version

Summary of CCAACGG (All List)

Organism Oryza sativa
PPDB Motif CCAACGG
Description function unknown
Total Entry Count 12107

Entry Sequences (12107 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1.
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE
Os01g0101600AK099952CCGTTGGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
AK099952TACGGCCCAACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
AK122118CCGTTGGATNONE
AK122118TACGGCCCAACANONE
J013123J12CCGTTGGATNONE
J013123J12TACGGCCCAACANONE
J033026O19CCGTTGGATNONE
J033026O19TACGGCCCAACANONE
J033128C08CCGTTGGATNONE
J033128C08TACGGCCCAACANONE
J065116M14CCGTTGGATNONE
J065116M14TACGGCCCAACANONE
J090058F15CCGTTGGATNONE
J090058F15TACGGCCCAACANONE
J090079F20CCGTTGGATNONE
J090079F20TACGGCCCAACANONE
Os01g0102500011-064-A09CAACGGTCNONE
011-064-A09CCAGCCCACCAACNONE
015-011-E06CAACGGTCNONE
015-011-E06CCAGCCCACCAACNONE
016-083-H11CAACGGTCNONE
016-083-H11CCAGCCCACCAACNONE
AK100002CAACGGTCConserved hypothetical protein.
AK100002CCAGCCCACCAACConserved hypothetical protein.
J065063K05CAACGGTCNONE
J065063K05CCAGCCCACCAACNONE
J065191H24CAACGGTCNONE
J065191H24CCAGCCCACCAACNONE
J100079N16CAACGGTCNONE
J100079N16CCAGCCCACCAACNONE
Os01g0104000AK072087TGTTGGGCCGANONE
AK103808TGTTGGGCCGAC-type lectin domain containing protein.
Os01g0104100AK072797TCGGCCCAACAZinc finger, RING-type domain containing protein.
AK104280TCGGCCCAACANONE
Os01g0132800AK068422CCAGCCCAACAPeptidyl-tRNA hydrolase family protein.
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein.
Os01g0139200J023061K13GGCCGTTGNONE
J053024M09GGCCGTTGNONE
J053047C19GGCCGTTGNONE
Os01g0141100012-043-A12CCAACGGCNONE
AK062139CCAACGGCNONE
J013110M14CCAACGGCNONE
J013114F09CCAACGGCNONE
J033036J01CCAACGGCNONE
Os01g0141700AB082381CGTTGGATUV-damaged DNA binding protein 2.
AK111907CGTTGGATNONE
AK112097CGTTGGATNONE
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE
006-081-C11GTGGGTCCAACGGCCCAGCNONE
009-050-D04GTGGGTCCAACGGCCCAGCNONE
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein.
J023058M18GTGGGTCCAACGGCCCAGCNONE
J023112H22GTGGGTCCAACGGCCCAGCNONE
J065048P05GTGGGTCCAACGGCCCAGCNONE
J100068N20GTGGGTCCAACGGCCCAGCNONE
J100073A02GTGGGTCCAACGGCCCAGCNONE
Os01g0158000AK058679AGTTGGGCCACACGNONE
AK103127AGTTGGGCCACACGImportin alpha-2 subunit.
D78504AGTTGGGCCACACGNONE
Os01g0172000012-070-G06GGTTGGGCCGGANONE
AK068405GGTTGGGCCGGAALG3 family protein.
J013149A07GGTTGGGCCGGANONE
J053047H05GGTTGGGCCGGANONE
J065075N03GGTTGGGCCGGANONE
J065093G22GGTTGGGCCGGANONE
J065130N21GGTTGGGCCGGANONE
J065143P05GGTTGGGCCGGANONE
J065216H07GGTTGGGCCGGANONE
J075013B06GGTTGGGCCGGANONE
J075196M05GGTTGGGCCGGANONE
J100039G24GGTTGGGCCGGANONE
J100041B11GGTTGGGCCGGANONE
J100069A16GGTTGGGCCGGANONE
J100069L12GGTTGGGCCGGANONE
J100074P16GGTTGGGCCGGANONE
Os01g0172100AK060343CAACGGTCSimilar to Triose phosphate/phosphate translocator, non-green plastid, chloroplast precursor (CTPT).
Os01g0172300AK106113CGTTGGATConserved hypothetical protein.
Os01g0176500AK102552ATCCAACGGCConserved hypothetical protein.
AK102552CCAACGGCTConserved hypothetical protein.
AK102552GACCGTTGConserved hypothetical protein.
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein.
Os01g0184000015-008-B06ATCCAACGGNONE
AK071130ATCCAACGGNUC156 family protein.
AK100604ATCCAACGGNONE
Os01g0184500AK060699GGCCCGTTDEAD/DEAH box helicase, N-terminal domain containing protein.
Os01g0185300011-055-A05AGCCGTTGNONE
015-007-B11AGCCGTTGNONE
015-062-F05AGCCGTTGNONE
015-078-C11AGCCGTTGNONE
016-068-F07AGCCGTTGNONE
016-074-F08AGCCGTTGNONE
AK065131AGCCGTTGTransferase family protein.
AK098922AGCCGTTGNONE
J013000G12AGCCGTTGNONE
J013001P14AGCCGTTGNONE
J013002O23AGCCGTTGNONE
J013096L23AGCCGTTGNONE
J013097F24AGCCGTTGNONE
J013120N24AGCCGTTGNONE
J023007C15AGCCGTTGNONE
J023119O12AGCCGTTGNONE
J033039O11AGCCGTTGNONE
J033043L11AGCCGTTGNONE
J033061A07AGCCGTTGNONE
J033076M13AGCCGTTGNONE
J033082B04AGCCGTTGNONE
J033143H15AGCCGTTGNONE
J043013A02AGCCGTTGNONE
J043036N21AGCCGTTGNONE
J065013M09AGCCGTTGNONE
J065082E22AGCCGTTGNONE
J065093G01AGCCGTTGNONE
J065120L06AGCCGTTGNONE
J065135D03AGCCGTTGNONE
J065197C10AGCCGTTGNONE
J100024J10AGCCGTTGNONE
J100042M22AGCCGTTGNONE
J100077E12AGCCGTTGNONE
J100084P03AGCCGTTGNONE
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE
Os01g0190000Os01g0190000ATCCAACGTaurine catabolism dioxygenase TauD/TfdA family protein.
Os01g0190400AK064011AAAAGCCCAACSimilar to Hexokinase.
AK099119AAAAGCCCAACNONE
Os01g0191100009-011-A02CAACGGCTNONE
009-028-D05CAACGGCTNONE
009-058-B11CAACGGCTNONE
009-151-D09CAACGGCTNONE
013-026-G03CAACGGCTNONE
013-063-F04CAACGGCTNONE
013-069-B05CAACGGCTNONE
014-029-E04CAACGGCTNONE
014-072-H04CAACGGCTNONE
014-089-E09CAACGGCTNONE
015-047-G05CAACGGCTNONE
016-033-G06CAACGGCTNONE
AK058815CAACGGCTSimilar to Acidic ribosomal protein P2a-4 (Fragment).
J023069C08CAACGGCTNONE
J023077K21CAACGGCTNONE
J023081F19CAACGGCTNONE
J033052N11CAACGGCTNONE
J033058N11CAACGGCTNONE
J033114G05CAACGGCTNONE
J033114O17CAACGGCTNONE
J033129L14CAACGGCTNONE
J053029I12CAACGGCTNONE
J065067N19CAACGGCTNONE
J065084I19CAACGGCTNONE
J065099O03CAACGGCTNONE
J065201I08CAACGGCTNONE
J075035B08CAACGGCTNONE
J075037B22CAACGGCTNONE
J075054L16CAACGGCTNONE
J075059D15CAACGGCTNONE
J075164I08CAACGGCTNONE
J075185J01CAACGGCTNONE
J090042O06CAACGGCTNONE
J090044F12CAACGGCTNONE
J090063L02CAACGGCTNONE
J090073I10CAACGGCTNONE
J090078E18CAACGGCTNONE
J100072K16CAACGGCTNONE
Os01g0191800AK061360GACCGTTGNONE
Os01g0205900006-057-B04GTTGGTGGNONE
AK060687GTTGGTGGNONE
AK105932GTTGGTGGSimilar to Class III peroxidase GvPx2b (Fragment).
J033143I12GTTGGTGGNONE
J075013J08GTTGGTGGNONE
J075090B11GTTGGTGGNONE
J075143C17GTTGGTGGNONE
J075147O13GTTGGTGGNONE
J075161L02GTTGGTGGNONE
Os01g0214500AK062484CAACGGCTCGGConserved hypothetical protein.
AK062484GGCCGTTGConserved hypothetical protein.
Os01g0215700AK059088CAACGGCTLipolytic enzyme, G-D-S-L family protein.
AK061118CAACGGCTNONE
AK119598CAACGGCTNONE
AK119642CAACGGCTNONE
Os01g0219100J065130F20AACGGGCCNONE
J065208O10AACGGGCCSFT2-like family protein.
Os01g0220200J100075D14TACGGCCCCCAACGGCCNONE
Os01g0221300011-021-E12TCTCGGCCCAACANONE
AK073330TCTCGGCCCAACAConserved hypothetical protein.
J013130J18TCTCGGCCCAACANONE
J033024A12TCTCGGCCCAACANONE
J065063H09TCTCGGCCCAACANONE
J065093G05TCTCGGCCCAACANONE
J090007K12TCTCGGCCCAACANONE
Os01g0222700012-011-E01GTTTGGGCCGACCGTTGNONE
AK068883GTTTGGGCCGACCGTTGNONE
AK101946GTTTGGGCCGACCGTTGZinc finger, BED-type predicted domain containing protein.
J033075C16GTTTGGGCCGACCGTTGNONE
J043013D08GTTTGGGCCGACCGTTGNONE
J065089G19GTTTGGGCCGACCGTTGNONE
J065197K19GTTTGGGCCGACCGTTGNONE
J075161L21GTTTGGGCCGACCGTTGNONE
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein.
Os01g0225400J080301M15TGTTGGGCTKetopantoate hydroxymethyltransferase family protein.
J080315B20TGTTGGGCTNONE
Os01g0227100AK068523CAACGGCTGlucose/ribitol dehydrogenase family protein.
J013094O19CAACGGCTNONE
J013094P19CAACGGCTNONE
J013097H20CAACGGCTNONE
J023050J04CAACGGCTNONE
Os01g0229900AK065381TCCAACGGNONE
AK065429TCCAACGGSimilar to Shaggy-related protein kinase dzeta (EC 2.7.1.-) (ASK-dzeta).
Os01g0231800009-133-C07CCACCAACNONE
AK062918CCACCAACAppr>p cyclic nucleotide phosphodiesterase domain containing protein.
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2.
AK069972CAAGGCCCAACASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2.
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE
J075090M12CAAGGCCCAACANONE
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE
J075146A12CAAGGCCCAACANONE
Os01g0238200009-027-B03AGCCGTTGGNONE
009-027-B03AGCCGTTGGNONE
009-031-A07AGCCGTTGGNONE
009-031-A07AGCCGTTGGNONE
009-119-A04AGCCGTTGGNONE
009-119-A04AGCCGTTGGNONE
009-175-C11AGCCGTTGGNONE
009-175-C11AGCCGTTGGNONE
AK062403AGCCGTTGGConserved hypothetical protein.
AK062403AGCCGTTGGConserved hypothetical protein.
AK063106AGCCGTTGGNONE
AK063106AGCCGTTGGNONE
J065058A15AGCCGTTGGNONE
J065058A15AGCCGTTGGNONE
J065116N10AGCCGTTGGNONE
J065116N10AGCCGTTGGNONE
J065141K18AGCCGTTGGNONE
J065141K18AGCCGTTGGNONE
Os01g0246100AK120732CACGGCCCGTTProtein of unknown function DUF902, CREBbp domain containing protein.
Os01g0246400009-143-G05CCACCAACNONE
AK062972CCACCAACSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP).
Os01g0254800AK067017ATCCAACGConserved hypothetical protein.
J013089L24ATCCAACGNONE
Os01g0257100J100030B03CCAGCCCAACCAACGGTCNONE
J100046K16CCAGCCCAACCAACGGTCRapid ALkalinization Factor family protein.
Os01g0261500AK072194GTTGGTGGTGTGGGCTTTTNONE
AK101899GTTGGTGGTGTGGGCTTTTConserved hypothetical protein.
J065041N17GTTGGTGGTGTGGGCTTTTNONE
Os01g0262700AK100901ATCCAACGGConserved hypothetical protein.
AK119928ATCCAACGGNONE
J033057O20ATCCAACGGNONE
J065093J01ATCCAACGGNONE
J075164F23ATCCAACGGNONE
J100025E08ATCCAACGGNONE
J100029L03ATCCAACGGNONE
J100079F02ATCCAACGGNONE
Os01g0276000009-162-D08AGCCCAAGCCCAACANONE
009-162-D08GAAGCCCAACANONE
AK058917AGCCCAAGCCCAACASimilar to 60S ribosomal protein L30.
AK058917GAAGCCCAACASimilar to 60S ribosomal protein L30.
AK119715AGCCCAAGCCCAACANONE
AK119715GAAGCCCAACANONE
AK122128AGCCCAAGCCCAACANONE
AK122128GAAGCCCAACANONE
J033132L17AGCCCAAGCCCAACANONE
J033132L17GAAGCCCAACANONE
J065019G15AGCCCAAGCCCAACANONE
J065019G15GAAGCCCAACANONE
J065033O12AGCCCAAGCCCAACANONE
J065033O12GAAGCCCAACANONE
J065058J19AGCCCAAGCCCAACANONE
J065058J19GAAGCCCAACANONE
J065069L03AGCCCAAGCCCAACANONE
J065069L03GAAGCCCAACANONE
J065072E03AGCCCAAGCCCAACANONE
J065072E03GAAGCCCAACANONE
J065112J06AGCCCAAGCCCAACANONE
J065112J06GAAGCCCAACANONE
J065163C18AGCCCAAGCCCAACANONE
J065163C18GAAGCCCAACANONE
J065170L20AGCCCAAGCCCAACANONE
J065170L20GAAGCCCAACANONE
J065184O11AGCCCAAGCCCAACANONE
J065184O11GAAGCCCAACANONE
J065199M19AGCCCAAGCCCAACANONE
J065199M19GAAGCCCAACANONE
J065207P22AGCCCAAGCCCAACANONE
J065207P22GAAGCCCAACANONE
J065211C12AGCCCAAGCCCAACANONE
J065211C12GAAGCCCAACANONE
J075072K20AGCCCAAGCCCAACANONE
J075072K20GAAGCCCAACANONE
J075100B16AGCCCAAGCCCAACANONE
J075100B16GAAGCCCAACANONE
J075173F02AGCCCAAGCCCAACANONE
J075173F02GAAGCCCAACANONE
J090083E15AGCCCAAGCCCAACANONE
J090083E15GAAGCCCAACANONE
J100022F06AGCCCAAGCCCAACANONE
J100022F06GAAGCCCAACANONE
J100064C04AGCCCAAGCCCAACANONE
J100064C04GAAGCCCAACANONE
J100068F11AGCCCAAGCCCAACANONE
J100068F11GAAGCCCAACANONE
Os01g0276500006-030-E04AACGGGCCNONE
AK061002AACGGGCCSimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)].
