version

Summary of CCATGG (All List)

Organism Oryza sativa
PPDB Motif CCATGG
Description function unknown
Total Entry Count 5505

Entry Sequences (5505 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602AAAAGCCCATGTSas10/Utp3 family protein.
J013109E04AAAAGCCCATGTNONE
J033057M05AAAAGCCCATGTNONE
J043021M24AAAAGCCCATGTNONE
J090014N05AAAAGCCCATGTNONE
J090077H23AAAAGCCCATGTNONE
J090084H08AAAAGCCCATGTNONE
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein.
J065164N24TCATGGGCCTTNONE
J065167H04TCATGGGCCTTNONE
J065187N12TCATGGGCCTTNONE
Os01g0134700AK111442AGCCCATGACalmodulin binding protein-like family protein.
J065141F12AGCCCATGANONE
J065156K22AGCCCATGANONE
J065160A12AGCCCATGANONE
Os01g0139600AK073130CCCAGCCCATGTSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase).
Os01g0148700006-099-B04CATGGGCCGTTTNONE
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein.
AK109379CATGGGCCGTTTNONE
J023101J18CATGGGCCGTTTNONE
J033036D19CATGGGCCGTTTNONE
J033051P05CATGGGCCGTTTNONE
J033061D21CATGGGCCGTTTNONE
J033071M06CATGGGCCGTTTNONE
J033072D18CATGGGCCGTTTNONE
J033073M13CATGGGCCGTTTNONE
J033084N02CATGGGCCGTTTNONE
J065092C13CATGGGCCGTTTNONE
J080017H24CATGGGCCGTTTNONE
J080032E16CATGGGCCGTTTNONE
J080077J07CATGGGCCGTTTNONE
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein.
Os01g0157800AK121694GCCCATGGHeat shock protein DnaJ, N-terminal domain containing protein.
J033072F06GCCCATGGNONE
Os01g0160200AK073444ATGGCCCATGNONE
AK102533ATGGCCCATGLeucine rich repeat, N-terminal domain containing protein.
J033044L19ATGGCCCATGNONE
J033096F04ATGGCCCATGNONE
Os01g0172000012-070-G06GGGCCGGAGGCCCATGANONE
AK068405GGGCCGGAGGCCCATGAALG3 family protein.
J013149A07GGGCCGGAGGCCCATGANONE
J053047H05GGGCCGGAGGCCCATGANONE
J065075N03GGGCCGGAGGCCCATGANONE
J065093G22GGGCCGGAGGCCCATGANONE
J065130N21GGGCCGGAGGCCCATGANONE
J065143P05GGGCCGGAGGCCCATGANONE
J065216H07GGGCCGGAGGCCCATGANONE
J075013B06GGGCCGGAGGCCCATGANONE
J075196M05GGGCCGGAGGCCCATGANONE
J100039G24GGGCCGGAGGCCCATGANONE
J100041B11GGGCCGGAGGCCCATGANONE
J100069A16GGGCCGGAGGCCCATGANONE
J100069L12GGGCCGGAGGCCCATGANONE
J100074P16GGGCCGGAGGCCCATGANONE
Os01g0191100009-011-A02GCCCATGGGCCTGGNONE
009-028-D05GCCCATGGGCCTGGNONE
009-058-B11GCCCATGGGCCTGGNONE
009-151-D09GCCCATGGGCCTGGNONE
013-026-G03GCCCATGGGCCTGGNONE
013-063-F04GCCCATGGGCCTGGNONE
013-069-B05GCCCATGGGCCTGGNONE
014-029-E04GCCCATGGGCCTGGNONE
014-072-H04GCCCATGGGCCTGGNONE
014-089-E09GCCCATGGGCCTGGNONE
015-047-G05GCCCATGGGCCTGGNONE
016-033-G06GCCCATGGGCCTGGNONE
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment).
J023069C08GCCCATGGGCCTGGNONE
J023077K21GCCCATGGGCCTGGNONE
J023081F19GCCCATGGGCCTGGNONE
J033052N11GCCCATGGGCCTGGNONE
J033058N11GCCCATGGGCCTGGNONE
J033114G05GCCCATGGGCCTGGNONE
J033114O17GCCCATGGGCCTGGNONE
J033129L14GCCCATGGGCCTGGNONE
J053029I12GCCCATGGGCCTGGNONE
J065067N19GCCCATGGGCCTGGNONE
J065084I19GCCCATGGGCCTGGNONE
J065099O03GCCCATGGGCCTGGNONE
J065201I08GCCCATGGGCCTGGNONE
J075035B08GCCCATGGGCCTGGNONE
J075037B22GCCCATGGGCCTGGNONE
J075054L16GCCCATGGGCCTGGNONE
J075059D15GCCCATGGGCCTGGNONE
J075164I08GCCCATGGGCCTGGNONE
J075185J01GCCCATGGGCCTGGNONE
J090042O06GCCCATGGGCCTGGNONE
J090044F12GCCCATGGGCCTGGNONE
J090063L02GCCCATGGGCCTGGNONE
J090073I10GCCCATGGGCCTGGNONE
J090078E18GCCCATGGGCCTGGNONE
J100072K16GCCCATGGGCCTGGNONE
Os01g0191800AK061360GTGGCCCATGNONE
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein.
Os01g0203300015-045-F03ACATGGGCTTCNONE
015-045-F03CCATGGGCTTCNONE
AK106329ACATGGGCTTCConserved hypothetical protein.
AK106329CCATGGGCTTCConserved hypothetical protein.
Os01g0210300AK106937AGCCCATGAConserved hypothetical protein.
Os01g0231700012-002-F11TCATGGGCTTTTNONE
013-082-F05TCATGGGCTTTTNONE
AK107453TCATGGGCTTTTSimilar to 60S acidic ribosomal protein P2-B (CaRP2B).
J065005L22TCATGGGCTTTTNONE
J065023E21TCATGGGCTTTTNONE
J065036H21TCATGGGCTTTTNONE
J065037M24TCATGGGCTTTTNONE
J065049L04TCATGGGCTTTTNONE
J065072F17TCATGGGCTTTTNONE
J065085H10TCATGGGCTTTTNONE
J065109N19TCATGGGCTTTTNONE
J065117M19TCATGGGCTTTTNONE
J065144C15TCATGGGCTTTTNONE
J065159G24TCATGGGCTTTTNONE
J065164N14TCATGGGCTTTTNONE
J075025K16TCATGGGCTTTTNONE
J075057L05TCATGGGCTTTTNONE
J075070I16TCATGGGCTTTTNONE
J075089D10TCATGGGCTTTTNONE
J075138F10TCATGGGCTTTTNONE
J090018C11TCATGGGCTTTTNONE
J100018L19TCATGGGCTTTTNONE
J100024B14TCATGGGCTTTTNONE
J100048L02TCATGGGCTTTTNONE
J100055A22TCATGGGCTTTTNONE
J100069K01TCATGGGCTTTTNONE
Os01g0233500AB024986ACATGGGCTNONE
AK063476ACATGGGCTCyclin.
Os01g0242200AK107468GCAGCCCATGZinc finger, C2H2-type domain containing protein.
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein.
Os01g0303800006-024-G06CCATGGGCNONE
006-025-F12CCATGGGCNONE
006-085-E12CCATGGGCNONE
006-092-F12CCATGGGCNONE
AK060078CCATGGGCUniversal stress protein (Usp) family protein.
AK121626CCATGGGCNONE
J023044K21CCATGGGCNONE
J023069K09CCATGGGCNONE
J023091A17CCATGGGCNONE
J033048C05CCATGGGCNONE
J033126M13CCATGGGCNONE
J065040E06CCATGGGCNONE
J065060D14CCATGGGCNONE
Os01g0312800AK106887CCATGGGCSimilar to CEL4=CELLULASE 4 (Fragment).
J065045N15CCATGGGCNONE
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein.
J023041L20GCGGGCCCATGGGCCATNONE
J043003M03GCGGGCCCATGGGCCATNONE
J075094C04GCGGGCCCATGGGCCATNONE
J090026M16GCGGGCCCATGGGCCATNONE
J100023F23GCGGGCCCATGGGCCATNONE
Y11189GCGGGCCCATGGGCCATNONE
Os01g0369500AK100805CCATGGGCCACC2 calcium/lipid-binding region, CaLB domain containing protein.
J023121K24CCATGGGCCACNONE
Os01g0506200AK073118TCATGGGCCTGTetratricopeptide-like helical domain containing protein.
J065002A07TCATGGGCCTGNONE
J065079J08TCATGGGCCTGNONE
J065167M18TCATGGGCCTGNONE
Os01g0508300AK101435GCGGCCCATGANONE
AK111287GCGGCCCATGAConserved hypothetical protein.
J065096N08GCGGCCCATGANONE
J075003F13GCGGCCCATGANONE
J075014I16GCGGCCCATGANONE
J075022D23GCGGCCCATGANONE
J075040N19GCGGCCCATGANONE
J075121O06GCGGCCCATGANONE
J075131E17GCGGCCCATGANONE
J075136N22GCGGCCCATGANONE
J075147D01GCGGCCCATGANONE
J075173C07GCGGCCCATGANONE
J075196L22GCGGCCCATGANONE
Os01g0513700AK058445ACATGGGCCGCNONE
AK058445ACCGGCCCATGGNONE
AK068877ACATGGGCCGCSybindin-like protein family protein.
AK068877ACCGGCCCATGGSybindin-like protein family protein.
J023001F01ACATGGGCCGCNONE
J023001F01ACCGGCCCATGGNONE
J065065I18ACATGGGCCGCNONE
J065065I18ACCGGCCCATGGNONE
J065165A09ACATGGGCCGCNONE
J065165A09ACCGGCCCATGGNONE
J065184N12ACATGGGCCGCNONE
J065184N12ACCGGCCCATGGNONE
J065205M05ACATGGGCCGCNONE
J065205M05ACCGGCCCATGGNONE
J075172I17ACATGGGCCGCNONE
J075172I17ACCGGCCCATGGNONE
J090025O09ACATGGGCCGCNONE
J090025O09ACCGGCCCATGGNONE
J100087H03ACATGGGCCGCNONE
J100087H03ACCGGCCCATGGNONE
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE
012-094-B11AACGGGCCCGGCCCATGNONE
015-096-C04AACGGGCCCGGCCCATGNONE
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein.
AK099005AACGGGCCCGGCCCATGNONE
J013109B04AACGGGCCCGGCCCATGNONE
J033057L14AACGGGCCCGGCCCATGNONE
J090072H04AACGGGCCCGGCCCATGNONE
J100030A14AACGGGCCCGGCCCATGNONE
Os01g0548000AK100868GCCCATGGConserved hypothetical protein.
AK108360GCCCATGGNONE
Os01g0574400AK072509ACATGGGCTSimilar to Cell division protein ftsH (EC 3.4.24.-).
Os01g0585400AK103584TCATGGGCCCAAATConserved hypothetical protein.
J033133B01TCATGGGCCCAAATNONE
Os01g0590300014-089-E04CCATGGGCTGANONE
AK063740CCATGGGCTGAConserved hypothetical protein.
Os01g0596300016-083-D09TCATGGGCCTTNONE
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein.
J023007D17TCATGGGCCTTNONE
J065141M02TCATGGGCCTTNONE
Os01g0613900014-018-D04GCGGCCCATGANONE
AK119181GCGGCCCATGAProtein of unknown function UPF0052 and CofD family protein.
J023119M14GCGGCCCATGANONE
J065019A15GCGGCCCATGANONE
J075090J10GCGGCCCATGANONE
J075195H12GCGGCCCATGANONE
Os01g0674150J065197O06GCCCATGGGCNONE
J065199N24GCCCATGGGCNONE
J090055L03GCCCATGGGCConserved hypothetical protein.
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein.
J013149O08ACCGGCCCATGANONE
J033064N24ACCGGCCCATGANONE
J043022M20ACCGGCCCATGANONE
J065075K20ACCGGCCCATGANONE
J065081K04ACCGGCCCATGANONE
J065128K13ACCGGCCCATGANONE
J065131K12ACCGGCCCATGANONE
J065137H20ACCGGCCCATGANONE
J065205A09ACCGGCCCATGANONE
J090030C13ACCGGCCCATGANONE
J090053I08ACCGGCCCATGANONE
J090054O22ACCGGCCCATGANONE
J090082C15ACCGGCCCATGANONE
J090097P12ACCGGCCCATGANONE
Os01g0700500AK072715GCAGCCCATGGCytochrome P450 family protein.
AK119264GCAGCCCATGGNONE
Os01g0706100AK072799TCATGGGCTConserved hypothetical protein.
J013049G14TCATGGGCTNONE
J023136E17TCATGGGCTNONE
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein.
J065006D07AAGGCCCATGGNONE
J065007E03AAGGCCCATGGNONE
J065015A13AAGGCCCATGGNONE
J065093J17AAGGCCCATGGNONE
J065116C09AAGGCCCATGGNONE
J065120E04AAGGCCCATGGNONE
J065197I17AAGGCCCATGGNONE
J065208L13AAGGCCCATGGNONE
J065213P07AAGGCCCATGGNONE
J075056K07AAGGCCCATGGNONE
J090036L08AAGGCCCATGGNONE
Os01g0709500AK065353AAGGCCCATGGNONE
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1).
Os01g0721900AK059581TCAGCCCATGGNONE
J065191A18TCAGCCCATGGNONE
J100064H01TCAGCCCATGGNONE
J100075M23TCAGCCCATGGNONE
J100090A11TCAGCCCATGGNONE
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein.
J033080F19AAGGCCCATGANONE
Os01g0730500AK100064GCCCATGGSimilar to Ferredoxin (Bacterial type ferredoxin family).
Os01g0736400AK069723GCCCATGGNONE
AK100689GCCCATGGAminotransferase, class I and II domain containing protein.
Os01g0737900012-087-D12CCATGGGCNONE
AK072600CCATGGGCProtein prenyltransferase domain containing protein.
J023006E12CCATGGGCNONE
J023130A18CCATGGGCNONE
J023134O05CCATGGGCNONE
Os01g0738600AK073479CCATGGGCTENTH/VHS domain containing protein.
AK073479TTGGCCCATGGENTH/VHS domain containing protein.
AK120616CCATGGGCTNONE
AK120616TTGGCCCATGGNONE
J013046M12CCATGGGCTNONE
J013046M12TTGGCCCATGGNONE
J013152B11CCATGGGCTNONE
J013152B11TTGGCCCATGGNONE
J023007A09CCATGGGCTNONE
J023007A09TTGGCCCATGGNONE
J023007N03CCATGGGCTNONE
J023007N03TTGGCCCATGGNONE
J023042A01CCATGGGCTNONE
J023042A01TTGGCCCATGGNONE
J023059P06CCATGGGCTNONE
J023059P06TTGGCCCATGGNONE
J023113A05CCATGGGCTNONE
J023113A05TTGGCCCATGGNONE
J033044K11CCATGGGCTNONE
J033044K11TTGGCCCATGGNONE
J033082E04CCATGGGCTNONE
J033082E04TTGGCCCATGGNONE
J090033B13CCATGGGCTNONE
J090033B13TTGGCCCATGGNONE
J090062H08CCATGGGCTNONE
J090062H08TTGGCCCATGGNONE
J100086G23CCATGGGCTNONE
J100086G23TTGGCCCATGGNONE
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein.
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1.
J013049F10ATATGGGCTTCGGCCCATGANONE
J013088L10ATATGGGCTTCGGCCCATGANONE
J023020B21ATATGGGCTTCGGCCCATGANONE
J023038M01ATATGGGCTTCGGCCCATGANONE
J033058H15ATATGGGCTTCGGCCCATGANONE
J033088C04ATATGGGCTTCGGCCCATGANONE
J033115N19ATATGGGCTTCGGCCCATGANONE
J033131H04ATATGGGCTTCGGCCCATGANONE
J065067E05ATATGGGCTTCGGCCCATGANONE
J065085C07ATATGGGCTTCGGCCCATGANONE
J065095D12ATATGGGCTTCGGCCCATGANONE
J065124B19ATATGGGCTTCGGCCCATGANONE
J065181H07ATATGGGCTTCGGCCCATGANONE
J065197B09ATATGGGCTTCGGCCCATGANONE
J075090K22ATATGGGCTTCGGCCCATGANONE
J075101P17ATATGGGCTTCGGCCCATGANONE
J075181F13ATATGGGCTTCGGCCCATGANONE
J075190H19ATATGGGCTTCGGCCCATGANONE
J090004P17ATATGGGCTTCGGCCCATGANONE
J090066I03ATATGGGCTTCGGCCCATGANONE
Os01g0773600AK067004TCATGGGCCTAGlycoside hydrolase, family 47 protein.
J013091F09TCATGGGCCTANONE
J013134K14TCATGGGCCTANONE
J013158J15TCATGGGCCTANONE
J033060O20TCATGGGCCTANONE
J033074C16TCATGGGCCTANONE
J075086F05TCATGGGCCTANONE
J075150H08TCATGGGCCTANONE
J090006E02TCATGGGCCTANONE
J090074E02TCATGGGCCTANONE
J100030M05TCATGGGCCTANONE
J100036M16TCATGGGCCTANONE
J100063H18TCATGGGCCTANONE
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein.
Os01g0787000006-035-E12GCCCATGGNONE
015-056-B07GCCCATGGNONE
AK101743GCCCATGGSimilar to Peroxidase (EC 1.11.1.7).
AK109348GCCCATGGNONE
J065096L02GCCCATGGNONE
J065185H10GCCCATGGNONE
J065186E06GCCCATGGNONE
J090081I17GCCCATGGNONE
Os01g0798500006-106-C11CCAAGCCCATGNONE
AK061244CCAAGCCCATGNONE
AK068219CCAAGCCCATGMalate synthase-like family protein.
J065199O16CCAAGCCCATGNONE
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18).
Os01g0805000009-045-H11AAGGCCCATGANONE
009-196-H08AAGGCCCATGANONE
J013094D22AAGGCCCATGARibosomal protein L34 family protein.
J013119F23AAGGCCCATGANONE
J065128B11AAGGCCCATGANONE
Os01g0831900011-058-G07CCATGGGCCAGANONE
AK063959CCATGGGCCAGANONE
AK102106CCATGGGCCAGASimilar to Ammonium transporter.
J033084D13CCATGGGCCAGANONE
Os01g0833000AK067226CAGGCCCATGAProtein prenyltransferase domain containing protein.
J013098M23CAGGCCCATGANONE
Os01g0834200AK069188CATGGGCCCACANONE
AK100543CATGGGCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment).
Os01g0834700AK101559CCATGGGCZinc finger, CCCH-type domain containing protein.
AK106074CCATGGGCNONE
Os01g0838350J065034O10CCAGCCCATGNONE
J065151M02CCAGCCCATGConserved hypothetical protein.
J065187I12CCAGCCCATGNONE
J075083I04CCAGCCCATGNONE
J075117N03CCAGCCCATGNONE
Os01g0842500011-030-F11CATGGGCCCCNONE
AK066513CATGGGCCCCSimilar to Laccase (EC 1.10.3.2).
Os01g0842600AK100245GTGGCCCATGGSimilar to AAA-metalloprotease FtsH.
Os01g0848200AK069425AGCCCATGTSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)].
AK101230AGCCCATGTNONE
Os01g0848300AK120668TCCGGCCCATGProtein prenyltransferase domain containing protein.
Os01g0850900009-089-D11CCAGCCCATGANONE
AK063822CCAGCCCATGANONE
AK102887CCAGCCCATGASOUL heme-binding protein family protein.
J033112K22CCAGCCCATGANONE
J065087B10CCAGCCCATGANONE
J065100A05CCAGCCCATGANONE
J075077M10CCAGCCCATGANONE
Os01g0856600016-013-C05CCATGGGCNONE
AK064176CCATGGGCNsp1-like, C-terminal family protein.
Os01g0857700006-045-F05GAGGCCCATGANONE
AK066959GAGGCCCATGASimilar to G10.
AK099794GAGGCCCATGANONE
J013093N15GAGGCCCATGANONE
J023105B19GAGGCCCATGANONE
Os01g0863300014-030-D08ATGGCCCATGGNONE
AK111571ATGGCCCATGGSimilar to MCB2 protein.
J013071A13ATGGCCCATGGNONE
J075060E09ATGGCCCATGGNONE
J075138C14ATGGCCCATGGNONE
J075150M17ATGGCCCATGGNONE
Os01g0869800006-029-F03CACGCCACGCGGCCCATGNONE
006-067-H02CACGCCACGCGGCCCATGNONE
006-084-A06CACGCCACGCGGCCCATGNONE
AK058284CACGCCACGCGGCCCATGSimilar to Photosystem II subunit PsbS.
AK071827CACGCCACGCGGCCCATGNONE
AK104275CACGCCACGCGGCCCATGNONE
J013049J07CACGCCACGCGGCCCATGNONE
J033089F12CACGCCACGCGGCCCATGNONE
J090094I11CACGCCACGCGGCCCATGNONE
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE
AF047428CGTGGACCGGGCCCATGNONE
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein.
J023082D05CGTGGACCGGGCCCATGNONE
J065062L19CGTGGACCGGGCCCATGNONE
J065116H15CGTGGACCGGGCCCATGNONE
J065194N09CGTGGACCGGGCCCATGNONE
J100074C19CGTGGACCGGGCCCATGNONE
Os01g0889800003-107-A06GAAGCCCATGGGCCTCNONE
005-016-H12GAAGCCCATGGGCCTCNONE
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein.
AK104708GAAGCCCATGGGCCTCNONE
J013035D13GAAGCCCATGGGCCTCNONE
J013068K01GAAGCCCATGGGCCTCNONE
J023042J18GAAGCCCATGGGCCTCNONE
J053023F13GAAGCCCATGGGCCTCNONE
J053026M13GAAGCCCATGGGCCTCNONE
J053033N15GAAGCCCATGGGCCTCNONE
J053035I16GAAGCCCATGGGCCTCNONE
J053039A11GAAGCCCATGGGCCTCNONE
J053039K22GAAGCCCATGGGCCTCNONE
J053043B08GAAGCCCATGGGCCTCNONE
J053068K09GAAGCCCATGGGCCTCNONE
J053082D11GAAGCCCATGGGCCTCNONE
J053092N12GAAGCCCATGGGCCTCNONE
J053099A19GAAGCCCATGGGCCTCNONE
J065027F17GAAGCCCATGGGCCTCNONE
J065039B13GAAGCCCATGGGCCTCNONE
J065139N16GAAGCCCATGGGCCTCNONE
J065205B22GAAGCCCATGGGCCTCNONE
Os01g0904400AJ535210GCGGCCCATGGNONE
AK103514GCGGCCCATGGSimilar to Chromosome assembly protein homolog.
Os01g0926400AK063916TCATGGGCTTANONE
AK073976TCATGGGCTTASimilar to Pectin-glucuronyltransferase.
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein.
Os01g0936100AK101371ACATGGGCCAGASimilar to Protein kinase.
Os01g0937300AK062872CCATGGGCCACNONE
J033136K12CCATGGGCCACNONE
J053048E20CCATGGGCCACNONE
J053088K08CCATGGGCCACNONE
J065011G23CCATGGGCCACNONE
J065202J09CCATGGGCCACNONE
Os01g0945300003-104-D07TCATGGGCTTTTNONE
AK065371TCATGGGCTTTTAmino acid/polyamine transporter I family protein.
AK072189TCATGGGCTTTTNONE
J013023D09TCATGGGCTTTTNONE
J013055J18TCATGGGCTTTTNONE
J013146P21TCATGGGCTTTTNONE
J075109G14TCATGGGCTTTTNONE
J075158O19TCATGGGCTTTTNONE
Os01g0948100AK111411GAGGCCCATGAERCC4 domain containing protein.
J090089O16GAGGCCCATGANONE
Os01g0949700AK069037CCAGCCCATGGNONE
J023004F17CCAGCCCATGGNONE
J065063D04CCAGCCCATGGNONE
J065196H02CCAGCCCATGGNONE
J075198A05CCAGCCCATGGNONE
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein.
J023036H24AGATGGGCCTTGGCCCATGANONE
J023084G23AGATGGGCCTTGGCCCATGANONE
J033025J04AGATGGGCCTTGGCCCATGANONE
J033139J18AGATGGGCCTTGGCCCATGANONE
J090006A09AGATGGGCCTTGGCCCATGANONE
J090036D02AGATGGGCCTTGGCCCATGANONE
Os01g0951800AK069239ACATGGGCTProtein prenyltransferase domain containing protein.
Os01g0954400003-009-F12ACATGGGCTTTNONE
012-080-B09ACATGGGCTTTNONE
AK065709ACATGGGCTTTSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor.
AK104335ACATGGGCTTTNONE
J013039J02ACATGGGCTTTNONE
J033081E17ACATGGGCTTTNONE
J075058B02ACATGGGCTTTNONE
J075067K19ACATGGGCTTTNONE
J075120E23ACATGGGCTTTNONE
J075147I16ACATGGGCTTTNONE
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE
AK058574TCGTGGGCCTCATGGGCCGCANONE
AK058574TCGTGGGCCTCATGGGCCGCANONE
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor.
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor.
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor.
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE
AK109369TCGTGGGCCTCATGGGCCGCANONE
AK109369TCGTGGGCCTCATGGGCCGCANONE
Os01g0962600009-104-A04GAGGCCCATGTNONE
AK073846GAGGCCCATGTSimilar to 40S ribosomal protein S10-1.
J033070I05GAGGCCCATGTNONE
J065079N18GAGGCCCATGTNONE
J065122H12GAGGCCCATGTNONE
J065197O14GAGGCCCATGTNONE
Os01g0965500J075073G20CCATGGGCCGCNuclear protein SET domain containing protein.
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein.
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit).
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
Os01g0971000AK061660GCCCATGGConserved hypothetical protein.
