
J013096O21AACGGGCCNONE
J013096O21CGGGCCCAGANONE
J023109I23AACGGGCCNONE
J023109I23CGGGCCCAGANONE
J033106N09AACGGGCCNONE
J033106N09CGGGCCCAGANONE
J033107H03AACGGGCCNONE
J033107H03CGGGCCCAGANONE
J033118G03AACGGGCCNONE
J033118G03CGGGCCCAGANONE
J033145I24AACGGGCCNONE
J033145I24CGGGCCCAGANONE
J065138D15AACGGGCCNONE
J065138D15CGGGCCCAGANONE
J065140L13AACGGGCCNONE
J065140L13CGGGCCCAGANONE
J065179M13AACGGGCCNONE
J065179M13CGGGCCCAGANONE
J065200F05AACGGGCCNONE
J065200F05CGGGCCCAGANONE
J075104F20AACGGGCCNONE
J075104F20CGGGCCCAGANONE
J075143A15AACGGGCCNONE
J075143A15CGGGCCCAGANONE
J075197J11AACGGGCCNONE
J075197J11CGGGCCCAGANONE
Os03g0825700AK067902TGCGGGCCCCACASimilar to Defective in exine formation.
Os03g0831100AK103115AACGGCCCGGCCArmadillo-like helical domain containing protein.
J033119F15AACGGCCCGGCCNONE
J065011M19AACGGCCCGGCCNONE
J075019I08AACGGCCCGGCCNONE
J075047A01AACGGCCCGGCCNONE
J075096P21AACGGCCCGGCCNONE
J075121I05AACGGCCCGGCCNONE
J075121I07AACGGCCCGGCCNONE
J090063F13AACGGCCCGGCCNONE
J090068F16AACGGCCCGGCCNONE
J090094E14AACGGCCCGGCCNONE
Os03g0832200AK070712CCCGTGGGCCAGSimilar to Calcium-binding protein precursor (Calreticulin).
Os03g0836200009-165-F07CGGGCCCCACANONE
015-092-G01CGGGCCCCACANONE
AK058443CGGGCCCCACANONE
AK067084CGGGCCCCACASimilar to RNA-binding protein RZ-1.
AK101225CGGGCCCCACANONE
J013092A03CGGGCCCCACANONE
J013095N17CGGGCCCCACANONE
J013147J18CGGGCCCCACANONE
J023019O10CGGGCCCCACANONE
J023065N18CGGGCCCCACANONE
J033113E18CGGGCCCCACANONE
J033133E03CGGGCCCCACANONE
J065059J15CGGGCCCCACANONE
J065075O11CGGGCCCCACANONE
J065119I07CGGGCCCCACANONE
J065171J03CGGGCCCCACANONE
J090016D21CGGGCCCCACANONE
J090081O03CGGGCCCCACANONE
J100040G18CGGGCCCCACANONE
J100040L10CGGGCCCCACANONE
J100055H13CGGGCCCCACANONE
J100059I22CGGGCCCCACANONE
J100078A08CGGGCCCCACANONE
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein.
Os03g0843500AK067985CGGGCCCAACANONE
AK067985CGGGCCCAGCCCACGCNONE
AK101661CGGGCCCAACASimilar to Sarcoplasmic reticulum protein (With alternative splicing).
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing).
AY224454CGGGCCCAACANONE
AY224454CGGGCCCAGCCCACGCNONE
J080302L23CGGGCCCAACANONE
J080302L23CGGGCCCAGCCCACGCNONE
Os03g0846400AK067706CGGGCCGTGCCCGGCCCNONE
AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE
AK070549CGGGCCGTGCCCGGCCCPeptidase, trypsin-like serine and cysteine domain containing protein.
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein.
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein.
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein.
AK102202TTGTGGGCCGGGCCCAAACNONE
AK104157TTGTGGGCCGGGCCCAAACNONE
J033087F19TTGTGGGCCGGGCCCAAACNONE
J065087I16TTGTGGGCCGGGCCCAAACNONE
J065113G04TTGTGGGCCGGGCCCAAACNONE
J090026M02TTGTGGGCCGGGCCCAAACNONE
J090027I04TTGTGGGCCGGGCCCAAACNONE
J100073E19TTGTGGGCCGGGCCCAAACNONE
Os03g0852600009-174-G04ATATGGGCCCGGANONE
AK063101ATATGGGCCCGGAProtein of unknown function DUF565 family protein.
J065131H12ATATGGGCCCGGANONE
J090046K24ATATGGGCCCGGANONE
Os03g0852900011-012-A12TCCGGGCCCAACTNONE
AK100660TCCGGGCCCAACTSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit).
J013073D18TCCGGGCCCAACTNONE
J013152K17TCCGGGCCCAACTNONE
J023111N01TCCGGGCCCAACTNONE
J065214G07TCCGGGCCCAACTNONE
J090080E10TCCGGGCCCAACTNONE
Os03g0854000009-186-C03GCGGGCCCACCTNONE
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein.
J065138B11GCGGGCCCACCTNONE
Os03g0854500012-067-H08CCCACGGGCCCCNONE
AK100430CCCACGGGCCCCSimilar to Heat shock transcription factor 31 (Fragment).
AK106118CCCACGGGCCCCNONE
AY344485CCCACGGGCCCCNONE
J023088F14CCCACGGGCCCCNONE
J100041G01CCCACGGGCCCCNONE
J100046N19CCCACGGGCCCCNONE
J100052O08CCCACGGGCCCCNONE
Os03g0854800J090007D13GCCGGCCCACGGGNONE
J090085N22GCCGGCCCACGGGNONE
Os03g0855700AK070400GCTGGGCCCGGTNucleic acid-binding, OB-fold domain containing protein.
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein.
Os04g0128700AK107172TGCGGGCCCATTAThioredoxin-like fold domain containing protein.