AK099335AACGGGCCNONE
Os01g0276700011-014-A12CCGTTGGANONE
012-092-G12CCGTTGGANONE
AK103164CCGTTGGANONE
AK103465CCGTTGGASimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK).
J023019H09CCGTTGGANONE
J023084I02CCGTTGGANONE
J033027F20CCGTTGGANONE
J033029M06CCGTTGGANONE
J033039K13CCGTTGGANONE
J033057C24CCGTTGGANONE
J033058G20CCGTTGGANONE
J033060A14CCGTTGGANONE
J033061M21CCGTTGGANONE
J033068M10CCGTTGGANONE
J033074K16CCGTTGGANONE
J033076C11CCGTTGGANONE
J033093O13CCGTTGGANONE
J033119H20CCGTTGGANONE
J033121D22CCGTTGGANONE
J033129N11CCGTTGGANONE
J033131E12CCGTTGGANONE
J033150L07CCGTTGGANONE
J053024N17CCGTTGGANONE
J053034G19CCGTTGGANONE
J053035E18CCGTTGGANONE
J053046M01CCGTTGGANONE
J053047P04CCGTTGGANONE
J053048B06CCGTTGGANONE
J053050M22CCGTTGGANONE
J053053E09CCGTTGGANONE
J053053I07CCGTTGGANONE
J053059K03CCGTTGGANONE
J053059P12CCGTTGGANONE
J053060C12CCGTTGGANONE
J053060H24CCGTTGGANONE
J053064D19CCGTTGGANONE
J053066L15CCGTTGGANONE
J053073I02CCGTTGGANONE
J053083E15CCGTTGGANONE
J053094D05CCGTTGGANONE
J053094P18CCGTTGGANONE
J053095C15CCGTTGGANONE
J053095C21CCGTTGGANONE
J053099N16CCGTTGGANONE
J090025O19CCGTTGGANONE
J090049N22CCGTTGGANONE
J090050F17CCGTTGGANONE
Os01g0277500AK066984AGTTGGGCTCTTGGGCCTCSimilar to Dof3 gene (Fragment).
J013074F19AGTTGGGCTCTTGGGCCTCNONE
J013091E10AGTTGGGCTCTTGGGCCTCNONE
J023077C19AGTTGGGCTCTTGGGCCTCNONE
J033068A02AGTTGGGCTCTTGGGCCTCNONE
J065137O05AGTTGGGCTCTTGGGCCTCNONE
Os01g0281200AK107209GACCGTTGGASimilar to Type B-like cyclin (Fragment).
AK107209GCCGTTGGSimilar to Type B-like cyclin (Fragment).
AY647458GACCGTTGGANONE
AY647458GCCGTTGGNONE
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein.
Os01g0290700AK058263GACCGTTGSimilar to CjMDR1.
Os01g0294700006-057-A09CAACGGCCNONE
AK068755CAACGGCCHaem peroxidase, plant/fungal/bacterial family protein.
AK104388CAACGGCCNONE
AK104781CAACGGCCNONE
J013000M08CAACGGCCNONE
J013067E04CAACGGCCNONE
J013067E05CAACGGCCNONE
J013159G18CAACGGCCNONE
J065053A05CAACGGCCNONE
J065065J01CAACGGCCNONE
J065109H12CAACGGCCNONE
J065131F05CAACGGCCNONE
J075095D14CAACGGCCNONE
J075156A05CAACGGCCNONE
Os01g0295900J065076G19GGCCCGTTNONE
Os01g0296900Os01g0296900CAACGGTCProtein of unknown function DUF6, transmembrane domain containing protein.
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein.
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE
Os01g0303300J053035N19AAAGCCCAACCNONE
J075042F02AAAGCCCAACCNONE
J075068E10AAAGCCCAACCNONE
J075116E19AAAGCCCAACCNONE
J075131C10AAAGCCCAACCNONE
J075145J11AAAGCCCAACCNONE
J075157P20AAAGCCCAACCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J075164G12AAAGCCCAACCNONE
Os01g0305900Os01g0305900CCACCAACSimilar to A-type R2R3 Myb protein (Fragment).
Os01g0306100AK111041GACCGTTGPlant specific eukaryotic initiation factor 4B family protein.
Os01g0309900AK100627CCGTTGGATLipase, class 3 family protein.
Os01g0315800AB167396ATCCAACGNONE
AK101168ATCCAACGUDP-glucuronic acid decarboxylase (EC 4.1.1.35).
J013075K16ATCCAACGNONE
J013096B22ATCCAACGNONE
J033028I19ATCCAACGNONE
J033042O14ATCCAACGNONE
J065137I23ATCCAACGNONE
J065163K17ATCCAACGNONE
J100028N19ATCCAACGNONE
J100051G09ATCCAACGNONE
Os01g0321800AK064712ATCCAACGGCCGAGAGas vesicle protein GvpC repeat containing protein.
J075175N03ATCCAACGGCCGAGANONE
Os01g0327600AK120216AGTTGGGCTNONE
AK121799AGTTGGGCTConserved hypothetical protein.
J065081I07AGTTGGGCTNONE
J065082D04AGTTGGGCTNONE
J065082G10AGTTGGGCTNONE
J065085G24AGTTGGGCTNONE
J065105J24AGTTGGGCTNONE
J065128D18AGTTGGGCTNONE
J065155D13AGTTGGGCTNONE
J065200C11AGTTGGGCTNONE
Os01g0328400006-092-H09ATCCAACGGCNONE
006-092-H09GTTGGTGGNONE
009-085-A02ATCCAACGGCNONE
009-085-A02GTTGGTGGNONE
012-078-B03ATCCAACGGCNONE
012-078-B03GTTGGTGGNONE
AK061988ATCCAACGGCUbiquitin.
AK061988GTTGGTGGUbiquitin.
J013073B13ATCCAACGGCNONE
J013073B13GTTGGTGGNONE
J023135L09ATCCAACGGCNONE
J023135L09GTTGGTGGNONE
J023135O07ATCCAACGGCNONE
J023135O07GTTGGTGGNONE
J033027B12ATCCAACGGCNONE
J033027B12GTTGGTGGNONE
J033084P17ATCCAACGGCNONE
J033084P17GTTGGTGGNONE
J065010M05ATCCAACGGCNONE
J065010M05GTTGGTGGNONE
J065021N11ATCCAACGGCNONE
J065021N11GTTGGTGGNONE
J065021N12ATCCAACGGCNONE
J065021N12GTTGGTGGNONE
J065031K11ATCCAACGGCNONE
J065031K11GTTGGTGGNONE
J065072P04ATCCAACGGCNONE
J065072P04GTTGGTGGNONE
J065098D05ATCCAACGGCNONE
J065098D05GTTGGTGGNONE
J065122N23ATCCAACGGCNONE
J065122N23GTTGGTGGNONE
J065129L13ATCCAACGGCNONE
J065129L13GTTGGTGGNONE
J065135N13ATCCAACGGCNONE
J065135N13GTTGGTGGNONE
J065215N10ATCCAACGGCNONE
J065215N10GTTGGTGGNONE
J075120N22ATCCAACGGCNONE
J075120N22GTTGGTGGNONE
J090011G23ATCCAACGGCNONE
J090011G23GTTGGTGGNONE
J090014F06ATCCAACGGCNONE
J090014F06GTTGGTGGNONE
J090040G23ATCCAACGGCNONE
J090040G23GTTGGTGGNONE
J090075I20ATCCAACGGCNONE
J090075I20GTTGGTGGNONE
J090075N01ATCCAACGGCNONE
J090075N01GTTGGTGGNONE
J090089B04ATCCAACGGCNONE
J090089B04GTTGGTGGNONE
J090090F08ATCCAACGGCNONE
J090090F08GTTGGTGGNONE
J090091M17ATCCAACGGCNONE
J090091M17GTTGGTGGNONE
J090094L03ATCCAACGGCNONE
J090094L03GTTGGTGGNONE
J090099L06ATCCAACGGCNONE
J090099L06GTTGGTGGNONE
J100018A18ATCCAACGGCNONE
J100018A18GTTGGTGGNONE
J100027H13ATCCAACGGCNONE
J100027H13GTTGGTGGNONE
J100069C05ATCCAACGGCNONE
J100069C05GTTGGTGGNONE
J100086L10ATCCAACGGCNONE
J100086L10GTTGGTGGNONE
Os01g0329900009-063-H04CCACCAACNONE
AK105168CCACCAACNONE
AK120056CCACCAACSimilar to Lipase homolog (Fragment).
J013000O15CCACCAACNONE
J065026F09CCACCAACNONE
Os01g0331900013-026-D04TGTTGGGCCAGNONE
AK064784TGTTGGGCCAGNONE
AK121761TGTTGGGCCAGProtein of unknown function DUF846, eukaryotic family protein.
J013000B15TGTTGGGCCAGNONE
J033090D07TGTTGGGCCAGNONE
J090006L21TGTTGGGCCAGNONE
Os01g0348700009-125-H02CCAACGGCCNONE
009-156-F08CCAACGGCCNONE
009-177-A11CCAACGGCCNONE
009-195-D02CCAACGGCCNONE
013-040-B06CCAACGGCCNONE
013-051-B09CCAACGGCCNONE
AK120842CCAACGGCCSimilar to 60S ribosomal protein L23a (L25).
J013071O22CCAACGGCCNONE
J023022J07CCAACGGCCNONE
J033028J08CCAACGGCCNONE
J033109M11CCAACGGCCNONE
J043022K15CCAACGGCCNONE
J043031N11CCAACGGCCNONE
J053023I10CCAACGGCCNONE
J053045F16CCAACGGCCNONE
J053054F22CCAACGGCCNONE
J053094P15CCAACGGCCNONE
J065048F01CCAACGGCCNONE
J075012F16CCAACGGCCNONE
J075089C09CCAACGGCCNONE
J075179J20CCAACGGCCNONE
J080305E19CCAACGGCCNONE
J080309B21CCAACGGCCNONE
J090017L05CCAACGGCCNONE
J090058B11CCAACGGCCNONE
Os01g0349400AK064941ATCCAACGGCCNONE
AK100195ATCCAACGGCCNONE
AK105047ATCCAACGGCCNONE
AK122182ATCCAACGGCCSimilar to Serine/threonine protein phosphatase PP1 (EC 3.1.3.16) (Fragment).
Os01g0350900AK070217GGTTGGGCTTGSimilar to VIP2 protein.
J065165D23GGTTGGGCTTGNONE
Os01g0358300AK060388TTCGGCCCAACTNONE
AK072081TTCGGCCCAACTTetratricopeptide-like helical domain containing protein.
Os01g0358400006-031-B11AGTTGGGCCGAANONE
006-083-B11AGTTGGGCCGAANONE
006-083-C09AGTTGGGCCGAANONE
006-088-H03AGTTGGGCCGAANONE
006-102-H05AGTTGGGCCGAANONE
AK061826AGTTGGGCCGAASimilar to 40S ribosomal protein S4.
J013105M07AGTTGGGCCGAANONE
J013155A16AGTTGGGCCGAANONE
J033025C03AGTTGGGCCGAANONE
J033072L20AGTTGGGCCGAANONE
J033095I15AGTTGGGCCGAANONE
J033105E03AGTTGGGCCGAANONE
J033112G18AGTTGGGCCGAANONE
J033125D09AGTTGGGCCGAANONE
J065100L16AGTTGGGCCGAANONE
J065176I05AGTTGGGCCGAANONE
J090001C14AGTTGGGCCGAANONE
J090058E15AGTTGGGCCGAANONE
J090068F07AGTTGGGCCGAANONE
Os01g0367100AK068655CAACGGTCCAGANONE
AK068655TGTTGGGCTNONE
AK101540CAACGGTCCAGANONE
AK101540TGTTGGGCTNONE
AK101542CAACGGTCCAGANONE
AK101542TGTTGGGCTNONE
AK119785CAACGGTCCAGAConserved hypothetical protein.
AK119785TGTTGGGCTConserved hypothetical protein.
Os01g0506100AK102377ATCCAACGGGlobin-like family protein.
AK109825ATCCAACGGNONE
Os01g0511600012-053-F10AGCCCAACANONE
AK059042AGCCCAACANONE
AK072161AGCCCAACAConserved hypothetical protein.
J013132P06AGCCCAACANONE
Os01g0512200J013067C10ATCCCCCACAAGCCCAACTNONE
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE
012-094-B11AACGGGCCCGGCCCATGNONE
015-096-C04AACGGGCCCGGCCCATGNONE
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein.
AK099005AACGGGCCCGGCCCATGNONE
J013109B04AACGGGCCCGGCCCATGNONE
J033057L14AACGGGCCCGGCCCATGNONE
J090072H04AACGGGCCCGGCCCATGNONE
J100030A14AACGGGCCCGGCCCATGNONE
Os01g0530366J075001P06AACGGGCCCAGTTNONE
J075001P06GCCGGCCCATATAACGGGCCNONE
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein.
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein.
J075030G13AACGGGCCCAGTTNONE
J075030G13GCCGGCCCATATAACGGGCCNONE
Os01g0530400016-019-E07AAGGCCCAACNONE
AK103724AAGGCCCAACNONE
AK106476AAGGCCCAACGlutaredoxin-related protein family protein.