AK120145GCCCATGGNONE
J013028J10GCCCATGGNONE
J013127C22GCCCATGGNONE
J065028I23GCCCATGGNONE
J065041P03GCCCATGGNONE
J065048M20GCCCATGGNONE
J065048N19GCCCATGGNONE
J065068A03GCCCATGGNONE
J065195H10GCCCATGGNONE
J065209B18GCCCATGGNONE
J075007K05GCCCATGGNONE
J075049C23GCCCATGGNONE
J075082P22GCCCATGGNONE
J075102H09GCCCATGGNONE
J100042D11GCCCATGGNONE
J100057M03GCCCATGGNONE
Os01g0976700AK068121CCATGGGCTGCNONE
AK100571CCATGGGCTGCSimilar to Protein phosphatase 2C-like protein.
Os02g0103800006-046-H11GTGGCCCATGANONE
006-060-B05GTGGCCCATGANONE
006-097-A09GTGGCCCATGANONE
006-102-A10GTGGCCCATGANONE
006-104-E11GTGGCCCATGANONE
006-112-D09GTGGCCCATGANONE
AK061774GTGGCCCATGANONE
AK065309GTGGCCCATGANONE
AK106213GTGGCCCATGASimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
J013002O13GTGGCCCATGANONE
J013026F06GTGGCCCATGANONE
J013037O14GTGGCCCATGANONE
J013066N06GTGGCCCATGANONE
J013108G22GTGGCCCATGANONE
J023050M15GTGGCCCATGANONE
J023054B21GTGGCCCATGANONE
J023073C23GTGGCCCATGANONE
J023086H17GTGGCCCATGANONE
J023105A20GTGGCCCATGANONE
J065019E16GTGGCCCATGANONE
J065064G10GTGGCCCATGANONE
J065071C18GTGGCCCATGANONE
J065103B02GTGGCCCATGANONE
J065153G06GTGGCCCATGANONE
J075152G24GTGGCCCATGANONE
J075166P04GTGGCCCATGANONE
J080001F02GTGGCCCATGANONE
J080001M07GTGGCCCATGANONE
J080001O05GTGGCCCATGANONE
J080003I19GTGGCCCATGANONE
J080004C12GTGGCCCATGANONE
J080008E17GTGGCCCATGANONE
J080008M08GTGGCCCATGANONE
J080010H21GTGGCCCATGANONE
J080011F22GTGGCCCATGANONE
J080012C16GTGGCCCATGANONE
J080013D20GTGGCCCATGANONE
J080018K15GTGGCCCATGANONE
J080020O14GTGGCCCATGANONE
J080020P21GTGGCCCATGANONE
J080021A07GTGGCCCATGANONE
J080021B06GTGGCCCATGANONE
J080022G21GTGGCCCATGANONE
J080022P14GTGGCCCATGANONE
J080023H24GTGGCCCATGANONE
J080023M08GTGGCCCATGANONE
J080027E08GTGGCCCATGANONE
J080027E18GTGGCCCATGANONE
J080027O16GTGGCCCATGANONE
J080029M22GTGGCCCATGANONE
J080034A17GTGGCCCATGANONE
J080038G04GTGGCCCATGANONE
J080040F13GTGGCCCATGANONE
J080040F22GTGGCCCATGANONE
J080041L15GTGGCCCATGANONE
J080042L04GTGGCCCATGANONE
J080042M14GTGGCCCATGANONE
J080043C22GTGGCCCATGANONE
J080043O09GTGGCCCATGANONE
J080045N17GTGGCCCATGANONE
J080046N08GTGGCCCATGANONE
J080047K11GTGGCCCATGANONE
J080047O06GTGGCCCATGANONE
J080048H10GTGGCCCATGANONE
J080048N03GTGGCCCATGANONE
J080050N02GTGGCCCATGANONE
J080051A05GTGGCCCATGANONE
J080052I20GTGGCCCATGANONE
J080053E08GTGGCCCATGANONE
J080055P05GTGGCCCATGANONE
J080056F15GTGGCCCATGANONE
J080056H07GTGGCCCATGANONE
J080057M20GTGGCCCATGANONE
J080059K09GTGGCCCATGANONE
J080059M10GTGGCCCATGANONE
J080060B12GTGGCCCATGANONE
J080061N09GTGGCCCATGANONE
J080062H11GTGGCCCATGANONE
J080062M13GTGGCCCATGANONE
J080063D14GTGGCCCATGANONE
J080063G10GTGGCCCATGANONE
J080063H18GTGGCCCATGANONE
J080066J23GTGGCCCATGANONE
J080067J06GTGGCCCATGANONE
J080069I11GTGGCCCATGANONE
J080069O22GTGGCCCATGANONE
J080070P11GTGGCCCATGANONE
J080072D06GTGGCCCATGANONE
J080072J22GTGGCCCATGANONE
J080075A20GTGGCCCATGANONE
J080076F11GTGGCCCATGANONE
J080076J24GTGGCCCATGANONE
J080076K05GTGGCCCATGANONE
J080077O10GTGGCCCATGANONE
J080078L19GTGGCCCATGANONE
J080080I08GTGGCCCATGANONE
J080081J23GTGGCCCATGANONE
J080083A17GTGGCCCATGANONE
J080085C05GTGGCCCATGANONE
J080086G24GTGGCCCATGANONE
J080087H02GTGGCCCATGANONE
J080089A13GTGGCCCATGANONE
J080090K08GTGGCCCATGANONE
J080092M01GTGGCCCATGANONE
J080095A19GTGGCCCATGANONE
J080095B20GTGGCCCATGANONE
J100028F13GTGGCCCATGANONE
J100040G22GTGGCCCATGANONE
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE
J100030O18CCACTGACACATGGGCCCTNONE
Os02g0121200AK070123GAGGCCCATGTNONE
AK121751GAGGCCCATGTProtein of unknown function DUF890 family protein.
Os02g0130300011-005-D07CATGGGCCCACCTNONE
011-041-B06CATGGGCCCACCTNONE
015-099-D11CATGGGCCCACCTNONE
016-049-D06CATGGGCCCACCTNONE
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein.
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein.
J023034H09TGCGGCCCAATTCAGCCCATGTNONE
J033090D08TGCGGCCCAATTCAGCCCATGTNONE
J100025N07TGCGGCCCAATTCAGCCCATGTNONE
J100075G18TGCGGCCCAATTCAGCCCATGTNONE
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein.
Os02g0140200AK066454GCCCATGGSimilar to Beta-amyrin synthase.
Os02g0141000009-053-C03AGCCCATGGNONE
AK121058AGCCCATGGAIG2-like family protein.
J023054F06AGCCCATGGNONE
J023056J21AGCCCATGGNONE
J053031K06AGCCCATGGNONE
J053098J23AGCCCATGGNONE
J065178E11AGCCCATGGNONE
Os02g0148400AK070451TCCGGCCCATGANONE
AK072039TCCGGCCCATGAPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein.
J075148J10TCCGGCCCATGANONE
Os02g0158900AK108324GCAGCCCATGSimilar to SNF4.
Os02g0162500009-181-F03CATGGGCTNONE
AK058907CATGGGCTNONE
AK121223CATGGGCTSimilar to 40S ribosomal protein S14.
J023090I10CATGGGCTNONE
J023136J11CATGGGCTNONE
J053097J20CATGGGCTNONE
J053098F01CATGGGCTNONE
J065065B09CATGGGCTNONE
J065082M04CATGGGCTNONE
J065188O05CATGGGCTNONE
J075057P15CATGGGCTNONE
J075061J08CATGGGCTNONE
J075061N15CATGGGCTNONE
J075131I08CATGGGCTNONE
J075141H13CATGGGCTNONE
J080062E14CATGGGCTNONE
J080062P15CATGGGCTNONE
J080318G17CATGGGCTNONE
J080319G19CATGGGCTNONE
J090001L10CATGGGCTNONE
J090024I18CATGGGCTNONE
J090033F24CATGGGCTNONE
J090036M16CATGGGCTNONE
J090040I24CATGGGCTNONE
J090048P06CATGGGCTNONE
J090049B12CATGGGCTNONE
J090068C02CATGGGCTNONE
J090069O04CATGGGCTNONE
J090084H22CATGGGCTNONE
J100022L03CATGGGCTNONE
J100028O14CATGGGCTNONE
J100028O18CATGGGCTNONE
J100032A15CATGGGCTNONE
J100033D21CATGGGCTNONE
J100034J23CATGGGCTNONE
J100043K22CATGGGCTNONE
J100052M22CATGGGCTNONE
J100053N03CATGGGCTNONE
J100074N24CATGGGCTNONE
J100082J10CATGGGCTNONE
Os02g0163600AK068043TCATGGGCTTAConserved hypothetical protein.
J013131O20TCATGGGCTTANONE
J065006E03TCATGGGCTTANONE
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein.
Os02g0176400009-099-H11TCATGGGCCGAAANONE
AK062746TCATGGGCCGAAAProtein of unknown function DUF872, eukaryotic family protein.
Os02g0177700AK119941GCCCATGGCGCACGCGTCTCProtein of unknown function DUF588 family protein.
Os02g0178400009-151-B08TAGGCCCATGGGCCGGANONE
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit.
AK121516TAGGCCCATGGGCCGGANONE
J033026A17TAGGCCCATGGGCCGGANONE
J065011K14TAGGCCCATGGGCCGGANONE
J065056D01TAGGCCCATGGGCCGGANONE
J065061L22TAGGCCCATGGGCCGGANONE
J065076M01TAGGCCCATGGGCCGGANONE
J075092E14TAGGCCCATGGGCCGGANONE
Os02g0179100AK058557ACATGGGCTMetal-dependent phosphohydrolase, HD region domain containing protein.
J080311O10ACATGGGCTNONE
Os02g0180100005-013-B11TCATGGGCCCGNONE
AK067359TCATGGGCCCGPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein.
AK104700TCATGGGCCCGNONE
J013090O22TCATGGGCCCGNONE
J013099P19TCATGGGCCCGNONE
J090041M21TCATGGGCCCGNONE
J090049C14TCATGGGCCCGNONE
Os02g0192500AK059580TTGGCCCATGNONE
Os02g0198000AK067695AGCCCATGTProtein of unknown function DUF1677, Oryza sativa family protein.
AK067695CTGGCCCATGAProtein of unknown function DUF1677, Oryza sativa family protein.
Os02g0202800011-038-F08AGCCCATGGNONE
015-041-G02AGCCCATGGNONE
AK102082AGCCCATGGFAR1 domain containing protein.
AK102813AGCCCATGGNONE
AK109243AGCCCATGGNONE
J033108L18AGCCCATGGNONE
J033129C24AGCCCATGGNONE
J065138F15AGCCCATGGNONE
Os02g0205300006-050-H03ACATGGGCCGGCNONE
011-057-B04ACATGGGCCGGCNONE
AB033537ACATGGGCCGGCNONE
AB052887ACATGGGCCGGCNONE
AK061762ACATGGGCCGGCNONE
AK102286ACATGGGCCGGCSimilar to TAT-binding protein homolog (Fragment).
AK106217ACATGGGCCGGCNONE
J013000E18ACATGGGCCGGCNONE
J023030F11ACATGGGCCGGCNONE
J033030E16ACATGGGCCGGCNONE
J033061B21ACATGGGCCGGCNONE
J033086D09ACATGGGCCGGCNONE
J033089I16ACATGGGCCGGCNONE
J033132G01ACATGGGCCGGCNONE
J090003O15ACATGGGCCGGCNONE
J090004A19ACATGGGCCGGCNONE
J090054P05ACATGGGCCGGCNONE
J090083M17ACATGGGCCGGCNONE
J100039E08ACATGGGCCGGCNONE
J100058D24ACATGGGCCGGCNONE
J100066P09ACATGGGCCGGCNONE
J100086K12ACATGGGCCGGCNONE
J100088J15ACATGGGCCGGCNONE
Os02g0241100Os02g0241100GAGGCCCATGTProtein kinase-like domain containing protein.
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein.
Os02g0255100AK060458GCCCATGGNONE
Os02g0274000006-082-B11TCATGGGCCATNONE
009-149-B01TCATGGGCCATNONE
013-005-D02TCATGGGCCATNONE
AK061802TCATGGGCCATNONE
AK099750TCATGGGCCATConserved hypothetical protein.
J013092A18TCATGGGCCATNONE
J065205D02TCATGGGCCATNONE
J080305A06TCATGGGCCATNONE
J080306D13TCATGGGCCATNONE
J090043E14TCATGGGCCATNONE
J100023E14TCATGGGCCATNONE
J100041A16TCATGGGCCATNONE
J100078K21TCATGGGCCATNONE
Os02g0288100AK107019GCCCATGGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment).
Os02g0441000AK108073CCATGGGCConserved hypothetical protein.
Os02g0467700AK121672GAGGCCCATGTGlycosyltransferase 28, C-terminal domain containing protein.
J033068B18GAGGCCCATGTNONE
J080035D09GAGGCCCATGTNONE
J080039E21GAGGCCCATGTNONE
J080054N01GAGGCCCATGTNONE
J080071C12GAGGCCCATGTNONE
Os02g0562300AK073250GAGGCCCATGACalmodulin binding protein-like family protein.
Os02g0567000AK068282GTGTGGGCCCATGAConserved hypothetical protein.
J075034A17GTGTGGGCCCATGANONE
J075129I09GTGTGGGCCCATGANONE
Os02g0581300AK071553ACATGGGCTTRAM, LAG1 and CLN8 homology domain containing protein.
J023105G15ACATGGGCTNONE
J065044A01ACATGGGCTNONE
J065089D11ACATGGGCTNONE
J065098K16ACATGGGCTNONE
J065119D04ACATGGGCTNONE
J065190M10ACATGGGCTNONE
J090029F16ACATGGGCTNONE
J090040K10ACATGGGCTNONE
J090058J09ACATGGGCTNONE
J090080C19ACATGGGCTNONE
Os02g0581500AK059396GCCCATGGEpoxide hydrolase family protein.
Os02g0584700009-044-F06AGCCCATGANONE
J065178P16AGCCCATGANONE
J075029H13AGCCCATGANONE
J075042D04AGCCCATGAHeavy metal transport/detoxification protein domain containing protein.
J075048C14AGCCCATGANONE
J075068P06AGCCCATGANONE
J075094M11AGCCCATGANONE
J075101D19AGCCCATGANONE
J075121E10AGCCCATGANONE
J075170D07AGCCCATGANONE
J075174C22AGCCCATGANONE
J075178D09AGCCCATGANONE
J075187A20AGCCCATGANONE
J075190I15AGCCCATGANONE
Os02g0591800AK060611ACATGGGCTAGGCCCACTBrix domain containing protein.
AK102534ACATGGGCTAGGCCCACTNONE
J075057H08ACATGGGCTAGGCCCACTNONE
J075179P18ACATGGGCTAGGCCCACTNONE
J080011H01ACATGGGCTAGGCCCACTNONE
J080018E14ACATGGGCTAGGCCCACTNONE
J080026N17ACATGGGCTAGGCCCACTNONE
J080047A13ACATGGGCTAGGCCCACTNONE
J080049C17ACATGGGCTAGGCCCACTNONE
J080050G07ACATGGGCTAGGCCCACTNONE
J080064D10ACATGGGCTAGGCCCACTNONE
J080080A03ACATGGGCTAGGCCCACTNONE
J080080G20ACATGGGCTAGGCCCACTNONE
J080080I03ACATGGGCTAGGCCCACTNONE
J080081H12ACATGGGCTAGGCCCACTNONE
J080090K07ACATGGGCTAGGCCCACTNONE
J080092O06ACATGGGCTAGGCCCACTNONE
J080096B07ACATGGGCTAGGCCCACTNONE
J080097M08ACATGGGCTAGGCCCACTNONE
Os02g0600100AK071215TCCGGCCCATGGSimilar to 26S proteasome subunit RPN7.
AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7.
Os02g0605600016-017-B02TCATGGGCCGCNONE
AK066104TCATGGGCCGCLUC7 related family protein.
J013052G16TCATGGGCCGCNONE
J043022E03TCATGGGCCGCNONE
J065105P10TCATGGGCCGCNONE
Os02g0614600AK058581GCCCATGGNONE
Os02g0618250009-115-E10CCAAGCCCATGTNONE
014-076-A03CCAAGCCCATGTNONE
J065096D10CCAAGCCCATGTSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein.
J075045G01CCAAGCCCATGTNONE
J075092J11CCAAGCCCATGTNONE
J075134F02CCAAGCCCATGTNONE
Os02g0621700011-079-F10TAGGCCCATGANONE
AK101006TAGGCCCATGASimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta).
AK103525TAGGCCCATGANONE
J013026C02TAGGCCCATGANONE
J013104M10TAGGCCCATGANONE
J023003D01TAGGCCCATGANONE
J023007H13TAGGCCCATGANONE
J023019G09TAGGCCCATGANONE
J023020L19TAGGCCCATGANONE
J023022L12TAGGCCCATGANONE
J023022O14TAGGCCCATGANONE
J023036F16TAGGCCCATGANONE
J023047D16TAGGCCCATGANONE
J023052P08TAGGCCCATGANONE
J023077C01TAGGCCCATGANONE
J023083M06TAGGCCCATGANONE
J023105A11TAGGCCCATGANONE
J023117F21TAGGCCCATGANONE
J023119D20TAGGCCCATGANONE
J023148E03TAGGCCCATGANONE
J023149B13TAGGCCCATGANONE
J033029A10TAGGCCCATGANONE
J033046L17TAGGCCCATGANONE
J033052M04TAGGCCCATGANONE
J033057M14TAGGCCCATGANONE
J033066K24TAGGCCCATGANONE
J033069K02TAGGCCCATGANONE
J033079G14TAGGCCCATGANONE
J033101E06TAGGCCCATGANONE
J033116E06TAGGCCCATGANONE
J033118L18TAGGCCCATGANONE
J033135B13TAGGCCCATGANONE
J033136C10TAGGCCCATGANONE
J033136P08TAGGCCCATGANONE
J043027B13TAGGCCCATGANONE
J065039I03TAGGCCCATGANONE
J065185N21TAGGCCCATGANONE
J090008D14TAGGCCCATGANONE
J090029K17TAGGCCCATGANONE
J090047H20TAGGCCCATGANONE
J090048N17TAGGCCCATGANONE
J090085G08TAGGCCCATGANONE
J090089F07TAGGCCCATGANONE
Os02g0634800003-004-F03TCAGCCCATGANONE
AK059694TCAGCCCATGAUbiquitin-conjugating enzyme, E2 domain containing protein.
J013067H17TCAGCCCATGANONE
J053077G20TCAGCCCATGANONE
J075195F14TCAGCCCATGANONE
Os02g0634900006-032-G12TCATGGGCTGANONE
006-033-E09TCATGGGCTGANONE
006-117-F10TCATGGGCTGANONE
006-118-E01TCATGGGCTGANONE
013-056-G08TCATGGGCTGANONE
AK059769TCATGGGCTGANONE
AK068583TCATGGGCTGANONE
AK072855TCATGGGCTGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
AK106210TCATGGGCTGANONE
J023138P05TCATGGGCTGANONE
J023143J07TCATGGGCTGANONE
J033022O09TCATGGGCTGANONE
J033111L02TCATGGGCTGANONE
J033135O03TCATGGGCTGANONE
J065005K19TCATGGGCTGANONE
J065044C17TCATGGGCTGANONE
J065116K09TCATGGGCTGANONE
J065119O21TCATGGGCTGANONE
J075014L05TCATGGGCTGANONE
J075109H16TCATGGGCTGANONE
J075117D04TCATGGGCTGANONE
Os02g0637900AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein.
J065038O03GCTGGGCCATGGCCCATGTNONE
J065052A19GCTGGGCCATGGCCCATGTNONE
J065052A20GCTGGGCCATGGCCCATGTNONE
J065063D06GCTGGGCCATGGCCCATGTNONE
J065069D12GCTGGGCCATGGCCCATGTNONE
J065074H07GCTGGGCCATGGCCCATGTNONE
J065174K17GCTGGGCCATGGCCCATGTNONE
J065215M12GCTGGGCCATGGCCCATGTNONE
J075007E12GCTGGGCCATGGCCCATGTNONE
J075057K20GCTGGGCCATGGCCCATGTNONE
J075119I10GCTGGGCCATGGCCCATGTNONE
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein.
Os02g0643500AK068423CATGGGCTTTPentapeptide repeat containing protein.
AK068423TCATGGGCCAAPentapeptide repeat containing protein.
Os02g0646200009-031-C03AACGGCCCATGNONE
AK071507AACGGCCCATGZinc finger, B-box domain containing protein.
J023090D24AACGGCCCATGNONE
Os02g0651500AK066333TCAGCCCATGANONE
AK121865TCAGCCCATGAHypothetical protein.
J090038J11TCAGCCCATGANONE
Os02g0655300006-024-H05CCATGGGCCACNONE
006-032-G04CCATGGGCCACNONE
006-045-F03CCATGGGCCACNONE
006-076-D04CCATGGGCCACNONE
006-086-C09CCATGGGCCACNONE
006-104-C07CCATGGGCCACNONE
AK061544CCATGGGCCACNONE
AK103778CCATGGGCCACNONE
AK106107CCATGGGCCACNONE
AK120006CCATGGGCCACNONE
AY363174CCATGGGCCACSimilar to 3-isopropylmalate dehydratase, small subunit.
J033145B21CCATGGGCCACNONE
J065021C16CCATGGGCCACNONE
J065182F01CCATGGGCCACNONE
J075063I18CCATGGGCCACNONE
J075151E01CCATGGGCCACNONE
J075198K18CCATGGGCCACNONE
J090026M06CCATGGGCCACNONE
J090081H02CCATGGGCCACNONE
J100061E20CCATGGGCCACNONE
Os02g0665400AK073914TCATGGGCCACNONE
AK109787TCATGGGCCACNONE
AK120141TCATGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2.
J065021I19TCATGGGCCACNONE
J075165B08TCATGGGCCACNONE
J075177B03TCATGGGCCACNONE
J075191K02TCATGGGCCACNONE
J090051I12TCATGGGCCACNONE
J090057E21TCATGGGCCACNONE
J090058E01TCATGGGCCACNONE
J090087C06TCATGGGCCACNONE
J100025K07TCATGGGCCACNONE
J100026I21TCATGGGCCACNONE
J100041E12TCATGGGCCACNONE
J100083B01TCATGGGCCACNONE
Os02g0670900003-115-B09GCCCATGGNONE
003-115-B09TGTGGGCCCATGANONE
005-004-F12GCCCATGGNONE
005-004-F12TGTGGGCCCATGANONE
006-037-B11GCCCATGGNONE
006-037-B11TGTGGGCCCATGANONE
006-094-B07GCCCATGGNONE
006-094-B07TGTGGGCCCATGANONE
011-020-A12GCCCATGGNONE
011-020-A12TGTGGGCCCATGANONE
AK061649GCCCATGGNONE
AK061649TGTGGGCCCATGANONE
AK061743GCCCATGGNONE
AK061743TGTGGGCCCATGANONE
AK064827GCCCATGGNONE
AK064827TGTGGGCCCATGANONE
AK100650GCCCATGGSimilar to Amino acid transporter protein-like.
AK100650TGTGGGCCCATGASimilar to Amino acid transporter protein-like.
AK119517GCCCATGGNONE
AK119517TGTGGGCCCATGANONE
J013000F07GCCCATGGNONE
J013000F07TGTGGGCCCATGANONE
J013027M02GCCCATGGNONE
J013027M02TGTGGGCCCATGANONE
J013027M22GCCCATGGNONE
J013027M22TGTGGGCCCATGANONE
J013031G16GCCCATGGNONE
J013031G16TGTGGGCCCATGANONE
J013044H17GCCCATGGNONE
J013044H17TGTGGGCCCATGANONE
J013045G22GCCCATGGNONE
J013045G22TGTGGGCCCATGANONE
J013059N20GCCCATGGNONE
J013059N20TGTGGGCCCATGANONE
J013063G15GCCCATGGNONE
J013063G15TGTGGGCCCATGANONE
J013064J09GCCCATGGNONE
J013064J09TGTGGGCCCATGANONE
J013089F14GCCCATGGNONE
J013089F14TGTGGGCCCATGANONE
J013099L15GCCCATGGNONE
J013099L15TGTGGGCCCATGANONE
J013119A08GCCCATGGNONE
J013119A08TGTGGGCCCATGANONE
J013119B13GCCCATGGNONE
J013119B13TGTGGGCCCATGANONE
J013126K07GCCCATGGNONE
J013126K07TGTGGGCCCATGANONE
J023019J06GCCCATGGNONE
J023019J06TGTGGGCCCATGANONE
J023019K19GCCCATGGNONE
J023019K19TGTGGGCCCATGANONE
J023038I17GCCCATGGNONE
J023038I17TGTGGGCCCATGANONE
J023042O17GCCCATGGNONE
J023042O17TGTGGGCCCATGANONE
J023060G23GCCCATGGNONE
J023060G23TGTGGGCCCATGANONE
J023064A12GCCCATGGNONE
J023064A12TGTGGGCCCATGANONE
J023072G01GCCCATGGNONE
J023072G01TGTGGGCCCATGANONE
J023108K16GCCCATGGNONE
J023108K16TGTGGGCCCATGANONE
J023111D04GCCCATGGNONE
J023111D04TGTGGGCCCATGANONE
J023134O14GCCCATGGNONE
J023134O14TGTGGGCCCATGANONE
J023142P09GCCCATGGNONE
J023142P09TGTGGGCCCATGANONE
J033039F01GCCCATGGNONE
J033039F01TGTGGGCCCATGANONE
J033068J18GCCCATGGNONE
J033068J18TGTGGGCCCATGANONE
J033117B05GCCCATGGNONE
J033117B05TGTGGGCCCATGANONE
J033118I01GCCCATGGNONE
J033118I01TGTGGGCCCATGANONE
J033136E10GCCCATGGNONE
J033136E10TGTGGGCCCATGANONE
J033140C15GCCCATGGNONE
J033140C15TGTGGGCCCATGANONE
J043024E09GCCCATGGNONE
J043024E09TGTGGGCCCATGANONE
J043038B21GCCCATGGNONE
J043038B21TGTGGGCCCATGANONE
J090005F19GCCCATGGNONE
J090005F19TGTGGGCCCATGANONE
J090022N04GCCCATGGNONE
J090022N04TGTGGGCCCATGANONE
J090023F15GCCCATGGNONE
J090023F15TGTGGGCCCATGANONE
J090038O19GCCCATGGNONE
J090038O19TGTGGGCCCATGANONE
J090042N22GCCCATGGNONE
J090042N22TGTGGGCCCATGANONE
J090051C06GCCCATGGNONE
J090051C06TGTGGGCCCATGANONE
J090063O09GCCCATGGNONE
J090063O09TGTGGGCCCATGANONE
J090079N05GCCCATGGNONE
J090079N05TGTGGGCCCATGANONE
J090096L17GCCCATGGNONE
J090096L17TGTGGGCCCATGANONE
J100038G08GCCCATGGNONE
J100038G08TGTGGGCCCATGANONE
J100041F17GCCCATGGNONE
J100041F17TGTGGGCCCATGANONE
J100042G15GCCCATGGNONE
J100042G15TGTGGGCCCATGANONE
J100042N11GCCCATGGNONE
J100042N11TGTGGGCCCATGANONE
J100048B10GCCCATGGNONE
J100048B10TGTGGGCCCATGANONE
J100056C24GCCCATGGNONE
J100056C24TGTGGGCCCATGANONE
J100059K07GCCCATGGNONE
J100059K07TGTGGGCCCATGANONE
J100069A06GCCCATGGNONE
J100069A06TGTGGGCCCATGANONE
J100077B01GCCCATGGNONE
J100077B01TGTGGGCCCATGANONE
J100089D17GCCCATGGNONE
J100089D17TGTGGGCCCATGANONE
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE
J023037G24TCCGGCCCATGAGGGGCCCAATANONE
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein.