J065102M16TGCGGGCCCATTANONE
J065124K01TGCGGGCCCATTANONE
J065129I12TGCGGGCCCATTANONE
J065192C08TGCGGGCCCATTANONE
Os04g0206200015-013-E04CCCGGGCCGANONE
AK109506CCCGGGCCGANONE
AK110950CCCGGGCCGANONE
Os04g0208400AK069629AACGGGCCGTGCyclin-like F-box domain containing protein.
AK069629CACGGCCCGCyclin-like F-box domain containing protein.
Os04g0218600009-123-A05GGGGCCCGNONE
AK062873GGGGCCCGNONE
AK103472GGGGCCCGConserved hypothetical protein.
J090077A20GGGGCCCGNONE
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein.
Os04g0270100AK063713CGGGCCCAGGNONE
AK107968CGGGCCCAGGNONE
Os04g0282400AK120187CCCGGGCCCCACACSimilar to FPF1 protein-like (RAA1).
J013034O10CCCGGGCCCCACACNONE
J013071G20CCCGGGCCCCACACNONE
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein.
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE
Os04g0378200AK103076GGTCCCACGGGSterile alpha motif SAM domain containing protein.
J033118E02GGTCCCACGGGNONE
J065065F15GGTCCCACGGGNONE
J090080I24GGTCCCACGGGNONE
Os04g0382300AK071912TGCGGGCCCCACCNONE
AK101795TGCGGGCCCCACCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1).
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE
009-148-E01CGGGCCCAGCNONE
009-155-A11CCCGTGGGGCCCACGCNONE
009-155-A11CGGGCCCAGCNONE
009-175-F04CCCGTGGGGCCCACGCNONE
009-175-F04CGGGCCCAGCNONE
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein.
AK063862CGGGCCCAGCConserved hypothetical protein.
J065035F12CCCGTGGGGCCCACGCNONE
J065035F12CGGGCCCAGCNONE
J065162C13CCCGTGGGGCCCACGCNONE
J065162C13CGGGCCCAGCNONE
J065169L19CCCGTGGGGCCCACGCNONE
J065169L19CGGGCCCAGCNONE
Os04g0390500AK066575TCCGGGCCCCNONE
AK099908TCCGGGCCCCNONE
AK100148TCCGGGCCCCNONE
Os04g0418000006-025-C05AACGGGCCNONE
006-025-C05CGGGCCGAAANONE
006-025-D11AACGGGCCNONE
006-025-D11CGGGCCGAAANONE
006-045-F02AACGGGCCNONE
006-045-F02CGGGCCGAAANONE
006-060-B04AACGGGCCNONE
006-060-B04CGGGCCGAAANONE
006-063-E03AACGGGCCNONE
006-063-E03CGGGCCGAAANONE
006-070-G08AACGGGCCNONE
006-070-G08CGGGCCGAAANONE
006-072-H05AACGGGCCNONE
006-072-H05CGGGCCGAAANONE
AK061030AACGGGCCNONE
AK061030CGGGCCGAAANONE
AK099124AACGGGCCNONE
AK099124CGGGCCGAAANONE
AK106155AACGGGCCConserved hypothetical protein.
AK106155CGGGCCGAAAConserved hypothetical protein.
AK119714AACGGGCCNONE
AK119714CGGGCCGAAANONE
J023039I07AACGGGCCNONE
J023039I07CGGGCCGAAANONE
J065025N03AACGGGCCNONE
J065025N03CGGGCCGAAANONE
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8.
Os04g0436100AK072631TCTCGGCCCGPhenylacetic acid degradation-related protein domain containing protein.
J023132I18TCTCGGCCCGNONE
J065112K15TCTCGGCCCGNONE
J065138F04TCTCGGCCCGNONE
J075078D03TCTCGGCCCGNONE
J090090K17TCTCGGCCCGNONE
Os04g0444900AK063657ACCGGGCCCCACACSimilar to Alfin-1.
AK063657GGCCCGTTSimilar to Alfin-1.
AK098960ACCGGGCCCCACACNONE
AK098960GGCCCGTTNONE
J065037L14ACCGGGCCCCACACNONE
J065037L14GGCCCGTTNONE
J065037P22ACCGGGCCCCACACNONE
J065037P22GGCCCGTTNONE
J065173O15ACCGGGCCCCACACNONE
J065173O15GGCCCGTTNONE
Os04g0449000016-008-B09CGGGCCGAANONE
AK106468CGGGCCGAAMitochondrial substrate carrier family protein.
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE
009-147-H12ATCTGGGCCGGGCCGTTTNONE
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein.
J013130N24ATCTGGGCCGGGCCGTTTNONE
J065019D10ATCTGGGCCGGGCCGTTTNONE
J065168O21ATCTGGGCCGGGCCGTTTNONE
J075051G06ATCTGGGCCGGGCCGTTTNONE
J075148G11ATCTGGGCCGGGCCGTTTNONE
Os04g0462900006-094-A02CACGGCCCGTTNONE
006-097-F05CACGGCCCGTTNONE
009-129-A10CACGGCCCGTTNONE
015-042-F07CACGGCCCGTTNONE
AK058481CACGGCCCGTTNONE
AK059483CACGGCCCGTTNONE
AK061324CACGGCCCGTTNONE
AK099100CACGGCCCGTTNONE
AK102579CACGGCCCGTTNONE
AK106322CACGGCCCGTTSimilar to Prohibitin.
J065059J20CACGGCCCGTTNONE
J065085I02CACGGCCCGTTNONE
J065118N23CACGGCCCGTTNONE
J065208K24CACGGCCCGTTNONE
J075053B14CACGGCCCGTTNONE
J075097M22CACGGCCCGTTNONE
J075184B07CACGGCCCGTTNONE
J075194A15CACGGCCCGTTNONE
J080315G03CACGGCCCGTTNONE
J090088H19CACGGCCCGTTNONE
Os04g0476000Os04g0476000ACCGGGCCCAATATetratricopeptide-like helical domain containing protein.