J023108F14AAGGCCCAACNONE
J033138C10AAGGCCCAACNONE
Os01g0546900AK073801GAGGCCCAACCTranscription factor jumonji/aspartyl beta-hydroxylase domain containing protein.
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE
009-183-B08CCCAGCCCGGCCCAACCNONE
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein.
AK106034CCCAGCCCGGCCCAACCNONE
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE
006-120-G12CCACCAACNONE
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE
J013100N20CCACCAACNONE
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE
J033043P09CCACCAACNONE
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE
J033125M18CCACCAACNONE
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE
J053043N11CCACCAACNONE
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE
J065008E07CCACCAACNONE
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE
J065080O16CCACCAACNONE
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE
J075002G24CCACCAACNONE
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE
J075123C09CCACCAACNONE
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1.
S66160CCACCAACRas-related protein RIC1.
Os01g0571300016-074-C10CCAACGGCNONE
AK064271CCAACGGCSimilar to Heat shock transcription factor 31 (Fragment).
Os01g0578000AK060971ATCCAACGRecA bacterial DNA recombination family protein.
AK060971ATCCAACGGTCRecA bacterial DNA recombination family protein.
AK068701ATCCAACGNONE
AK068701ATCCAACGGTCNONE
J090025J16ATCCAACGNONE
J090025J16ATCCAACGGTCNONE
Os01g0581300AK066182GGGGCCCAACSimilar to Lycopene epsilon-cyclase (Fragment).
AK072015GGGGCCCAACNONE
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase.
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE
Os01g0585400AK103584GGCCGTTGGConserved hypothetical protein.
J033133B01GGCCGTTGGNONE
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE
AJ251563CCAGGCCCAACCAAGCCCACGGNONE
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel.
AK104055CCAGGCCCAACCAAGCCCACGGNONE
AK104419CCAGGCCCAACCAAGCCCACGGNONE
J023057A07CCAGGCCCAACCAAGCCCACGGNONE
J023068C08CCAGGCCCAACCAAGCCCACGGNONE
J023148E24CCAGGCCCAACCAAGCCCACGGNONE
J090045O22CCAGGCCCAACCAAGCCCACGGNONE
J090045P03CCAGGCCCAACCAAGCCCACGGNONE
J090050C18CCAGGCCCAACCAAGCCCACGGNONE
J100023F01CCAGGCCCAACCAAGCCCACGGNONE
J100051I18CCAGGCCCAACCAAGCCCACGGNONE
J100060P17CCAGGCCCAACCAAGCCCACGGNONE
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE
012-005-A05GTTGGGCCGGGGCCCATTANONE
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein.
AK099235GTTGGGCCGGGGCCCATTANONE
AK105022GTTGGGCCGGGGCCCATTANONE
J065030D21GTTGGGCCGGGGCCCATTANONE
J065031C10GTTGGGCCGGGGCCCATTANONE
J065105A22GTTGGGCCGGGGCCCATTANONE
J065173M19GTTGGGCCGGGGCCCATTANONE
J075188F15GTTGGGCCGGGGCCCATTANONE
J090050C15GTTGGGCCGGGGCCCATTANONE
J100058K07GTTGGGCCGGGGCCCATTANONE
Os01g0590300014-089-E04AGCCCAACANONE
AK063740AGCCCAACAConserved hypothetical protein.
Os01g0596700AK107371AACGGGCCCCACGFBD domain containing protein.
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein.
J013094O21AAATGGGCCGAGCCCAACTNONE
Os01g0604700012-002-G04GTTGGTGGNONE
AK063423GTTGGTGGNONE
AK071681GTTGGTGGConserved hypothetical protein.
Os01g0611000003-117-E07GGCCCGTTNONE
006-051-D01GGCCCGTTNONE
006-085-B10GGCCCGTTNONE
012-092-F03GGCCCGTTNONE
AK060682GGCCCGTTNONE
AK072500GGCCCGTTSimilar to Unidentified precursor.
AK105921GGCCCGTTNONE
J023001D07GGCCCGTTNONE
J023075J23GGCCCGTTNONE
J023127H12GGCCCGTTNONE
J033024H20GGCCCGTTNONE
J033025H03GGCCCGTTNONE
J065057F11GGCCCGTTNONE
J065096C07GGCCCGTTNONE
J065103A08GGCCCGTTNONE
J065137L11GGCCCGTTNONE
J065179I16GGCCCGTTNONE
J065197P22GGCCCGTTNONE
J075089M08GGCCCGTTNONE
J090008N14GGCCCGTTNONE
J090011K16GGCCCGTTNONE
J090075K24GGCCCGTTNONE
J090079E08GGCCCGTTNONE
Os01g0618200AK102319CCACCAACProtein phosphatase 2C family protein.
AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein.
Os01g0618500011-019-D03ATTGGGCCAGGTTGGGCCATNONE
AK067476ATTGGGCCAGGTTGGGCCATSimilar to RNA helicase (Fragment).
J013020E19ATTGGGCCAGGTTGGGCCATNONE
J033046J12ATTGGGCCAGGTTGGGCCATNONE
J033055D06ATTGGGCCAGGTTGGGCCATNONE
Os01g0620100AK070122ACAGCCCAACTWD40-like domain containing protein.
J023044A10ACAGCCCAACTNONE
J033023C13ACAGCCCAACTNONE
J033045E16ACAGCCCAACTNONE
J033111H03ACAGCCCAACTNONE
Os01g0621700AK108938GACGGCCCAACCMyosin tail 2 domain containing protein.
J100033P13GACGGCCCAACCNONE
Os01g0623900J090025M21CAACGGCCNONE
J090082F22CAACGGCCNONE
J090084L02CAACGGCCSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein).
Os01g0636500012-066-G03GGGGCCCGTTNONE
AK073853GGGGCCCGTTSimilar to Polygalacturonase PG2.
AK104990GGGGCCCGTTNONE
J033072D05GGGGCCCGTTNONE
Os01g0637600AK106980CGCACCGCCAACGGCCSimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase).
Os01g0639600005-018-A02CCAACGGCNONE
AK067056CCAACGGCProtein of unknown function DUF1645 family protein.
J013066M03CCAACGGCNONE
J013066O05CCAACGGCNONE
J013088M21CCAACGGCNONE
J065045F04CCAACGGCNONE
J080018F22CCAACGGCNONE
J080037B10CCAACGGCNONE
J080042G23CCAACGGCNONE
J080052B21CCAACGGCNONE
J080060H13CCAACGGCNONE
J100024A05CCAACGGCNONE
J100071A09CCAACGGCNONE
J100080K14CCAACGGCNONE
Os01g0640800AK065688TCTGGCCCGTTConserved hypothetical protein 48 family protein.
J013042L10TCTGGCCCGTTNONE
J013121H08TCTGGCCCGTTNONE
Os01g0649000AK073564TCGGCCCAACGGCCWD40-like domain containing protein.
Os01g0654500013-057-E05GCCCACCAACNONE
AF155333GCCCACCAACNONE
AK061752GCCCACCAACSimilar to NADP-isocitrate dehydrogenase.
D21069GCCCACCAACNONE
Os01g0658500AK058491GCCGTTGGAProtein of unknown function DUF852, eukaryotic family protein.
AK058491GCGGGCCCAACProtein of unknown function DUF852, eukaryotic family protein.
AK069050GCCGTTGGANONE
AK069050GCGGGCCCAACNONE
J043036P22GCCGTTGGANONE
J043036P22GCGGGCCCAACNONE
Os01g0663400016-054-B01GCCGTTGGNONE
AK072283GCCGTTGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-).
AK072645GCCGTTGGNONE
J065180A21GCCGTTGGNONE
J075026E13GCCGTTGGNONE
J075109M23GCCGTTGGNONE
J075151A02GCCGTTGGNONE
J090004B07GCCGTTGGNONE
J090023O22GCCGTTGGNONE
J090054G09GCCGTTGGNONE
J090058H13GCCGTTGGNONE
J090076G13GCCGTTGGNONE
J100057F11GCCGTTGGNONE
Os01g0665200012-014-E12CCACCAACNONE
AK072082CCACCAACSimilar to Blast and wounding induced mitogen-activated protein kinase.
J013000P12CCACCAACNONE
J013074J01CCACCAACNONE
J013147E15CCACCAACNONE
J023003P12CCACCAACNONE
J023126F21CCACCAACNONE
J033028H14CCACCAACNONE
J033034L22CCACCAACNONE
Os01g0674150J065197O06GTTGGTGGNONE
J065199N24GTTGGTGGNONE
J090055L03GTTGGTGGConserved hypothetical protein.
Os01g0678400006-114-H04CCAACGGCNONE
AK106072CCAACGGCConserved hypothetical protein.
Os01g0678500AB071014TTGGCCCAACNONE
AB100696TTGGCCCAACSimilar to Two-pore calcium channel.
AK067839TTGGCCCAACNONE
AK100998TTGGCCCAACNONE
J013089O09TTGGCCCAACNONE
J013126J24TTGGCCCAACNONE
J013146L16TTGGCCCAACNONE
J013160D06TTGGCCCAACNONE
J090067N19TTGGCCCAACNONE
J090070E11TTGGCCCAACNONE
Os01g0680500AK069325ATATGGGCTCGTTGGATConserved hypothetical protein.
J090003P06ATATGGGCTCGTTGGATNONE
Os01g0684900AK102052CAACGGCCMulti antimicrobial extrusion protein MatE family protein.
J033082B20CAACGGCCNONE
J100084N08CAACGGCCNONE
Os01g0685900AK064024AACGGGCCNONE
AK102005AACGGGCCSimilar to 65kD microtubule associated protein.
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein.
Os01g0692200AK111036GACCGTTGConserved hypothetical protein.
Os01g0701900AK066793CAACGGCTSimilar to Phosphatidylinositol transfer-like protein III.
Os01g0704700AK100296GGCCCGTTSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2.
Os01g0707300AK059962TAAGCCCAACANONE
AK059962TGTTGGGCCTTNONE
AK104463TAAGCCCAACASimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13).
AK104463TGTTGGGCCTTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13).
Os01g0708300AK060040CCACCAACNONE
Os01g0708600AK111377AGCCCAACTTransport protein particle (TRAPP) component, Bet3 family protein.
J065006D07AGCCCAACTNONE
J065007E03AGCCCAACTNONE
J065015A13AGCCCAACTNONE
J065093J17AGCCCAACTNONE
J065116C09AGCCCAACTNONE
J065120E04AGCCCAACTNONE
J065197I17AGCCCAACTNONE
J065208L13AGCCCAACTNONE
J065213P07AGCCCAACTNONE
J075056K07AGCCCAACTNONE
J090036L08AGCCCAACTNONE
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein.
Os01g0709500016-042-H01CCACCAACNONE
AK065353CCACCAACNONE
AK105743CCACCAACNONE
AK121129CCACCAACSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1).
J023075E10CCACCAACNONE
J023106N12CCACCAACNONE
J043016L01CCACCAACNONE
J043026D20CCACCAACNONE
J065086G18CCACCAACNONE
J065137B07CCACCAACNONE
J065202M22CCACCAACNONE
J065207I15CCACCAACNONE
J075038B04CCACCAACNONE
J075044E14CCACCAACNONE
J075120G21CCACCAACNONE
J075149O14CCACCAACNONE
J090003L12CCACCAACNONE
J090006B04CCACCAACNONE
J090009F02CCACCAACNONE
J090014L16CCACCAACNONE
J090017A05CCACCAACNONE
J090018H23CCACCAACNONE
J090039P04CCACCAACNONE
J090058F13CCACCAACNONE
J090077H07CCACCAACNONE
J090084F06CCACCAACNONE
J090091H18CCACCAACNONE
J090097F01CCACCAACNONE
Os01g0710800013-097-E05AGCCGTTGGATNONE
013-097-E05GGTTGGGCTTGAAGCCCAACNONE
AK069973AGCCGTTGGATNONE
AK069973GGTTGGGCTTGAAGCCCAACNONE
AK071099AGCCGTTGGATConserved hypothetical protein.
AK071099GGTTGGGCTTGAAGCCCAACConserved hypothetical protein.
J023081K01AGCCGTTGGATNONE
J023081K01GGTTGGGCTTGAAGCCCAACNONE
J023123E16AGCCGTTGGATNONE
J023123E16GGTTGGGCTTGAAGCCCAACNONE
J033066B11AGCCGTTGGATNONE
J033066B11GGTTGGGCTTGAAGCCCAACNONE
J065144G11AGCCGTTGGATNONE
J065144G11GGTTGGGCTTGAAGCCCAACNONE
Os01g0713200006-029-E05GTTGGTGGNONE
006-033-F12GTTGGTGGNONE
006-035-C06GTTGGTGGNONE
006-035-G12GTTGGTGGNONE
006-043-B10GTTGGTGGNONE
006-051-D05GTTGGTGGNONE
006-051-E10GTTGGTGGNONE
006-054-E03GTTGGTGGNONE
006-061-A11GTTGGTGGNONE
006-062-A07GTTGGTGGNONE
006-068-F08GTTGGTGGNONE
006-073-B03GTTGGTGGNONE
006-076-C11GTTGGTGGNONE
006-083-D09GTTGGTGGNONE
006-085-B02GTTGGTGGNONE
006-086-H06GTTGGTGGNONE
006-091-E02GTTGGTGGNONE
006-097-A03GTTGGTGGNONE
006-097-D10GTTGGTGGNONE
006-104-A10GTTGGTGGNONE
006-104-E10GTTGGTGGNONE
006-106-C05GTTGGTGGNONE
006-120-F10GTTGGTGGNONE
009-048-C12GTTGGTGGNONE
AB027429GTTGGTGGNONE
AB027430GTTGGTGGNONE
AF030167GTTGGTGGNONE
AK060113GTTGGTGGNONE
AK060862GTTGGTGGSimilar to Beta-glucanase.
AK104472GTTGGTGGNONE
J065057A22GTTGGTGGNONE
J065102D04GTTGGTGGNONE
J065104C05GTTGGTGGNONE
J065199P19GTTGGTGGNONE
J075072E03GTTGGTGGNONE
J100017N05GTTGGTGGNONE
J100021K10GTTGGTGGNONE
J100024L11GTTGGTGGNONE
J100040H13GTTGGTGGNONE
J100070H04GTTGGTGGNONE
J100071I09GTTGGTGGNONE
J100074P15GTTGGTGGNONE
J100086F19GTTGGTGGNONE
Os01g0714800AK108555ATCCAACGWRKY transcription factor 26.