J023142L24TCCGGCCCATGAGGGGCCCAATANONE
J033115B14TCCGGCCCATGAGGGGCCCAATANONE
J075004B15TCCGGCCCATGAGGGGCCCAATANONE
J075067J21TCCGGCCCATGAGGGGCCCAATANONE
J075072K07TCCGGCCCATGAGGGGCCCAATANONE
J075147H21TCCGGCCCATGAGGGGCCCAATANONE
J075154F03TCCGGCCCATGAGGGGCCCAATANONE
Os02g0678300J075035C01AACGGCCCATGGlucose-methanol-choline oxidoreductase domain containing protein.
J075148E09AACGGCCCATGNONE
J080024A08AACGGCCCATGNONE
J080063C14AACGGCCCATGNONE
J080072L04AACGGCCCATGNONE
J080074H15AACGGCCCATGNONE
J080080E22AACGGCCCATGNONE
J080086H10AACGGCCCATGNONE
J080093B21AACGGCCCATGNONE
J080094G01AACGGCCCATGNONE
J080306H24AACGGCCCATGNONE
Os02g0681100AK100584AAAGCCCATGAProtein of unknown function DUF604 family protein.
J023106A15AAAGCCCATGANONE
Os02g0697500AK105680CACGGCCCATGSimilar to Selenium-binding protein-like.
AK105680GCCCATGGSimilar to Selenium-binding protein-like.
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein.
Os02g0751600006-048-C01GGGAAAGCCCATGGNONE
006-059-E07GGGAAAGCCCATGGNONE
AK060441GGGAAAGCCCATGGNONE
AK061027GGGAAAGCCCATGGNONE
AK072946GGGAAAGCCCATGGPeptidylprolyl isomerase, FKBP-type domain containing protein.
AK104401GGGAAAGCCCATGGNONE
J023150D22GGGAAAGCCCATGGNONE
J075005E17GGGAAAGCCCATGGNONE
J075019F10GGGAAAGCCCATGGNONE
J075047K24GGGAAAGCCCATGGNONE
J075052B13GGGAAAGCCCATGGNONE
J075063M19GGGAAAGCCCATGGNONE
J075136P10GGGAAAGCCCATGGNONE
J075139E24GGGAAAGCCCATGGNONE
J075152K11GGGAAAGCCCATGGNONE
J075161A10GGGAAAGCCCATGGNONE
J075187F20GGGAAAGCCCATGGNONE
Os02g0753300012-010-H04ATGGCCCATGGNONE
AK065736ATGGCCCATGGLipoxygenase, LH2 domain containing protein.
AK104930ATGGCCCATGGNONE
J013038J04ATGGCCCATGGNONE
J065041B21ATGGCCCATGGNONE
J065162K13ATGGCCCATGGNONE
J065187G18ATGGCCCATGGNONE
J075051J11ATGGCCCATGGNONE
J100027H02ATGGCCCATGGNONE
Os02g0754500AK069965AGCCCATGACAAGCCCACGGNONE
AK105696AGCCCATGACAAGCCCACGGAmidase family protein.
Os02g0756200AK063454CGGGCCCATGGNONE
AK101655CGGGCCCATGGSimilar to Phi-1 protein.
J065104L21CGGGCCCATGGNONE
J065141A07CGGGCCCATGGNONE
Os02g0759700AK111935AGCCCATGGNONE
Os02g0767100011-054-E05ACATGGGCCTCNONE
AK063351ACATGGGCCTCNONE
AK103640ACATGGGCCTCConserved hypothetical protein.
J090022G11ACATGGGCCTCNONE
J090072L18ACATGGGCCTCNONE
Os02g0769700AK111328ACATGGGCCGAProtein kinase-like domain containing protein.
AK111328CATGGGCCATProtein kinase-like domain containing protein.
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein.
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE
Os02g0782200AK070439AAGGCCCATGANONE
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein.
Os02g0791800AK066282CATGGGCTGCNONE
AK099697CATGGGCTGCWD-40 repeat containing protein.
AY445625CATGGGCTGCNONE
J053065H07CATGGGCTGCNONE
J065108P05CATGGGCTGCNONE
J065154P22CATGGGCTGCNONE
J100037P04CATGGGCTGCNONE
J100068K05CATGGGCTGCNONE
Os02g0798300AK120999GTGGCCCATGAConserved hypothetical protein.
Os02g0803600AK064750AGCCCATGALongin-like domain containing protein.
Os02g0804300006-046-D12GAGGCCCATGANONE
AK060165GAGGCCCATGANONE
AK067584GAGGCCCATGASAM (and some other nucleotide) binding motif domain containing protein.
J013112C12GAGGCCCATGANONE
J023098C22GAGGCCCATGANONE
J033123P06GAGGCCCATGANONE
J065060N24GAGGCCCATGANONE
J065069H22GAGGCCCATGANONE
J065155N20GAGGCCCATGANONE
J065170K07GAGGCCCATGANONE
J090033D12GAGGCCCATGANONE
Os02g0813700Os02g0813700CAAGCCCATGANONE
Os02g0823000AK122065CTGGCCCATGAPeptidase A22B, minor histocompatibility antigen H13 family protein.
Os02g0823400AK105029AGCCCATGTSimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment).
J033140N12AGCCCATGTNONE
J075104C12AGCCCATGTNONE
J075120E03AGCCCATGTNONE
J075126M18AGCCCATGTNONE
J075189P21AGCCCATGTNONE
Os02g0823600AK070498CAGGCCCATGAConserved hypothetical protein.
J065055C02CAGGCCCATGANONE
J065098A17CAGGCCCATGANONE
J065119B13CAGGCCCATGANONE
J065146F10CAGGCCCATGANONE
J065209G06CAGGCCCATGANONE
J080001K12CAGGCCCATGANONE
J080004O17CAGGCCCATGANONE
J080005P21CAGGCCCATGANONE
J080009M18CAGGCCCATGANONE
J080013O18CAGGCCCATGANONE
J080014B04CAGGCCCATGANONE
J080014O21CAGGCCCATGANONE
J080015B04CAGGCCCATGANONE
J080016B17CAGGCCCATGANONE
J080017G09CAGGCCCATGANONE
J080022A17CAGGCCCATGANONE
J080024M10CAGGCCCATGANONE
J080025F17CAGGCCCATGANONE
J080025O16CAGGCCCATGANONE
J080029H09CAGGCCCATGANONE
J080030G24CAGGCCCATGANONE
J080031E02CAGGCCCATGANONE
J080032A18CAGGCCCATGANONE
J080032G24CAGGCCCATGANONE
J080033C05CAGGCCCATGANONE
J080033N19CAGGCCCATGANONE
J080035H10CAGGCCCATGANONE
J080035L05CAGGCCCATGANONE
J080042N09CAGGCCCATGANONE
J080044C14CAGGCCCATGANONE
J080048K16CAGGCCCATGANONE
J080050L07CAGGCCCATGANONE
J080051L06CAGGCCCATGANONE
J080051P22CAGGCCCATGANONE
J080053D09CAGGCCCATGANONE
J080053J15CAGGCCCATGANONE
J080053O12CAGGCCCATGANONE
J080057L01CAGGCCCATGANONE
J080062E08CAGGCCCATGANONE
J080062I09CAGGCCCATGANONE
J080063A21CAGGCCCATGANONE
J080063E04CAGGCCCATGANONE
J080063E08CAGGCCCATGANONE
J080064D15CAGGCCCATGANONE
J080064N15CAGGCCCATGANONE
J080068F13CAGGCCCATGANONE
J080070L16CAGGCCCATGANONE
J080072O17CAGGCCCATGANONE
J080075A07CAGGCCCATGANONE
J080076H10CAGGCCCATGANONE
J080077K19CAGGCCCATGANONE
J080078E19CAGGCCCATGANONE
J080082A02CAGGCCCATGANONE
J080083O05CAGGCCCATGANONE
J080091I07CAGGCCCATGANONE
J080094K10CAGGCCCATGANONE
J080094N03CAGGCCCATGANONE
J080096F09CAGGCCCATGANONE
J080097O04CAGGCCCATGANONE
J090037B19CAGGCCCATGANONE
J100017A13CAGGCCCATGANONE
J100068N22CAGGCCCATGANONE
J100072C06CAGGCCCATGANONE
Os02g0827300AK069159TCATGGGCCATProtein of unknown function DUF382 domain containing protein.
Os02g0830100J013032G02TTGGCCCATGANONE
J013052O21TTGGCCCATGANONE
J023078A05TTGGCCCATGANONE
J033114C07TTGGCCCATGANONE
J033125M07TTGGCCCATGANONE
J053045C11TTGGCCCATGANONE
J100055G05TTGGCCCATGANONE
J100080J22TTGGCCCATGANONE
Os02g0833900003-009-D08AGCCCATGANONE
006-021-A06AGCCCATGANONE
006-021-C05AGCCCATGANONE
006-026-E10AGCCCATGANONE
006-030-E06AGCCCATGANONE
006-057-B10AGCCCATGANONE
006-063-H09AGCCCATGANONE
006-068-H02AGCCCATGANONE
006-074-H10AGCCCATGANONE
006-077-F08AGCCCATGANONE
006-078-F01AGCCCATGANONE
006-079-A12AGCCCATGANONE
006-086-F02AGCCCATGANONE
006-086-G01AGCCCATGANONE
006-101-A03AGCCCATGANONE
006-108-C11AGCCCATGANONE
006-113-G12AGCCCATGANONE
006-117-F12AGCCCATGANONE
006-119-D10AGCCCATGANONE
006-119-F09AGCCCATGANONE
009-106-G05AGCCCATGANONE
009-126-B08AGCCCATGANONE
009-166-F06AGCCCATGANONE
AK060083AGCCCATGANONE
AK099584AGCCCATGANONE
AK106092AGCCCATGANONE
AK106171AGCCCATGASimilar to Peroxidase 64 precursor (EC 1.11.1.7) (Atperox P64) (PRXR4) (ATP17a).
J013042D08AGCCCATGANONE
J013042E08AGCCCATGANONE
J075002G19AGCCCATGANONE
J075030K18AGCCCATGANONE
J075065P19AGCCCATGANONE
J075091B17AGCCCATGANONE
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein.
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE
Os03g0115200009-112-E09TCGGACGGCCCATGNONE
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST.
J023088J06TCGGACGGCCCATGNONE
J065075D17TCGGACGGCCCATGNONE
J065108G15TCGGACGGCCCATGNONE
J065165A16TCGGACGGCCCATGNONE
J075015O12TCGGACGGCCCATGNONE
J075022O06TCGGACGGCCCATGNONE
J075031H14TCGGACGGCCCATGNONE
J075033D10TCGGACGGCCCATGNONE
J075070A04TCGGACGGCCCATGNONE
J075127A05TCGGACGGCCCATGNONE
J100070B16TCGGACGGCCCATGNONE
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11.
J023055L16TAGGCCCATGAAAGCCCAAACNONE
J023088I16TAGGCCCATGAAAGCCCAAACNONE
J033070E21TAGGCCCATGAAAGCCCAAACNONE
J065124N22TAGGCCCATGAAAGCCCAAACNONE
J075152A19TAGGCCCATGAAAGCCCAAACNONE
J075181J21TAGGCCCATGAAAGCCCAAACNONE
J090011F23TAGGCCCATGAAAGCCCAAACNONE
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2.
J023024E17CCATGGGCCCACGGCCCATTNONE
J023122B02CCATGGGCCCACGGCCCATTNONE
J090094E15CCATGGGCCCACGGCCCATTNONE
Os03g0120300AK066854ACATGGGCCGTGProtein of unknown function DUF1084 family protein.
AK104882ACATGGGCCGTGNONE
J013075C10ACATGGGCCGTGNONE
J090012B18ACATGGGCCGTGNONE
J090087J08ACATGGGCCGTGNONE
Os03g0122200009-052-H10GCCGGGCCGCATGGGCCATNONE
AB042934GCCGGGCCGCATGGGCCATNONE
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11.
J013001H03GCCGGGCCGCATGGGCCATNONE
J023149C23GCCGGGCCGCATGGGCCATNONE
J065025J15GCCGGGCCGCATGGGCCATNONE
J065093D22GCCGGGCCGCATGGGCCATNONE
Os03g0130700015-052-H06TCATGGGCTGTNONE
AK073872TCATGGGCTGTNONE
AK100822TCATGGGCTGTNONE
AK119886TCATGGGCTGTNONE
J090060L05TCATGGGCTGTNONE
J100059N01TCATGGGCTGTNONE
Os03g0131200AB020502TGCGGCCCATGTNONE
AK062174TGCGGCCCATGTNONE
AK066378TGCGGCCCATGTSimilar to Catalase isozyme 2 (EC 1.11.1.6).
AY339372TGCGGCCCATGTNONE
J013060B21TGCGGCCCATGTNONE
J013149P20TGCGGCCCATGTNONE
J023060E16TGCGGCCCATGTNONE
J043004A19TGCGGCCCATGTNONE
J053029N09TGCGGCCCATGTNONE
J053072I10TGCGGCCCATGTNONE
J065016G02TGCGGCCCATGTNONE
J065022E22TGCGGCCCATGTNONE
J065024K17TGCGGCCCATGTNONE
J065035E10TGCGGCCCATGTNONE
J065036D13TGCGGCCCATGTNONE
J065041E06TGCGGCCCATGTNONE
J065064H14TGCGGCCCATGTNONE
J065067I06TGCGGCCCATGTNONE
J065080C01TGCGGCCCATGTNONE
J065086K23TGCGGCCCATGTNONE
J065087L12TGCGGCCCATGTNONE
J065090I05TGCGGCCCATGTNONE
J065117E23TGCGGCCCATGTNONE
J065120A10TGCGGCCCATGTNONE
J065120L22TGCGGCCCATGTNONE
J065123F02TGCGGCCCATGTNONE
J065128G02TGCGGCCCATGTNONE
J065142B04TGCGGCCCATGTNONE
J065143K12TGCGGCCCATGTNONE
J065148B18TGCGGCCCATGTNONE
J065153C16TGCGGCCCATGTNONE
J065163J11TGCGGCCCATGTNONE
J065168L24TGCGGCCCATGTNONE
J065181J11TGCGGCCCATGTNONE
J065190F19TGCGGCCCATGTNONE
J065209E24TGCGGCCCATGTNONE
J065210G04TGCGGCCCATGTNONE
J065217H17TGCGGCCCATGTNONE
J065219I20TGCGGCCCATGTNONE
J075001M13TGCGGCCCATGTNONE
J075007B08TGCGGCCCATGTNONE
J075009I01TGCGGCCCATGTNONE
J075014C11TGCGGCCCATGTNONE
J075014L02TGCGGCCCATGTNONE
J075016E07TGCGGCCCATGTNONE
J075017J02TGCGGCCCATGTNONE
J075018F07TGCGGCCCATGTNONE
J075018N07TGCGGCCCATGTNONE
J075019B06TGCGGCCCATGTNONE
J075024F21TGCGGCCCATGTNONE
J075026B18TGCGGCCCATGTNONE
J075026M12TGCGGCCCATGTNONE
J075032B13TGCGGCCCATGTNONE
J075033O09TGCGGCCCATGTNONE
J075041A09TGCGGCCCATGTNONE
J075045L13TGCGGCCCATGTNONE
J075048N11TGCGGCCCATGTNONE
J075052A14TGCGGCCCATGTNONE
J075061B17TGCGGCCCATGTNONE
J075061I05TGCGGCCCATGTNONE
J075066I11TGCGGCCCATGTNONE
J075066P09TGCGGCCCATGTNONE
J075068F03TGCGGCCCATGTNONE
J075068P22TGCGGCCCATGTNONE
J075080I15TGCGGCCCATGTNONE
J075081I07TGCGGCCCATGTNONE
J075082K01TGCGGCCCATGTNONE
J075083A18TGCGGCCCATGTNONE
J075086O11TGCGGCCCATGTNONE
J075087E02TGCGGCCCATGTNONE
J075087M19TGCGGCCCATGTNONE
J075088G23TGCGGCCCATGTNONE
J075092K18TGCGGCCCATGTNONE
J075095H15TGCGGCCCATGTNONE
J075095K12TGCGGCCCATGTNONE
J075096L06TGCGGCCCATGTNONE
J075100H23TGCGGCCCATGTNONE
J075100K01TGCGGCCCATGTNONE
J075102K21TGCGGCCCATGTNONE
J075104F24TGCGGCCCATGTNONE
J075106C17TGCGGCCCATGTNONE
J075106E06TGCGGCCCATGTNONE
J075106M19TGCGGCCCATGTNONE
J075106O12TGCGGCCCATGTNONE
J075108I09TGCGGCCCATGTNONE
J075111M06TGCGGCCCATGTNONE
J075112E12TGCGGCCCATGTNONE
J075114C04TGCGGCCCATGTNONE
J075120A06TGCGGCCCATGTNONE
J075120D14TGCGGCCCATGTNONE
J075122P15TGCGGCCCATGTNONE
J075123A11TGCGGCCCATGTNONE
J075123L12TGCGGCCCATGTNONE
J075127G14TGCGGCCCATGTNONE
J075127H09TGCGGCCCATGTNONE
J075128M04TGCGGCCCATGTNONE
J075129J04TGCGGCCCATGTNONE
J075130J01TGCGGCCCATGTNONE
J075137N02TGCGGCCCATGTNONE
J075137O14TGCGGCCCATGTNONE
J075138H22TGCGGCCCATGTNONE
J075139P16TGCGGCCCATGTNONE
J075141G08TGCGGCCCATGTNONE
J075142C17TGCGGCCCATGTNONE
J075143B09TGCGGCCCATGTNONE
J075156I11TGCGGCCCATGTNONE
J075158M03TGCGGCCCATGTNONE
J075166I21TGCGGCCCATGTNONE
J075167C08TGCGGCCCATGTNONE
J075170C12TGCGGCCCATGTNONE
J075170F08TGCGGCCCATGTNONE
J075170G04TGCGGCCCATGTNONE
J075172N16TGCGGCCCATGTNONE
J075172P13TGCGGCCCATGTNONE
J075173G24TGCGGCCCATGTNONE
J075175D01TGCGGCCCATGTNONE
J075175K01TGCGGCCCATGTNONE
J075181O04TGCGGCCCATGTNONE
J075186A04TGCGGCCCATGTNONE
J075190B08TGCGGCCCATGTNONE
J075190M24TGCGGCCCATGTNONE
J075193D18TGCGGCCCATGTNONE
J075193H03TGCGGCCCATGTNONE
J075195N18TGCGGCCCATGTNONE
J080001N20TGCGGCCCATGTNONE
J080006K17TGCGGCCCATGTNONE
J080012I16TGCGGCCCATGTNONE
J080013K20TGCGGCCCATGTNONE
J080018N01TGCGGCCCATGTNONE
J080041G15TGCGGCCCATGTNONE
J080048L15TGCGGCCCATGTNONE
J080049A21TGCGGCCCATGTNONE
J080075G12TGCGGCCCATGTNONE
J080076O09TGCGGCCCATGTNONE
J080078P10TGCGGCCCATGTNONE
J080084D10TGCGGCCCATGTNONE
J090005N07TGCGGCCCATGTNONE
Os03g0131400015-012-D11TCTGGGCCCATGANONE
AK103714TCTGGGCCCATGAPoly-A polymerase/tRNA nucleotidyltransferase family protein.
Os03g0131500AK109755TCATGGGCCCAGAVitamin K epoxide reductase domain containing protein.
Os03g0139000006-059-C06TCATGGGCTNONE
009-055-F07TCATGGGCTNONE
AK060973TCATGGGCTConserved hypothetical protein.
AK103850TCATGGGCTNONE
Os03g0143400AK073999ACATGGGCCGCASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)].
AK073999CAGGCCCATGASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)].
J023025G21ACATGGGCCGCANONE
J023025G21CAGGCCCATGANONE
J033073C08ACATGGGCCGCANONE
J033073C08CAGGCCCATGANONE
J033094C19ACATGGGCCGCANONE
J033094C19CAGGCCCATGANONE
J065017L10ACATGGGCCGCANONE
J065017L10CAGGCCCATGANONE
J065070H22ACATGGGCCGCANONE
J065070H22CAGGCCCATGANONE
J065079M09ACATGGGCCGCANONE
J065079M09CAGGCCCATGANONE
J065091N18ACATGGGCCGCANONE
J065091N18CAGGCCCATGANONE
J065109N03ACATGGGCCGCANONE
J065109N03CAGGCCCATGANONE
J065113F05ACATGGGCCGCANONE
J065113F05CAGGCCCATGANONE
J065135D23ACATGGGCCGCANONE
J065135D23CAGGCCCATGANONE
J065156L16ACATGGGCCGCANONE
J065156L16CAGGCCCATGANONE
J065207O04ACATGGGCCGCANONE
J065207O04CAGGCCCATGANONE
J065208F03ACATGGGCCGCANONE
J065208F03CAGGCCCATGANONE
J090010M15ACATGGGCCGCANONE
J090010M15CAGGCCCATGANONE
J090056J18ACATGGGCCGCANONE
J090056J18CAGGCCCATGANONE
Os03g0145700AK065716AGGGCCCATGNONE
J013039F14AGGGCCCATGNONE
J013091M20AGGGCCCATGNONE
J065059P20AGGGCCCATGNONE
J065128M07AGGGCCCATGNONE
J065136N23AGGGCCCATGNONE
J065163H21AGGGCCCATGNONE
J065176B18AGGGCCCATGNONE
J065177A17AGGGCCCATGNONE
J065201F24AGGGCCCATGNONE
Os03g0152800AK066205CATGGGCCTCProtein kinase-like domain containing protein.
AK100518CATGGGCCTCNONE
Os03g0171700J065192H12AGCCCATGGGCCAGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os03g0177000AK071368CCATGGGCCATGCN5-related N-acetyltransferase domain containing protein.
Os03g0182600006-028-E05CTTGGGCCGGCCCATGNONE
006-047-F10CTTGGGCCGGCCCATGNONE
009-123-C08CTTGGGCCGGCCCATGNONE
016-033-G05CTTGGGCCGGCCCATGNONE
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein.
AK066899CTTGGGCCGGCCCATGNONE
J013065H05CTTGGGCCGGCCCATGNONE
J023012F15CTTGGGCCGGCCCATGNONE
J023065M10CTTGGGCCGGCCCATGNONE
J033079N15CTTGGGCCGGCCCATGNONE
J033109E21CTTGGGCCGGCCCATGNONE
J033148M14CTTGGGCCGGCCCATGNONE
J043015G23CTTGGGCCGGCCCATGNONE
J043022M01CTTGGGCCGGCCCATGNONE
J053060D01CTTGGGCCGGCCCATGNONE
J053062E24CTTGGGCCGGCCCATGNONE
J053096N12CTTGGGCCGGCCCATGNONE
J053098N02CTTGGGCCGGCCCATGNONE
J090024N09CTTGGGCCGGCCCATGNONE
J090027G22CTTGGGCCGGCCCATGNONE
J090043C10CTTGGGCCGGCCCATGNONE
J090063F05CTTGGGCCGGCCCATGNONE
J090066J05CTTGGGCCGGCCCATGNONE
J090073I17CTTGGGCCGGCCCATGNONE
J090087L04CTTGGGCCGGCCCATGNONE
J100075O12CTTGGGCCGGCCCATGNONE
Os03g0195900J065063O15GAGGCCCATGANONE
Os03g0197000AK071163CCATGGGCTGGConserved hypothetical protein.
J023079A07CCATGGGCTGGNONE
Os03g0200500005-016-A06CATGGGCCTANONE
AK069251CATGGGCCTA40S ribosomal protein S3a (CYC07 protein).