Os04g0476400J033082D17GCGGGCCCCNONE
J033082D17TTTCGGCCCGNONE
Os04g0481100AK099817CGGGCCCCSimilar to Seed imbibition protein (Fragment).
AK100197CGGGCCCCNONE
AK111421CGGGCCCCNONE
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein.
J065141K24CCACTGACAGGTGGGCCCGCNONE
J065144O22CCACTGACAGGTGGGCCCGCNONE
J065162F11CCACTGACAGGTGGGCCCGCNONE
Os04g0486400AJ535489GGGCCGGGCCGGGCCGAANONE
AK103296GGGCCGGGCCGGGCCGAARML1 protein.
J013045L03GGGCCGGGCCGGGCCGAANONE
J013045M03GGGCCGGGCCGGGCCGAANONE
J033034L24GGGCCGGGCCGGGCCGAANONE
J033125B02GGGCCGGGCCGGGCCGAANONE
J075001G08GGGCCGGGCCGGGCCGAANONE
J075011I16GGGCCGGGCCGGGCCGAANONE
J075033M08GGGCCGGGCCGGGCCGAANONE
J075044G01GGGCCGGGCCGGGCCGAANONE
J075047D04GGGCCGGGCCGGGCCGAANONE
J075061J09GGGCCGGGCCGGGCCGAANONE
J075085L07GGGCCGGGCCGGGCCGAANONE
J075087D20GGGCCGGGCCGGGCCGAANONE
J075117A04GGGCCGGGCCGGGCCGAANONE
J075134H06GGGCCGGGCCGGGCCGAANONE
J075184J12GGGCCGGGCCGGGCCGAANONE
Os04g0490500AK065576GCCGGGCCCCSimilar to Pto kinase interactor 1.
J080004D10GCCGGGCCCCNONE
J080083C02GCCGGGCCCCNONE
J080083G13GCCGGGCCCCNONE
J080097F03GCCGGGCCCCNONE
Os04g0490700AK072099CGGGCCGAConserved hypothetical protein.
J065140P05CGGGCCGANONE
J100055M05CGGGCCGANONE
J100071P15CGGGCCGANONE
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein.
Os04g0497000006-097-G07GCGGGCCCAGCNONE
AK069136GCGGGCCCAGCNONE
AK109382GCGGGCCCAGCSimilar to Allyl alcohol dehydrogenase.
J023008C06GCGGGCCCAGCNONE
J043007K16GCGGGCCCAGCNONE
J065110K06GCGGGCCCAGCNONE
J080012F02GCGGGCCCAGCNONE
J080020N21GCGGGCCCAGCNONE
J080026H09GCGGGCCCAGCNONE
J080029D13GCGGGCCCAGCNONE
J080034C08GCGGGCCCAGCNONE
J080050J07GCGGGCCCAGCNONE
Os04g0503500AK099404CGGGCCCACAALeucine-rich repeat, cysteine-containing subtype containing protein.
AK101695CGGGCCCACAANONE
Os04g0504200AK110863CGGGCCCCACConserved hypothetical protein.
Os04g0504800AK064269CCCACGGGNONE
AK067210CCCACGGGSimilar to Poly(A)-binding protein.
Os04g0508000AK071432AACGGGCCProtein of unknown function DUF231, plant domain containing protein.
Os04g0508100009-180-A02GGCCCGTTNONE
AK121759GGCCCGTTConserved hypothetical protein.
J023007G10GGCCCGTTNONE
J033089A17GGCCCGTTNONE
J065193E13GGCCCGTTNONE
J075025M02GGCCCGTTNONE
J075027J10GGCCCGTTNONE
J075030N03GGCCCGTTNONE
J075045I20GGCCCGTTNONE
J075065E04GGCCCGTTNONE
J075134M16GGCCCGTTNONE
J075140B10GGCCCGTTNONE
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein.
J023117E20AACGGGCCGGGCCGGCCCAGTANONE
J023150D11AACGGGCCGGGCCGGCCCAGTANONE
Os04g0542900AK068610TTCGGCCCGGTConserved hypothetical protein.
Os04g0548000011-097-D07GGGGCCCGCNONE
AK073099GGGGCCCGCNONE
AK104979GGGGCCCGCProtein of unknown function DUF862, eukaryotic domain containing protein.
J065102C18GGGGCCCGCNONE
J075076A16GGGGCCCGCNONE
J075082L09GGGGCCCGCNONE
J075092L18GGGGCCCGCNONE
J075092N01GGGGCCCGCNONE
J075122P14GGGGCCCGCNONE
J075148L06GGGGCCCGCNONE
Os04g0561200AK107862CCCGGGCCCCCACCellular retinaldehyde-binding/triple function, C-terminal domain containing protein.
J065028J03CCCGGGCCCCCACNONE
J065042H13CCCGGGCCCCCACNONE
J065079N01CCCGGGCCCCCACNONE
J065190N16CCCGGGCCCCCACNONE
J065191H22CCCGGGCCCCCACNONE
Os04g0562000006-096-A05GCAGCCCACGGGNONE
006-105-B08GCAGCCCACGGGNONE
AK060894GCAGCCCACGGGNONE
AK072630GCAGCCCACGGGZinc finger, DHHC-type domain containing protein.
AK104521GCAGCCCACGGGNONE
J023038A11GCAGCCCACGGGNONE
J023130P03GCAGCCCACGGGNONE
J090006F10GCAGCCCACGGGNONE
J090007M22GCAGCCCACGGGNONE
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein.