AY870609ATCCAACGNONE
Os01g0715800011-061-G06TGTTGGGCCTTNONE
AK063369TGTTGGGCCTTConserved hypothetical protein.
J065194O22TGTTGGGCCTTNONE
Os01g0716200AK062106AGCCGTTGGAIQ calmodulin-binding region domain containing protein.
AK098920AGCCGTTGGANONE
J013002N06AGCCGTTGGANONE
J013050O19AGCCGTTGGANONE
J013074N19AGCCGTTGGANONE
J013127F17AGCCGTTGGANONE
J013155C17AGCCGTTGGANONE
J013158K07AGCCGTTGGANONE
J053086D01AGCCGTTGGANONE
Os01g0722700AK069917CAACGGCTSimilar to Hexokinase.
Os01g0730900AK120751GTTGGTGGCGTCGCGTCChaperonin clpA/B family protein.
J023004P12GTTGGTGGCGTCGCGTCNONE
J065006G23GTTGGTGGCGTCGCGTCNONE
Os01g0734800003-125-B01CCGTTGGANONE
006-091-B09CCGTTGGANONE
AK061830CCGTTGGANONE
AK102415CCGTTGGAUDP-glucuronosyl/UDP-glucosyltransferase family protein.
J013023J06CCGTTGGANONE
J033028I18CCGTTGGANONE
J033060I01CCGTTGGANONE
J033093B13CCGTTGGANONE
J033148I15CCGTTGGANONE
J043009M12CCGTTGGANONE
J100033P04CCGTTGGANONE
J100037L12CCGTTGGANONE
J100047A08CCGTTGGANONE
J100079D19CCGTTGGANONE
Os01g0742400AK109885AGTTGGGCCTTNONE
AK119360AGTTGGGCCTTNONE
AK120741AGTTGGGCCTTProtein kinase-like domain containing protein.
J023003P18AGTTGGGCCTTNONE
Os01g0744400AK067648CCACCAACConserved hypothetical protein.
Os01g0748600AK104674GTTGGTGGNONE
Os01g0749400AK064990AGCCCAACCNONE
AK067731AGCCCAACCHAD-superfamily hydrolase subfamily IIB protein.
AK103775AGCCCAACCNONE
J023001B06AGCCCAACCNONE
Os01g0751600AK108569GACCGTTGConserved hypothetical protein.
J075117H02GACCGTTGNONE
J075172C03GACCGTTGNONE
Os01g0752300AK121755GGCCCGTTSimilar to 60S ribosomal protein L18a-1.
J013049F10GGCCCGTTNONE
J013088L10GGCCCGTTNONE
J023020B21GGCCCGTTNONE
J023038M01GGCCCGTTNONE
J033058H15GGCCCGTTNONE
J033088C04GGCCCGTTNONE
J033115N19GGCCCGTTNONE
J033131H04GGCCCGTTNONE
J065067E05GGCCCGTTNONE
J065085C07GGCCCGTTNONE
J065095D12GGCCCGTTNONE
J065124B19GGCCCGTTNONE
J065181H07GGCCCGTTNONE
J065197B09GGCCCGTTNONE
J075090K22GGCCCGTTNONE
J075101P17GGCCCGTTNONE
J075181F13GGCCCGTTNONE
J075190H19GGCCCGTTNONE
J090004P17GGCCCGTTNONE
J090066I03GGCCCGTTNONE
Os01g0756200AK108553CCACCAACSimilar to VirE2-interacting protein VIP1.
Os01g0757400AB110177GCCGGCCCCACCAACNONE
AB110177GCGGGCCCCACCAACNONE
AK058626GCCGGCCCCACCAACNONE
AK058626GCGGGCCCCACCAACNONE
AK102585GCCGGCCCCACCAACNONE
AK102585GCGGGCCCCACCAACNONE
AK105474GCCGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
AK105474GCGGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2.
J033098E22GCCGGCCCCACCAACNONE
J033098E22GCGGGCCCCACCAACNONE
J033105O19GCCGGCCCCACCAACNONE
J033105O19GCGGGCCCCACCAACNONE
J065019C21GCCGGCCCCACCAACNONE
J065019C21GCGGGCCCCACCAACNONE
J090082H11GCCGGCCCCACCAACNONE
J090082H11GCGGGCCCCACCAACNONE
J100050B19GCCGGCCCCACCAACNONE
J100050B19GCGGGCCCCACCAACNONE
J100078H19GCCGGCCCCACCAACNONE
J100078H19GCGGGCCCCACCAACNONE
Os01g0757700AK102734ATCCAACGConserved hypothetical protein.
J033106B06ATCCAACGNONE
J065025B07ATCCAACGNONE
J065025B08ATCCAACGNONE
J065033E12ATCCAACGNONE
J065197B01ATCCAACGNONE
Os01g0761100AK122112GCGGCCCAACATesmin/TSO1-like, CXC domain containing protein.
Os01g0764000006-021-G03GACGGCCCACCCACCAACNONE
006-025-C07GACGGCCCACCCACCAACNONE
006-029-G11GACGGCCCACCCACCAACNONE
006-030-C04GACGGCCCACCCACCAACNONE
006-035-E05GACGGCCCACCCACCAACNONE
006-037-G01GACGGCCCACCCACCAACNONE
006-038-C01GACGGCCCACCCACCAACNONE
006-039-G05GACGGCCCACCCACCAACNONE
006-042-E11GACGGCCCACCCACCAACNONE
006-044-H04GACGGCCCACCCACCAACNONE
006-045-A10GACGGCCCACCCACCAACNONE
006-045-C05GACGGCCCACCCACCAACNONE
006-047-A11GACGGCCCACCCACCAACNONE
006-048-H10GACGGCCCACCCACCAACNONE
006-050-C01GACGGCCCACCCACCAACNONE
006-050-H11GACGGCCCACCCACCAACNONE
006-051-G10GACGGCCCACCCACCAACNONE
006-051-G11GACGGCCCACCCACCAACNONE
006-056-B04GACGGCCCACCCACCAACNONE
006-063-F04GACGGCCCACCCACCAACNONE
006-063-H12GACGGCCCACCCACCAACNONE
006-065-G09GACGGCCCACCCACCAACNONE
006-067-F11GACGGCCCACCCACCAACNONE
006-073-D10GACGGCCCACCCACCAACNONE
006-074-G09GACGGCCCACCCACCAACNONE
006-075-D04GACGGCCCACCCACCAACNONE
006-077-C10GACGGCCCACCCACCAACNONE
006-082-A10GACGGCCCACCCACCAACNONE
006-084-C12GACGGCCCACCCACCAACNONE
006-085-F05GACGGCCCACCCACCAACNONE
006-087-H12GACGGCCCACCCACCAACNONE
006-092-E10GACGGCCCACCCACCAACNONE
006-094-C06GACGGCCCACCCACCAACNONE
006-096-G11GACGGCCCACCCACCAACNONE
006-097-H11GACGGCCCACCCACCAACNONE
006-101-A07GACGGCCCACCCACCAACNONE
006-101-G08GACGGCCCACCCACCAACNONE
006-110-E08GACGGCCCACCCACCAACNONE
006-111-D04GACGGCCCACCCACCAACNONE
006-116-H04GACGGCCCACCCACCAACNONE
AK058894GACGGCCCACCCACCAACNONE
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi).
AK099142GACGGCCCACCCACCAACNONE
J013119N15GACGGCCCACCCACCAACNONE
J013123P15GACGGCCCACCCACCAACNONE
J023055F24GACGGCCCACCCACCAACNONE
J023125K17GACGGCCCACCCACCAACNONE
J053050A20GACGGCCCACCCACCAACNONE
J053056P10GACGGCCCACCCACCAACNONE
J053074D19GACGGCCCACCCACCAACNONE
J053078A14GACGGCCCACCCACCAACNONE
J053086P10GACGGCCCACCCACCAACNONE
J053094N23GACGGCCCACCCACCAACNONE
J053095M23GACGGCCCACCCACCAACNONE
J065006D02GACGGCCCACCCACCAACNONE
J065030A17GACGGCCCACCCACCAACNONE
J065030K04GACGGCCCACCCACCAACNONE
J065035L12GACGGCCCACCCACCAACNONE
J065046E12GACGGCCCACCCACCAACNONE
J065065H19GACGGCCCACCCACCAACNONE
J065073C01GACGGCCCACCCACCAACNONE
J065105F01GACGGCCCACCCACCAACNONE
J065131N16GACGGCCCACCCACCAACNONE
J065144O13GACGGCCCACCCACCAACNONE
J065160E12GACGGCCCACCCACCAACNONE
J065160K02GACGGCCCACCCACCAACNONE
J065163F09GACGGCCCACCCACCAACNONE
J065165E18GACGGCCCACCCACCAACNONE
J065174E04GACGGCCCACCCACCAACNONE
J065175O08GACGGCCCACCCACCAACNONE
J065191N24GACGGCCCACCCACCAACNONE
J065193D19GACGGCCCACCCACCAACNONE
J065198D04GACGGCCCACCCACCAACNONE
J065200G09GACGGCCCACCCACCAACNONE
J075016L06GACGGCCCACCCACCAACNONE
J075017J11GACGGCCCACCCACCAACNONE
J075019L08GACGGCCCACCCACCAACNONE
J075028M08GACGGCCCACCCACCAACNONE
J075029K05GACGGCCCACCCACCAACNONE
J075039K04GACGGCCCACCCACCAACNONE
J075047J22GACGGCCCACCCACCAACNONE
J075079H13GACGGCCCACCCACCAACNONE
J075095K14GACGGCCCACCCACCAACNONE
J075111D21GACGGCCCACCCACCAACNONE
J075131A19GACGGCCCACCCACCAACNONE
J075147G20GACGGCCCACCCACCAACNONE
J075158F11GACGGCCCACCCACCAACNONE
J075166N10GACGGCCCACCCACCAACNONE
J075196G09GACGGCCCACCCACCAACNONE
J075198I24GACGGCCCACCCACCAACNONE
J090001L08GACGGCCCACCCACCAACNONE
J090026G07GACGGCCCACCCACCAACNONE
J090050M15GACGGCCCACCCACCAACNONE
J090071A01GACGGCCCACCCACCAACNONE
J090072P16GACGGCCCACCCACCAACNONE
J090078D22GACGGCCCACCCACCAACNONE
J090089C18GACGGCCCACCCACCAACNONE
J100019B07GACGGCCCACCCACCAACNONE
J100019H15GACGGCCCACCCACCAACNONE
J100019P09GACGGCCCACCCACCAACNONE
J100023A16GACGGCCCACCCACCAACNONE
J100023B09GACGGCCCACCCACCAACNONE
J100026O18GACGGCCCACCCACCAACNONE
J100027E09GACGGCCCACCCACCAACNONE
J100028F22GACGGCCCACCCACCAACNONE
J100029P05GACGGCCCACCCACCAACNONE
J100031M19GACGGCCCACCCACCAACNONE
J100032A11GACGGCCCACCCACCAACNONE
J100036G19GACGGCCCACCCACCAACNONE
J100038E22GACGGCCCACCCACCAACNONE
J100040A12GACGGCCCACCCACCAACNONE
J100040L02GACGGCCCACCCACCAACNONE
J100043O13GACGGCCCACCCACCAACNONE
J100045E20GACGGCCCACCCACCAACNONE
J100046H18GACGGCCCACCCACCAACNONE
J100047E08GACGGCCCACCCACCAACNONE
J100050E08GACGGCCCACCCACCAACNONE
J100050P14GACGGCCCACCCACCAACNONE
J100051G10GACGGCCCACCCACCAACNONE
J100052L12GACGGCCCACCCACCAACNONE
J100056G24GACGGCCCACCCACCAACNONE
J100066B15GACGGCCCACCCACCAACNONE
J100068O15GACGGCCCACCCACCAACNONE
J100070J16GACGGCCCACCCACCAACNONE
J100074I22GACGGCCCACCCACCAACNONE
J100075M12GACGGCCCACCCACCAACNONE
J100077M09GACGGCCCACCCACCAACNONE
J100077O14GACGGCCCACCCACCAACNONE
J100079J08GACGGCCCACCCACCAACNONE
J100080I16GACGGCCCACCCACCAACNONE
Os01g0765000AK101905AGCCCAACGGCCSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase).
AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase).
J065061M19GGCCGTTGNONE
Os01g0766600AK061986ATCCAACGGNONE
AK103570ATCCAACGGBSD domain containing protein.
Os01g0773700003-115-A05TTGGCCCAACTNONE
009-016-C08TTGGCCCAACTNONE
009-027-A08TTGGCCCAACTNONE
009-038-C02TTGGCCCAACTNONE
009-087-D04TTGGCCCAACTNONE
009-119-A01TTGGCCCAACTNONE
009-125-D06TTGGCCCAACTNONE
009-129-B06TTGGCCCAACTNONE
009-136-G07TTGGCCCAACTNONE
009-141-D09TTGGCCCAACTNONE
009-149-C06TTGGCCCAACTNONE
009-149-G03TTGGCCCAACTNONE
009-149-H06TTGGCCCAACTNONE
009-151-C05TTGGCCCAACTNONE
009-153-D08TTGGCCCAACTNONE
009-154-H12TTGGCCCAACTNONE
009-181-C03TTGGCCCAACTNONE
009-181-C06TTGGCCCAACTNONE
009-181-G02TTGGCCCAACTNONE
009-183-B06TTGGCCCAACTNONE
009-187-D09TTGGCCCAACTNONE
009-194-C07TTGGCCCAACTNONE
009-194-C10TTGGCCCAACTNONE
009-195-F10TTGGCCCAACTNONE
009-199-G07TTGGCCCAACTNONE
AK060438TTGGCCCAACTNONE
AK060476TTGGCCCAACTNONE
AK119161TTGGCCCAACTSimilar to Photosystem II reaction center W protein (PSII 6.1 kDa protein) (Fragment).