AK104243CATGGGCCTANONE
AK104699CATGGGCCTANONE
D26060CATGGGCCTANONE
J013024H20CATGGGCCTANONE
J013029C14CATGGGCCTANONE
J013035O17CATGGGCCTANONE
J013066B11CATGGGCCTANONE
J013066B12CATGGGCCTANONE
J013066B13CATGGGCCTANONE
J013152M04CATGGGCCTANONE
J023001A03CATGGGCCTANONE
J023013H23CATGGGCCTANONE
J023042L07CATGGGCCTANONE
J023081L11CATGGGCCTANONE
J023088I23CATGGGCCTANONE
J023092N22CATGGGCCTANONE
J023126A20CATGGGCCTANONE
J023139A17CATGGGCCTANONE
J023150G12CATGGGCCTANONE
J033026M10CATGGGCCTANONE
J033031H24CATGGGCCTANONE
J033036C22CATGGGCCTANONE
J033037P08CATGGGCCTANONE
J033045G14CATGGGCCTANONE
J033048A13CATGGGCCTANONE
J033048B13CATGGGCCTANONE
J033048K11CATGGGCCTANONE
J033066A06CATGGGCCTANONE
J033072H01CATGGGCCTANONE
J033082K07CATGGGCCTANONE
J033091G20CATGGGCCTANONE
J033095C14CATGGGCCTANONE
J033101N24CATGGGCCTANONE
J033105L15CATGGGCCTANONE
J033107J18CATGGGCCTANONE
J033112L02CATGGGCCTANONE
J033117I17CATGGGCCTANONE
J043003K06CATGGGCCTANONE
J043016I20CATGGGCCTANONE
J043021A10CATGGGCCTANONE
J043034F14CATGGGCCTANONE
J065002O17CATGGGCCTANONE
J065014B14CATGGGCCTANONE
J065054N19CATGGGCCTANONE
J065112P18CATGGGCCTANONE
J065121B20CATGGGCCTANONE
J065170M08CATGGGCCTANONE
J065194B05CATGGGCCTANONE
J090040F01CATGGGCCTANONE
J090078O20CATGGGCCTANONE
J090078P21CATGGGCCTANONE
J090084E11CATGGGCCTANONE
J100080B11CATGGGCCTANONE
Os03g0219400AK100702ACATGGGCCGCGlycoside hydrolase, family 20 protein.
AK100702ACATGGGCCGTCGlycoside hydrolase, family 20 protein.
AK121985ACATGGGCCGCNONE
AK121985ACATGGGCCGTCNONE
J023114O06ACATGGGCCGCNONE
J023114O06ACATGGGCCGTCNONE
J100043M20ACATGGGCCGCNONE
J100043M20ACATGGGCCGTCNONE
Os03g0226300AK111731AGCCCATGASimilar to Pto kinase interactor 1.
Os03g0249900AK058379GAGGCCCATGTConserved hypothetical protein.
Os03g0253100AK119618ACAGCCCATGTPhosphomevalonate kinase Erg8 family protein.
J033052A14ACAGCCCATGTNONE
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein.
Os03g0266900013-080-C12AGCCCATGNONE
014-010-A09AGCCCATGNONE
014-013-G10AGCCCATGNONE
014-019-D06AGCCCATGNONE
014-030-F08AGCCCATGNONE
014-039-C05AGCCCATGNONE
014-053-H08AGCCCATGNONE
014-089-F06AGCCCATGNONE
014-094-A05AGCCCATGNONE
014-098-C12AGCCCATGNONE
AK119243AGCCCATGLow molecular mass heat shock protein Oshsp17.3.
AK119717AGCCCATGNONE
D12635AGCCCATGNONE
M80186AGCCCATGNONE
Os03g0273800AK059223CGCGACGCCATGGGCTTCNONE
AK067356CGCGACGCCATGGGCTTCNONE
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein.
Os03g0279400AK101851CCATGGGCCCCACCTGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain].
AK106253CCATGGGCCCCACCTGNONE
J023079P21CCATGGGCCCCACCTGNONE
J023120G14CCATGGGCCCCACCTGNONE
J090042F16CCATGGGCCCCACCTGNONE
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE
006-088-H05ACATGGGCTGATGGGCCGTGNONE
AK061166ACAGCCCAAGAAGGCCCATGTNONE
AK061166ACATGGGCTGATGGGCCGTGNONE
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein.
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein.
AK104514ACAGCCCAAGAAGGCCCATGTNONE
AK104514ACATGGGCTGATGGGCCGTGNONE
Os03g0298800009-079-B10ACATGGGCTGTNONE
AK103337ACATGGGCTGTSimilar to Spliceosomal protein.
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment).
AY338235TAGGCCCAGCCCATGANONE
J053077F07TAGGCCCAGCCCATGANONE
Os03g0300700AK071770TCATGGGCCTARetrotransposon gag protein family protein.
J023112P05TCATGGGCCTANONE
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein.
Os03g0302700006-099-F12AGCCCATGTNONE
AK112010AGCCCATGTZinc finger, RING-type domain containing protein.
AK121656AGCCCATGTNONE
J075090A19AGCCCATGTNONE
J075148M06AGCCCATGTNONE
Os03g0305400009-198-D04CCATGGGCNONE
013-012-C06CCATGGGCNONE
014-034-D01CCATGGGCNONE
AK071397CCATGGGCUniversal stress protein (Usp) family protein.
J023012O22CCATGGGCNONE
J023097A13CCATGGGCNONE
J023107P16CCATGGGCNONE
J023113C14CCATGGGCNONE
Os03g0306301J065212M16GCCCATGGConserved hypothetical protein.
Os03g0308100AB116073TAAGCCCATGAPeptidase S14, ClpP family protein.
AK060518TAAGCCCATGANONE
AK099107TAAGCCCATGANONE
AK105977TAAGCCCATGANONE
J065005O19TAAGCCCATGANONE
J065007L02TAAGCCCATGANONE
J065128G15TAAGCCCATGANONE
J065128N14TAAGCCCATGANONE
J075010E21TAAGCCCATGANONE
J075101J24TAAGCCCATGANONE
J075124O14TAAGCCCATGANONE
J075126O07TAAGCCCATGANONE
Os03g0308900AK064183GAGGCCCATGAConserved hypothetical protein.
Os03g0324800AK059868ACATGGGCCATNONE
AK071431ACATGGGCCATHypothetical protein.
Os03g0324900014-018-F11GTGGCCCATGANONE
AK068144GTGGCCCATGAZinc finger, RING-type domain containing protein.
Os03g0343700AK060603ACATGGGCCAGABrix domain containing protein.
AK102274ACATGGGCCAGANONE
J033089C06ACATGGGCCAGANONE
J090089A17ACATGGGCCAGANONE
Os03g0345100AK065579CCATGGGCCCACCRad9 family protein.
J100033H02CCATGGGCCCACCNONE
Os03g0352800009-030-G08ACATGGGCCGTANONE
AK059673ACATGGGCCGTASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3).
J023060F17ACATGGGCCGTANONE
J075050N19ACATGGGCCGTANONE
J075104J18ACATGGGCCGTANONE
J075142K05ACATGGGCCGTANONE
J100050I19ACATGGGCCGTANONE
J100057N04ACATGGGCCGTANONE
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD.
Os03g0364000J065042L07TCATGGGCCTGNONE
J065061O16TCATGGGCCTGNONE
J065075L02TCATGGGCCTGNONE
J065138N02TCATGGGCCTGNONE
J065209H20TCATGGGCCTGNONE
J075019G03TCATGGGCCTGNONE
J075086E23TCATGGGCCTGNONE
J075094M12TCATGGGCCTGNONE
J075139L07TCATGGGCCTGNONE
J075162I16TCATGGGCCTGNONE
J075199G20TCATGGGCCTGNONE
Os03g0381500AK108125TCATGGGCCTCATGGGCCTCConserved hypothetical protein.
Os03g0383100AK107106CTGGCCCATGAConserved hypothetical protein.
Os03g0386000AK072984CCAGCCCATGSimilar to WD domain protein-like.
J065009K18CCAGCCCATGNONE
J065165P09CCAGCCCATGNONE
Os03g0389700AK061085CCATGGGCCNONE
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment).
J023030J03TATTGGGCTTCCATGGGCCTCNONE
Os03g0410700J065102A22GCGGCCCATGANONE
J065102A22GCGGCCCATGGNONE
Os03g0410900J065067F10CCATGGGCCGCNONE
J065067F10TCATGGGCCGCNONE
J065073D08CCATGGGCCGCNONE
J065073D08TCATGGGCCGCNONE
J065176C06CCATGGGCCGCNONE
J065176C06TCATGGGCCGCNONE
J065189O13CCATGGGCCGCNONE
J065189O13TCATGGGCCGCNONE
J065214E05CCATGGGCCGCNONE
J065214E05TCATGGGCCGCNONE
J080007H09CCATGGGCCGCNONE
J080007H09TCATGGGCCGCNONE
J080012B19CCATGGGCCGCNONE
J080012B19TCATGGGCCGCNONE
J080020J16CCATGGGCCGCNONE
J080020J16TCATGGGCCGCNONE
J080038J22CCATGGGCCGCNONE
J080038J22TCATGGGCCGCNONE
J080045I09CCATGGGCCGCNONE
J080045I09TCATGGGCCGCNONE
J080059M16CCATGGGCCGCNONE
J080059M16TCATGGGCCGCNONE
J080060C19CCATGGGCCGCNONE
J080060C19TCATGGGCCGCNONE
J080080P22CCATGGGCCGCNONE
J080080P22TCATGGGCCGCNONE
J080083C03CCATGGGCCGCNONE
J080083C03TCATGGGCCGCNONE
J080093M17CCATGGGCCGCNONE
J080093M17TCATGGGCCGCNONE
J100029F12CCATGGGCCGCLike-Sm ribonucleoprotein, core family protein.
J100029F12TCATGGGCCGCLike-Sm ribonucleoprotein, core family protein.
Os03g0411500AK058696TAGGCCCATGANONE
AK071057TAGGCCCATGAPeptidase S14, ClpP family protein.
Os03g0441000AK108726ACATGGGCTTranscription initiation factor TFIID component TAF4 domain containing protein.
Os03g0448600AK111867CTCGGCCCATGWD40-like domain containing protein.
Os03g0566600011-071-A08ACATGGGCCATNONE
AK063379ACATGGGCCATMethyltransferase FkbM domain containing protein.
Os03g0566800AK103270CATGGGCCATSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3).
J023063L18CATGGGCCATNONE
J023136P06CATGGGCCATNONE
J033081A22CATGGGCCATNONE
J033109N12CATGGGCCATNONE
J033124H10CATGGGCCATNONE
J033141B09CATGGGCCATNONE
J090026G23CATGGGCCATNONE
J090077J20CATGGGCCATNONE
Os03g0568500AK058939GCCCATGGProtein of unknown function UPF0136, Transmembrane family protein.
J065036G14GCCCATGGNONE
J065044A09GCCCATGGNONE
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE
009-175-C06ACATGGGCCCAATGGGCCCATGANONE
009-179-H05ACATGGGCCCAATGGGCCCATGANONE
013-078-G11ACATGGGCCCAATGGGCCCATGANONE
AK062224ACATGGGCCCAATGGGCCCATGANONE
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein.
J013096L16ACATGGGCCCAATGGGCCCATGANONE
J100042G12ACATGGGCCCAATGGGCCCATGANONE
J100069F04ACATGGGCCCAATGGGCCCATGANONE
J100073H14ACATGGGCCCAATGGGCCCATGANONE
Os03g0581600J065037H09TCATGGGCCTGNONE
J065183O12TCATGGGCCTGNONE
Os03g0586800003-114-H11TCATGGGCCAGGCCCNONE
AK063765TCATGGGCCAGGCCCSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS).
AK099302TCATGGGCCAGGCCCNONE
J090004H06TCATGGGCCAGGCCCNONE
J090022N15TCATGGGCCAGGCCCNONE
J100035E05TCATGGGCCAGGCCCNONE
J100041L05TCATGGGCCAGGCCCNONE
J100041M18TCATGGGCCAGGCCCNONE
J100057P04TCATGGGCCAGGCCCNONE
J100089H06TCATGGGCCAGGCCCNONE
J100090C23TCATGGGCCAGGCCCNONE
Os03g0606200009-030-E09CCCGGCCCATGTNONE
009-076-H10CCCGGCCCATGTNONE
009-122-H12CCCGGCCCATGTNONE
009-153-F09CCCGGCCCATGTNONE
AB055076CCCGGCCCATGTMitochondrial ATP synthase 6 KD subunit.
AK072384CCCGGCCCATGTNONE
AK107928CCCGGCCCATGTNONE
J023078E13CCCGGCCCATGTNONE
J053031N01CCCGGCCCATGTNONE
J053046K19CCCGGCCCATGTNONE
J053062P07CCCGGCCCATGTNONE
J053091C23CCCGGCCCATGTNONE
J053099N19CCCGGCCCATGTNONE
J065005E06CCCGGCCCATGTNONE
J065030N03CCCGGCCCATGTNONE
J065138O21CCCGGCCCATGTNONE
J065159K03CCCGGCCCATGTNONE
J075030M08CCCGGCCCATGTNONE
J080006E23CCCGGCCCATGTNONE
J080010D10CCCGGCCCATGTNONE
J080016N17CCCGGCCCATGTNONE
J080024N09CCCGGCCCATGTNONE
J080028E23CCCGGCCCATGTNONE
J080035I11CCCGGCCCATGTNONE
J080038D15CCCGGCCCATGTNONE
J080040H08CCCGGCCCATGTNONE
J080043L04CCCGGCCCATGTNONE
J080047C06CCCGGCCCATGTNONE
J080061G04CCCGGCCCATGTNONE
J080066E10CCCGGCCCATGTNONE
J080067P03CCCGGCCCATGTNONE
J080082D07CCCGGCCCATGTNONE
J080089M13CCCGGCCCATGTNONE
J080094O09CCCGGCCCATGTNONE
J080095C24CCCGGCCCATGTNONE
J080309E21CCCGGCCCATGTNONE
J090016G15CCCGGCCCATGTNONE
J090031C20CCCGGCCCATGTNONE
J090033A15CCCGGCCCATGTNONE
J090037L07CCCGGCCCATGTNONE
J090038I10CCCGGCCCATGTNONE
J090072P19CCCGGCCCATGTNONE
J100040J02CCCGGCCCATGTNONE
J100047N05CCCGGCCCATGTNONE
J100048M10CCCGGCCCATGTNONE
J100076C02CCCGGCCCATGTNONE
J100077G23CCCGGCCCATGTNONE
J100080O08CCCGGCCCATGTNONE
J100085C06CCCGGCCCATGTNONE
J100085F16CCCGGCCCATGTNONE
Os03g0609500Os03g0609500GCGGCCCATGTSimilar to LOB domain protein 39.
Os03g0622300AK107931AGCCCATGGGCTGTConserved hypothetical protein.
J065184K14AGCCCATGGGCTGTNONE
Os03g0633800AK073044CATGGGCTGCSimilar to IAA6 (Fragment).
J065038L22CATGGGCTGCNONE
J065185C13CATGGGCTGCNONE
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor.
Os03g0646300AK069229GTGGCCCATGTSimilar to Cyclic nucleotide-gated channel A (Fragment).
Os03g0656900AK066416TTTCGGCCCATGANusB/RsmB/TIM44 domain containing protein.
J065157L23TTTCGGCCCATGANONE
J065166P22TTTCGGCCCATGANONE
Os03g0668000AK111705TAAGCCCATGGNONE
AK111783TAAGCCCATGGCyclin-like F-box domain containing protein.
J023087J12TAAGCCCATGGNONE
Os03g0669600009-081-F01TCATGGGCTNONE
AK073152TCATGGGCTNONE
AK104971TCATGGGCTHypothetical protein.
J065166I17TCATGGGCTNONE
Os03g0670700009-028-B03GCGGCCCATGTNONE
009-036-H12GCGGCCCATGTNONE
009-053-H05GCGGCCCATGTNONE
009-126-B02GCGGCCCATGTNONE
009-135-D07GCGGCCCATGTNONE
009-148-A03GCGGCCCATGTNONE
009-148-A12GCGGCCCATGTNONE
009-152-B02GCGGCCCATGTNONE
009-153-B06GCGGCCCATGTNONE
009-166-G05GCGGCCCATGTNONE
009-181-A09GCGGCCCATGTNONE
011-061-D07GCGGCCCATGTNONE
012-043-C04GCGGCCCATGTNONE
013-001-A02GCGGCCCATGTNONE
013-004-F05GCGGCCCATGTNONE
013-008-C08GCGGCCCATGTNONE
013-015-B09GCGGCCCATGTNONE
013-016-G05GCGGCCCATGTNONE
013-023-A06GCGGCCCATGTNONE
013-023-B06GCGGCCCATGTNONE
013-032-F09GCGGCCCATGTNONE
013-059-C07GCGGCCCATGTNONE
013-071-E09GCGGCCCATGTNONE
013-073-D06GCGGCCCATGTNONE
013-077-C02GCGGCCCATGTNONE
013-078-B12GCGGCCCATGTNONE
013-093-A01GCGGCCCATGTNONE
014-002-B12GCGGCCCATGTNONE
014-003-E08GCGGCCCATGTNONE
014-004-D06GCGGCCCATGTNONE
014-007-C11GCGGCCCATGTNONE
014-007-G10GCGGCCCATGTNONE
014-019-C04GCGGCCCATGTNONE
014-021-F05GCGGCCCATGTNONE
014-024-G06GCGGCCCATGTNONE
014-027-C07GCGGCCCATGTNONE
014-027-D03GCGGCCCATGTNONE
014-029-E07GCGGCCCATGTNONE
014-031-B04GCGGCCCATGTNONE
014-033-B05GCGGCCCATGTNONE
014-033-C03GCGGCCCATGTNONE
014-033-C12GCGGCCCATGTNONE
014-036-F01GCGGCCCATGTNONE
014-037-C04GCGGCCCATGTNONE
014-040-H02GCGGCCCATGTNONE
014-045-H04GCGGCCCATGTNONE
014-045-H06GCGGCCCATGTNONE
014-052-A08GCGGCCCATGTNONE
014-076-G01GCGGCCCATGTNONE
014-083-F04GCGGCCCATGTNONE
014-086-E01GCGGCCCATGTNONE
014-091-D02GCGGCCCATGTNONE
014-091-F05GCGGCCCATGTNONE
014-093-E10GCGGCCCATGTNONE
014-100-C10GCGGCCCATGTNONE
015-011-H02GCGGCCCATGTNONE
015-073-B03GCGGCCCATGTNONE
AF010579GCGGCCCATGTNONE
AK059164GCGGCCCATGTSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein.
AK070016GCGGCCCATGTNONE
AK119238GCGGCCCATGTNONE
AK119242GCGGCCCATGTNONE
J023037K17GCGGCCCATGTNONE
J033136F11GCGGCCCATGTNONE
J065008C13GCGGCCCATGTNONE
J065032K18GCGGCCCATGTNONE
J065043N10GCGGCCCATGTNONE
J065045E06GCGGCCCATGTNONE
J065046P21GCGGCCCATGTNONE
J065048J17GCGGCCCATGTNONE
J065053I23GCGGCCCATGTNONE
J065053P03GCGGCCCATGTNONE
J065054C13GCGGCCCATGTNONE
J065058I17GCGGCCCATGTNONE
J065061I12GCGGCCCATGTNONE
J065062E09GCGGCCCATGTNONE
J065063P04GCGGCCCATGTNONE
J065068J07GCGGCCCATGTNONE
J065076D02GCGGCCCATGTNONE
J065083O07GCGGCCCATGTNONE
J065090J02GCGGCCCATGTNONE
J065093N08GCGGCCCATGTNONE
J065097F02GCGGCCCATGTNONE
J065112H17GCGGCCCATGTNONE
J065121B01GCGGCCCATGTNONE
J065124F12GCGGCCCATGTNONE
J065130L03GCGGCCCATGTNONE
J065131K05GCGGCCCATGTNONE
J065132C06GCGGCCCATGTNONE
J065135J18GCGGCCCATGTNONE
J065138J22GCGGCCCATGTNONE
J065140G21GCGGCCCATGTNONE
J065161B19GCGGCCCATGTNONE
J065162F22GCGGCCCATGTNONE
J065162M09GCGGCCCATGTNONE
J065163D03GCGGCCCATGTNONE
J065163O21GCGGCCCATGTNONE
J065165H11GCGGCCCATGTNONE
J065165O16GCGGCCCATGTNONE
J065167N06GCGGCCCATGTNONE
J065168I08GCGGCCCATGTNONE
J065170A14GCGGCCCATGTNONE
J065170L03GCGGCCCATGTNONE
J065171C08GCGGCCCATGTNONE
J065173G11GCGGCCCATGTNONE
J065173M09GCGGCCCATGTNONE
J065176P07GCGGCCCATGTNONE
J065178K24GCGGCCCATGTNONE
J065185O12GCGGCCCATGTNONE
J065191E02GCGGCCCATGTNONE
J065204H10GCGGCCCATGTNONE
J075033C23GCGGCCCATGTNONE
J075041M21GCGGCCCATGTNONE
J075043F13GCGGCCCATGTNONE
J075044D02GCGGCCCATGTNONE
J075044J15GCGGCCCATGTNONE
J075048L07GCGGCCCATGTNONE
J075054G12GCGGCCCATGTNONE
J075055J10GCGGCCCATGTNONE
J075059F09GCGGCCCATGTNONE
J075066M23GCGGCCCATGTNONE
J075071O09GCGGCCCATGTNONE
J075085G23GCGGCCCATGTNONE
J075086B21GCGGCCCATGTNONE
J075087L18GCGGCCCATGTNONE
J075087L21GCGGCCCATGTNONE
J075087N14GCGGCCCATGTNONE
J075088O13GCGGCCCATGTNONE
J075089B06GCGGCCCATGTNONE
J075089E20GCGGCCCATGTNONE
J075090J01GCGGCCCATGTNONE
J075090L05GCGGCCCATGTNONE
J075091G05GCGGCCCATGTNONE
J075091N06GCGGCCCATGTNONE
J075093G08GCGGCCCATGTNONE
J075094C13GCGGCCCATGTNONE
J075095K01GCGGCCCATGTNONE
J075096C02GCGGCCCATGTNONE
J075097L16GCGGCCCATGTNONE
J075097O10GCGGCCCATGTNONE
J075098H24GCGGCCCATGTNONE
J075099H02GCGGCCCATGTNONE
J075099J11GCGGCCCATGTNONE
J075099L08GCGGCCCATGTNONE
J075109I11GCGGCCCATGTNONE
J075114F03GCGGCCCATGTNONE
J075121G07GCGGCCCATGTNONE
J075122D23GCGGCCCATGTNONE
J075132O07GCGGCCCATGTNONE
J075141L21GCGGCCCATGTNONE
J075142I08GCGGCCCATGTNONE
J075145A06GCGGCCCATGTNONE
J075147J15GCGGCCCATGTNONE
J075150B09GCGGCCCATGTNONE
J075151E07GCGGCCCATGTNONE
J075161M16GCGGCCCATGTNONE
J075190I16GCGGCCCATGTNONE
J075192L05GCGGCCCATGTNONE
J075192O03GCGGCCCATGTNONE
J075192O08GCGGCCCATGTNONE
J075193L12GCGGCCCATGTNONE
J080001M24GCGGCCCATGTNONE
J080004E20GCGGCCCATGTNONE
J080005K15GCGGCCCATGTNONE
J080005L05GCGGCCCATGTNONE
J080014P20GCGGCCCATGTNONE
J080029D12GCGGCCCATGTNONE
J080030H09GCGGCCCATGTNONE
J080039G05GCGGCCCATGTNONE
J080040E18GCGGCCCATGTNONE
J080041B02GCGGCCCATGTNONE
J080041E06GCGGCCCATGTNONE
J080041G05GCGGCCCATGTNONE
J080041G24GCGGCCCATGTNONE
J080041H07GCGGCCCATGTNONE
J080041K03GCGGCCCATGTNONE
J080047G01GCGGCCCATGTNONE
J080052E07GCGGCCCATGTNONE
J080053B15GCGGCCCATGTNONE
J080053N01GCGGCCCATGTNONE
J080054I01GCGGCCCATGTNONE
J080054N02GCGGCCCATGTNONE
J080063P03GCGGCCCATGTNONE
J080064E13GCGGCCCATGTNONE
J080064G13GCGGCCCATGTNONE
J080065F02GCGGCCCATGTNONE
J080065G03GCGGCCCATGTNONE
J080065K17GCGGCCCATGTNONE
J080067D06GCGGCCCATGTNONE
J080067H23GCGGCCCATGTNONE
J080067M15GCGGCCCATGTNONE
J080068B20GCGGCCCATGTNONE
J080068G24GCGGCCCATGTNONE
J080072K19GCGGCCCATGTNONE
J080076I24GCGGCCCATGTNONE
J080092F05GCGGCCCATGTNONE
J080092K14GCGGCCCATGTNONE
J080092N22GCGGCCCATGTNONE
J080093K02GCGGCCCATGTNONE
J080094C08GCGGCCCATGTNONE
J080094E09GCGGCCCATGTNONE
J080094E20GCGGCCCATGTNONE
J080094G08GCGGCCCATGTNONE
J080094H18GCGGCCCATGTNONE
J080094P22GCGGCCCATGTNONE
J080095J23GCGGCCCATGTNONE
J080096F14GCGGCCCATGTNONE
J080097A21GCGGCCCATGTNONE
J080097I07GCGGCCCATGTNONE
J080097J02GCGGCCCATGTNONE
J080097K01GCGGCCCATGTNONE
J080097K03GCGGCCCATGTNONE
J080305H18GCGGCCCATGTNONE
J080306G01GCGGCCCATGTNONE
J080306O08GCGGCCCATGTNONE
J080311I01GCGGCCCATGTNONE
J080315N24GCGGCCCATGTNONE
J090003K21GCGGCCCATGTNONE
J090008C20GCGGCCCATGTNONE
J090008K19GCGGCCCATGTNONE
J090008P13GCGGCCCATGTNONE
J090015H22GCGGCCCATGTNONE
J090016M01GCGGCCCATGTNONE
J090018E13GCGGCCCATGTNONE
J090018G03GCGGCCCATGTNONE
J090018L17GCGGCCCATGTNONE
J090019H11GCGGCCCATGTNONE
J090021B19GCGGCCCATGTNONE
J090021K02GCGGCCCATGTNONE
J090023H15GCGGCCCATGTNONE
J090034E03GCGGCCCATGTNONE
J090045D16GCGGCCCATGTNONE
J090045I06GCGGCCCATGTNONE
J090047L09GCGGCCCATGTNONE
J090048B05GCGGCCCATGTNONE
J090048D11GCGGCCCATGTNONE
J090048N11GCGGCCCATGTNONE
J090050F20GCGGCCCATGTNONE
J090052M20GCGGCCCATGTNONE
J090083H03GCGGCCCATGTNONE
J090084C12GCGGCCCATGTNONE
J090095B05GCGGCCCATGTNONE
J090095M18GCGGCCCATGTNONE
J100024I22GCGGCCCATGTNONE
J100024J12GCGGCCCATGTNONE
J100024J22GCGGCCCATGTNONE
J100025F07GCGGCCCATGTNONE
J100026B13GCGGCCCATGTNONE
J100027N03GCGGCCCATGTNONE
J100029F14GCGGCCCATGTNONE
J100029L20GCGGCCCATGTNONE
J100032C22GCGGCCCATGTNONE
J100032I08GCGGCCCATGTNONE
J100032O05GCGGCCCATGTNONE
J100033J24GCGGCCCATGTNONE
J100033L12GCGGCCCATGTNONE
J100034K06GCGGCCCATGTNONE
J100037D09GCGGCCCATGTNONE
J100038H02GCGGCCCATGTNONE
J100039A12GCGGCCCATGTNONE
J100039N12GCGGCCCATGTNONE
J100039O21GCGGCCCATGTNONE
J100040K05GCGGCCCATGTNONE
J100042A02GCGGCCCATGTNONE
J100042A17GCGGCCCATGTNONE
J100043C15GCGGCCCATGTNONE
J100044A17GCGGCCCATGTNONE
J100044E18GCGGCCCATGTNONE
J100044I11GCGGCCCATGTNONE
J100044J15GCGGCCCATGTNONE
J100045E23GCGGCCCATGTNONE
J100049B18GCGGCCCATGTNONE
J100050G04GCGGCCCATGTNONE
J100051D06GCGGCCCATGTNONE
J100051H20GCGGCCCATGTNONE
J100052J01GCGGCCCATGTNONE
J100052K07GCGGCCCATGTNONE
J100055I01GCGGCCCATGTNONE
J100057D02GCGGCCCATGTNONE
J100059G14GCGGCCCATGTNONE
J100059G21GCGGCCCATGTNONE
J100059H03GCGGCCCATGTNONE
J100059H15GCGGCCCATGTNONE
J100063E13GCGGCCCATGTNONE
J100063M02GCGGCCCATGTNONE
J100064B17GCGGCCCATGTNONE
J100064F11GCGGCCCATGTNONE
J100066G12GCGGCCCATGTNONE
J100066H09GCGGCCCATGTNONE
J100068B12GCGGCCCATGTNONE
J100068L16GCGGCCCATGTNONE
J100068M23GCGGCCCATGTNONE
J100069A02GCGGCCCATGTNONE
J100069D07GCGGCCCATGTNONE
J100069M13GCGGCCCATGTNONE
J100070C07GCGGCCCATGTNONE
J100070J11GCGGCCCATGTNONE
J100070L20GCGGCCCATGTNONE
J100071H10GCGGCCCATGTNONE
J100072L14GCGGCCCATGTNONE
J100072N12GCGGCCCATGTNONE
J100073A21GCGGCCCATGTNONE
J100074K17GCGGCCCATGTNONE
J100074M04GCGGCCCATGTNONE
J100075F11GCGGCCCATGTNONE
J100076E23GCGGCCCATGTNONE
J100076G03GCGGCCCATGTNONE
J100077K01GCGGCCCATGTNONE
J100077N23GCGGCCCATGTNONE
J100079H17GCGGCCCATGTNONE
J100081N01GCGGCCCATGTNONE
J100082E04GCGGCCCATGTNONE
J100082K11GCGGCCCATGTNONE
J100085H23GCGGCCCATGTNONE
J100086O18GCGGCCCATGTNONE
J100087F21GCGGCCCATGTNONE
J100088E02GCGGCCCATGTNONE
J100088F08GCGGCCCATGTNONE
J100088G24GCGGCCCATGTNONE
J100088K20GCGGCCCATGTNONE
J100089B19GCGGCCCATGTNONE
J100089K22GCGGCCCATGTNONE
J100089N22GCGGCCCATGTNONE
J100089O17GCGGCCCATGTNONE
J100090N05GCGGCCCATGTNONE
Os03g0679000AK059913TCATGGGCCTGConserved hypothetical protein.