J023097O18CAGGTGGGCCCGGCCCATANONE
J065100E16CAGGTGGGCCCGGCCCATANONE
J075022C23CAGGTGGGCCCGGCCCATANONE
J075023L18CAGGTGGGCCCGGCCCATANONE
J075040N10CAGGTGGGCCCGGCCCATANONE
J075061L14CAGGTGGGCCCGGCCCATANONE
J075069B15CAGGTGGGCCCGGCCCATANONE
J075106C16CAGGTGGGCCCGGCCCATANONE
J075138P13CAGGTGGGCCCGGCCCATANONE
J075139H18CAGGTGGGCCCGGCCCATANONE
J075139L06CAGGTGGGCCCGGCCCATANONE
J075149B07CAGGTGGGCCCGGCCCATANONE
J075177N21CAGGTGGGCCCGGCCCATANONE
Os04g0579200AK100603GCCCCACGGGZinc finger, RING-type domain containing protein.
Os04g0591000006-090-E02AACGGGCCGAANONE
AK072902AACGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J065061E23AACGGGCCGAANONE
Os04g0612600AB042115AACGGGCCAGANONE
AB042115TCCGACGGGCCCACCTNONE
AK060707AACGGGCCAGASimilar to Coatomer-like protein, epsilon subunit.
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit.
AK099008AACGGGCCAGANONE
AK099008TCCGACGGGCCCACCTNONE
AK104427AACGGGCCAGANONE
AK104427TCCGACGGGCCCACCTNONE
J023043H02AACGGGCCAGANONE
J023043H02TCCGACGGGCCCACCTNONE
J033033I23AACGGGCCAGANONE
J033033I23TCCGACGGGCCCACCTNONE
J033067P21AACGGGCCAGANONE
J033067P21TCCGACGGGCCCACCTNONE
J033088M21AACGGGCCAGANONE
J033088M21TCCGACGGGCCCACCTNONE
J033133M08AACGGGCCAGANONE
J033133M08TCCGACGGGCCCACCTNONE
J043030I16AACGGGCCAGANONE
J043030I16TCCGACGGGCCCACCTNONE
J075049H08AACGGGCCAGANONE
J075049H08TCCGACGGGCCCACCTNONE
Os04g0614500AK100259CACGGCCCGAminotransferase class-III family protein.
Os04g0626400006-050-B09AACGGCCCGCANONE
006-072-C12AACGGCCCGCANONE
006-092-C11AACGGCCCGCANONE
AK059851AACGGCCCGCACalycin-like family protein.
AK100069AACGGCCCGCANONE
AK104062AACGGCCCGCANONE
AK104663AACGGCCCGCANONE
Os04g0627000AK101563TCCGGGCCGAGANONE
Os04g0635800006-033-E07CACGGCCCGTTNONE
011-067-A08CACGGCCCGTTNONE
AK060110CACGGCCCGTTNONE
AK099507CACGGCCCGTTGCN5-related N-acetyltransferase domain containing protein.
AK104741CACGGCCCGTTNONE
AK120021CACGGCCCGTTNONE
J013029B17CACGGCCCGTTNONE
J013134M07CACGGCCCGTTNONE
J013149N18CACGGCCCGTTNONE
J013153L10CACGGCCCGTTNONE
J033131F08CACGGCCCGTTNONE
J043010E02CACGGCCCGTTNONE
J065031J05CACGGCCCGTTNONE
J065031J06CACGGCCCGTTNONE
J075030K04CACGGCCCGTTNONE
J075178K05CACGGCCCGTTNONE
J080001B10CACGGCCCGTTNONE
J080003N19CACGGCCCGTTNONE
J080005F20CACGGCCCGTTNONE
J080005G16CACGGCCCGTTNONE
J080007N02CACGGCCCGTTNONE
J080009J04CACGGCCCGTTNONE
J080017D04CACGGCCCGTTNONE
J080020M22CACGGCCCGTTNONE
J080021A15CACGGCCCGTTNONE
J080021F21CACGGCCCGTTNONE
J080023P05CACGGCCCGTTNONE
J080024P22CACGGCCCGTTNONE
J080027C20CACGGCCCGTTNONE
J080029K03CACGGCCCGTTNONE
J080035M18CACGGCCCGTTNONE
J080039F22CACGGCCCGTTNONE
J080039J03CACGGCCCGTTNONE
J080039L03CACGGCCCGTTNONE
J080039P14CACGGCCCGTTNONE
J080042E12CACGGCCCGTTNONE
J080047D19CACGGCCCGTTNONE
J080047M21CACGGCCCGTTNONE
J080049N03CACGGCCCGTTNONE
J080056J12CACGGCCCGTTNONE
J080060B10CACGGCCCGTTNONE
J080062K08CACGGCCCGTTNONE
J080064L07CACGGCCCGTTNONE
J080069C15CACGGCCCGTTNONE
J080074H06CACGGCCCGTTNONE
J080086O14CACGGCCCGTTNONE
J080090C20CACGGCCCGTTNONE
J080090L14CACGGCCCGTTNONE
J080095G08CACGGCCCGTTNONE
J080097C07CACGGCCCGTTNONE
J090011F03CACGGCCCGTTNONE
J090082O17CACGGCCCGTTNONE
Os04g0659400AK070174CTCGGCCCGGAENT domain containing protein.
Os04g0660600009-113-A11CCCGGGCCCAATTNONE
AK120899CCCGGGCCCAATTATPase, V0 complex, subunit H family protein.
J023030J05CCCGGGCCCAATTNONE
J065068M07CCCGGGCCCAATTNONE
J065120G22CCCGGGCCCAATTNONE
J065168J18CCCGGGCCCAATTNONE
J065211M10CCCGGGCCCAATTNONE
J075175E21CCCGGGCCCAATTNONE
J090021C06CCCGGGCCCAATTNONE
J090032P15CCCGGGCCCAATTNONE
J090082E05CCCGGGCCCAATTNONE
J100090O11CCCGGGCCCAATTNONE
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein.