J013132H23TTGGCCCAACTNONE
J013158C16TTGGCCCAACTNONE
J023008K22TTGGCCCAACTNONE
J023012B02TTGGCCCAACTNONE
J065045L04TTGGCCCAACTNONE
J065046O07TTGGCCCAACTNONE
J065048G02TTGGCCCAACTNONE
J065060H11TTGGCCCAACTNONE
J065101B04TTGGCCCAACTNONE
J065148G21TTGGCCCAACTNONE
J065158L13TTGGCCCAACTNONE
J065180I22TTGGCCCAACTNONE
J075007F14TTGGCCCAACTNONE
J075047L09TTGGCCCAACTNONE
J075122H09TTGGCCCAACTNONE
J075175B12TTGGCCCAACTNONE
J075193A01TTGGCCCAACTNONE
J080303H08TTGGCCCAACTNONE
J080305O21TTGGCCCAACTNONE
J080306M22TTGGCCCAACTNONE
Os01g0781000006-077-C12GTTGGGCTTANONE
009-156-E02GTTGGGCTTANONE
AK059870GTTGGGCTTAVacuolar protein sorting-associated, VPS28 family protein.
AK099116GTTGGGCTTANONE
AK104274GTTGGGCTTANONE
J023034E12GTTGGGCTTANONE
J075074G06GTTGGGCTTANONE
J090041H03GTTGGGCTTANONE
J100045K08GTTGGGCTTANONE
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein.
Os01g0785700AK100774AGCCGTTGGGCCTGNONE
AK102081AGCCGTTGGGCCTGProtein prenyltransferase domain containing protein.
AY129829AGCCGTTGGGCCTGNONE
J023120B17AGCCGTTGGGCCTGNONE
J033082K10AGCCGTTGGGCCTGNONE
Os01g0785900AK071014GTTGGTGGZinc finger, C2H2-type domain containing protein.
AK104311GTTGGTGGNONE
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein.
Os01g0793300J065140J12GTTGGTGGTyrosinase family protein.
Os01g0798500006-106-C11AGTTGGGCTNONE
AK061244AGTTGGGCTNONE
AK068219AGTTGGGCTMalate synthase-like family protein.
J065199O16AGTTGGGCTNONE
Os01g0800300006-097-C12ATGGCCCAACCNONE
014-070-C12ATGGCCCAACCNONE
AK072549ATGGCCCAACCNONE
AK100942ATGGCCCAACCNONE
AK100951ATGGCCCAACCConserved hypothetical protein.
AK106023ATGGCCCAACCNONE
J023138D05ATGGCCCAACCNONE
J075097P16ATGGCCCAACCNONE
J075099F23ATGGCCCAACCNONE
Os01g0801700AK073813ATCCAACGGConserved hypothetical protein.
AK073813CGTTGGATConserved hypothetical protein.
J033067K14ATCCAACGGNONE
J033067K14CGTTGGATNONE
Os01g0805000009-045-H11CAACGGCCGGCTCGGNONE
009-196-H08CAACGGCCGGCTCGGNONE
J013094D22CAACGGCCGGCTCGGRibosomal protein L34 family protein.
J013119F23CAACGGCCGGCTCGGNONE
J065128B11CAACGGCCGGCTCGGNONE
Os01g0806200011-003-A04CCACCAACNONE
011-034-A08CCACCAACNONE
AK105235CCACCAACCyclin-like F-box domain containing protein.
J065053J03CCACCAACNONE
Os01g0806300AK111352CCGTTGGATConserved hypothetical protein.
Os01g0806400Os01g0806400CCACCAACProtein of unknown function DUF617, plant family protein.
Os01g0807000AK109751TGTTGGGCCCGConserved hypothetical protein.
Os01g0810100AK071916GTTGGGCCACACGRibonuclease III domain containing protein.
AK071916GTTGGTGGRibonuclease III domain containing protein.
AK099056GTTGGGCCACACGNONE
AK099056GTTGGTGGNONE
AK104320GTTGGGCCACACGNONE
AK104320GTTGGTGGNONE
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE
006-030-C07TGTTGGGCTGGGCCGGGNONE
006-068-F06TGTTGGGCTGGGCCGGGNONE
006-096-E09TGTTGGGCTGGGCCGGGNONE
006-097-B11TGTTGGGCTGGGCCGGGNONE
006-104-H02TGTTGGGCTGGGCCGGGNONE
AK062251TGTTGGGCTGGGCCGGGNONE
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1.
J013022G24TGTTGGGCTGGGCCGGGNONE
J013104C07TGTTGGGCTGGGCCGGGNONE
J023074M17TGTTGGGCTGGGCCGGGNONE
J043027C07TGTTGGGCTGGGCCGGGNONE
J065026K05TGTTGGGCTGGGCCGGGNONE
J065103I01TGTTGGGCTGGGCCGGGNONE
J090025M17TGTTGGGCTGGGCCGGGNONE
J100027L03TGTTGGGCTGGGCCGGGNONE
J100054I20TGTTGGGCTGGGCCGGGNONE
Os01g0816700AK100654GGCCGTTGGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase).
Os01g0817700006-112-C04TGTTGGGCCTGNONE
Os01g0823200AK066097CCACCAACConserved hypothetical protein.
J013056K15CCACCAACNONE
Os01g0825500AK060613AGTTGGGCTGGNONE
AK072321AGTTGGGCTGGNONE
AK103941AGTTGGGCTGGNodulin-like domain containing protein.
J075053A14AGTTGGGCTGGNONE
J075151J22AGTTGGGCTGGNONE
J075174K14AGTTGGGCTGGNONE
Os01g0826400AK107199CAACGGTCWRKY transcription factor 24 (WRKY24).
AK107199CCACCAACWRKY transcription factor 24 (WRKY24).
AY341849CAACGGTCNONE
AY341849CCACCAACNONE
AY676925CAACGGTCNONE
AY676925CCACCAACNONE
AY870608CAACGGTCNONE
AY870608CCACCAACNONE
Os01g0827400AK108526AGCCGTTGPrenylated rab acceptor PRA1 family protein.
J065099C03AGCCGTTGNONE
J075090E23AGCCGTTGNONE
Os01g0829266J065010C18TGTTGGGCCCATTANONE
J065037A22TGTTGGGCCCATTANONE
J065044B02TGTTGGGCCCATTAConserved hypothetical protein.
J065044B10TGTTGGGCCCATTANONE
J065051A06TGTTGGGCCCATTANONE
J065073E06TGTTGGGCCCATTANONE
J065074I11TGTTGGGCCCATTANONE
J065086D22TGTTGGGCCCATTANONE
J065104H10TGTTGGGCCCATTANONE
J065107C05TGTTGGGCCCATTANONE
J065124H16TGTTGGGCCCATTANONE
J065165F22TGTTGGGCCCATTANONE
J065169B11TGTTGGGCCCATTANONE
J065172G21TGTTGGGCCCATTANONE
J065191E05TGTTGGGCCCATTANONE
J065191F18TGTTGGGCCCATTANONE
Os01g0831300AK109023CCACCAACSimilar to Ammonium transporter.
Os01g0833000AK067226CCAGCCCAACAProtein prenyltransferase domain containing protein.
J013098M23CCAGCCCAACANONE
Os01g0836400AK073540GTTGGGCCTGSAC3/GANP family protein.
AK073540TCAGGCCCGTTSAC3/GANP family protein.
J023019D11GTTGGGCCTGNONE
J023019D11TCAGGCCCGTTNONE
J023139O22GTTGGGCCTGNONE
J023139O22TCAGGCCCGTTNONE
J033042J20GTTGGGCCTGNONE
J033042J20TCAGGCCCGTTNONE
J033046M18GTTGGGCCTGNONE
J033046M18TCAGGCCCGTTNONE
J033124J09GTTGGGCCTGNONE
J033124J09TCAGGCCCGTTNONE
J090015E05GTTGGGCCTGNONE
J090015E05TCAGGCCCGTTNONE
J090076J09GTTGGGCCTGNONE
J090076J09TCAGGCCCGTTNONE
Os01g0836800006-021-C09ATCCAACGNONE
006-021-C09ATCCAACGGNONE
006-091-F04ATCCAACGNONE
006-091-F04ATCCAACGGNONE
014-013-D08ATCCAACGNONE
014-013-D08ATCCAACGGNONE
015-018-F10ATCCAACGNONE
015-018-F10ATCCAACGGNONE
015-058-H03ATCCAACGNONE
015-058-H03ATCCAACGGNONE
AK061720ATCCAACGNONE
AK061720ATCCAACGGNONE
AK066629ATCCAACGLung seven transmembrane receptor family protein.
AK066629ATCCAACGGLung seven transmembrane receptor family protein.
AK098958ATCCAACGNONE
AK098958ATCCAACGGNONE
AK106145ATCCAACGNONE
AK106145ATCCAACGGNONE
AK119783ATCCAACGNONE
AK119783ATCCAACGGNONE
J013063N02ATCCAACGNONE
J013063N02ATCCAACGGNONE
J013071A10ATCCAACGNONE
J013071A10ATCCAACGGNONE
J013124C08ATCCAACGNONE
J013124C08ATCCAACGGNONE
J023055J07ATCCAACGNONE
J023055J07ATCCAACGGNONE
J023081H15ATCCAACGNONE
J023081H15ATCCAACGGNONE
J023082D01ATCCAACGNONE
J023082D01ATCCAACGGNONE
J023091F07ATCCAACGNONE
J023091F07ATCCAACGGNONE
J023091L13ATCCAACGNONE
J023091L13ATCCAACGGNONE
J023104G05ATCCAACGNONE
J023104G05ATCCAACGGNONE
J023110M16ATCCAACGNONE
J023110M16ATCCAACGGNONE
J023120F18ATCCAACGNONE
J023120F18ATCCAACGGNONE
J023128O11ATCCAACGNONE
J023128O11ATCCAACGGNONE
J023140B11ATCCAACGNONE
J023140B11ATCCAACGGNONE
J033023B15ATCCAACGNONE
J033023B15ATCCAACGGNONE
J033025E14ATCCAACGNONE
J033025E14ATCCAACGGNONE
J033027J21ATCCAACGNONE
J033027J21ATCCAACGGNONE
J033041F19ATCCAACGNONE
J033041F19ATCCAACGGNONE
J033044L10ATCCAACGNONE
J033044L10ATCCAACGGNONE
J033052M08ATCCAACGNONE
J033052M08ATCCAACGGNONE
J033084P07ATCCAACGNONE
J033084P07ATCCAACGGNONE
J033086P11ATCCAACGNONE
J033086P11ATCCAACGGNONE
J033090I20ATCCAACGNONE
J033090I20ATCCAACGGNONE
J033093D17ATCCAACGNONE
J033093D17ATCCAACGGNONE
J033099C04ATCCAACGNONE
J033099C04ATCCAACGGNONE
J033108M19ATCCAACGNONE
J033108M19ATCCAACGGNONE
J033124O20ATCCAACGNONE
J033124O20ATCCAACGGNONE
J033145D24ATCCAACGNONE
J033145D24ATCCAACGGNONE
J033145O09ATCCAACGNONE
J033145O09ATCCAACGGNONE
J043016F03ATCCAACGNONE
J043016F03ATCCAACGGNONE
J043037C06ATCCAACGNONE
J043037C06ATCCAACGGNONE
J053095L22ATCCAACGNONE
J053095L22ATCCAACGGNONE
J053100E09ATCCAACGNONE
J053100E09ATCCAACGGNONE
J065023G19ATCCAACGNONE
J065023G19ATCCAACGGNONE
J065197D03ATCCAACGNONE
J065197D03ATCCAACGGNONE
J090003E23ATCCAACGNONE
J090003E23ATCCAACGGNONE
J090012P18ATCCAACGNONE
J090012P18ATCCAACGGNONE
J090019E14ATCCAACGNONE
J090019E14ATCCAACGGNONE
J090021B01ATCCAACGNONE
J090021B01ATCCAACGGNONE
J090022J10ATCCAACGNONE
J090022J10ATCCAACGGNONE
J090045L06ATCCAACGNONE
J090045L06ATCCAACGGNONE
J090050J02ATCCAACGNONE
J090050J02ATCCAACGGNONE
J090065F15ATCCAACGNONE
J090065F15ATCCAACGGNONE
J100018A06ATCCAACGNONE
J100018A06ATCCAACGGNONE
J100022K07ATCCAACGNONE
J100022K07ATCCAACGGNONE
J100036H01ATCCAACGNONE
J100036H01ATCCAACGGNONE
J100044I09ATCCAACGNONE
J100044I09ATCCAACGGNONE
J100057M17ATCCAACGNONE
J100057M17ATCCAACGGNONE
J100058O04ATCCAACGNONE
J100058O04ATCCAACGGNONE
J100079C21ATCCAACGNONE
J100079C21ATCCAACGGNONE
J100079G13ATCCAACGNONE
J100079G13ATCCAACGGNONE
Os01g0838300J090017B22AGTGGGCCGTTGNONE
J090017B22CCAAGCCCAACTNONE
J090061B04AGTGGGCCGTTGNONE
J090061B04CCAAGCCCAACTNONE
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein.
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE
Os01g0840100006-095-C03ATCCAACGNONE
006-095-C03GGTTGGGCTGCNONE
011-075-F07ATCCAACGNONE
011-075-F07GGTTGGGCTGCNONE
012-010-A08ATCCAACGNONE
012-010-A08GGTTGGGCTGCNONE
012-035-A09ATCCAACGNONE
012-035-A09GGTTGGGCTGCNONE
014-010-B01ATCCAACGNONE
014-010-B01GGTTGGGCTGCNONE
014-011-H07ATCCAACGNONE
014-011-H07GGTTGGGCTGCNONE
014-040-F03ATCCAACGNONE
014-040-F03GGTTGGGCTGCNONE
014-077-C11ATCCAACGNONE
014-077-C11GGTTGGGCTGCNONE
014-078-C11ATCCAACGNONE
014-078-C11GGTTGGGCTGCNONE
014-097-A10ATCCAACGNONE
014-097-A10GGTTGGGCTGCNONE
014-097-D02ATCCAACGNONE
014-097-D02GGTTGGGCTGCNONE
014-100-D02ATCCAACGNONE
014-100-D02GGTTGGGCTGCNONE
015-012-H01ATCCAACGNONE
015-012-H01GGTTGGGCTGCNONE
015-049-G07ATCCAACGNONE
015-049-G07GGTTGGGCTGCNONE
015-066-C09ATCCAACGNONE
015-066-C09GGTTGGGCTGCNONE
016-033-C09ATCCAACGHeat shock protein Hsp70 family protein.
016-033-C09GGTTGGGCTGCHeat shock protein Hsp70 family protein.