J065094N08TCATGGGCCTGNONE
J065108H06TCATGGGCCTGNONE
Os03g0701000J075172J23CTGGCCCATGGGCCCCNONE
Os03g0712400AK106604GCCCATGGGCSimilar to Atypical receptor-like kinase MARK.
Os03g0726900AK072553CCATGGGCConserved hypothetical protein.
AK100280CCATGGGCNONE
Os03g0730500AK066477GCCCATGGNONE
AK066640GCCCATGGPeptidase S10, serine carboxypeptidase family protein.
Os03g0734700AK072060GCGGCCCATGAMitochondrial substrate carrier family protein.
AK120533GCGGCCCATGANONE
J043026E20GCGGCCCATGANONE
Os03g0736700006-022-F08ATGGCCCATGGNONE
006-042-H09ATGGCCCATGGNONE
006-053-H02ATGGCCCATGGNONE
009-127-A06ATGGCCCATGGNONE
013-089-C06ATGGCCCATGGNONE
AK060947ATGGCCCATGGGRAM domain containing protein.
AK073026ATGGCCCATGGNONE
AK104415ATGGCCCATGGNONE
AK104642ATGGCCCATGGNONE
J065027H19ATGGCCCATGGNONE
J065059K06ATGGCCCATGGNONE
J065065I02ATGGCCCATGGNONE
J065085E10ATGGCCCATGGNONE
J065140M09ATGGCCCATGGNONE
J075115M21ATGGCCCATGGNONE
Os03g0743200J065049G14TCAGCCCATGANONE
J065158O18TCAGCCCATGANONE
Os03g0746700015-015-E02CATGGGCTNONE
015-059-G01CATGGGCTNONE
015-073-C05CATGGGCTNONE
AK068199CATGGGCTConserved hypothetical protein.
J075066J09CATGGGCTNONE
J100025E14CATGGGCTNONE
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein.
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein.
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE
Os03g0754800AK101584ACATGGGCCGGAMitochondrial substrate carrier family protein.
J080305A09ACATGGGCCGGANONE
J080310E24ACATGGGCCGGANONE
J080310O12ACATGGGCCGGANONE
J080311N04ACATGGGCCGGANONE
J080313N20ACATGGGCCGGANONE
J080317H24ACATGGGCCGGANONE
Os03g0757900011-060-H04GTGGCCCATGGNONE
011-082-B10GTGGCCCATGGNONE
012-053-F12GTGGCCCATGGNONE
013-029-C07GTGGCCCATGGNONE
AK098880GTGGCCCATGGSimilar to UDP-glucose 6-dehydrogenase (EC 1.1.1.22) (UDP-Glc dehydrogenase) (UDP-GlcDH) (UDPGDH).
J023009B02GTGGCCCATGGNONE
J023085H11GTGGCCCATGGNONE
J023135M18GTGGCCCATGGNONE
J023147P04GTGGCCCATGGNONE
J033072J22GTGGCCCATGGNONE
J033128J06GTGGCCCATGGNONE
Os03g0766000AK070596CCAAGCCCATGANONE
AK104743CCAAGCCCATGANONE
AK106079CCAAGCCCATGANONE
J013063M09CCAAGCCCATGANONE
J023056A03CCAAGCCCATGANONE
J043038L07CCAAGCCCATGANONE
J053067N16CCAAGCCCATGANONE
J053073G09CCAAGCCCATGANONE
J053075I19CCAAGCCCATGANONE
Os03g0769600AK100054CCATGGGCCACResB-like family protein.
AK100054TCATGGGCCCTResB-like family protein.
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like.
J053100E14TATTGGGCCACATGGGCCTCNONE
J075111A12TATTGGGCCACATGGGCCTCNONE
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein.
Os03g0787100006-022-G04CAAGGCCCATGANONE
AK110858CAAGGCCCATGAConserved hypothetical protein.
J065197C24CAAGGCCCATGANONE
J075147E03CAAGGCCCATGANONE
J100065K06CAAGGCCCATGANONE
Os03g0791800013-037-A12GACAGGTGGGCCCATGGNONE
AB079798GACAGGTGGGCCCATGGNONE
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein).
AK120251GACAGGTGGGCCCATGGNONE
J013045G10GACAGGTGGGCCCATGGNONE
J023102B18GACAGGTGGGCCCATGGNONE
J065020J23GACAGGTGGGCCCATGGNONE
J065127I21GACAGGTGGGCCCATGGNONE
J065151E11GACAGGTGGGCCCATGGNONE
J075076B05GACAGGTGGGCCCATGGNONE
J075116C15GACAGGTGGGCCCATGGNONE
J075136A07GACAGGTGGGCCCATGGNONE
J100029G21GACAGGTGGGCCCATGGNONE
J100030K01GACAGGTGGGCCCATGGNONE
J100041J02GACAGGTGGGCCCATGGNONE
J100049C22GACAGGTGGGCCCATGGNONE
J100057G17GACAGGTGGGCCCATGGNONE
J100086L12GACAGGTGGGCCCATGGNONE
Os03g0797000AK073440ACATGGGCTTCSimilar to Indole synthase.
Os03g0807800AK064984ATGGCCCATGSimilar to 40S ribosomal protein S2 (Fragment).
J013001C14ATGGCCCATGNONE
J065015J20ATGGCCCATGNONE
J065122L11ATGGCCCATGNONE
J065217E10ATGGCCCATGNONE
J075023C02ATGGCCCATGNONE
J075102O04ATGGCCCATGNONE
J080024G24ATGGCCCATGNONE
J080033F02ATGGCCCATGNONE
J080047M13ATGGCCCATGNONE
J080048A22ATGGCCCATGNONE
J080056E06ATGGCCCATGNONE
J080064O11ATGGCCCATGNONE
Os03g0824400AK070153CACGGCCCATGGNONE
AK070153TCATGGGCTNONE
AK104298CACGGCCCATGGSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase).
AK104298TCATGGGCTSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase).
Os03g0824500AK058990TCATGGGCCCATTTConserved hypothetical protein.
AK058990TCATGGGCCGAGCCGConserved hypothetical protein.
J065057L18TCATGGGCCCATTTNONE
J065057L18TCATGGGCCGAGCCGNONE
J065083L02TCATGGGCCCATTTNONE
J065083L02TCATGGGCCGAGCCGNONE
J065086L24TCATGGGCCCATTTNONE
J065086L24TCATGGGCCGAGCCGNONE
J065121L10TCATGGGCCCATTTNONE
J065121L10TCATGGGCCGAGCCGNONE
J065168N03TCATGGGCCCATTTNONE
J065168N03TCATGGGCCGAGCCGNONE
J100035J22TCATGGGCCCATTTNONE
J100035J22TCATGGGCCGAGCCGNONE
J100050G18TCATGGGCCCATTTNONE
J100050G18TCATGGGCCGAGCCGNONE
J100055F15TCATGGGCCCATTTNONE
J100055F15TCATGGGCCGAGCCGNONE
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein.
J033119F15TAGGCCCAGCCCATGGGCNONE
J065011M19TAGGCCCAGCCCATGGGCNONE
J075019I08TAGGCCCAGCCCATGGGCNONE
J075047A01TAGGCCCAGCCCATGGGCNONE
J075096P21TAGGCCCAGCCCATGGGCNONE
J075121I05TAGGCCCAGCCCATGGGCNONE
J075121I07TAGGCCCAGCCCATGGGCNONE
J090063F13TAGGCCCAGCCCATGGGCNONE
J090068F16TAGGCCCAGCCCATGGGCNONE
J090094E14TAGGCCCAGCCCATGGGCNONE
Os03g0833500AK119356CCATGGGCTGGSimilar to 98kDa HDM allergen.
Os03g0833700011-060-A10TCATGGGCCGTTTNONE
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein.
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1).
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein.
Os03g0850100AK101126AGCCCATGGNLI interacting factor domain containing protein.
Os03g0851900AK102145ACATGGGCCGAAAFG1-like ATPase family protein.
J033086B08ACATGGGCCGAANONE
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE
006-069-B11CTGGCCCATATCGGCCCATGTNONE
006-104-B10CTGGCCCATATCGGCCCATGTNONE
AK059849CTGGCCCATATCGGCCCATGTNONE
AK102872CTGGCCCATATCGGCCCATGTNONE
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein.
J033112B07CTGGCCCATATCGGCCCATGTNONE
J053059J20CTGGCCCATATCGGCCCATGTNONE
J065155F15CTGGCCCATATCGGCCCATGTNONE
Os03g0854000009-186-C03GAGGCCCATGNONE
AK061374GAGGCCCATGProtein of unknown function UPF0131 family protein.
J065138B11GAGGCCCATGNONE
Os03g0855600006-029-G09GTGGCCCATGGNONE
006-033-E02GTGGCCCATGGNONE
006-069-G07GTGGCCCATGGNONE
006-083-A02GTGGCCCATGGNONE
006-098-H04GTGGCCCATGGNONE
009-054-C04GTGGCCCATGGNONE
AK060030GTGGCCCATGGNONE
AK061467GTGGCCCATGGConserved hypothetical protein.
AK067858GTGGCCCATGGNONE
AK106030GTGGCCCATGGNONE
J013123A10GTGGCCCATGGNONE
J065001I24GTGGCCCATGGNONE
J065015N21GTGGCCCATGGNONE
J065016H07GTGGCCCATGGNONE
J065040A05GTGGCCCATGGNONE
J065040F01GTGGCCCATGGNONE
J065066G17GTGGCCCATGGNONE
J065077I09GTGGCCCATGGNONE
J065099M22GTGGCCCATGGNONE
J065135B13GTGGCCCATGGNONE
J065144H19GTGGCCCATGGNONE
J065146I03GTGGCCCATGGNONE
J065169E02GTGGCCCATGGNONE
J065177D21GTGGCCCATGGNONE
J065189L20GTGGCCCATGGNONE
J065207H13GTGGCCCATGGNONE
J065210D24GTGGCCCATGGNONE
J065212I03GTGGCCCATGGNONE
J075007E21GTGGCCCATGGNONE
J075013H07GTGGCCCATGGNONE
J075023K06GTGGCCCATGGNONE
J075031D23GTGGCCCATGGNONE
J075038K09GTGGCCCATGGNONE
J075084C08GTGGCCCATGGNONE
J075098K20GTGGCCCATGGNONE
J090028E04GTGGCCCATGGNONE
J090031E20GTGGCCCATGGNONE
J090042F06GTGGCCCATGGNONE
J090049L05GTGGCCCATGGNONE
J090086G03GTGGCCCATGGNONE
J090096J04GTGGCCCATGGNONE
J100035O03GTGGCCCATGGNONE
J100053H24GTGGCCCATGGNONE
J100056L17GTGGCCCATGGNONE
J100058K06GTGGCCCATGGNONE
J100059G09GTGGCCCATGGNONE
J100081C15GTGGCCCATGGNONE
Os04g0127800AK105313GGACGGCCATGGGCCCCACCTGConserved hypothetical protein.
Os04g0220300AK058435GCCCATGGGCTConserved hypothetical protein.
Os04g0270100AK063713TCATGGGCTGANONE
AK107968TCATGGGCTGANONE
Os04g0283700AK063831CATGGGCTChromo domain containing protein.
Os04g0304200AB018443ACATGGGCTTTNONE
AK067128ACATGGGCTTTSimilar to Nonphototropic hypocotyl protein 1 (EC 2.7.1.37) (Phototropin).
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE
J065050F15TCATGGGCTGGGCTTCNONE
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein.
J065057I09TCATGGGCTGGGCTTCNONE
J065132E14TCATGGGCTGGGCTTCNONE
J065144L23TCATGGGCTGGGCTTCNONE
J065154N13TCATGGGCTGGGCTTCNONE
J065158P16TCATGGGCTGGGCTTCNONE
J080302F01TCATGGGCTGGGCTTCNONE
J080308G20TCATGGGCTGGGCTTCNONE
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein.
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE
Os04g0447300AK111006TCATGGGCTConserved hypothetical protein.
Os04g0457100AK108672AGCCCATGConserved hypothetical protein.
Os04g0475500Os04g0475500TCATGGGCCATConserved hypothetical protein.
Os04g0476400J033082D17CCATGGGCCGANONE
Os04g0479000AK106344TCATGGGCCGASimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein).
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein.
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE
Os04g0481800AK109152ACATGGGCTGTMembrane bound O-acyl transferase, MBOAT family protein.
AK109152TCGGCCCATGGMembrane bound O-acyl transferase, MBOAT family protein.
J065002K24ACATGGGCTGTNONE
J065002K24TCGGCCCATGGNONE
Os04g0494600AK110895AGCCCATGGGCTTCProtein of unknown function DUF642 family protein.
Os04g0502300009-116-F02TGCGGCCCATGTNONE
009-130-H06TGCGGCCCATGTNONE
AK120520TGCGGCCCATGTSimilar to 40S ribosomal protein S11.
J013124K01TGCGGCCCATGTNONE
J023102F03TGCGGCCCATGTNONE
J033094F17TGCGGCCCATGTNONE
J053054C22TGCGGCCCATGTNONE
J065024N13TGCGGCCCATGTNONE
J065083J18TGCGGCCCATGTNONE
J065132O14TGCGGCCCATGTNONE
J065156M09TGCGGCCCATGTNONE
J065176N15TGCGGCCCATGTNONE
J065208H08TGCGGCCCATGTNONE
J075054B03TGCGGCCCATGTNONE
J090053E20TGCGGCCCATGTNONE
J100075B09TGCGGCCCATGTNONE
J100089H12TGCGGCCCATGTNONE
Os04g0504600J065162K24TCTGGGCCCATGANONE
Os04g0506800006-044-G02ACATGGGCTNONE
AK070719ACATGGGCTGlycosyl transferase, family 29 protein.
AK104647ACATGGGCTNONE
AK104762ACATGGGCTNONE
J013096J11ACATGGGCTNONE
J023058L14ACATGGGCTNONE
J065057C09ACATGGGCTNONE
J065101H18ACATGGGCTNONE
J065107F03ACATGGGCTNONE
J065154O19ACATGGGCTNONE
J065179I09ACATGGGCTNONE
J065189E21ACATGGGCTNONE
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein.
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE
Os04g0525900AK065806AGCCCATGAMajor facilitator superfamily protein.
Os04g0528100009-090-G06CCATGGGCCTCNONE
009-168-C11CCATGGGCCTCNONE
AK065957CCATGGGCCTCConserved hypothetical protein.
J013039G20CCATGGGCCTCNONE
J013044D08CCATGGGCCTCNONE
J065013L14CCATGGGCCTCNONE
J065143H08CCATGGGCCTCNONE
J065146C14CCATGGGCCTCNONE
J065149K22CCATGGGCCTCNONE
J065156B18CCATGGGCCTCNONE
J065201A04CCATGGGCCTCNONE
J065209A04CCATGGGCCTCNONE
Os04g0542900AK068610TCATGGGCTTAConserved hypothetical protein.
Os04g0551300AK103502TAGGCCCATGTSimilar to Growth regulator like protein.
Os04g0551800016-049-G12CCATGGGCGAGGNONE
AK121568CCATGGGCGAGGSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha).
J013073O06CCATGGGCGAGGNONE
J013111B11CCATGGGCGAGGNONE
J013121H23CCATGGGCGAGGNONE
J023012A17CCATGGGCGAGGNONE
J023092M05CCATGGGCGAGGNONE
J033026P14CCATGGGCGAGGNONE
J033033C10CCATGGGCGAGGNONE
J033033M10CCATGGGCGAGGNONE
J033035C24CCATGGGCGAGGNONE
J033052E19CCATGGGCGAGGNONE
J033140K19CCATGGGCGAGGNONE
J065036F18CCATGGGCGAGGNONE
J065067L12CCATGGGCGAGGNONE
J065095G09CCATGGGCGAGGNONE
J065115B08CCATGGGCGAGGNONE
J065218E24CCATGGGCGAGGNONE
J090002N13CCATGGGCGAGGNONE
J090008B12CCATGGGCGAGGNONE
J090016F24CCATGGGCGAGGNONE
J090019H14CCATGGGCGAGGNONE
J090020G20CCATGGGCGAGGNONE
J090029L18CCATGGGCGAGGNONE
J090057C23CCATGGGCGAGGNONE
J090073H23CCATGGGCGAGGNONE
J090081C16CCATGGGCGAGGNONE
J090081E21CCATGGGCGAGGNONE
J090084L14CCATGGGCGAGGNONE
J090086M01CCATGGGCGAGGNONE
J090089E16CCATGGGCGAGGNONE
J100031P12CCATGGGCGAGGNONE
J100090N23CCATGGGCGAGGNONE
Os04g0569900AK059100CATGGGCTNONE
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein.
AK103182GGATGGGCCAAGCCCATGTNONE
AK119612GGATGGGCCAAGCCCATGTNONE
AK120901GGATGGGCCAAGCCCATGTNONE
Os04g0577000AK073711ACATGGGCTGAUbiquitin fusion degradation protein UFD1 family protein.
AK119957ACATGGGCTGANONE
J013127H04ACATGGGCTGANONE
J033035G06ACATGGGCTGANONE
J033061G23ACATGGGCTGANONE
J033127L07ACATGGGCTGANONE
J065015F17ACATGGGCTGANONE
J065062G08ACATGGGCTGANONE
J065132M07ACATGGGCTGANONE
J065155C12ACATGGGCTGANONE
J075055I08ACATGGGCTGANONE
J075140D07ACATGGGCTGANONE
J090055B21ACATGGGCTGANONE
J100031D23ACATGGGCTGANONE
Os04g0581100AK100853TCATGGGCTIsopenicillin N synthase family protein.
J023123J08TCATGGGCTNONE
Os04g0585100012-055-B08GGACGGCCCATGANONE
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein.
Os04g0595000AK106907TCATGGGCTTGPeptidase A1, pepsin family protein.
AK106907TCCGGCCCATGAPeptidase A1, pepsin family protein.
Os04g0599000AK111508AGCCCATGEGF-like, type 3 domain containing protein.
Os04g0610500006-115-C07ATATGGGCTGCAGCCCATGTNONE
AK066289ATATGGGCTGCAGCCCATGTPeptidase M24A, methionine aminopeptidase, subfamily 1 protein.
AK104817ATATGGGCTGCAGCCCATGTNONE
J013096N09ATATGGGCTGCAGCCCATGTNONE
J023054I11ATATGGGCTGCAGCCCATGTNONE
J023121P20ATATGGGCTGCAGCCCATGTNONE
J053039O20ATATGGGCTGCAGCCCATGTNONE
J053071L20ATATGGGCTGCAGCCCATGTNONE
J053088H23ATATGGGCTGCAGCCCATGTNONE
J053096J03ATATGGGCTGCAGCCCATGTNONE
Os04g0617050J065197A20TGTGGGGCCCATGNONE
J090067K01TGTGGGGCCCATGAuxin responsive SAUR protein family protein.
Os04g0635700009-079-G03AAGGCCCATGTNONE
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein.
AK098916AAGGCCCATGTNONE
J013002J07AAGGCCCATGTNONE
J013109L20AAGGCCCATGTNONE
J023055C07AAGGCCCATGTNONE
J065036K04AAGGCCCATGTNONE
J065164G12AAGGCCCATGTNONE
Os04g0636900011-028-G03CCATGGGCCTTNONE
012-040-G03CCATGGGCCTTNONE
AK058405CCATGGGCCTTNONE
AK065789CCATGGGCCTTNONE
AK101408CCATGGGCCTTNONE
AK119286CCATGGGCCTTNONE
J013042J24CCATGGGCCTTNONE
J033037I12CCATGGGCCTTNONE
J043031B12CCATGGGCCTTNONE
J065152N10CCATGGGCCTTNONE
J090060K17CCATGGGCCTTNONE
J090083K14CCATGGGCCTTNONE
J100046O13CCATGGGCCTTNONE
J100066G22CCATGGGCCTTNONE
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein.
AK104273ACATGGGCCGGTNONE
Os04g0656800011-008-B09AGCCCATGGNONE
Os04g0660600009-113-A11ACATGGGCCCACTTGNONE
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein.
J023030J05ACATGGGCCCACTTGNONE
J065068M07ACATGGGCCCACTTGNONE
J065120G22ACATGGGCCCACTTGNONE
J065168J18ACATGGGCCCACTTGNONE
J065211M10ACATGGGCCCACTTGNONE
J075175E21ACATGGGCCCACTTGNONE
J090021C06ACATGGGCCCACTTGNONE
J090032P15ACATGGGCCCACTTGNONE
J090082E05ACATGGGCCCACTTGNONE
J100090O11ACATGGGCCCACTTGNONE
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein.
AK103942ACAGCCCAACACGGCCCATGGNONE
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE
Os04g0667000AK069874CCATGGGCGGCCCACATafazzin family protein.
J100055P09CCATGGGCGGCCCACANONE
J100057O12CCATGGGCGGCCCACANONE
J100067H07CCATGGGCGGCCCACANONE
J100070D06CCATGGGCGGCCCACANONE
J100071J16CCATGGGCGGCCCACANONE
J100072C15CCATGGGCGGCCCACANONE
Os04g0674100J080097J12TCATGGGCCGCAThioredoxin-like fold domain containing protein.