J033075E19GCCACGTGGGCCCGCACCGCNONE
J033109O19GCCACGTGGGCCCGCACCGCNONE
J065002J12GCCACGTGGGCCCGCACCGCNONE
J065026E22GCCACGTGGGCCCGCACCGCNONE
J065061F05GCCACGTGGGCCCGCACCGCNONE
J065068D22GCCACGTGGGCCCGCACCGCNONE
J065072N14GCCACGTGGGCCCGCACCGCNONE
J065085F02GCCACGTGGGCCCGCACCGCNONE
J075055G19GCCACGTGGGCCCGCACCGCNONE
J075105B14GCCACGTGGGCCCGCACCGCNONE
J075118M17GCCACGTGGGCCCGCACCGCNONE
J075193H02GCCACGTGGGCCCGCACCGCNONE
J100040O05GCCACGTGGGCCCGCACCGCNONE
J100064I04GCCACGTGGGCCCGCACCGCNONE
Os04g0661300AK070723CCCACGGGGCCCACACConserved hypothetical protein.
AK103942CCCACGGGGCCCACACNONE
Os04g0670400012-048-A10CGGGCCGTANONE
012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE
AK103099CGGGCCGTAOvarian tumour, otubain domain containing protein.
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein.
J033118N06CGGGCCGTANONE
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE
J100019K03CGGGCCGTANONE
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE
Os04g0670500AK107506TACGGCCCGCysteine protease 1 precursor (EC 3.4.22.-) (OsCP1).
AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1).
Os04g0674000006-093-C01GCGGGCCCACGCNONE
009-040-F06GCGGGCCCACGCNONE
AK071276GCGGGCCCACGCNONE
AK109377GCGGGCCCACGCConserved hypothetical protein.
AK119671GCGGGCCCACGCNONE
J023084J11GCGGGCCCACGCNONE
J023088F18GCGGGCCCACGCNONE
J065099M12GCGGGCCCACGCNONE
J065136J08GCGGGCCCACGCNONE
J065167H22GCGGGCCCACGCNONE
J075046L21GCGGGCCCACGCNONE
J080029F17GCGGGCCCACGCNONE
J080053C16GCGGGCCCACGCNONE
J080053E24GCGGGCCCACGCNONE
J080074D14GCGGGCCCACGCNONE
J100029C12GCGGGCCCACGCNONE
J100030D01GCGGGCCCACGCNONE
J100044E16GCGGGCCCACGCNONE
J100065N18GCGGGCCCACGCNONE
J100077D18GCGGGCCCACGCNONE
J100090P13GCGGGCCCACGCNONE
Os04g0677033J100048A06CTTGGGCCCGCAConserved hypothetical protein.
Os04g0678800AK072212ACCGGCCCGTTN-acetylglucosaminylphosphatidylinositol deacetylase family protein.
AK099065ACCGGCCCGTTNONE
Os04g0683800011-050-B05CTCGGCCCGGCCCNONE
AK073897CTCGGCCCGGCCCSimilar to Phosphoribosyltransferase (Fragment).
AK102910CTCGGCCCGGCCCNONE
J033075A06CTCGGCCCGGCCCNONE
J033079F23CTCGGCCCGGCCCNONE
J033093D20CTCGGCCCGGCCCNONE
J033099B18CTCGGCCCGGCCCNONE
J033129G13CTCGGCCCGGCCCNONE
J065075F21CTCGGCCCGGCCCNONE
J065093M19CTCGGCCCGGCCCNONE
J075023K10CTCGGCCCGGCCCNONE
J075046J08CTCGGCCCGGCCCNONE
J090003I20CTCGGCCCGGCCCNONE
J090017L12CTCGGCCCGGCCCNONE
J090024B04CTCGGCCCGGCCCNONE
J090033A20CTCGGCCCGGCCCNONE
J090083F02CTCGGCCCGGCCCNONE
Os04g0684500AK066014TATTGGGCCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17).
AK071345CGGGCCCACCTGTCAGNONE
J023069G19CGGGCCCACCTGTCAGNONE
J023097E09CGGGCCCACCTGTCAGNONE
J065071A01CGGGCCCACCTGTCAGNONE
J065186F08CGGGCCCACCTGTCAGNONE
J075044B21CGGGCCCACCTGTCAGNONE
J075120N18CGGGCCCACCTGTCAGNONE
J075131B22CGGGCCCACCTGTCAGNONE
J100041H18CGGGCCCACCTGTCAGNONE
J100042P13CGGGCCCACCTGTCAGNONE
Os04g0692200006-047-H10AACGGGCCNONE
006-107-D08AACGGGCCNONE
009-122-B09AACGGGCCNONE
AK059807AACGGGCCNONE
AK060875AACGGGCCNONE
AK071726AACGGGCCConserved hypothetical protein.
J023110I24AACGGGCCNONE
J033091O06AACGGGCCNONE
J053027N16AACGGGCCNONE
J053089E19AACGGGCCNONE
J053098H12AACGGGCCNONE
J053099N13AACGGGCCNONE
J075031B15AACGGGCCNONE
J080013D12AACGGGCCNONE
J080013H05AACGGGCCNONE
J080013H07AACGGGCCNONE
J080088I03AACGGGCCNONE
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein.
J023003L12CCACTGACATGCGGGCCCCACNONE
J023025C18CCACTGACATGCGGGCCCCACNONE
J023074E20CCACTGACATGCGGGCCCCACNONE
J023128H09CCACTGACATGCGGGCCCCACNONE
J033092N18CCACTGACATGCGGGCCCCACNONE
J065009J09CCACTGACATGCGGGCCCCACNONE
J090073L21CCACTGACATGCGGGCCCCACNONE
Os05g0116100006-049-G01AACGGGCCNONE
006-064-F09AACGGGCCNONE
006-082-A03AACGGGCCNONE
006-092-G06AACGGGCCNONE
006-102-F09AACGGGCCNONE
AB037970AACGGGCCNONE
AK061836AACGGGCCNONE
AK070895AACGGGCCDehydroascorbate reductase.