016-084-F08ATCCAACGNONE
016-084-F08GGTTGGGCTGCNONE
J023037O13ATCCAACGNONE
J023037O13GGTTGGGCTGCNONE
J033116B07ATCCAACGNONE
J033116B07GGTTGGGCTGCNONE
J033121N13ATCCAACGNONE
J033121N13GGTTGGGCTGCNONE
J065057F16ATCCAACGNONE
J065057F16GGTTGGGCTGCNONE
J065112D05ATCCAACGNONE
J065112D05GGTTGGGCTGCNONE
J065157G17ATCCAACGNONE
J065157G17GGTTGGGCTGCNONE
J090014O03ATCCAACGNONE
J090014O03GGTTGGGCTGCNONE
J090015K13ATCCAACGNONE
J090015K13GGTTGGGCTGCNONE
J090021I21ATCCAACGNONE
J090021I21GGTTGGGCTGCNONE
J090048D02ATCCAACGNONE
J090048D02GGTTGGGCTGCNONE
J090054D14ATCCAACGNONE
J090054D14GGTTGGGCTGCNONE
J090060J03ATCCAACGNONE
J090060J03GGTTGGGCTGCNONE
J090063G01ATCCAACGNONE
J090063G01GGTTGGGCTGCNONE
J090063H04ATCCAACGNONE
J090063H04GGTTGGGCTGCNONE
J090063L13ATCCAACGNONE
J090063L13GGTTGGGCTGCNONE
J090074E03ATCCAACGNONE
J090074E03GGTTGGGCTGCNONE
J090096A03ATCCAACGNONE
J090096A03GGTTGGGCTGCNONE
J090096I11ATCCAACGNONE
J090096I11GGTTGGGCTGCNONE
J090099E16ATCCAACGNONE
J090099E16GGTTGGGCTGCNONE
J100050G20ATCCAACGNONE
J100050G20GGTTGGGCTGCNONE
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment).
AK102882CCACCAACTGGGCCCCACANONE
AK103686CCACCAACTGGGCCCCACANONE
Os01g0847300AK071164GCCCACCAACProtein of unknown function DUF588 family protein.
AK104027GCCCACCAACNONE
Os01g0848300AK120668AGCCCATCAACGGTCProtein prenyltransferase domain containing protein.
AK120668TCAGCCCAACAProtein prenyltransferase domain containing protein.
Os01g0851000AK065338TGTTGGGCCTAPfkB domain containing protein.
Os01g0852200AK063954CCACCAACNONE
Os01g0853600AK107747AACGGGCCGTANONE
AK108628AACGGGCCGTANONE
AK120975AACGGGCCGTAConserved hypothetical protein.
J023041K02AACGGGCCGTANONE
Os01g0856000016-095-F09CCAACGGCNONE
AK107439CCAACGGCSimilar to CDC6 protein.
AK107451CCAACGGCNONE
Os01g0862200AK059299CCAACGGCCConserved hypothetical protein.
AK100818CCAACGGCCNONE
J023122F03CCAACGGCCNONE
Os01g0863166J065007F23AACGGGCCGTGNONE
J065007F23AACGGGCCGTGNONE
J065007F23CACGGCCCGTTNONE
J065124H21AACGGGCCGTGConserved hypothetical protein.
J065124H21AACGGGCCGTGConserved hypothetical protein.
J065124H21CACGGCCCGTTConserved hypothetical protein.
Os01g0864100AK064616GACCGTTGGAConserved hypothetical protein.
Os01g0866200009-039-E12ATCCAACGGTCNONE
J065059P16ATCCAACGGTCNONE
J065063E21ATCCAACGGTCNONE
J065078B21ATCCAACGGTCNONE
J065079A11ATCCAACGGTCNONE
J065087H15ATCCAACGGTCNONE
J065137M10ATCCAACGGTCNONE
J065138K24ATCCAACGGTCNONE
J065142E08ATCCAACGGTCNONE
J065171G11ATCCAACGGTCNONE
J065183K15ATCCAACGGTCNONE
J065192J05ATCCAACGGTCNONE
J075151P09ATCCAACGGTCNONE
J090020B17ATCCAACGGTCNONE
J090067F15ATCCAACGGTCNONE
J090070K06ATCCAACGGTCNONE
J090094G13ATCCAACGGTCNONE
J100081M20ATCCAACGGTCHistone H3.
J100089D06ATCCAACGGTCNONE
Os01g0866300006-087-C06ATCCAACGGTCNONE
006-114-E01ATCCAACGGTCNONE
J065202L13ATCCAACGGTCNONE
Os01g0866400AB007193CCGTTGGASimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment).
AF378183CCGTTGGANONE
AK070516CCGTTGGANONE
AK119536CCGTTGGANONE
J023057C24CCGTTGGANONE
J023078G07CCGTTGGANONE
J065015D23CCGTTGGANONE
J065050J17CCGTTGGANONE
J065058B03CCGTTGGANONE
J065119C16CCGTTGGANONE
J065134N01CCGTTGGANONE
J065174B10CCGTTGGANONE
J075046D04CCGTTGGANONE
J075172N05CCGTTGGANONE
Os01g0868300AB004461AGCCCAACSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7).
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein.
AK072312GTTGGGCCCACCTGGGCCTGGNONE
AK103428CCAACGGCNONE
AK103428GTTGGGCCCACCTGGGCCTGGNONE
Os01g0872000AK102239ATCCAACGGTGF-beta receptor, type I/II extracellular region family protein.
Os01g0876500J053026A07AGGGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J053076M17AGGGCCCAACCNONE
Os01g0880200AK105039GTTGGTGGNONE
Os01g0888700AK073376AGCCGTTGProtein of unknown function RIO1 family protein.
J033030B16AGCCGTTGNONE
J033098D06AGCCGTTGNONE
J033112A12AGCCGTTGNONE
J043003L24AGCCGTTGNONE
Os01g0896400AK107067AGCCGTTGConserved hypothetical protein.
AK107067CAACGGCTConserved hypothetical protein.
AK107067CCAACGGCCConserved hypothetical protein.
AK107067CCAACGGCTConserved hypothetical protein.
Os01g0897800AF140489CATCCCCCATCCAACGGCNONE
AK072409CATCCCCCATCCAACGGCNONE
AK072812CATCCCCCATCCAACGGCRad21/Rec8 like protein, N-terminal domain containing protein.
AK099099CATCCCCCATCCAACGGCNONE
AY288943CATCCCCCATCCAACGGCNONE
AY318757CATCCCCCATCCAACGGCNONE
J013021C23CATCCCCCATCCAACGGCNONE
J013027H03CATCCCCCATCCAACGGCNONE
J013032C02CATCCCCCATCCAACGGCNONE
J013068G13CATCCCCCATCCAACGGCNONE
J013070K16CATCCCCCATCCAACGGCNONE
J013070L02CATCCCCCATCCAACGGCNONE
J013091E15CATCCCCCATCCAACGGCNONE
J013109D04CATCCCCCATCCAACGGCNONE
J013118B04CATCCCCCATCCAACGGCNONE
J013129E08CATCCCCCATCCAACGGCNONE
J013134I15CATCCCCCATCCAACGGCNONE
J013146N16CATCCCCCATCCAACGGCNONE
J023083F05CATCCCCCATCCAACGGCNONE
J023107E17CATCCCCCATCCAACGGCNONE
J023113D21CATCCCCCATCCAACGGCNONE
J023123A22CATCCCCCATCCAACGGCNONE
J023133I24CATCCCCCATCCAACGGCNONE
J023134L21CATCCCCCATCCAACGGCNONE
J023142N24CATCCCCCATCCAACGGCNONE
J033051B12CATCCCCCATCCAACGGCNONE
J033058B04CATCCCCCATCCAACGGCNONE
J033068E24CATCCCCCATCCAACGGCNONE
J033076D01CATCCCCCATCCAACGGCNONE
J033088O06CATCCCCCATCCAACGGCNONE
J033093K15CATCCCCCATCCAACGGCNONE
J033101G18CATCCCCCATCCAACGGCNONE
J033130A01CATCCCCCATCCAACGGCNONE
J043027I17CATCCCCCATCCAACGGCNONE
J043027L17CATCCCCCATCCAACGGCNONE
J090001N13CATCCCCCATCCAACGGCNONE
J090004L10CATCCCCCATCCAACGGCNONE
J090027D08CATCCCCCATCCAACGGCNONE
J090027H18CATCCCCCATCCAACGGCNONE
J090031F16CATCCCCCATCCAACGGCNONE
J090048L18CATCCCCCATCCAACGGCNONE
J090050N08CATCCCCCATCCAACGGCNONE
J090051G05CATCCCCCATCCAACGGCNONE
J090063G03CATCCCCCATCCAACGGCNONE
J090068P21CATCCCCCATCCAACGGCNONE
J090072P21CATCCCCCATCCAACGGCNONE
J090079A14CATCCCCCATCCAACGGCNONE
J090086I20CATCCCCCATCCAACGGCNONE
J090087D19CATCCCCCATCCAACGGCNONE
J090099B06CATCCCCCATCCAACGGCNONE
J100047J19CATCCCCCATCCAACGGCNONE
J100058I06CATCCCCCATCCAACGGCNONE
Os01g0902300Os01g0902300ATCCAACGEsterase/lipase/thioesterase domain containing protein.
Os01g0907300015-031-F03TGTTGGGCCTANONE
AK103626TGTTGGGCCTAConserved hypothetical protein.
AK108617TGTTGGGCCTANONE
J013094D23TGTTGGGCCTANONE
J013106G24TGTTGGGCCTANONE
J013120M13TGTTGGGCCTANONE
J023056M16TGTTGGGCCTANONE
J023092M24TGTTGGGCCTANONE
J033133N22TGTTGGGCCTANONE
J043010O12TGTTGGGCCTANONE
Os01g0908100AK072293TGTTGGGCTTGRabGAP/TBC domain containing protein.
J065010B13TGTTGGGCTTGNONE
J065010M12TGTTGGGCTTGNONE
J065047C19TGTTGGGCTTGNONE
J065069B18TGTTGGGCTTGNONE
J065071K24TGTTGGGCTTGNONE
J065142P04TGTTGGGCTTGNONE
J065170E11TGTTGGGCTTGNONE
Os01g0916000015-035-A02GTTGGTGGNONE
AK106300GTTGGTGGConserved hypothetical protein.
J100028B12GTTGGTGGNONE
J100035N14GTTGGTGGNONE
J100042J01GTTGGTGGNONE
J100045K22GTTGGTGGNONE
J100054P19GTTGGTGGNONE
J100063O03GTTGGTGGNONE
J100066I09GTTGGTGGNONE
J100066K05GTTGGTGGNONE
J100072B04GTTGGTGGNONE
J100073K11GTTGGTGGNONE
J100078J18GTTGGTGGNONE
J100079L10GTTGGTGGNONE
J100080P17GTTGGTGGNONE
J100081E17GTTGGTGGNONE
J100085J05GTTGGTGGNONE
J100087N20GTTGGTGGNONE
Os01g0917100AK107234ATCCAACGGCTConserved hypothetical protein.
Os01g0925100AK120911CCACCAACConserved hypothetical protein.
J033022M17CCACCAACNONE
J065050H13CCACCAACNONE
J065137I09CCACCAACNONE
Os01g0926300AK067632CCACCAACSimilar to Transaldolase (EC 2.2.1.2).
AK072701CCACCAACNONE
AK104087CCACCAACNONE
AK105800CCACCAACNONE
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein.
AK120263AGTTGGGCCTTACTGGGCCGGTNONE
Os01g0933900006-115-F10CGTTGGATNONE
009-130-C11CGTTGGATNONE
009-183-F07CGTTGGATNONE
009-196-F08CGTTGGATNONE
012-078-H05CGTTGGATNONE
015-004-D01CGTTGGATNONE
015-083-F05CGTTGGATNONE
AF309383CGTTGGATSimilar to Glutathione transferase III(B) (EC 2.5.1.18).
AK059985CGTTGGATNONE
AK103927CGTTGGATNONE
J065026P12CGTTGGATNONE
J065041M20CGTTGGATNONE
J065043H06CGTTGGATNONE
J065049E19CGTTGGATNONE
J065097D10CGTTGGATNONE
J065143I07CGTTGGATNONE
J065152F10CGTTGGATNONE
J065163F22CGTTGGATNONE
J065166O17CGTTGGATNONE
J065188B21CGTTGGATNONE
J065197D18CGTTGGATNONE
J065198E06CGTTGGATNONE
J065199D17CGTTGGATNONE
J065212I10CGTTGGATNONE
J075001L04CGTTGGATNONE
J090051G02CGTTGGATNONE
J090074K01CGTTGGATNONE
Os01g0934300AK101422GACCGTTGNONE
J033038C07GACCGTTGNONE
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein.
Os01g0939700AK059803CAACGGCTNONE
AK070588CAACGGCTSimilar to Esterase D (EC 3.1.1.1).
AK111469CAACGGCTNONE
J090021L11CAACGGCTNONE
Os01g0949200AK102412ACCGGCCCAACTNONE
J033093A04ACCGGCCCAACTNONE
J065053P06ACCGGCCCAACTNONE
J100086D18ACCGGCCCAACTNONE
Os01g0951500J065043B20ATCCAACGCytochrome P450 family protein.
Os01g0952600AK067525GTTGGTGGGCTTANONE
AK070047GTTGGTGGGCTTASimilar to LacZ (Fragment).
Os01g0952700AK103457CCGTTGGATMetallo-dependent hydrolase, composite domain containing protein.
Os01g0954100009-087-G12TCTGGACCGTTGNONE
AK062680TCTGGACCGTTGConserved hypothetical protein.
Os01g0960400AK111512CCAAGCCCAACTProtein kinase-like domain containing protein.
Os01g0961200011-099-H06CTGGCCCACCAACNONE
AK105424CTGGCCCACCAACCBS domain containing protein.
J065169J18CTGGCCCACCAACNONE
J075109H12CTGGCCCACCAACNONE
Os01g0962400AK059165AGCCCAACCProtein of unknown function UPF0185 family protein.