Os04g0674200AK101965TGCGGCCCATGANONE
AK103795TGCGGCCCATGACoenzyme Q biosynthesis Coq4 family protein.
J033076F14TGCGGCCCATGANONE
J065020P20TGCGGCCCATGANONE
J065057I21TGCGGCCCATGANONE
J065059P11TGCGGCCCATGANONE
J065083A22TGCGGCCCATGANONE
J065093K10TGCGGCCCATGANONE
J065097D03TGCGGCCCATGANONE
J065103P05TGCGGCCCATGANONE
J065113K09TGCGGCCCATGANONE
J065118F23TGCGGCCCATGANONE
J065119M06TGCGGCCCATGANONE
J065146K17TGCGGCCCATGANONE
J065161N12TGCGGCCCATGANONE
J065169L02TGCGGCCCATGANONE
J065189H12TGCGGCCCATGANONE
J065192E24TGCGGCCCATGANONE
J065193K17TGCGGCCCATGANONE
J065197O21TGCGGCCCATGANONE
J065214D09TGCGGCCCATGANONE
J065217B11TGCGGCCCATGANONE
J075132K07TGCGGCCCATGANONE
J100059D14TGCGGCCCATGANONE
Os04g0674350J065104O14TCTCGGCCCATGGNONE
J065118J19TCTCGGCCCATGGNONE
J065167I12TCTCGGCCCATGGHypothetical protein.
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor.
Os04g0681500AK105582CATGGGCTEF-Hand type domain containing protein.
Os04g0687300AK060617ACATGGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein.
J065072M04ACATGGGCCAGANONE
Os05g0103100AK103317GGGGCCCATGTTranslocon-associated beta family protein.
J033125H15GGGGCCCATGTNONE
J065021L01GGGGCCCATGTNONE
J065029M01GGGGCCCATGTNONE
J065089F17GGGGCCCATGTNONE
J065112N04GGGGCCCATGTNONE
J065163L03GGGGCCCATGTNONE
J065175B04GGGGCCCATGTNONE
J065192E02GGGGCCCATGTNONE
J075046C20GGGGCCCATGTNONE
J075192A01GGGGCCCATGTNONE
J100018H13GGGGCCCATGTNONE
J100067K20GGGGCCCATGTNONE
J100080N03GGGGCCCATGTNONE
Os05g0112800AK108350CAGGCCCATGProtein of unknown function DUF26 domain containing protein.
J065163K08CAGGCCCATGNONE
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE
AB037970TTGGCCCATGGGCCGCCACGTCNONE
AK061836TTGGCCCATGGGCCGCCACGTCNONE
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase.
AY074786TTGGCCCATGGGCCGCCACGTCNONE
J013022K21TTGGCCCATGGGCCGCCACGTCNONE
J013154A03TTGGCCCATGGGCCGCCACGTCNONE
J023074C02TTGGCCCATGGGCCGCCACGTCNONE
J023091I19TTGGCCCATGGGCCGCCACGTCNONE
J023135M05TTGGCCCATGGGCCGCCACGTCNONE
J065027L11TTGGCCCATGGGCCGCCACGTCNONE
J065065A08TTGGCCCATGGGCCGCCACGTCNONE
J065120A08TTGGCCCATGGGCCGCCACGTCNONE
J065174A05TTGGCCCATGGGCCGCCACGTCNONE
J065184O22TTGGCCCATGGGCCGCCACGTCNONE
J065191D07TTGGCCCATGGGCCGCCACGTCNONE
J065209D04TTGGCCCATGGGCCGCCACGTCNONE
J075014F11TTGGCCCATGGGCCGCCACGTCNONE
J075036D03TTGGCCCATGGGCCGCCACGTCNONE
J075157D23TTGGCCCATGGGCCGCCACGTCNONE
J080007F15TTGGCCCATGGGCCGCCACGTCNONE
J080008N12TTGGCCCATGGGCCGCCACGTCNONE
J080010F22TTGGCCCATGGGCCGCCACGTCNONE
J080011C19TTGGCCCATGGGCCGCCACGTCNONE
J080011F12TTGGCCCATGGGCCGCCACGTCNONE
J080012E11TTGGCCCATGGGCCGCCACGTCNONE
J080015B12TTGGCCCATGGGCCGCCACGTCNONE
J080015O16TTGGCCCATGGGCCGCCACGTCNONE
J080016G24TTGGCCCATGGGCCGCCACGTCNONE
J080016K13TTGGCCCATGGGCCGCCACGTCNONE
J080018A02TTGGCCCATGGGCCGCCACGTCNONE
J080018H03TTGGCCCATGGGCCGCCACGTCNONE
J080022M01TTGGCCCATGGGCCGCCACGTCNONE
J080023D20TTGGCCCATGGGCCGCCACGTCNONE
J080023I01TTGGCCCATGGGCCGCCACGTCNONE
J080023J05TTGGCCCATGGGCCGCCACGTCNONE
J080024A09TTGGCCCATGGGCCGCCACGTCNONE
J080024I09TTGGCCCATGGGCCGCCACGTCNONE
J080025A10TTGGCCCATGGGCCGCCACGTCNONE
J080025G04TTGGCCCATGGGCCGCCACGTCNONE
J080027D21TTGGCCCATGGGCCGCCACGTCNONE
J080029M05TTGGCCCATGGGCCGCCACGTCNONE
J080030J01TTGGCCCATGGGCCGCCACGTCNONE
J080034D10TTGGCCCATGGGCCGCCACGTCNONE
J080036F18TTGGCCCATGGGCCGCCACGTCNONE
J080038N11TTGGCCCATGGGCCGCCACGTCNONE
J080039B07TTGGCCCATGGGCCGCCACGTCNONE
J080039E01TTGGCCCATGGGCCGCCACGTCNONE
J080039K11TTGGCCCATGGGCCGCCACGTCNONE
J080040B09TTGGCCCATGGGCCGCCACGTCNONE
J080040G11TTGGCCCATGGGCCGCCACGTCNONE
J080041H08TTGGCCCATGGGCCGCCACGTCNONE
J080041H19TTGGCCCATGGGCCGCCACGTCNONE
J080041O20TTGGCCCATGGGCCGCCACGTCNONE
J080042C15TTGGCCCATGGGCCGCCACGTCNONE
J080043C16TTGGCCCATGGGCCGCCACGTCNONE
J080043F18TTGGCCCATGGGCCGCCACGTCNONE
J080044B17TTGGCCCATGGGCCGCCACGTCNONE
J080044N10TTGGCCCATGGGCCGCCACGTCNONE
J080044O07TTGGCCCATGGGCCGCCACGTCNONE
J080045H15TTGGCCCATGGGCCGCCACGTCNONE
J080045I03TTGGCCCATGGGCCGCCACGTCNONE
J080046A05TTGGCCCATGGGCCGCCACGTCNONE
J080048I06TTGGCCCATGGGCCGCCACGTCNONE
J080049L04TTGGCCCATGGGCCGCCACGTCNONE
J080049M09TTGGCCCATGGGCCGCCACGTCNONE
J080050G11TTGGCCCATGGGCCGCCACGTCNONE
J080051G20TTGGCCCATGGGCCGCCACGTCNONE
J080053C09TTGGCCCATGGGCCGCCACGTCNONE
J080053I05TTGGCCCATGGGCCGCCACGTCNONE
J080053P18TTGGCCCATGGGCCGCCACGTCNONE
J080054K10TTGGCCCATGGGCCGCCACGTCNONE
J080054P14TTGGCCCATGGGCCGCCACGTCNONE
J080057L05TTGGCCCATGGGCCGCCACGTCNONE
J080062K11TTGGCCCATGGGCCGCCACGTCNONE
J080063C19TTGGCCCATGGGCCGCCACGTCNONE
J080065B03TTGGCCCATGGGCCGCCACGTCNONE
J080066E15TTGGCCCATGGGCCGCCACGTCNONE
J080066H05TTGGCCCATGGGCCGCCACGTCNONE
J080066I05TTGGCCCATGGGCCGCCACGTCNONE
J080068O11TTGGCCCATGGGCCGCCACGTCNONE
J080070L22TTGGCCCATGGGCCGCCACGTCNONE
J080071I12TTGGCCCATGGGCCGCCACGTCNONE
J080071N20TTGGCCCATGGGCCGCCACGTCNONE
J080072D10TTGGCCCATGGGCCGCCACGTCNONE
J080072I10TTGGCCCATGGGCCGCCACGTCNONE
J080074G03TTGGCCCATGGGCCGCCACGTCNONE
J080076E23TTGGCCCATGGGCCGCCACGTCNONE
J080076N03TTGGCCCATGGGCCGCCACGTCNONE
J080077N23TTGGCCCATGGGCCGCCACGTCNONE
J080084B13TTGGCCCATGGGCCGCCACGTCNONE
J080084F07TTGGCCCATGGGCCGCCACGTCNONE
J080085J15TTGGCCCATGGGCCGCCACGTCNONE
J080085P20TTGGCCCATGGGCCGCCACGTCNONE
J080090F21TTGGCCCATGGGCCGCCACGTCNONE
J080093H16TTGGCCCATGGGCCGCCACGTCNONE
J080093J01TTGGCCCATGGGCCGCCACGTCNONE
J080093L04TTGGCCCATGGGCCGCCACGTCNONE
J080097E24TTGGCCCATGGGCCGCCACGTCNONE
J090012G04TTGGCCCATGGGCCGCCACGTCNONE
J090054K05TTGGCCCATGGGCCGCCACGTCNONE
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein.
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein.
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE
Os05g0120300AK109108CATGGGCCGAHypothetical protein.
Os05g0123400AK069521CCAGCCCATGAConserved hypothetical protein.
J023022O05CCAGCCCATGANONE
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein.
AK102515ATCTCGGCCCATGAAAAGCCCNONE
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein.
Os05g0138000AK120814GCCCATGGConserved hypothetical protein.
J023014M12GCCCATGGNONE
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein.
Os05g0155100006-075-B02TCAGCCCATGNONE
AK061929TCAGCCCATGNONE
AK102810TCAGCCCATGNONE
AK120877TCAGCCCATGSimilar to 60S ribosomal protein L18.
J013023E03TCAGCCCATGNONE
J013038C16TCAGCCCATGNONE
J013120M14TCAGCCCATGNONE
J013153B04TCAGCCCATGNONE
J013159B07TCAGCCCATGNONE
J023012A02TCAGCCCATGNONE
J023027F08TCAGCCCATGNONE
J023027I12TCAGCCCATGNONE
J023120F05TCAGCCCATGNONE
J023138O03TCAGCCCATGNONE
J023142H13TCAGCCCATGNONE
J023143P06TCAGCCCATGNONE
J033023P09TCAGCCCATGNONE
J033035O14TCAGCCCATGNONE
J033042N19TCAGCCCATGNONE
J033043B12TCAGCCCATGNONE
J033065D10TCAGCCCATGNONE
J033081A12TCAGCCCATGNONE
J033084N05TCAGCCCATGNONE
J033085M03TCAGCCCATGNONE
J033112D15TCAGCCCATGNONE
J033114O07TCAGCCCATGNONE
J033119D15TCAGCCCATGNONE
J033140E06TCAGCCCATGNONE
J033141K23TCAGCCCATGNONE
J043040I22TCAGCCCATGNONE
J053050B21TCAGCCCATGNONE
J053065I18TCAGCCCATGNONE
J053074O16TCAGCCCATGNONE
J065072K13TCAGCCCATGNONE
J065211I09TCAGCCCATGNONE
J090004K04TCAGCCCATGNONE
J090016L06TCAGCCCATGNONE
J090040F22TCAGCCCATGNONE
J090063F22TCAGCCCATGNONE
J090081J09TCAGCCCATGNONE
J100032A10TCAGCCCATGNONE
J100037G20TCAGCCCATGNONE
J100056O10TCAGCCCATGNONE
J100071D10TCAGCCCATGNONE
J100075K13TCAGCCCATGNONE
J100079F16TCAGCCCATGNONE
J100080O16TCAGCCCATGNONE
J100086N05TCAGCCCATGNONE
Os05g0155300AK069217CCATGGGCCGACCACGGCCSimilar to HIRA interacting protein 5.
Os05g0162500AK067124CCATGGGCProtein kinase-like domain containing protein.
J013072E19CCATGGGCNONE
J013098L04CCATGGGCNONE
J023002B02CCATGGGCNONE
J023012O16CCATGGGCNONE
J033107H18CCATGGGCNONE
J065154H15CCATGGGCNONE
J065157K22CCATGGGCNONE
Os05g0176600009-151-A09ACATGGGCCGCNONE
AK071760ACATGGGCCGCConserved hypothetical protein.
J023110C14ACATGGGCCGCNONE
J065116G18ACATGGGCCGCNONE
J065131I04ACATGGGCCGCNONE
J065163H12ACATGGGCCGCNONE
J075088L08ACATGGGCCGCNONE
J075165F17ACATGGGCCGCNONE
Os05g0180700J100062K04CCATGGGCCTAConserved hypothetical protein.
Os05g0182700003-102-E07CCCGGCCCATGANONE
011-019-D04CCCGGCCCATGANONE
013-068-D09CCCGGCCCATGANONE
014-032-G03CCCGGCCCATGANONE
AK065911CCCGGCCCATGAProtein of unknown function DUF1664 family protein.
AK104343CCCGGCCCATGANONE
J013045E01CCCGGCCCATGANONE
J013156L15CCCGGCCCATGANONE
J023029P17CCCGGCCCATGANONE
J023134I24CCCGGCCCATGANONE
J033099A10CCCGGCCCATGANONE
J033115L16CCCGGCCCATGANONE
J090007M24CCCGGCCCATGANONE
J090019F02CCCGGCCCATGANONE
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE
006-103-D10TCATGGGCTTGGNONE
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-047-D06TCATGGGCTTGGNONE
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-073-G05TCATGGGCTTGGNONE
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-084-G09TCATGGGCTTGGNONE
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-097-G04TCATGGGCTTGGNONE
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-111-D11TCATGGGCTTGGNONE
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-115-G01TCATGGGCTTGGNONE
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-131-B04TCATGGGCTTGGNONE
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-144-F05TCATGGGCTTGGNONE
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE
009-154-D08TCATGGGCTTGGNONE
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE
014-004-H02TCATGGGCTTGGNONE
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE
AK058675TCATGGGCTTGGNONE
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment).
AK060420TCATGGGCTTGGSimilar to 30S ribosomal protein S31, chloroplast (Fragment).
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE
AK061231TCATGGGCTTGGNONE
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE
J065155C08TCATGGGCTTGGNONE
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE
J075143K12TCATGGGCTTGGNONE
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE
AK058865TCATGGGCCTCNONE
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein.
AK067940TCATGGGCCTCConserved hypothetical protein.
J065043K19TATTGGGCCAGCCCATGNONE
J065043K19TCATGGGCCTCNONE
J065095O10TATTGGGCCAGCCCATGNONE
J065095O10TCATGGGCCTCNONE
J065095O12TATTGGGCCAGCCCATGNONE
J065095O12TCATGGGCCTCNONE
J080002K02TATTGGGCCAGCCCATGNONE
J080002K02TCATGGGCCTCNONE
J080012L17TATTGGGCCAGCCCATGNONE
J080012L17TCATGGGCCTCNONE
J080013J02TATTGGGCCAGCCCATGNONE
J080013J02TCATGGGCCTCNONE
J080013O11TATTGGGCCAGCCCATGNONE
J080013O11TCATGGGCCTCNONE
J080020A17TATTGGGCCAGCCCATGNONE
J080020A17TCATGGGCCTCNONE
J080028E18TATTGGGCCAGCCCATGNONE
J080028E18TCATGGGCCTCNONE
J080036P11TATTGGGCCAGCCCATGNONE
J080036P11TCATGGGCCTCNONE
J080042E10TATTGGGCCAGCCCATGNONE
J080042E10TCATGGGCCTCNONE
J080042L10TATTGGGCCAGCCCATGNONE
J080042L10TCATGGGCCTCNONE
J080047B11TATTGGGCCAGCCCATGNONE
J080047B11TCATGGGCCTCNONE
J080048N05TATTGGGCCAGCCCATGNONE
J080048N05TCATGGGCCTCNONE
J080057E20TATTGGGCCAGCCCATGNONE
J080057E20TCATGGGCCTCNONE
J080057K13TATTGGGCCAGCCCATGNONE
J080057K13TCATGGGCCTCNONE
J080058L03TATTGGGCCAGCCCATGNONE
J080058L03TCATGGGCCTCNONE
J080063H07TATTGGGCCAGCCCATGNONE
J080063H07TCATGGGCCTCNONE
J080066L23TATTGGGCCAGCCCATGNONE
J080066L23TCATGGGCCTCNONE
J080069G22TATTGGGCCAGCCCATGNONE
J080069G22TCATGGGCCTCNONE
J080072E12TATTGGGCCAGCCCATGNONE
J080072E12TCATGGGCCTCNONE
J080076D06TATTGGGCCAGCCCATGNONE
J080076D06TCATGGGCCTCNONE
J080077A22TATTGGGCCAGCCCATGNONE
J080077A22TCATGGGCCTCNONE
J080081A01TATTGGGCCAGCCCATGNONE
J080081A01TCATGGGCCTCNONE
J080090M13TATTGGGCCAGCCCATGNONE
J080090M13TCATGGGCCTCNONE
J080093G07TATTGGGCCAGCCCATGNONE
J080093G07TCATGGGCCTCNONE
J080094O20TATTGGGCCAGCCCATGNONE
J080094O20TCATGGGCCTCNONE
J080097F13TATTGGGCCAGCCCATGNONE
J080097F13TCATGGGCCTCNONE
Os05g0195700006-027-E05TCATGGGCTNONE
AK061427TCATGGGCTNONE
AK065594TCATGGGCTSimilar to Transcription factor MYBS2.
J013029P13TCATGGGCTNONE
J065048A06TCATGGGCTNONE
J065080L03TCATGGGCTNONE
J065103D11TCATGGGCTNONE
J065106I19TCATGGGCTNONE
J065198K16TCATGGGCTNONE
Os05g0252000AK068865CATGGGCTOligopeptide transporter OPT superfamily protein.
Os05g0267100009-106-H07ACATGGGCTTGNONE
009-177-H02ACATGGGCTTGNONE
AK062790ACATGGGCTTGNONE
AK065811ACATGGGCTTGNONE
J013026N17ACATGGGCTTGNONE
J013039F07ACATGGGCTTGNONE
Os05g0327000014-005-A12CATGGGCCGANONE
AK064059CATGGGCCGACyclin-like domain containing protein.
AK101588CATGGGCCGANONE
J033051A05CATGGGCCGANONE
J065106E02CATGGGCCGANONE
J065183D01CATGGGCCGANONE
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein.
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE
Os05g0349000AK070681CCATGGGCGTTGGGCCTCConserved hypothetical protein.
AK120753CCATGGGCGTTGGGCCTCNONE
J023006K02CCATGGGCGTTGGGCCTCNONE
J023063E02CCATGGGCGTTGGGCCTCNONE
J043003J19CCATGGGCGTTGGGCCTCNONE
Os05g0383100AK121835AGCCCATGGGCTClathrin adaptor complex, medium chain family protein.
AK121835CCATGGGCCGGCCCATTClathrin adaptor complex, medium chain family protein.
Os05g0400600AK072045GAGGCCCATGACobalt transport protein family protein.
Os05g0413000AK058277AAAAGCCCATGMitochodrial transcription termination factor-related family protein.
Os05g0417200AK071955CTCGGCCCATGAThioredoxin-like fold domain containing protein.
Os05g0430200J090095K16ACAGCCCATGNONE
Os05g0445500009-021-C05GCAGCCCATGNONE
009-021-C05TCATGGGCTNONE
009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE
009-129-D11GCAGCCCATGNONE
009-129-D11TCATGGGCTNONE
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE
009-147-E04GCAGCCCATGNONE
009-147-E04TCATGGGCTNONE
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE
009-169-C11GCAGCCCATGNONE
009-169-C11TCATGGGCTNONE
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE
AK121459GCAGCCCATGSimilar to 60S acidic ribosomal protein P2B.
AK121459TCATGGGCTSimilar to 60S acidic ribosomal protein P2B.
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B.
D21114GCAGCCCATGNONE
D21114TCATGGGCTNONE
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE
J023001K23GCAGCCCATGNONE
J023001K23TCATGGGCTNONE
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE
J023107J19GCAGCCCATGNONE
J023107J19TCATGGGCTNONE
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE
J023143J09GCAGCCCATGNONE
J023143J09TCATGGGCTNONE
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE
J065049D04GCAGCCCATGNONE
J065049D04TCATGGGCTNONE
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE
J065092I06GCAGCCCATGNONE
J065092I06TCATGGGCTNONE
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE
J065188H04GCAGCCCATGNONE
J065188H04TCATGGGCTNONE
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1).
Os05g0456300006-096-G05GTGGCCCATGGNONE
006-108-F09GTGGCCCATGGNONE
AK061843GTGGCCCATGGNONE
AK068616GTGGCCCATGGSimilar to Aldose reductase.
J013156J23GTGGCCCATGGNONE
J023080O21GTGGCCCATGGNONE
J043031L21GTGGCCCATGGNONE
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein.
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE
Os05g0470800011-027-A06GAGGCCCATGGGCCATNONE
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein.
J023007A20GAGGCCCATGGGCCATNONE
J023028F19GAGGCCCATGGGCCATNONE
J023081E20GAGGCCCATGGGCCATNONE
J023089D13GAGGCCCATGGGCCATNONE
J023115D18GAGGCCCATGGGCCATNONE
J033087E22GAGGCCCATGGGCCATNONE
J033143O14GAGGCCCATGGGCCATNONE
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein.
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE
Os05g0488900AK071883CTGGCCCATGSimilar to Cytochrome b5 reductase.
AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase.
AK073699CTGGCCCATGNONE
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
AK105459CTGGCCCATGNONE
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
J080009C06CTGGCCCATGNONE
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
J080021N09CTGGCCCATGNONE
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
J080041K24CTGGCCCATGNONE
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
J080058H15CTGGCCCATGNONE
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
J080064P06CTGGCCCATGNONE
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
J080077B16CTGGCCCATGNONE
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE
Os05g0503000AK068335TCATGGGCCGAAASimilar to Secretory carrier membrane protein.
AK104049TCATGGGCCGAAANONE
J013149D04TCATGGGCCGAAANONE
J075085A06TCATGGGCCGAAANONE
Os05g0509200AK061566TAAGCCCATGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein.
AK099007TAAGCCCATGANONE
AK100226TAAGCCCATGANONE
J013114B12TAAGCCCATGANONE
J023048D09TAAGCCCATGANONE
Os05g0526800016-054-G05ACATGGGCCATNONE
AK066551ACATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein.
J013074J04ACATGGGCCATNONE
J013095M02ACATGGGCCATNONE
J065195O21ACATGGGCCATNONE
Os05g0528200009-146-C01ATGGCCCATGNONE
009-146-C01TTGGCCCATGANONE
AK062985ATGGCCCATGSimilar to 50S ribosomal protein L20.
AK062985TTGGCCCATGASimilar to 50S ribosomal protein L20.
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein.
AK101531CCATGGGCCTTNONE
J033030F10CCATGGGCCTTNONE
Os05g0541900009-130-F05ACATGGGCCAANONE
009-200-E07ACATGGGCCAANONE
013-057-G09ACATGGGCCAANONE
Os05g0558900AK101679ACATGGGCTGGSimilar to Frsb-prov protein.
AK101679TCATGGGCCATSimilar to Frsb-prov protein.
J013028M08ACATGGGCTGGNONE
J013028M08TCATGGGCCATNONE
J013074E16ACATGGGCTGGNONE
J013074E16TCATGGGCCATNONE
J013096L01ACATGGGCTGGNONE
J013096L01TCATGGGCCATNONE
J023085M19ACATGGGCTGGNONE
J023085M19TCATGGGCCATNONE
J033058I10ACATGGGCTGGNONE
J033058I10TCATGGGCCATNONE
J033091D18ACATGGGCTGGNONE
J033091D18TCATGGGCCATNONE
J033111H13ACATGGGCTGGNONE
J033111H13TCATGGGCCATNONE
J033114C18ACATGGGCTGGNONE
J033114C18TCATGGGCCATNONE
Os05g0559900AK067197ACATGGGCCGTCtRNA-binding arm domain containing protein.
J013074C15ACATGGGCCGTCNONE
J013098O16ACATGGGCCGTCNONE
J033030M01ACATGGGCCGTCNONE
J090058H12ACATGGGCCGTCNONE
J090075M06ACATGGGCCGTCNONE
Os05g0563500AK121924TCATGGGCTConserved hypothetical protein.
J033106F17TCATGGGCTNONE
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein.
Os05g0568600009-024-B09TCATGGGCCCACGCNONE
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein.
J080049H14TCATGGGCCCACGCNONE
J080062M08TCATGGGCCCACGCNONE
J080064I07TCATGGGCCCACGCNONE
J080068A12TCATGGGCCCACGCNONE
J080086J10TCATGGGCCCACGCNONE
Os05g0571400009-019-B04AGCCCATGCGGCCCAAAANONE
009-043-H02AGCCCATGCGGCCCAAAANONE
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein.
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein.
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein.
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE
Os05g0580500AK102000TTGGCCCATGANONE
AY371049TTGGCCCATGARad21/Rec8 like protein, N-terminal domain containing protein.
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein.
AK107350CCATGGGCCTTNONE
Os05g0595300011-076-H02GCGTGGGCCCATGGNONE
012-009-E07GCGTGGGCCCATGGNONE
012-096-B01GCGTGGGCCCATGGNONE
AK059614GCGTGGGCCCATGGNONE
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein.