AY074786AACGGGCCNONE
J013022K21AACGGGCCNONE
J013154A03AACGGGCCNONE
J023074C02AACGGGCCNONE
J023091I19AACGGGCCNONE
J023135M05AACGGGCCNONE
J065027L11AACGGGCCNONE
J065065A08AACGGGCCNONE
J065120A08AACGGGCCNONE
J065174A05AACGGGCCNONE
J065184O22AACGGGCCNONE
J065191D07AACGGGCCNONE
J065209D04AACGGGCCNONE
J075014F11AACGGGCCNONE
J075036D03AACGGGCCNONE
J075157D23AACGGGCCNONE
J080007F15AACGGGCCNONE
J080008N12AACGGGCCNONE
J080010F22AACGGGCCNONE
J080011C19AACGGGCCNONE
J080011F12AACGGGCCNONE
J080012E11AACGGGCCNONE
J080015B12AACGGGCCNONE
J080015O16AACGGGCCNONE
J080016G24AACGGGCCNONE
J080016K13AACGGGCCNONE
J080018A02AACGGGCCNONE
J080018H03AACGGGCCNONE
J080022M01AACGGGCCNONE
J080023D20AACGGGCCNONE
J080023I01AACGGGCCNONE
J080023J05AACGGGCCNONE
J080024A09AACGGGCCNONE
J080024I09AACGGGCCNONE
J080025A10AACGGGCCNONE
J080025G04AACGGGCCNONE
J080027D21AACGGGCCNONE
J080029M05AACGGGCCNONE
J080030J01AACGGGCCNONE
J080034D10AACGGGCCNONE
J080036F18AACGGGCCNONE
J080038N11AACGGGCCNONE
J080039B07AACGGGCCNONE
J080039E01AACGGGCCNONE
J080039K11AACGGGCCNONE
J080040B09AACGGGCCNONE
J080040G11AACGGGCCNONE
J080041H08AACGGGCCNONE
J080041H19AACGGGCCNONE
J080041O20AACGGGCCNONE
J080042C15AACGGGCCNONE
J080043C16AACGGGCCNONE
J080043F18AACGGGCCNONE
J080044B17AACGGGCCNONE
J080044N10AACGGGCCNONE
J080044O07AACGGGCCNONE
J080045H15AACGGGCCNONE
J080045I03AACGGGCCNONE
J080046A05AACGGGCCNONE
J080048I06AACGGGCCNONE
J080049L04AACGGGCCNONE
J080049M09AACGGGCCNONE
J080050G11AACGGGCCNONE
J080051G20AACGGGCCNONE
J080053C09AACGGGCCNONE
J080053I05AACGGGCCNONE
J080053P18AACGGGCCNONE
J080054K10AACGGGCCNONE
J080054P14AACGGGCCNONE
J080057L05AACGGGCCNONE
J080062K11AACGGGCCNONE
J080063C19AACGGGCCNONE
J080065B03AACGGGCCNONE
J080066E15AACGGGCCNONE
J080066H05AACGGGCCNONE
J080066I05AACGGGCCNONE
J080068O11AACGGGCCNONE
J080070L22AACGGGCCNONE
J080071I12AACGGGCCNONE
J080071N20AACGGGCCNONE
J080072D10AACGGGCCNONE
J080072I10AACGGGCCNONE
J080074G03AACGGGCCNONE
J080076E23AACGGGCCNONE
J080076N03AACGGGCCNONE
J080077N23AACGGGCCNONE
J080084B13AACGGGCCNONE
J080084F07AACGGGCCNONE
J080085J15AACGGGCCNONE
J080085P20AACGGGCCNONE
J080090F21AACGGGCCNONE
J080093H16AACGGGCCNONE
J080093J01AACGGGCCNONE
J080093L04AACGGGCCNONE
J080097E24AACGGGCCNONE
J090012G04AACGGGCCNONE
J090054K05AACGGGCCNONE
Os05g0121400AK099528CCCGTGGGNONE
AK099528GCCCACGGGNONE
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein.
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE
Os05g0143800016-024-C02CCCGTGGGNONE
AK106538CCCGTGGGGH3 auxin-responsive promoter family protein.
J043020B18CCCGTGGGNONE
J100025E03CCCGTGGGNONE
Os05g0148600003-016-C11GGTGGGGCCCGTTNONE
AK066168GGTGGGGCCCGTTNONE
AK104336GGTGGGGCCCGTTSimilar to Na+/H+ antiporter.
AY360145GGTGGGGCCCGTTNONE
J013055J22GGTGGGGCCCGTTNONE
J013057M24GGTGGGGCCCGTTNONE
J013074N03GGTGGGGCCCGTTNONE
J013158A22GGTGGGGCCCGTTNONE
J075118H09GGTGGGGCCCGTTNONE
Os05g0149900AK072901AACGGGCCNONE
AK101105AACGGGCCNONE
AK105677AACGGGCCNONE
J023145E04AACGGGCCNONE
Os05g0156200AK071622TCCGGGCCGTTConserved hypothetical protein.
J023099E19TCCGGGCCGTTNONE
J090025C09TCCGGGCCGTTNONE
J090071K23TCCGGGCCGTTNONE
Os05g0169400AK073439GCTGGGCCGGATCGGGCCGAProtein of unknown function DUF1421 family protein.
J013110E15GCTGGGCCGGATCGGGCCGANONE
J033044H02GCTGGGCCGGATCGGGCCGANONE
Os05g0176100AF030052CCCGGGCCCACCCNONE
AK067850CCCGGGCCCACCCNONE
AK067967CCCGGGCCCACCCNONE
AK098978CCCGGGCCCACCCNONE
AK099228CCCGGGCCCACCCNONE
AK099281CCCGGGCCCACCCNONE
AK100188CCCGGGCCCACCCSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment).