J013157N02AGCCCAACCNONE
J065169F13AGCCCAACCNONE
J065192L21AGCCCAACCNONE
J075016P11AGCCCAACCNONE
J075023M14AGCCCAACCNONE
J075051K17AGCCCAACCNONE
J075053O05AGCCCAACCNONE
J075080D08AGCCCAACCNONE
J075080P04AGCCCAACCNONE
J075088B19AGCCCAACCNONE
J075137L06AGCCCAACCNONE
J100029C08AGCCCAACCNONE
J100067J09AGCCCAACCNONE
Os01g0962500AK073163CAACGGTCZinc finger, HIT-type domain containing protein.
AK105822CAACGGTCNONE
J033024I07CAACGGTCNONE
Os01g0963300AK067544CCACCAACSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1).
Os01g0963600006-037-F11CGTTGGATNONE
006-049-E01CGTTGGATNONE
006-115-A02CGTTGGATNONE
AK060804CGTTGGATABA/WDS induced protein family protein.
AK065858CGTTGGATNONE
AK104613CGTTGGATNONE
J013041E22CGTTGGATNONE
Os01g0966200009-079-H11TGTTGGGCCGTANONE
009-124-G10TGTTGGGCCGTANONE
AK058564TGTTGGGCCGTAProtein of unknown function YGGT family protein.
AK098935TGTTGGGCCGTANONE
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein.
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit).
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE
Os01g0972300009-034-G05GTCGGATCCAACGGNONE
AK062432GTCGGATCCAACGGDVL family protein.
Os01g0973500AK069546ATCCAACGGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-).
Os01g0976100AK069646AGTTGGGCTTGABC transporter, transmembrane region domain containing protein.
Os01g0976600AK072971GGCCGTGGCCGTTGGSimilar to Methlytransferase, UbiE/COQ5 family.
J023148G18GGCCGTGGCCGTTGGNONE
J075095H03GGCCGTGGCCGTTGGNONE
J090089M19GGCCGTGGCCGTTGGNONE
Os02g0100200AK121311ATCCAACGGCTSteroid nuclear receptor, ligand-binding domain containing protein.
Os02g0103000AK110906GCCGTTGGConserved hypothetical protein.
Os02g0104800AK070860AACGGGCCConserved hypothetical protein.
J023002G20AACGGGCCNONE
J023022J19AACGGGCCNONE
J023067K03AACGGGCCNONE
J023108G24AACGGGCCNONE
J033075B01AACGGGCCNONE
J033087I15AACGGGCCNONE
J065087I11AACGGGCCNONE
J065194E02AACGGGCCNONE
Os02g0115900AF006825ATCTCGGCCCGTTNONE
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein.
AK119653ATCTCGGCCCGTTNONE
Os02g0116600004-011-A08CCACCAACNONE
009-035-C03CCACCAACNONE
009-062-A03CCACCAACNONE
AK060881CCACCAACNONE
AK103434CCACCAACBasic helix-loop-helix dimerisation region bHLH domain containing protein.
AK104188CCACCAACNONE
J013058F02CCACCAACNONE
J023042N21CCACCAACNONE
J033129B02CCACCAACNONE
J075030L17CCACCAACNONE
J075048A07CCACCAACNONE
J075084E21CCACCAACNONE
J075138F20CCACCAACNONE
J075147H12CCACCAACNONE
J075149J07CCACCAACNONE
J075168F01CCACCAACNONE
J075196B10CCACCAACNONE
Os02g0119700AK108777AAAGCCCAACAProtein prenyltransferase domain containing protein.
AK108777TCTGGCCCAACCProtein prenyltransferase domain containing protein.
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS).
AK099931TGTTGGGCTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS).
Os02g0122000AK121653AACGGGCCSimilar to P18.
J023034M04AACGGGCCNONE
J033023M01AACGGGCCNONE
J033061I03AACGGGCCNONE
J033075B04AACGGGCCNONE
J065035D09AACGGGCCNONE
J065103D15AACGGGCCNONE
J065146O07AACGGGCCNONE
J065193L20AACGGGCCNONE
J090015G02AACGGGCCNONE
J090059G13AACGGGCCNONE
J090068F14AACGGGCCNONE
J090087H22AACGGGCCNONE
J100017D08AACGGGCCNONE
J100029H10AACGGGCCNONE
J100029I17AACGGGCCNONE
J100059H12AACGGGCCNONE
J100060H07AACGGGCCNONE
Os02g0123100011-014-B01CCACCAACNONE
012-013-G11CCACCAACNONE
016-011-A12CCACCAACNONE
AK063438CCACCAACNONE
AK064363CCACCAACNONE
AK101344CCACCAACSimilar to Cell division control protein 28 (EC 2.7.1.37).
X60375CCACCAACNONE
Os02g0124800AK058547ATCCAACGHypothetical protein.
Os02g0129900Os02g0129900TACGGCCCAACTPGAP1-like family protein.
Os02g0135000AK069693AGCCGTTGGAConserved hypothetical protein.
J023028F11AGCCGTTGGANONE
Os02g0139600AK107052CAACGGCCNONE
AK121266CAACGGCCSimilar to Dars-prov protein.
Os02g0141300AK067279CATCCACCACCAACGalactokinase family protein.
AK074020CATCCACCACCAACNONE
Os02g0148600AK059287GGCCGTTGGATConserved hypothetical protein.
Os02g0158400006-048-F06TGTTGGGCCGGGNONE
AK061569TGTTGGGCCGGGssDNA-binding transcriptional regulator family protein.
AK099479TGTTGGGCCGGGNONE
AK104768TGTTGGGCCGGGNONE
J013025B22TGTTGGGCCGGGNONE
J023009C03TGTTGGGCCGGGNONE
J033115N14TGTTGGGCCGGGNONE
J065036F05TGTTGGGCCGGGNONE
J065191K17TGTTGGGCCGGGNONE
J065202K16TGTTGGGCCGGGNONE
J075053E14TGTTGGGCCGGGNONE
J075101E04TGTTGGGCCGGGNONE
J075111C06TGTTGGGCCGGGNONE
J075137O04TGTTGGGCCGGGNONE
J075139E07TGTTGGGCCGGGNONE
J075143K07TGTTGGGCCGGGNONE
J075144K15TGTTGGGCCGGGNONE
J075164L14TGTTGGGCCGGGNONE
J075199D06TGTTGGGCCGGGNONE
J090010G24TGTTGGGCCGGGNONE
J090017C18TGTTGGGCCGGGNONE
J090066F01TGTTGGGCCGGGNONE
J090088G01TGTTGGGCCGGGNONE
Os02g0163500AK070929AGCCGTTGGAConserved hypothetical protein.
J065065O20AGCCGTTGGANONE
J065073E14AGCCGTTGGANONE
J065134J06AGCCGTTGGANONE
J075017I19AGCCGTTGGANONE
J075074A02AGCCGTTGGANONE
J075088N14AGCCGTTGGANONE
J075108F01AGCCGTTGGANONE
J075114M06AGCCGTTGGANONE
J075153E15AGCCGTTGGANONE
J075158D01AGCCGTTGGANONE
J075177K13AGCCGTTGGANONE
J075195G15AGCCGTTGGANONE
J075198A19AGCCGTTGGANONE
Os02g0163600AK068043AACGGGCCCGCConserved hypothetical protein.
J013131O20AACGGGCCCGCNONE
J065006E03AACGGGCCCGCNONE
Os02g0167700AK069128AAAAGCCCAACCGCCCACCTArmadillo-like helical domain containing protein.
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE
009-184-H07AGCCCAGCCCAACCNONE
009-199-D07AGCCCAGCCCAACCNONE
AK058292AGCCCAGCCCAACCNONE
AK120215AGCCCAGCCCAACCConserved hypothetical protein.
J013040G12AGCCCAGCCCAACCNONE
J065050N21AGCCCAGCCCAACCNONE
J065077O07AGCCCAGCCCAACCNONE
J065102G05AGCCCAGCCCAACCNONE
J065197A04AGCCCAGCCCAACCNONE
J075024L24AGCCCAGCCCAACCNONE
J075038K01AGCCCAGCCCAACCNONE
J075044L04AGCCCAGCCCAACCNONE
J075063D23AGCCCAGCCCAACCNONE
J075079P13AGCCCAGCCCAACCNONE
J075084G03AGCCCAGCCCAACCNONE
J075135G07AGCCCAGCCCAACCNONE
J075148D17AGCCCAGCCCAACCNONE
J075150F13AGCCCAGCCCAACCNONE
J075157F06AGCCCAGCCCAACCNONE
J090054A05AGCCCAGCCCAACCNONE
J090085O04AGCCCAGCCCAACCNONE
J100023C04AGCCCAGCCCAACCNONE
J100023H23AGCCCAGCCCAACCNONE
J100026A16AGCCCAGCCCAACCNONE
J100035K13AGCCCAGCCCAACCNONE
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein.
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE
Os02g0176400009-099-H11ACAGCCCAACCNONE
009-099-H11AGCCCAACCAGGGCCCAAATNONE
009-099-H11CCACCAACNONE
AK062746ACAGCCCAACCProtein of unknown function DUF872, eukaryotic family protein.
AK062746AGCCCAACCAGGGCCCAAATProtein of unknown function DUF872, eukaryotic family protein.
AK062746CCACCAACProtein of unknown function DUF872, eukaryotic family protein.
Os02g0179100AK058557TCCGGCCCAACAMetal-dependent phosphohydrolase, HD region domain containing protein.
J080311O10TCCGGCCCAACANONE
Os02g0180100005-013-B11GAGGCCCAACCNONE
AK067359GAGGCCCAACCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein.
AK104700GAGGCCCAACCNONE
J013090O22GAGGCCCAACCNONE
J013099P19GAGGCCCAACCNONE
J090041M21GAGGCCCAACCNONE
J090049C14GAGGCCCAACCNONE
Os02g0180700AK070746GGCCCGTTSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44).
Os02g0186500AK068056CCACCAACSimilar to Protein kinase-like protein.
AK099031CCACCAACNONE
J013111A12CCACCAACNONE
J013127K13CCACCAACNONE
J013132O11CCACCAACNONE
J023056A11CCACCAACNONE
J023078M08CCACCAACNONE
J033081F07CCACCAACNONE
J090079E24CCACCAACNONE
J090097I02CCACCAACNONE
Os02g0186700AK064492AAAGCCCAACTConserved hypothetical protein.
J065210K09AAAGCCCAACTNONE
J075006A17AAAGCCCAACTNONE
J075108C18AAAGCCCAACTNONE
J075153E08AAAGCCCAACTNONE
Os02g0188500AK102004CATCCCCCTCCAACGGCTNONE
AK106917CATCCCCCTCCAACGGCTUbiquitin domain containing protein.
J090039N13CATCCCCCTCCAACGGCTNONE
Os02g0190950J075001E02TTTTGGGCCCAACCConserved hypothetical protein.
J075117E23TTTTGGGCCCAACCNONE
J075117F23TTTTGGGCCCAACCNONE
J075144M12TTTTGGGCCCAACCNONE
J075145H10TTTTGGGCCCAACCNONE
J075186B15TTTTGGGCCCAACCNONE
Os02g0192700004-020-H12CCACCAACNONE
004-020-H12TAGGCCCAACCNONE
004-020-H12TTTCGGCCCAACANONE
006-024-H06CCACCAACNONE
006-024-H06TAGGCCCAACCNONE
006-024-H06TTTCGGCCCAACANONE
006-042-F06CCACCAACNONE
006-042-F06TAGGCCCAACCNONE
006-042-F06TTTCGGCCCAACANONE
006-050-D04CCACCAACNONE
006-050-D04TAGGCCCAACCNONE
006-050-D04TTTCGGCCCAACANONE
006-059-E10CCACCAACNONE
006-059-E10TAGGCCCAACCNONE
006-059-E10TTTCGGCCCAACANONE
006-070-B02CCACCAACNONE
006-070-B02TAGGCCCAACCNONE
006-070-B02TTTCGGCCCAACANONE
006-084-A09CCACCAACNONE
006-084-A09TAGGCCCAACCNONE
006-084-A09TTTCGGCCCAACANONE
006-114-E11CCACCAACNONE
006-114-E11TAGGCCCAACCNONE
006-114-E11TTTCGGCCCAACANONE
006-117-E05CCACCAACNONE
006-117-E05TAGGCCCAACCNONE
006-117-E05TTTCGGCCCAACANONE
009-126-D11CCACCAACNONE
009-126-D11TAGGCCCAACCNONE
009-126-D11TTTCGGCCCAACANONE
AK061629CCACCAACSimilar to Thioredoxin peroxidase.
AK061629TAGGCCCAACCSimilar to Thioredoxin peroxidase.
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase.
AK065909CCACCAACNONE
AK065909TAGGCCCAACCNONE
AK065909TTTCGGCCCAACANONE
J013043E11CCACCAACNONE
J013043E11TAGGCCCAACCNONE
J013043E11TTTCGGCCCAACANONE
J065038I09CCACCAACNONE
J065038I09TAGGCCCAACCNONE
J065038I09TTTCGGCCCAACANONE
J065078C12CCACCAACNONE
J065078C12TAGGCCCAACCNONE
J065078C12TTTCGGCCCAACANONE
J065122O14CCACCAACNONE
J065122O14TAGGCCCAACCNONE
J065122O14TTTCGGCCCAACANONE
J065198H04CCACCAACNONE
J065198H04TAGGCCCAACCNONE
J065198H04TTTCGGCCCAACANONE
Os02g0193600AK060499CCAAGCCCAACTMad3/BUB1 homology region 1 domain containing protein.
Os02g0194000015-020-A08GGTTGGGCCCAATNONE
AK064096GGTTGGGCCCAATMyb, DNA-binding domain containing protein.
J090092L06GGTTGGGCCCAATNONE
Os02g0202400AK107368GCCGTTGGTGGSimilar to Plastidial ADP-glucose transporter.
J075147G14GCCGTTGGTGGNONE
J090009K03GCCGTTGGTGGNONE
Os02g0205000AK060003AGCCGTTGNONE
AK060003TCCAACGGCNONE
AK060003TGTTGGGCTTTNONE
AK073514AGCCGTTGRibosomal protein L19 family protein.
AK073514TCCAACGGCRibosomal protein L19 family protein.
AK073514TGTTGGGCTTTRibosomal protein L19 family protein.
J065106I07AGCCGTTGNONE
J065106I07TCCAACGGCNONE
J065106I07TGTTGGGCTTTNONE
Os02g0205400AK101434ATCCAACGGCCWD40-like domain containing protein.