J033040P21GCGTGGGCCCATGGNONE
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein.
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein.
Os06g0106000006-086-D02TCATGGGCTTANONE
AK059897TCATGGGCTTASeptum site-determining protein MinD family protein.
AK105653TCATGGGCTTANONE
J065059N03TCATGGGCTTANONE
J065138F18TCATGGGCTTANONE
J065158D02TCATGGGCTTANONE
Os06g0113600016-067-E03ATTTGGGCCTCCCATGGGCCATNONE
AK062095ATTTGGGCCTCCCATGGGCCATNONE
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein.
AK122025ATTTGGGCCTCCCATGGGCCATNONE
J013022O19ATTTGGGCCTCCCATGGGCCATNONE
J023045P05ATTTGGGCCTCCCATGGGCCATNONE
J033031K01ATTTGGGCCTCCCATGGGCCATNONE
J033034I09ATTTGGGCCTCCCATGGGCCATNONE
J033041O04ATTTGGGCCTCCCATGGGCCATNONE
J033071K03ATTTGGGCCTCCCATGGGCCATNONE
J033075K16ATTTGGGCCTCCCATGGGCCATNONE
J033097M01ATTTGGGCCTCCCATGGGCCATNONE
J033099M22ATTTGGGCCTCCCATGGGCCATNONE
J033108N15ATTTGGGCCTCCCATGGGCCATNONE
J033121D18ATTTGGGCCTCCCATGGGCCATNONE
J033125O06ATTTGGGCCTCCCATGGGCCATNONE
J033139M16ATTTGGGCCTCCCATGGGCCATNONE
J033145P18ATTTGGGCCTCCCATGGGCCATNONE
J033149D05ATTTGGGCCTCCCATGGGCCATNONE
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein.
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein.
Os06g0124900009-128-B12GGGGCCCATGNONE
009-186-H09GGGGCCCATGNONE
AK062901GGGGCCCATGConserved hypothetical protein.
J013056D13GGGGCCCATGNONE
J013056D17GGGGCCCATGNONE
J013066A13GGGGCCCATGNONE
J013066C03GGGGCCCATGNONE
J013066F01GGGGCCCATGNONE
J023078D03GGGGCCCATGNONE
J033113N02GGGGCCCATGNONE
J065019F09GGGGCCCATGNONE
J065048C21GGGGCCCATGNONE
J065077L13GGGGCCCATGNONE
J065082J09GGGGCCCATGNONE
J065113H16GGGGCCCATGNONE
J065147A20GGGGCCCATGNONE
J065180A13GGGGCCCATGNONE
J065198M18GGGGCCCATGNONE
J065207K19GGGGCCCATGNONE
J075109H13GGGGCCCATGNONE
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein.
Os06g0130000AK064427CCATGGGCNONE
AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE
AK070084CCATGGGCNONE
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE
AK119321CCATGGGCSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment).
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment).
Os06g0134000AK102796CCATGGGCCAGNONE
Os06g0135340J065061D17TAAGCCCATGANONE
J065159A10TAAGCCCATGAConserved hypothetical protein.
Os06g0137500AK072896ACAGCCCATGGGCBrix domain containing protein.
AK121945ACAGCCCATGGGCNONE
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE
009-009-A08CCATGGGCCAAGGCCCATTNONE
015-020-D09CCATGGGCCAAGGCCCATTNONE
015-087-H06CCATGGGCCAAGGCCCATTNONE
016-078-A03CCATGGGCCAAGGCCCATTNONE
AK067884CCATGGGCCAAGGCCCATTNONE
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein.
AK106116CCATGGGCCAAGGCCCATTNONE
AK106220CCATGGGCCAAGGCCCATTNONE
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein.
J075021O05GCCCAGTAAGGCCCATGGGCCTTGNONE
J075023M12GCCCAGTAAGGCCCATGGGCCTTGNONE
J075041C14GCCCAGTAAGGCCCATGGGCCTTGNONE
J075041C19GCCCAGTAAGGCCCATGGGCCTTGNONE
J075064F08GCCCAGTAAGGCCCATGGGCCTTGNONE
J075116I03GCCCAGTAAGGCCCATGGGCCTTGNONE
J075123I02GCCCAGTAAGGCCCATGGGCCTTGNONE
Os06g0157800AK121504TCATGGGCCGGASimilar to CG7224 (Fragment).
J033022L20TCATGGGCCGGANONE
J075033D09TCATGGGCCGGANONE
Os06g0178900011-082-D06GAGGCCCATGTNONE
AK066933GAGGCCCATGTVacuolar H+-pyrophosphatase (EC 3.6.1.1) (Ovp2).
D45384GAGGCCCATGTNONE
J013025O19GAGGCCCATGTNONE
J013067J23GAGGCCCATGTNONE
J013119G12GAGGCCCATGTNONE
J013119I17GAGGCCCATGTNONE
J013132B18GAGGCCCATGTNONE
J023108D14GAGGCCCATGTNONE
J033034C17GAGGCCCATGTNONE
J033088E10GAGGCCCATGTNONE
J065013C19GAGGCCCATGTNONE
J065047E17GAGGCCCATGTNONE
J090004E24GAGGCCCATGTNONE
J090008I11GAGGCCCATGTNONE
J090011F12GAGGCCCATGTNONE
J090014D19GAGGCCCATGTNONE
J090030B11GAGGCCCATGTNONE
J090038J24GAGGCCCATGTNONE
J090045I05GAGGCCCATGTNONE
J090046C11GAGGCCCATGTNONE
J090046F19GAGGCCCATGTNONE
J090048G03GAGGCCCATGTNONE
J090050A14GAGGCCCATGTNONE
J090051B15GAGGCCCATGTNONE
J090052E04GAGGCCCATGTNONE
J090052L10GAGGCCCATGTNONE
J090071O13GAGGCCCATGTNONE
J090075F03GAGGCCCATGTNONE
J090080I15GAGGCCCATGTNONE
J090088B04GAGGCCCATGTNONE
J100029D12GAGGCCCATGTNONE
J100032D14GAGGCCCATGTNONE
J100037J15GAGGCCCATGTNONE
J100045D01GAGGCCCATGTNONE
J100045K04GAGGCCCATGTNONE
J100053M07GAGGCCCATGTNONE
J100056F04GAGGCCCATGTNONE
J100056L21GAGGCCCATGTNONE
J100073N11GAGGCCCATGTNONE
J100076O13GAGGCCCATGTNONE
Os06g0181500AK068950GCCCATGGNONE
AK100878GCCCATGGSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3).
J023001P16GCCCATGGNONE
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3.
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE
Os06g0219900AK058704CCATGGGCSimilar to Phi-1 protein.
Os06g0220800AK059876AATTGGGCCCATGANONE
AK059876CCATGGGCCCCNONE
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein.
AY739306CCATGGGCCCCThioredoxin domain 2 containing protein.
J075093C09AATTGGGCCCATGANONE
J075093C09CCATGGGCCCCNONE
J100026J18AATTGGGCCCATGANONE
J100026J18CCATGGGCCCCNONE
J100041O16AATTGGGCCCATGANONE
J100041O16CCATGGGCCCCNONE
J100089K16AATTGGGCCCATGANONE
J100089K16CCATGGGCCCCNONE
Os06g0257200J053059P05AATTGGGCCCATGGNONE
J075006K03AATTGGGCCCATGGNONE
J075067F07AATTGGGCCCATGGNONE
J075068F14AATTGGGCCCATGGNONE
J075068H14AATTGGGCCCATGGNONE
J075098N06AATTGGGCCCATGGNONE
J075099F08AATTGGGCCCATGGNONE
J075154G24AATTGGGCCCATGGNONE
J075195H09AATTGGGCCCATGGNONE
Os06g0287700AK067966AGGGCCCATGTSimilar to NBS-LRR disease resistance protein homologue (Fragment).
J013122I17AGGGCCCATGTNONE
J065038I02AGGGCCCATGTNONE
J065214J02AGGGCCCATGTNONE
Os06g0304500AK119441CATGGGCCTACRS1/YhbY domain containing protein.
J075143M24CATGGGCCTANONE
J075194D03CATGGGCCTANONE
Os06g0306600006-117-A07ACATGGGCCGTANONE
AK070763ACATGGGCCGTAEsterase/lipase/thioesterase domain containing protein.
AK099262ACATGGGCCGTANONE
AK106075ACATGGGCCGTANONE
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE
011-089-C01TTGGCCCATGNONE
015-030-D11ACATGGGCCGGGCCCAGGNONE
015-030-D11TTGGCCCATGNONE
015-044-H10ACATGGGCCGGGCCCAGGNONE
015-044-H10TTGGCCCATGNONE
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein.
AK105260TTGGCCCATGConserved hypothetical protein.
AK119646ACATGGGCCGGGCCCAGGNONE
AK119646TTGGCCCATGNONE
Os06g0320000009-030-C04CATGGGCCGAANONE
009-135-F08CATGGGCCGAANONE
J075103B05CATGGGCCGAAProtein of unknown function DUF953, thioredoxin-like family protein.
J075187J24CATGGGCCGAANONE
Os06g0325500011-037-D06AAAGCCCATGTNONE
011-093-G07AAAGCCCATGTNONE
AK063974AAAGCCCATGTProtein of unknown function DUF89 family protein.
AK099286AAAGCCCATGTNONE
J065124G18AAAGCCCATGTNONE
J065160K08AAAGCCCATGTNONE
J065207O08AAAGCCCATGTNONE
J075011D18AAAGCCCATGTNONE
J075012D02AAAGCCCATGTNONE
J075090F13AAAGCCCATGTNONE
J075164A04AAAGCCCATGTNONE
J075198I19AAAGCCCATGTNONE
Os06g0338900016-067-B02TCTGGACCATGGGCCGANONE
AK100837TCTGGACCATGGGCCGANucleotidyl transferase domain containing protein.
J013058L01TCTGGACCATGGGCCGANONE
J013135N01TCTGGACCATGGGCCGANONE
J023123E15TCTGGACCATGGGCCGANONE
J033051J01TCTGGACCATGGGCCGANONE
J090002O21TCTGGACCATGGGCCGANONE
J090013F06TCTGGACCATGGGCCGANONE
J090056F16TCTGGACCATGGGCCGANONE
J090081G13TCTGGACCATGGGCCGANONE
J090090P21TCTGGACCATGGGCCGANONE
J100039F05TCTGGACCATGGGCCGANONE
J100059J03TCTGGACCATGGGCCGANONE
Os06g0545800J023014L13CATGGGCCACNONE
J023019D15CATGGGCCACNONE
J023031O10CATGGGCCACNONE
J023041K05CATGGGCCACNONE
J023044D07CATGGGCCACNONE
J023054D06CATGGGCCACNONE
J023088I12CATGGGCCACNONE
J023093O06CATGGGCCACNONE
J023105M09CATGGGCCACNONE
J023109C07CATGGGCCACSimilar to Exopolygalacturonase precursor (EC 3.2.1.67) (ExoPG) (Pectinase) (Galacturan 1,4-alpha-galacturonidase).
J023135P03CATGGGCCACNONE
Os06g0556600AK072511GCCCATGGSimilar to Pollen allergen Phl p 11.
J023077F02GCCCATGGNONE
J023132A12GCCCATGGNONE
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE
J013169I02TTGGCCCATGAGGCCCATANONE
J023024B09TTGGCCCATGAGGCCCATANONE
J023132L02TTGGCCCATGAGGCCCATANONE
J033026C23TTGGCCCATGAGGCCCATANONE
J033094E23TTGGCCCATGAGGCCCATANONE
J033101D23TTGGCCCATGAGGCCCATANONE
J033125B15TTGGCCCATGAGGCCCATANONE
J033144I11TTGGCCCATGAGGCCCATANONE
J033145E13TTGGCCCATGAGGCCCATANONE
J033145I11TTGGCCCATGAGGCCCATANONE
J065022M23TTGGCCCATGAGGCCCATANONE
J065043I24TTGGCCCATGAGGCCCATANONE
J065053G06TTGGCCCATGAGGCCCATANONE
J065088K03TTGGCCCATGAGGCCCATANONE
J065121L09TTGGCCCATGAGGCCCATANONE
J065143M08TTGGCCCATGAGGCCCATANONE
J065146H02TTGGCCCATGAGGCCCATANONE
J065206M03TTGGCCCATGAGGCCCATANONE
J075004L13TTGGCCCATGAGGCCCATANONE
J075005L17TTGGCCCATGAGGCCCATANONE
J075007G18TTGGCCCATGAGGCCCATANONE
J075027E20TTGGCCCATGAGGCCCATANONE
J075029A19TTGGCCCATGAGGCCCATANONE
J075041C15TTGGCCCATGAGGCCCATANONE
J075046M05TTGGCCCATGAGGCCCATANONE
J075066P21TTGGCCCATGAGGCCCATANONE
J075069E07TTGGCCCATGAGGCCCATANONE
J075107P21TTGGCCCATGAGGCCCATANONE
J075123F03TTGGCCCATGAGGCCCATANONE
J075124E07TTGGCCCATGAGGCCCATANONE
J075140J22TTGGCCCATGAGGCCCATANONE
J075160N03TTGGCCCATGAGGCCCATANONE
Os06g0593100AK060274AACGGCCCATGASimilar to UDP-galactose/UDP-glucose transporter.
AK071175AACGGCCCATGANONE
Os06g0608700005-001-A05GCCCATGGNONE
005-019-A07GCCCATGGNONE
006-036-A06GCCCATGGNONE
AK058288GCCCATGGNONE
AK058302GCCCATGGNONE
AK064989GCCCATGGSimilar to Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13).
AK104381GCCCATGGNONE
J013001D08GCCCATGGNONE
J013029A21GCCCATGGNONE
J013045K06GCCCATGGNONE
J013060N12GCCCATGGNONE
J013066O09GCCCATGGNONE
J013073A17GCCCATGGNONE
J013095B08GCCCATGGNONE
J013105B15GCCCATGGNONE
J013124E11GCCCATGGNONE
J013153O07GCCCATGGNONE
J013157H19GCCCATGGNONE
J023007I10GCCCATGGNONE
J023028A13GCCCATGGNONE
J023052D09GCCCATGGNONE
J023067K10GCCCATGGNONE
J023087A18GCCCATGGNONE
J023087E22GCCCATGGNONE
J065023D07GCCCATGGNONE
J065084F21GCCCATGGNONE
J065116B13GCCCATGGNONE
J065188G18GCCCATGGNONE
J080001F22GCCCATGGNONE
J080001H04GCCCATGGNONE
J080013D13GCCCATGGNONE
J080025B20GCCCATGGNONE
J080025N19GCCCATGGNONE
J080029C09GCCCATGGNONE
J080029D04GCCCATGGNONE
J080038P07GCCCATGGNONE
J080053I03GCCCATGGNONE
J080054B02GCCCATGGNONE
J080057B13GCCCATGGNONE
J080059O09GCCCATGGNONE
J080064K18GCCCATGGNONE
J080072F14GCCCATGGNONE
J080074H03GCCCATGGNONE
J080074O15GCCCATGGNONE
J080079A02GCCCATGGNONE
J080079I05GCCCATGGNONE
J080080D11GCCCATGGNONE
Os06g0609700AK067228AGCCCATGGEsterase/lipase/thioesterase domain containing protein.
Os06g0638700AK108500ACAGCCCATGTPutative cyclase family protein.
Os06g0647900AK073750TCATGGGCTConserved hypothetical protein.
J033029K17TCATGGGCTNONE
J033070L21TCATGGGCTNONE
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein.
Os06g0667600AK058606ACATGGGCCTANONE
AK071621ACATGGGCCTASimilar to Glycine decarboxylase complex H-protein.
J023101D03ACATGGGCCTANONE
J033095E17ACATGGGCCTANONE
J065020B16ACATGGGCCTANONE
Os06g0673500J100018J12CCATGGGCCTTNONE
J100018J12GACGGCCCATGTNONE
J100072F13CCATGGGCCTTSimilar to Ubiquitin.
J100072F13GACGGCCCATGTSimilar to Ubiquitin.
Os06g0682800011-092-E01ACATGGGCCTGANONE
011-092-E01GCCGGGCCACATGGGCCGGANONE
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein.
AK064816GCCGGGCCACATGGGCCGGAZinc finger, CCCH-type domain containing protein.
J013000E13ACATGGGCCTGANONE
J013000E13GCCGGGCCACATGGGCCGGANONE
J013035J22ACATGGGCCTGANONE
J013035J22GCCGGGCCACATGGGCCGGANONE
J013045M06ACATGGGCCTGANONE
J013045M06GCCGGGCCACATGGGCCGGANONE
J013120A07ACATGGGCCTGANONE
J013120A07GCCGGGCCACATGGGCCGGANONE
J033144H15ACATGGGCCTGANONE
J033144H15GCCGGGCCACATGGGCCGGANONE
J033145H15ACATGGGCCTGANONE
J033145H15GCCGGGCCACATGGGCCGGANONE
J033145N16ACATGGGCCTGANONE
J033145N16GCCGGGCCACATGGGCCGGANONE
J090019J02ACATGGGCCTGANONE
J090019J02GCCGGGCCACATGGGCCGGANONE
Os06g0694400AK065599GCCCATGGNONE
AK120261GCCCATGGConserved hypothetical protein.
J075019F13GCCCATGGNONE
J075121H11GCCCATGGNONE
J075188O15GCCCATGGNONE
J075194O13GCCCATGGNONE
J100017M20GCCCATGGNONE
J100026G05GCCCATGGNONE
J100032G09GCCCATGGNONE
J100044M02GCCCATGGNONE
J100064A07GCCCATGGNONE
J100066K20GCCCATGGNONE
J100082M20GCCCATGGNONE
J100084A14GCCCATGGNONE
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein.
AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein.
AK103983CCATGGGCTGTATGGGCTTTTNONE
AK103983GCCGGCCCATCTCGGCCCATGANONE
Os06g0698300AK071637CCATGGGCProtein phosphatase 2C family protein.
J023098M15CCATGGGCNONE
J023101G03CCATGGGCNONE
J023139A04CCATGGGCNONE
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A).
J023091M16ACATGGGCTTTTCATGGGCCAGANONE
J033023L12ACATGGGCTTTTCATGGGCCAGANONE
J065043I07ACATGGGCTTTTCATGGGCCAGANONE
J065049E09ACATGGGCTTTTCATGGGCCAGANONE
J065054I05ACATGGGCTTTTCATGGGCCAGANONE
J065072H13ACATGGGCTTTTCATGGGCCAGANONE
J065073L10ACATGGGCTTTTCATGGGCCAGANONE
J065079P09ACATGGGCTTTTCATGGGCCAGANONE
J065112I06ACATGGGCTTTTCATGGGCCAGANONE
J065167C03ACATGGGCTTTTCATGGGCCAGANONE
J065167I03ACATGGGCTTTTCATGGGCCAGANONE
J065176P13ACATGGGCTTTTCATGGGCCAGANONE
J065205M07ACATGGGCTTTTCATGGGCCAGANONE
J075018E13ACATGGGCTTTTCATGGGCCAGANONE
J075021E04ACATGGGCTTTTCATGGGCCAGANONE
J075038F13ACATGGGCTTTTCATGGGCCAGANONE
J075051E05ACATGGGCTTTTCATGGGCCAGANONE
J075067C10ACATGGGCTTTTCATGGGCCAGANONE
J075079A12ACATGGGCTTTTCATGGGCCAGANONE
J075084A13ACATGGGCTTTTCATGGGCCAGANONE
J075103E20ACATGGGCTTTTCATGGGCCAGANONE
J075116E09ACATGGGCTTTTCATGGGCCAGANONE
J075118F15ACATGGGCTTTTCATGGGCCAGANONE
J075121I15ACATGGGCTTTTCATGGGCCAGANONE
J075129B01ACATGGGCTTTTCATGGGCCAGANONE
J075138A22ACATGGGCTTTTCATGGGCCAGANONE
J075159B22ACATGGGCTTTTCATGGGCCAGANONE
J075165I11ACATGGGCTTTTCATGGGCCAGANONE
J075186E09ACATGGGCTTTTCATGGGCCAGANONE
J075190J09ACATGGGCTTTTCATGGGCCAGANONE
J075191I07ACATGGGCTTTTCATGGGCCAGANONE
J080301C05ACATGGGCTTTTCATGGGCCAGANONE
J080302L02ACATGGGCTTTTCATGGGCCAGANONE
J100035C19ACATGGGCTTTTCATGGGCCAGANONE
J100059P06ACATGGGCTTTTCATGGGCCAGANONE
Os06g0702800009-039-E05ACATGGGCCAGNONE
009-039-E05ACATGGGCCAGGCCCAAATNONE
009-039-E05GGACGGCCCATGANONE
AK073948ACATGGGCCAGHypothetical protein.
AK073948ACATGGGCCAGGCCCAAATHypothetical protein.
AK073948GGACGGCCCATGAHypothetical protein.
J023108K23ACATGGGCCAGNONE
J023108K23ACATGGGCCAGGCCCAAATNONE
J023108K23GGACGGCCCATGANONE
J033072H04ACATGGGCCAGNONE
J033072H04ACATGGGCCAGGCCCAAATNONE
J033072H04GGACGGCCCATGANONE
J065008G05ACATGGGCCAGNONE
J065008G05ACATGGGCCAGGCCCAAATNONE
J065008G05GGACGGCCCATGANONE
J065128J12ACATGGGCCAGNONE
J065128J12ACATGGGCCAGGCCCAAATNONE
J065128J12GGACGGCCCATGANONE
J065131A01ACATGGGCCAGNONE
J065131A01ACATGGGCCAGGCCCAAATNONE
J065131A01GGACGGCCCATGANONE
J065173B12ACATGGGCCAGNONE
J065173B12ACATGGGCCAGGCCCAAATNONE
J065173B12GGACGGCCCATGANONE
Os06g0709100006-057-D06TTCGGCCCATGANONE
011-040-A08TTCGGCCCATGANONE
016-044-A01TTCGGCCCATGANONE
AK059732TTCGGCCCATGANONE
AK070881TTCGGCCCATGACyclin-like F-box domain containing protein.
AK103683TTCGGCCCATGANONE
J065026P10TTCGGCCCATGANONE
J090017L13TTCGGCCCATGANONE
Os06g0709300AK108588ACATGGGCCCACCCFAR1 domain containing protein.
Os06g0711600016-047-G09CATGGGCCTTGNONE
016-047-G09TCATGGGCTGGNONE
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein.
AK064384TCATGGGCTGGmRNA splicing factor SYF2 family protein.
AK102831CATGGGCCTTGNONE
AK102831TCATGGGCTGGNONE
J013072P18CATGGGCCTTGNONE
J013072P18TCATGGGCTGGNONE
J023049G01CATGGGCCTTGNONE
J023049G01TCATGGGCTGGNONE
J023088I01CATGGGCCTTGNONE
J023088I01TCATGGGCTGGNONE
J033023I22CATGGGCCTTGNONE
J033023I22TCATGGGCTGGNONE
J033106I12CATGGGCCTTGNONE
J033106I12TCATGGGCTGGNONE
J033109G07CATGGGCCTTGNONE
J033109G07TCATGGGCTGGNONE
J065030F22CATGGGCCTTGNONE
J065030F22TCATGGGCTGGNONE
J065132H19CATGGGCCTTGNONE
J065132H19TCATGGGCTGGNONE
J080301D07CATGGGCCTTGNONE
J080301D07TCATGGGCTGGNONE
J080305C09CATGGGCCTTGNONE
J080305C09TCATGGGCTGGNONE
J080312C03CATGGGCCTTGNONE
J080312C03TCATGGGCTGGNONE
J080313I15CATGGGCCTTGNONE
J080313I15TCATGGGCTGGNONE
J080315B09CATGGGCCTTGNONE
J080315B09TCATGGGCTGGNONE
J090056N21CATGGGCCTTGNONE
J090056N21TCATGGGCTGGNONE
J100027B07CATGGGCCTTGNONE
J100027B07TCATGGGCTGGNONE
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-).
Os06g0712900AK106648ACATGGGCCGGADihydrouridine synthase, DuS family protein.
AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein.
J075055M19ACATGGGCCGGANONE
J075055M19TCATGGGCCGAAAAGGCCCATATNONE
J075122I03ACATGGGCCGGANONE
J075122I03TCATGGGCCGAAAAGGCCCATATNONE
Os06g0726400AF136268GACACGTGAAGGCCCATGGNONE
AK065121GACACGTGAAGGCCCATGGNONE
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I).