AK102140CCCGGGCCCACCCNONE
Os05g0186300AK070360GCGGGCCCCCACSimilar to NADP-malic enzyme.
AK099249GCGGGCCCCCACNONE
AY435404GCGGGCCCCCACNONE
J023006D11GCGGGCCCCCACNONE
J023059P07GCGGGCCCCCACNONE
Os05g0187100012-066-F01CCCGTGGGCNONE
AK067988CCCGTGGGCSimilar to Hexokinase.
Os05g0194600AK102487TTTCGGCCCGPeptidase M22, O-sialoglycoprotein endopeptidase family protein.
J100032M01TTTCGGCCCGNONE
J100041A08TTTCGGCCCGNONE
Os05g0207700AK102665TGCGGGCCCACCCCCACTCCNONE
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1).
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE
AK063666CCCACGGGCCCACCTGTCAGTNONE
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator.
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein.
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE
Os05g0227800AK110997AACGGGCCGGTCCAAGCCCAAHomeodomain-like containing protein.
Os05g0241400AK107803CGGGCCGAConserved hypothetical protein.
Os05g0242600016-092-A07CCCGTGGGGCCCGCNONE
AK107430CCCGTGGGGCCCGCPrefoldin domain containing protein.
J065218C11CCCGTGGGGCCCGCNONE
Os05g0295100AK100239CCCGTGGGGGCCCGProtein of unknown function DUF1253 family protein.
AK100239GCCCCACGGGProtein of unknown function DUF1253 family protein.
AK108559CCCGTGGGGGCCCGNONE
AK108559GCCCCACGGGNONE
Os05g0297900AK071238AACGGGCCSimilar to Signal peptidase 18 subunit (Fragment).
J013159C03AACGGGCCNONE
J023041J06AACGGGCCNONE
J023085B09AACGGGCCNONE
J033031J11AACGGGCCNONE
J065010C22AACGGGCCNONE
J065032E10AACGGGCCNONE
J065141O18AACGGGCCNONE
J065155K04AACGGGCCNONE
Os05g0304200009-059-H05TCGGCCCGTTNONE
AK099372TCGGCCCGTTNONE
AK112073TCGGCCCGTTPAP fibrillin family protein.
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450.
AK104994TCCGGGCCCACGTNONE
Os05g0328000AK107977TCTGGCCCGTTCGGCCCGConserved hypothetical protein.
AK107977TTTCGGCCCGGAConserved hypothetical protein.
J065005I02TCTGGCCCGTTCGGCCCGNONE
J065005I02TTTCGGCCCGGANONE
J065049M05TCTGGCCCGTTCGGCCCGNONE
J065049M05TTTCGGCCCGGANONE
J080005F01TCTGGCCCGTTCGGCCCGNONE
J080005F01TTTCGGCCCGGANONE
J080005H15TCTGGCCCGTTCGGCCCGNONE
J080005H15TTTCGGCCCGGANONE
J080005K23TCTGGCCCGTTCGGCCCGNONE
J080005K23TTTCGGCCCGGANONE
J080007O03TCTGGCCCGTTCGGCCCGNONE
J080007O03TTTCGGCCCGGANONE
J080013H09TCTGGCCCGTTCGGCCCGNONE
J080013H09TTTCGGCCCGGANONE
J080024C02TCTGGCCCGTTCGGCCCGNONE
J080024C02TTTCGGCCCGGANONE
J080026M22TCTGGCCCGTTCGGCCCGNONE
J080026M22TTTCGGCCCGGANONE
J080029K21TCTGGCCCGTTCGGCCCGNONE
J080029K21TTTCGGCCCGGANONE
J080032K04TCTGGCCCGTTCGGCCCGNONE
J080032K04TTTCGGCCCGGANONE
J080034M16TCTGGCCCGTTCGGCCCGNONE
J080034M16TTTCGGCCCGGANONE
J080037G11TCTGGCCCGTTCGGCCCGNONE
J080037G11TTTCGGCCCGGANONE
J080040L01TCTGGCCCGTTCGGCCCGNONE
J080040L01TTTCGGCCCGGANONE
J080041D13TCTGGCCCGTTCGGCCCGNONE
J080041D13TTTCGGCCCGGANONE
J080043G20TCTGGCCCGTTCGGCCCGNONE
J080043G20TTTCGGCCCGGANONE
J080046H17TCTGGCCCGTTCGGCCCGNONE
J080046H17TTTCGGCCCGGANONE
J080048A05TCTGGCCCGTTCGGCCCGNONE
J080048A05TTTCGGCCCGGANONE
J080064C21TCTGGCCCGTTCGGCCCGNONE
J080064C21TTTCGGCCCGGANONE
J080067E15TCTGGCCCGTTCGGCCCGNONE
J080067E15TTTCGGCCCGGANONE
J080071P05TCTGGCCCGTTCGGCCCGNONE
J080071P05TTTCGGCCCGGANONE
J080074H16TCTGGCCCGTTCGGCCCGNONE
J080074H16TTTCGGCCCGGANONE
J080076A18TCTGGCCCGTTCGGCCCGNONE
J080076A18TTTCGGCCCGGANONE
J080076D20TCTGGCCCGTTCGGCCCGNONE
J080076D20TTTCGGCCCGGANONE
J080077J15TCTGGCCCGTTCGGCCCGNONE
J080077J15TTTCGGCCCGGANONE
J080085J11TCTGGCCCGTTCGGCCCGNONE
J080085J11TTTCGGCCCGGANONE
J080086E08TCTGGCCCGTTCGGCCCGNONE
J080086E08TTTCGGCCCGGANONE
J080088I23TCTGGCCCGTTCGGCCCGNONE
J080088I23TTTCGGCCCGGANONE
J080088I24TCTGGCCCGTTCGGCCCGNONE
J080088I24TTTCGGCCCGGANONE
J080089D05TCTGGCCCGTTCGGCCCGNONE
J080089D05TTTCGGCCCGGANONE
J080093B04TCTGGCCCGTTCGGCCCGNONE
J080093B04TTTCGGCCCGGANONE
J080093D07TCTGGCCCGTTCGGCCCGNONE
J080093D07TTTCGGCCCGGANONE
J080094A09TCTGGCCCGTTCGGCCCGNONE
J080094A09TTTCGGCCCGGANONE
J080096I12TCTGGCCCGTTCGGCCCGNONE
J080096I12TTTCGGCCCGGANONE
J080097L23TCTGGCCCGTTCGGCCCGNONE
J080097L23TTTCGGCCCGGANONE
Os05g0339300AK109898CCCACGGGConserved hypothetical protein.
J065068I16CCCACGGGNONE
J065194L19CCCACGGGNONE
Os05g0350600AK066244ACCGGGCCCCACCCCACCACSimilar to Atranbp1b protein.
J075100E12ACCGGGCCCCACCCCACCACNONE
J090024D03ACCGGGCCCCACCCCACCACNONE
J100027C02ACCGGGCCCCACCCCACCACNONE
J100053P05ACCGGGCCCCACCCCACCACNONE
J100055P22ACCGGGCCCCACCCCACCACNONE
Os05g0358000006-083-G07CCCGTGGGCCCCACCNONE
AK061141CCCGTGGGCCCCACCNONE
AK070900CCCGTGGGCCCCACCNONE
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein.
J023098C13CCCGTGGGCCCCACCNONE
J033032J06CCCGTGGGCCCCACCNONE
J065014A09CCCGTGGGCCCCACCNONE
J065121L01CCCGTGGGCCCCACCNONE
J065130K19CCCGTGGGCCCCACCNONE
J065208B21CCCGTGGGCCCCACCNONE
J075080G14CCCGTGGGCCCCACCNONE
J075135L01CCCGTGGGCCCCACCNONE
J075180J15CCCGTGGGCCCCACCNONE
Os05g0361900006-033-D04CTCGGCCCGGTNONE
AK060107CTCGGCCCGGTMitochondrial substrate carrier family protein.
AK104602CTCGGCCCGGTNONE
AK104747CTCGGCCCGGTNONE
J033133L03CTCGGCCCGGTNONE
J080001O06CTCGGCCCGGTNONE
J080004F05CTCGGCCCGGTNONE
J080005D12CTCGGCCCGGTNONE
J080008G19CTCGGCCCGGTNONE
J080015D10CTCGGCCCGGTNONE
J080015H22CTCGGCCCGGTNONE
J080016K15CTCGGCCCGGTNONE
J080018D12CTCGGCCCGGTNONE
J080020A01CTCGGCCCGGTNONE
J080027A09CTCGGCCCGGTNONE
J080032F05CTCGGCCCGGTNONE
J080039D09CTCGGCCCGGTNONE
J080043J19CTCGGCCCGGTNONE
J080052G22CTCGGCCCGGTNONE
J080052M15CTCGGCCCGGTNONE
J080053D22CTCGGCCCGGTNONE
J080061I18CTCGGCCCGGTNONE
J080064O14CTCGGCCCGGTNONE
J080075K01CTCGGCCCGGTNONE
J080082I02CTCGGCCCGGTNONE
J080095C14CTCGGCCCGGTNONE
J100028N14CTCGGCCCGGTNONE
Os05g0382600AK068231CCCGTGGGAnnexin family protein.
J013147O19CCCGTGGGNONE
Os05g0387600011-059-E01CGGGCCCCNONE
AK105254CGGGCCCCNONE
AK120230CGGGCCCCProtein kinase-like domain containing protein.
Os05g0393800AK069074CGGGCCGAGProtein of unknown function DUF221 domain containing protein.
Os05g0400800AK065701TGCGGGCCGAASimilar to 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase, chloroplast precursor (EC 5.3.1.16) (Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase) (5-proFAR isomerase) (BBM II).
Os05g0405400J090016P17CACGGCCCGGTNONE
Os05g0408200AK100057GCGGGCCCACCCGSBP domain containing protein.
AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein.
J065182F20GCGGGCCCACCCGNONE
J065182F20GCGGGCCCCACGCGCGACGCNONE
Os05g0408900006-053-D03CCCGGCCCGTTNONE
AF024512CCCGGCCCGTTNONE
AK058950CCCGGCCCGTTNONE
AK059821CCCGGCCCGTTNONE
AK064944CCCGGCCCGTTSimilar to 1-D-deoxyxylulose 5-phosphate synthase.
AK104851CCCGGCCCGTTNONE
AK106750CCCGGCCCGTTNONE
Os05g0409400AK102597CGGGCCGACCGTTGMAP65/ASE1 family protein.
Os05g0411300014-098-D05CCGTGGGCCCGNONE
015-093-F04CCGTGGGCCCGNONE
AK071931CCGTGGGCCCGConserved hypothetical protein.
AK073142CCGTGGGCCCGNONE
Os05g0413000AK058277TACGGCCCGMitochodrial transcription termination factor-related family protein.
Os05g0413200006-067-C03AACGGGCCNONE
006-080-C03AACGGGCCNONE
006-095-G10AACGGGCCNONE
006-115-G11AACGGGCCNONE
013-040-E05AACGGGCCNONE
AB104732AACGGGCCNONE
AK122099AACGGGCCBeta-tubulin.
J033087H20AACGGGCCNONE
J033117C18AACGGGCCNONE
J033125G10AACGGGCCNONE
Os05g0429900AK066834GCGGGCCCACCACNONE
AK099108GCGGGCCCACCACNONE
AK104053GCGGGCCCACCACNONE
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment).
J090031E22GCGGGCCCACCACNONE
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE
J090095K16AT