AK120332GACACGTGAAGGCCCATGGNONE
AY302112GACACGTGAAGGCCCATGGNONE
D10752GACACGTGAAGGCCCATGGNONE
D11082GACACGTGAAGGCCCATGGNONE
J013031L12GACACGTGAAGGCCCATGGNONE
J013042M09GACACGTGAAGGCCCATGGNONE
J013058E01GACACGTGAAGGCCCATGGNONE
J013058O09GACACGTGAAGGCCCATGGNONE
J013063J17GACACGTGAAGGCCCATGGNONE
J013066I24GACACGTGAAGGCCCATGGNONE
J013069F17GACACGTGAAGGCCCATGGNONE
J013106E01GACACGTGAAGGCCCATGGNONE
J013118D19GACACGTGAAGGCCCATGGNONE
J013162M11GACACGTGAAGGCCCATGGNONE
J023028B19GACACGTGAAGGCCCATGGNONE
J023031A13GACACGTGAAGGCCCATGGNONE
J023047H18GACACGTGAAGGCCCATGGNONE
J023059N10GACACGTGAAGGCCCATGGNONE
J023104N22GACACGTGAAGGCCCATGGNONE
J033025J03GACACGTGAAGGCCCATGGNONE
J033045B05GACACGTGAAGGCCCATGGNONE
J033067M08GACACGTGAAGGCCCATGGNONE
J033113D04GACACGTGAAGGCCCATGGNONE
J043003D11GACACGTGAAGGCCCATGGNONE
J043009O20GACACGTGAAGGCCCATGGNONE
J043016P06GACACGTGAAGGCCCATGGNONE
J043017C21GACACGTGAAGGCCCATGGNONE
J043017J20GACACGTGAAGGCCCATGGNONE
J043021P15GACACGTGAAGGCCCATGGNONE
J043026I22GACACGTGAAGGCCCATGGNONE
J043032L15GACACGTGAAGGCCCATGGNONE
J043034G14GACACGTGAAGGCCCATGGNONE
J043039L16GACACGTGAAGGCCCATGGNONE
J075003D02GACACGTGAAGGCCCATGGNONE
J075003O22GACACGTGAAGGCCCATGGNONE
J075005I24GACACGTGAAGGCCCATGGNONE
J075006N09GACACGTGAAGGCCCATGGNONE
J075011A22GACACGTGAAGGCCCATGGNONE
J075012K24GACACGTGAAGGCCCATGGNONE
J075017D01GACACGTGAAGGCCCATGGNONE
J075017I23GACACGTGAAGGCCCATGGNONE
J075023D17GACACGTGAAGGCCCATGGNONE
J075024B03GACACGTGAAGGCCCATGGNONE
J075025H05GACACGTGAAGGCCCATGGNONE
J075031D19GACACGTGAAGGCCCATGGNONE
J075034B02GACACGTGAAGGCCCATGGNONE
J075035C02GACACGTGAAGGCCCATGGNONE
J075037J12GACACGTGAAGGCCCATGGNONE
J075038M11GACACGTGAAGGCCCATGGNONE
J075039J17GACACGTGAAGGCCCATGGNONE
J075042P10GACACGTGAAGGCCCATGGNONE
J075046J20GACACGTGAAGGCCCATGGNONE
J075047F21GACACGTGAAGGCCCATGGNONE
J075053E05GACACGTGAAGGCCCATGGNONE
J075054D11GACACGTGAAGGCCCATGGNONE
J075054K06GACACGTGAAGGCCCATGGNONE
J075059E15GACACGTGAAGGCCCATGGNONE
J075061O04GACACGTGAAGGCCCATGGNONE
J075062I20GACACGTGAAGGCCCATGGNONE
J075066I12GACACGTGAAGGCCCATGGNONE
J075066L06GACACGTGAAGGCCCATGGNONE
J075071H12GACACGTGAAGGCCCATGGNONE
J075071N19GACACGTGAAGGCCCATGGNONE
J075074K01GACACGTGAAGGCCCATGGNONE
J075077H22GACACGTGAAGGCCCATGGNONE
J075083H18GACACGTGAAGGCCCATGGNONE
J075085F04GACACGTGAAGGCCCATGGNONE
J075085K09GACACGTGAAGGCCCATGGNONE
J075086C06GACACGTGAAGGCCCATGGNONE
J075086E06GACACGTGAAGGCCCATGGNONE
J075087A15GACACGTGAAGGCCCATGGNONE
J075090N02GACACGTGAAGGCCCATGGNONE
J075090N22GACACGTGAAGGCCCATGGNONE
J075091C04GACACGTGAAGGCCCATGGNONE
J075091G16GACACGTGAAGGCCCATGGNONE
J075097E04GACACGTGAAGGCCCATGGNONE
J075099E04GACACGTGAAGGCCCATGGNONE
J075102P22GACACGTGAAGGCCCATGGNONE
J075109B08GACACGTGAAGGCCCATGGNONE
J075109J02GACACGTGAAGGCCCATGGNONE
J075115I12GACACGTGAAGGCCCATGGNONE
J075117E17GACACGTGAAGGCCCATGGNONE
J075123C07GACACGTGAAGGCCCATGGNONE
J075124N05GACACGTGAAGGCCCATGGNONE
J075125E12GACACGTGAAGGCCCATGGNONE
J075126B11GACACGTGAAGGCCCATGGNONE
J075129E14GACACGTGAAGGCCCATGGNONE
J075130N15GACACGTGAAGGCCCATGGNONE
J075131I07GACACGTGAAGGCCCATGGNONE
J075141B13GACACGTGAAGGCCCATGGNONE
J075141B20GACACGTGAAGGCCCATGGNONE
J075144D23GACACGTGAAGGCCCATGGNONE
J075144N01GACACGTGAAGGCCCATGGNONE
J075147M24GACACGTGAAGGCCCATGGNONE
J075148L16GACACGTGAAGGCCCATGGNONE
J075151A22GACACGTGAAGGCCCATGGNONE
J075151D03GACACGTGAAGGCCCATGGNONE
J075151D04GACACGTGAAGGCCCATGGNONE
J075153E23GACACGTGAAGGCCCATGGNONE
J075156D02GACACGTGAAGGCCCATGGNONE
J075156P05GACACGTGAAGGCCCATGGNONE
J075162E23GACACGTGAAGGCCCATGGNONE
J075165J22GACACGTGAAGGCCCATGGNONE
J075166A06GACACGTGAAGGCCCATGGNONE
J075168H13GACACGTGAAGGCCCATGGNONE
J075170D04GACACGTGAAGGCCCATGGNONE
J075171C19GACACGTGAAGGCCCATGGNONE
J075173B12GACACGTGAAGGCCCATGGNONE
J075173M23GACACGTGAAGGCCCATGGNONE
J075174C03GACACGTGAAGGCCCATGGNONE
J075185O11GACACGTGAAGGCCCATGGNONE
J075186G21GACACGTGAAGGCCCATGGNONE
J075187D06GACACGTGAAGGCCCATGGNONE
J075195G21GACACGTGAAGGCCCATGGNONE
J090003D18GACACGTGAAGGCCCATGGNONE
J090005I12GACACGTGAAGGCCCATGGNONE
J090007D15GACACGTGAAGGCCCATGGNONE
J090007G20GACACGTGAAGGCCCATGGNONE
J090014G13GACACGTGAAGGCCCATGGNONE
J090014L08GACACGTGAAGGCCCATGGNONE
J090016J03GACACGTGAAGGCCCATGGNONE
J090023P22GACACGTGAAGGCCCATGGNONE
J090025C19GACACGTGAAGGCCCATGGNONE
J090028F11GACACGTGAAGGCCCATGGNONE
J090028G01GACACGTGAAGGCCCATGGNONE
J090028H02GACACGTGAAGGCCCATGGNONE
J090037I11GACACGTGAAGGCCCATGGNONE
J090040F21GACACGTGAAGGCCCATGGNONE
J090040N24GACACGTGAAGGCCCATGGNONE
J090044M12GACACGTGAAGGCCCATGGNONE
J090045B13GACACGTGAAGGCCCATGGNONE
J090045M22GACACGTGAAGGCCCATGGNONE
J090048C10GACACGTGAAGGCCCATGGNONE
J090051J02GACACGTGAAGGCCCATGGNONE
J090058O15GACACGTGAAGGCCCATGGNONE
J090062F11GACACGTGAAGGCCCATGGNONE
J090067D23GACACGTGAAGGCCCATGGNONE
J090069G15GACACGTGAAGGCCCATGGNONE
J090072I06GACACGTGAAGGCCCATGGNONE
J090073H18GACACGTGAAGGCCCATGGNONE
J090073L01GACACGTGAAGGCCCATGGNONE
J090075O21GACACGTGAAGGCCCATGGNONE
J090084K24GACACGTGAAGGCCCATGGNONE
J090087P11GACACGTGAAGGCCCATGGNONE
J090092B17GACACGTGAAGGCCCATGGNONE
J100042H08GACACGTGAAGGCCCATGGNONE
Os06g0730900AK062118GTGGCCCATGGNONE
AK064963GTGGCCCATGGPeptidase A22B, minor histocompatibility antigen H13 family protein.
AK065172GTGGCCCATGGNONE
AK099361GTGGCCCATGGNONE
Os07g0110100009-059-D11AGCCCATGANONE
AK071499AGCCCATGAConserved hypothetical protein.
J065064P17AGCCCATGANONE
J065111B09AGCCCATGANONE
J075099A14AGCCCATGANONE
J075139C23AGCCCATGANONE
Os07g0114550J090025L18AACGGCCCATGTHypothetical protein.
Os07g0118900009-112-E11GCCCATGGNONE
AK063837GCCCATGGNONE
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE
AK103212GCAGCCCATGGGCCTTNONE
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein.
J033122M09GCAGCCCATGGGCCTTNONE
J090007P13GCAGCCCATGGGCCTTNONE
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE
Os07g0137900011-017-E12GCCCATGGNONE
015-003-E11GCCCATGGNONE
015-024-A08GCCCATGGNONE
AK072448GCCCATGGNONE
J023114G23GCCCATGGNONE
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein.
J075120F11GGGGCCCATGGGCCAGANONE
J075170L13GGGGCCCATGGGCCAGANONE
J080302A21GGGGCCCATGGGCCAGANONE
J080304J04GGGGCCCATGGGCCAGANONE
J080308I12GGGGCCCATGGGCCAGANONE
J080312F11GGGGCCCATGGGCCAGANONE
J080315M22GGGGCCCATGGGCCAGANONE
Os07g0146700014-006-H11AGCCCATGGGCCAGANONE
AK063631AGCCCATGGGCCAGAConserved hypothetical protein.
AK101150AGCCCATGGGCCAGANONE
J065038C21AGCCCATGGGCCAGANONE
Os07g0150200009-152-C07AGATGGGCCGGCCCATGTNONE
009-152-C07AGCCCATGANONE
AK058680AGATGGGCCGGCCCATGTNONE
AK058680AGCCCATGANONE
AK121635AGATGGGCCGGCCCATGTSimilar to 40S ribosomal protein S12-1.
AK121635AGCCCATGASimilar to 40S ribosomal protein S12-1.
J033051C16AGATGGGCCGGCCCATGTNONE
J033051C16AGCCCATGANONE
J033123H15AGATGGGCCGGCCCATGTNONE
J033123H15AGCCCATGANONE
J065093I01AGATGGGCCGGCCCATGTNONE
J065093I01AGCCCATGANONE
J065197C05AGATGGGCCGGCCCATGTNONE
J065197C05AGCCCATGANONE
J075037B11AGATGGGCCGGCCCATGTNONE
J075037B11AGCCCATGANONE
J075114B08AGATGGGCCGGCCCATGTNONE
J075114B08AGCCCATGANONE
J075123N01AGATGGGCCGGCCCATGTNONE
J075123N01AGCCCATGANONE
J075129O04AGATGGGCCGGCCCATGTNONE
J075129O04AGCCCATGANONE
J075160H17AGATGGGCCGGCCCATGTNONE
J075160H17AGCCCATGANONE
J075166H17AGATGGGCCGGCCCATGTNONE
J075166H17AGCCCATGANONE
J080310F11AGATGGGCCGGCCCATGTNONE
J080310F11AGCCCATGANONE
J080315P11AGATGGGCCGGCCCATGTNONE
J080315P11AGCCCATGANONE
J090025A22AGATGGGCCGGCCCATGTNONE
J090025A22AGCCCATGANONE
Os07g0155200006-036-E03AATTGGGCCCATGTNONE
006-036-E04AATTGGGCCCATGTNONE
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein.
AK104606AATTGGGCCCATGTNONE
Os07g0164500J013094M18TCAGGCCCATGGGCTNONE
J013153L05TCAGGCCCATGGGCTNONE
J023011J18TCAGGCCCATGGGCTNONE
J023106H21TCAGGCCCATGGGCTNONE
J033105F10TCAGGCCCATGGGCTNONE
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase).
J090060F05TCAGGCCCATGGGCTNONE
J090061C13TCAGGCCCATGGGCTNONE
J090074K15TCAGGCCCATGGGCTNONE
Os07g0191700AK066389CCAAGCCCATGSimilar to AT.I.24-9 protein (Fragment).
AK103768CCAAGCCCATGNONE
Os07g0213400003-104-B01CCATGGGCNONE
AK062273CCATGGGCConserved hypothetical protein.
J065122P17CCATGGGCNONE
J065160A01CCATGGGCNONE
J090065M11CCATGGGCNONE
Os07g0245100J023048C16CCATGGGCCCACTTGNONE
J023110L14CCATGGGCCCACTTGNONE
J053023B18CCATGGGCCCACTTGNONE
J053031L17CCATGGGCCCACTTGNONE
J065035I22CCATGGGCCCACTTGNONE
J065043D21CCATGGGCCCACTTGNONE
J065072L16CCATGGGCCCACTTGNONE
J065214I23CCATGGGCCCACTTGNONE
Os07g0247000AK072232TCAGCCCATGPectinesterase inhibitor domain containing protein.
AK099091TCAGCCCATGNONE
Os07g0257200AK070788GCCCATGGSimilar to OsNramp1 (Integral membrane protein).
J023064O13GCCCATGGNONE
J090040J06GCCCATGGNONE
J090071P07GCCCATGGNONE
J100036G17GCCCATGGNONE
J100055E18GCCCATGGNONE
J100062N13GCCCATGGNONE
J100087P04GCCCATGGNONE
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein.
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE
Os07g0297200J090050L01ATGGCCCATGGConserved hypothetical protein.
Os07g0408100AK108466GCCGGCCCATGGNONE
AK111780GCCGGCCCATGGWD40-like domain containing protein.
Os07g0418100Os07g0418100GTATGGGCCCATGTProtein of unknown function DUF889, eukaryote family protein.
Os07g0459200AK066819ATGGCCCATGGGCCGGCNONE
AK102099ATGGCCCATGGGCCGGCSimilar to Possible kinase.
Os07g0481100003-130-F04ACAGCCCATGTNONE
AK062302ACAGCCCATGTProtein of unknown function DUF315 domain containing protein.
J090048K21ACAGCCCATGTNONE
Os07g0498300009-045-C02CCATGGGCTTCNONE
009-045-C02TTTCGGCCCATGGGCTTTTNONE
009-060-A09CCATGGGCTTCNONE
009-060-A09TTTCGGCCCATGGGCTTTTNONE
009-121-C04CCATGGGCTTCNONE
009-121-C04TTTCGGCCCATGGGCTTTTNONE
009-157-G09CCATGGGCTTCNONE
009-157-G09TTTCGGCCCATGGGCTTTTNONE
009-197-B02CCATGGGCTTCNONE
009-197-B02TTTCGGCCCATGGGCTTTTNONE
AK059124CCATGGGCTTCConserved hypothetical protein.
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein.
AK119800CCATGGGCTTCNONE
AK119800TTTCGGCCCATGGGCTTTTNONE
J065184M18CCATGGGCTTCNONE
J065184M18TTTCGGCCCATGGGCTTTTNONE
J075009G21CCATGGGCTTCNONE
J075009G21TTTCGGCCCATGGGCTTTTNONE
J075013O03CCATGGGCTTCNONE
J075013O03TTTCGGCCCATGGGCTTTTNONE
J075061C22CCATGGGCTTCNONE
J075061C22TTTCGGCCCATGGGCTTTTNONE
J075094E12CCATGGGCTTCNONE
J075094E12TTTCGGCCCATGGGCTTTTNONE
J075148C01CCATGGGCTTCNONE
J075148C01TTTCGGCCCATGGGCTTTTNONE
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein.
Os07g0516200AK061373ACATGGGCTTCSimilar to Endoribonuclease, L-PSP family.
Os07g0521800J100058N12GCCCATGGDisease resistance protein family protein.
Os07g0530700AK060014CCATGGGCTTCNONE
AK099533CCATGGGCTTCConserved hypothetical protein.
Os07g0531600015-098-E11ACATGGGCCGANONE
015-098-E11CCGAGCCGGCCCATGTNONE
AK067845ACATGGGCCGAPhospholipid/glycerol acyltransferase domain containing protein.
AK067845CCGAGCCGGCCCATGTPhospholipid/glycerol acyltransferase domain containing protein.
J013124G01ACATGGGCCGANONE
J013124G01CCGAGCCGGCCCATGTNONE
J065008E15ACATGGGCCGANONE
J065008E15CCGAGCCGGCCCATGTNONE
J065052K14ACATGGGCCGANONE
J065052K14CCGAGCCGGCCCATGTNONE
J065052L13ACATGGGCCGANONE
J065052L13CCGAGCCGGCCCATGTNONE
J065058M02ACATGGGCCGANONE
J065058M02CCGAGCCGGCCCATGTNONE
J065069M10ACATGGGCCGANONE
J065069M10CCGAGCCGGCCCATGTNONE
J065135A14ACATGGGCCGANONE
J065135A14CCGAGCCGGCCCATGTNONE
J065168O18ACATGGGCCGANONE
J065168O18CCGAGCCGGCCCATGTNONE
J075070D14ACATGGGCCGANONE
J075070D14CCGAGCCGGCCCATGTNONE
J075169B16ACATGGGCCGANONE
J075169B16CCGAGCCGGCCCATGTNONE
Os07g0533800016-078-C05GCCCATGGNONE
AK064277GCCCATGGPeptidase A1, pepsin family protein.
J100040M23GCCCATGGNONE
J100058K11GCCCATGGNONE
Os07g0546700009-110-H10TCATGGGCCGGCNONE
AK058262TCATGGGCCGGCNONE
J065154I05TCATGGGCCGGCNONE
J065175P09TCATGGGCCGGCNONE
J065187F11TCATGGGCCGGCNONE
J075114K16TCATGGGCCGGCNONE
J090031L21TCATGGGCCGGCNONE
U86017TCATGGGCCGGCSimilar to 60S ribosomal protein L38.
Os07g0558000AK069272ACATGGGCTTANONE
AK101867ACATGGGCTTAABC-1 domain containing protein.
Os07g0558800AK100986CAAGCCCATGAMajor sperm protein domain containing protein.
Os07g0568100AK099778AGCCCATGGGCCGASimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK).
Os07g0597000009-013-A01GCCCATGGNONE
009-077-A02GCCCATGGNONE
009-195-H04GCCCATGGNONE
AF094773GCCCATGGNONE
AK062134GCCCATGGNONE
AK103429GCCCATGGSimilar to Eukaryotic translation initiation factor 5A (eIF-5A).
J013088G19GCCCATGGNONE
J013152D01GCCCATGGNONE
J023024K09GCCCATGGNONE
J023058J15GCCCATGGNONE
J023097I07GCCCATGGNONE
J023132B05GCCCATGGNONE
J033065L11GCCCATGGNONE
J033086B12GCCCATGGNONE
J033128M07GCCCATGGNONE
J043010M23GCCCATGGNONE
J043024A05GCCCATGGNONE
J053057P08GCCCATGGNONE
J065022G24GCCCATGGNONE
J065028I10GCCCATGGNONE
J065065D08GCCCATGGNONE
J065103D22GCCCATGGNONE
J065153K16GCCCATGGNONE
J065210B16GCCCATGGNONE
J075015H18GCCCATGGNONE
J075102C14GCCCATGGNONE
J080302G09GCCCATGGNONE
J080302L20GCCCATGGNONE
J080303K11GCCCATGGNONE
J080312C18GCCCATGGNONE
J080316F08GCCCATGGNONE
J090023I05GCCCATGGNONE
J090023I07GCCCATGGNONE
J090053C21GCCCATGGNONE
J090067J22GCCCATGGNONE
J090070E24GCCCATGGNONE
J090078H04GCCCATGGNONE
J090089P06GCCCATGGNONE
J090092E21GCCCATGGNONE
J100014G01GCCCATGGNONE
J100022L20GCCCATGGNONE
J100024I05GCCCATGGNONE
J100025L08GCCCATGGNONE
J100030J03GCCCATGGNONE
J100031K12GCCCATGGNONE
J100036N01GCCCATGGNONE
J100050C23GCCCATGGNONE
J100062G12GCCCATGGNONE
J100067L17GCCCATGGNONE
J100074O09GCCCATGGNONE
Os07g0603100AK101352GCGGCCCATGGNuclear transport factor 2 domain containing protein.
AK101352TCATGGGCCGGANuclear transport factor 2 domain containing protein.
AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein.
J023077E09GCGGCCCATGGNONE
J023077E09TCATGGGCCGGANONE
J023077E09TCATGGGCCTGGNONE
J023081N15GCGGCCCATGGNONE
J023081N15TCATGGGCCGGANONE
J023081N15TCATGGGCCTGGNONE
J033022N22GCGGCCCATGGNONE
J033022N22TCATGGGCCGGANONE
J033022N22TCATGGGCCTGGNONE
J033024M18GCGGCCCATGGNONE
J033024M18TCATGGGCCGGANONE
J033024M18TCATGGGCCTGGNONE
J033034P09GCGGCCCATGGNONE
J033034P09TCATGGGCCGGANONE
J033034P09TCATGGGCCTGGNONE
J033046A06GCGGCCCATGGNONE
J033046A06TCATGGGCCGGANONE
J033046A06TCATGGGCCTGGNONE
J033051K01GCGGCCCATGGNONE
J033051K01TCATGGGCCGGANONE
J033051K01TCATGGGCCTGGNONE
J033081P09GCGGCCCATGGNONE
J033081P09TCATGGGCCGGANONE
J033081P09TCATGGGCCTGGNONE
J033091B17GCGGCCCATGGNONE
J033091B17TCATGGGCCGGANONE
J033091B17TCATGGGCCTGGNONE
J033092K23GCGGCCCATGGNONE
J033092K23TCATGGGCCGGANONE
J033092K23TCATGGGCCTGGNONE
J033132J09GCGGCCCATGGNONE
J033132J09TCATGGGCCGGANONE
J033132J09TCATGGGCCTGGNONE
J033144A14GCGGCCCATGGNONE
J033144A14TCATGGGCCGGANONE
J033144A14TCATGGGCCTGGNONE
J033145A14GCGGCCCATGGNONE
J033145A14TCATGGGCCGGANONE
J033145A14TCATGGGCCTGGNONE
J043021B20GCGGCCCATGGNONE
J043021B20TCATGGGCCGGANONE
J043021B20TCATGGGCCTGGNONE
J053024D23GCGGCCCATGGNONE
J053024D23TCATGGGCCGGANONE
J053024D23TCATGGGCCTGGNONE
J065212J10GCGGCCCATGGNONE
J065212J10TCATGGGCCGGANONE
J065212J10TCATGGGCCTGGNONE
J090055M05GCGGCCCATGGNONE
J090055M05TCATGGGCCGGANONE
J090055M05TCATGGGCCTGGNONE
J090065E14GCGGCCCATGGNONE
J090065E14TCATGGGCCGGANONE
J090065E14TCATGGGCCTGGNONE
J090092J06GCGGCCCATGGNONE
J090092J06TCATGGGCCGGANONE
J090092J06TCATGGGCCTGGNONE
Os07g0607200AK065746GCCCATGGProtein of unknown function DUF751 family protein.
J065037B15GCCCATGGNONE
J065042E20GCCCATGGNONE
J065161I08GCCCATGGNONE
Os07g0611700AK109158CGCGTGCGCACGGCCCATGPeptidase C1A, papain family protein.
Os07g0611800Os07g0611800CGCGTGCGCACGGCCCATGNONE
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein.
Os07g0627100AK119510GCCCATGGConserved hypothetical protein.
Os07g0635500011-089-H07ATGGCCCATGGNONE
016-030-A09ATGGCCCATGGNONE
AK106081ATGGCCCATGGNONE
AK121733ATGGCCCATGGSimilar to Cytochrome P450.
J043036I03ATGGCCCATGGNONE
J065001N22ATGGCCCATGGNONE
J065035I03ATGGCCCATGGNONE
J065167G12ATGGCCCATGGNONE
J075041E07ATGGCCCATGGNONE
J090007D08ATGGCCCATGGNONE
J090089I24ATGGCCCATGGNONE
J100026I23ATGGCCCATGGNONE
J100027H19ATGGCCCATGGNONE
J100044G07ATGGCCCATGGNONE
J100089H22ATGGCCCATGGNONE
J100090D03ATGGCCCATGGNONE
J100090D22ATGGCCCATGGNONE
Os07g0638300AK101401ACATGGGCCGCNONE
AK102982ACATGGGCCGCSimilar to 1-Cys peroxiredoxin.
AY336994ACATGGGCCGCNONE
D63917ACATGGGCCGCNONE
J033044N01ACATGGGCCGCNONE
J033055M23ACATGGGCCGCNONE
J033057E19ACATGGGCCGCNONE
J033114I23ACATGGGCCGCNONE
J033115O22ACATGGGCCGCNONE
J033120C03ACATGGGCCGCNONE
J033121H24ACATGGGCCGCNONE
J043034H13ACATGGGCCGCNONE
J065029D17ACATGGGCCGCNONE
J065058P20ACATGGGCCGCNONE
J065062L08ACATGGGCCGCNONE
J065082B12ACATGGGCCGCNONE
J065131K01ACATGGGCCGCNONE
J065181F09ACATGGGCCGCNONE
J065200F11ACATGGGCCGCNONE
J075003I12ACATGGGCCGCNONE
J075006B18ACATGGGCCGCNONE
J075013E13ACATGGGCCGCNONE
J075013I03ACATGGGCCGCNONE
J075017J08ACATGGGCCGCNONE
J075019J19ACATGGGCCGCNONE
J075030G22ACATGGGCCGCNONE
J075037E04ACATGGGCCGCNONE
J075048L18ACATGGGCCGCNONE
J075056A08ACATGGGCCGCNONE
J075059G05ACATGGGCCGCNONE
J075062J04ACATGGGCCGCNONE
J075070F14ACATGGGCCGCNONE
J075072N23ACATGGGCCGCNONE
J075085J23ACATGGGCCGCNONE
J075091L01ACATGGGCCGCNONE
J075094B10ACATGGGCCGCNONE
J075098M05ACATGGGCCGCNONE
J075106B18ACATGGGCCGCNONE
J075116K24ACATGGGCCGCNONE
J075136C06ACATGGGCCGCNONE
J075137I15ACATGGGCCGCNONE
J075140K14ACATGGGCCGCNONE
J075147H07