J043024M20ATCCAACGGCCNONE
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment).
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE
Os02g0209900Os02g0209900CGTTGGATSyntaxin/epimorphin family protein.
Os02g0218400AK068947CCAACGGCCUspA domain containing protein.
Os02g0220600AK061944ATCCAACGGElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma).
AK061944CAAGGCCCGTTElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma).
AK103901AAGGCCCAACANONE
AK103901AAGGCCCATTTCAGCCCAACANONE
AK103901GGCCCGTTACAGCCCAACANONE
AK104946ATCCAACGGNONE
AK104946CAAGGCCCGTTNONE
D89802ATCCAACGGNONE
D89802CAAGGCCCGTTNONE
J013042L22ATCCAACGGNONE
J013042L22CAAGGCCCGTTNONE
J013056A14ATCCAACGGNONE
J013056A14CAAGGCCCGTTNONE
J013058O03AAGGCCCAACANONE
J013058O03AAGGCCCATTTCAGCCCAACANONE
J013058O03GGCCCGTTACAGCCCAACANONE
J013120G13ATCCAACGGNONE
J013120G13CAAGGCCCGTTNONE
J013124E21AAGGCCCAACANONE
J013124E21AAGGCCCATTTCAGCCCAACANONE
J013124E21GGCCCGTTACAGCCCAACANONE
J013155K19ATCCAACGGNONE
J013155K19CAAGGCCCGTTNONE
J023002B10ATCCAACGGNONE
J023002B10CAAGGCCCGTTNONE
J023023L03AAGGCCCAACANONE
J023023L03AAGGCCCATTTCAGCCCAACANONE
J023023L03GGCCCGTTACAGCCCAACANONE
J023023L21AAGGCCCAACANONE
J023023L21AAGGCCCATTTCAGCCCAACANONE
J023023L21GGCCCGTTACAGCCCAACANONE
J023061N01AAGGCCCAACANONE
J023061N01AAGGCCCATTTCAGCCCAACANONE
J023061N01GGCCCGTTACAGCCCAACANONE
J023065O09AAGGCCCAACANONE
J023065O09AAGGCCCATTTCAGCCCAACANONE
J023065O09GGCCCGTTACAGCCCAACANONE
J023080J19ATCCAACGGNONE
J023080J19CAAGGCCCGTTNONE
J023081C08ATCCAACGGNONE
J023081C08CAAGGCCCGTTNONE
J023090H05ATCCAACGGNONE
J023090H05CAAGGCCCGTTNONE
J023091M07ATCCAACGGNONE
J023091M07CAAGGCCCGTTNONE
J023106J17AAGGCCCAACANONE
J023106J17AAGGCCCATTTCAGCCCAACANONE
J023106J17GGCCCGTTACAGCCCAACANONE
J023115F09ATCCAACGGNONE
J023115F09CAAGGCCCGTTNONE
J023119N08AAGGCCCAACANONE
J023119N08AAGGCCCATTTCAGCCCAACANONE
J023119N08GGCCCGTTACAGCCCAACANONE
J033025I23ATCCAACGGNONE
J033025I23CAAGGCCCGTTNONE
J033026G12ATCCAACGGNONE
J033026G12CAAGGCCCGTTNONE
J033035E15ATCCAACGGNONE
J033035E15CAAGGCCCGTTNONE
J033040N13ATCCAACGGNONE
J033040N13CAAGGCCCGTTNONE
J033046C17ATCCAACGGNONE
J033046C17CAAGGCCCGTTNONE
J033058A19AAGGCCCAACANONE
J033058A19AAGGCCCATTTCAGCCCAACANONE
J033058A19GGCCCGTTACAGCCCAACANONE
J033069F02ATCCAACGGNONE
J033069F02CAAGGCCCGTTNONE
J033071B16ATCCAACGGNONE
J033071B16CAAGGCCCGTTNONE
J033071N22ATCCAACGGNONE
J033071N22CAAGGCCCGTTNONE
J033088J02ATCCAACGGNONE
J033088J02CAAGGCCCGTTNONE
J033092N24ATCCAACGGNONE
J033092N24CAAGGCCCGTTNONE
J033093I09ATCCAACGGNONE
J033093I09CAAGGCCCGTTNONE
J033098O13AAGGCCCAACANONE
J033098O13AAGGCCCATTTCAGCCCAACANONE
J033098O13GGCCCGTTACAGCCCAACANONE
J033100M18AAGGCCCAACANONE
J033100M18AAGGCCCATTTCAGCCCAACANONE
J033100M18GGCCCGTTACAGCCCAACANONE
J033125A21AAGGCCCAACANONE
J033125A21AAGGCCCATTTCAGCCCAACANONE
J033125A21GGCCCGTTACAGCCCAACANONE
J033126G06ATCCAACGGNONE
J033126G06CAAGGCCCGTTNONE
J033148C12AAGGCCCAACANONE
J033148C12AAGGCCCATTTCAGCCCAACANONE
J033148C12GGCCCGTTACAGCCCAACANONE
J043003G15ATCCAACGGNONE
J043003G15CAAGGCCCGTTNONE
J043010M11ATCCAACGGNONE
J043010M11CAAGGCCCGTTNONE
J043017F03AAGGCCCAACANONE
J043017F03AAGGCCCATTTCAGCCCAACANONE
J043017F03GGCCCGTTACAGCCCAACANONE
J043024O20ATCCAACGGNONE
J043024O20CAAGGCCCGTTNONE
J043032J02AAGGCCCAACANONE
J043032J02AAGGCCCATTTCAGCCCAACANONE
J043032J02GGCCCGTTACAGCCCAACANONE
J053047N10AAGGCCCAACANONE
J053047N10AAGGCCCATTTCAGCCCAACANONE
J053047N10GGCCCGTTACAGCCCAACANONE
J053089P04AAGGCCCAACANONE
J053089P04AAGGCCCATTTCAGCCCAACANONE
J053089P04GGCCCGTTACAGCCCAACANONE
J065051K09AAGGCCCAACANONE
J065051K09AAGGCCCATTTCAGCCCAACANONE
J065051K09GGCCCGTTACAGCCCAACANONE
J065064H24AAGGCCCAACANONE
J065064H24AAGGCCCATTTCAGCCCAACANONE
J065064H24GGCCCGTTACAGCCCAACANONE
J065092N03ATCCAACGGNONE
J065092N03CAAGGCCCGTTNONE
J080004D17ATCCAACGGNONE
J080004D17CAAGGCCCGTTNONE
J080010L09ATCCAACGGNONE
J080010L09CAAGGCCCGTTNONE
J080021I11ATCCAACGGNONE
J080021I11CAAGGCCCGTTNONE
J080022L01ATCCAACGGNONE
J080022L01CAAGGCCCGTTNONE
J080029B01ATCCAACGGNONE
J080029B01CAAGGCCCGTTNONE
J080032D11ATCCAACGGNONE
J080032D11CAAGGCCCGTTNONE
J080039B11ATCCAACGGNONE
J080039B11CAAGGCCCGTTNONE
J080040K17ATCCAACGGNONE
J080040K17CAAGGCCCGTTNONE
J080041B21ATCCAACGGNONE
J080041B21CAAGGCCCGTTNONE
J080052L24ATCCAACGGNONE
J080052L24CAAGGCCCGTTNONE
J080054M12ATCCAACGGNONE
J080054M12CAAGGCCCGTTNONE
J080057B15ATCCAACGGNONE
J080057B15CAAGGCCCGTTNONE
J080078G15ATCCAACGGNONE
J080078G15CAAGGCCCGTTNONE
J080078H06ATCCAACGGNONE
J080078H06CAAGGCCCGTTNONE
J080079M03ATCCAACGGNONE
J080079M03CAAGGCCCGTTNONE
J080088H16ATCCAACGGNONE
J080088H16CAAGGCCCGTTNONE
J080093C11ATCCAACGGNONE
J080093C11CAAGGCCCGTTNONE
J080095K09ATCCAACGGNONE
J080095K09CAAGGCCCGTTNONE
J080095O20ATCCAACGGNONE
J080095O20CAAGGCCCGTTNONE
J090001L06AAGGCCCAACANONE
J090001L06AAGGCCCATTTCAGCCCAACANONE
J090001L06GGCCCGTTACAGCCCAACANONE
J090009J19ATCCAACGGNONE
J090009J19CAAGGCCCGTTNONE
J090017C24AAGGCCCAACANONE
J090017C24AAGGCCCATTTCAGCCCAACANONE
J090017C24GGCCCGTTACAGCCCAACANONE
J090040D04ATCCAACGGNONE
J090040D04CAAGGCCCGTTNONE
J090052E14ATCCAACGGNONE
J090052E14CAAGGCCCGTTNONE
J090058G15AAGGCCCAACANONE
J090058G15AAGGCCCATTTCAGCCCAACANONE
J090058G15GGCCCGTTACAGCCCAACANONE
J090058H23AAGGCCCAACANONE
J090058H23AAGGCCCATTTCAGCCCAACANONE
J090058H23GGCCCGTTACAGCCCAACANONE
J090061G20AAGGCCCAACANONE
J090061G20AAGGCCCATTTCAGCCCAACANONE
J090061G20GGCCCGTTACAGCCCAACANONE
J090063B14ATCCAACGGNONE
J090063B14CAAGGCCCGTTNONE
J090069N23AAGGCCCAACANONE
J090069N23AAGGCCCATTTCAGCCCAACANONE
J090069N23GGCCCGTTACAGCCCAACANONE
J090071A08AAGGCCCAACANONE
J090071A08AAGGCCCATTTCAGCCCAACANONE
J090071A08GGCCCGTTACAGCCCAACANONE
J090071K04ATCCAACGGNONE
J090071K04CAAGGCCCGTTNONE
J090074A08AAGGCCCAACANONE
J090074A08AAGGCCCATTTCAGCCCAACANONE
J090074A08GGCCCGTTACAGCCCAACANONE
J090075E12ATCCAACGGNONE
J090075E12CAAGGCCCGTTNONE
J090077B15AAGGCCCAACANONE
J090077B15AAGGCCCATTTCAGCCCAACANONE
J090077B15GGCCCGTTACAGCCCAACANONE
J090081K06AAGGCCCAACANONE
J090081K06AAGGCCCATTTCAGCCCAACANONE
J090081K06GGCCCGTTACAGCCCAACANONE
J090083I05AAGGCCCAACANONE
J090083I05AAGGCCCATTTCAGCCCAACANONE
J090083I05GGCCCGTTACAGCCCAACANONE
J090087A06ATCCAACGGNONE
J090087A06CAAGGCCCGTTNONE
J090091O22AAGGCCCAACANONE
J090091O22AAGGCCCATTTCAGCCCAACANONE
J090091O22GGCCCGTTACAGCCCAACANONE
J090094P03ATCCAACGGNONE
J090094P03CAAGGCCCGTTNONE
J090097L10AAGGCCCAACANONE
J090097L10AAGGCCCATTTCAGCCCAACANONE
J090097L10GGCCCGTTACAGCCCAACANONE
J090098M14ATCCAACGGNONE
J090098M14CAAGGCCCGTTNONE
J100026B11AAGGCCCAACANONE
J100026B11AAGGCCCATTTCAGCCCAACANONE
J100026B11GGCCCGTTACAGCCCAACANONE
J100044M01AAGGCCCAACANONE
J100044M01AAGGCCCATTTCAGCCCAACANONE
J100044M01GGCCCGTTACAGCCCAACANONE
J100046F10AAGGCCCAACANONE
J100046F10AAGGCCCATTTCAGCCCAACANONE
J100046F10GGCCCGTTACAGCCCAACANONE
J100051K14AAGGCCCAACANONE
J100051K14AAGGCCCATTTCAGCCCAACANONE
J100051K14GGCCCGTTACAGCCCAACANONE
J100060D22AAGGCCCAACANONE
J100060D22AAGGCCCATTTCAGCCCAACANONE
J100060D22GGCCCGTTACAGCCCAACANONE
J100060H18AAGGCCCAACANONE
J100060H18AAGGCCCATTTCAGCCCAACANONE
J100060H18GGCCCGTTACAGCCCAACANONE
J100070I06AAGGCCCAACANONE
J100070I06AAGGCCCATTTCAGCCCAACANONE
J100070I06GGCCCGTTACAGCCCAACANONE
J100071C04AAGGCCCAACANONE
J100071C04AAGGCCCATTTCAGCCCAACANONE
J100071C04GGCCCGTTACAGCCCAACANONE
J100078M13AAGGCCCAACANONE
J100078M13AAGGCCCATTTCAGCCCAACANONE
J100078M13GGCCCGTTACAGCCCAACANONE
J100080E17AAGGCCCAACANONE
J100080E17AAGGCCCATTTCAGCCCAACANONE
J100080E17GGCCCGTTACAGCCCAACANONE
J100083I09AAGGCCCAACANONE
J100083I09AAGGCCCATTTCAGCCCAACANONE
J100083I09GGCCCGTTACAGCCCAACANONE
Os02g0227400AK103143CGATGGGCATCCAACGNONE
AY785765CGATGGGCATCCAACGPoly(A) polymerase, central region domain containing protein.
Os02g0244700AF271995ATCCAACGNONE
AK065029ATCCAACGNONE
AK065425ATCCAACGSimilar to Phosphoenolpyruvate carboxylase 1 (EC 4.1.1.31) (PEPCase 1) (CP21).
AK106451ATCCAACGNONE
J013001G17ATCCAACGNONE
J013023G02ATCCAACGNONE
J013060F19ATCCAACGNONE
J013088B14ATCCAACGNONE
J013127H11ATCCAACGNONE
J013132M14ATCCAACGNONE
J013154N11ATCCAACGNONE
J023001E17ATCCAACGNONE
J023013K14ATCCAACGNONE
J023038J15ATCCAACGNONE
J023066I08ATCCAACGNONE
J023078P20ATCCAACGNONE
J023081I07ATCCAACGNONE
J023087B20ATCCAACGNONE
J023091H04ATCCAACGNONE
J023098I04ATCCAACGNONE
J023099G02ATCCAACGNONE
J023101L06ATCCAACGNONE
J023103M09ATCCAACGNONE
J023106N02ATCCAACGNONE
J023110H22ATCCAACGNONE
J023113F09ATCCAACGNONE
J023119P13ATCCAACGNONE
J023120K17ATCCAACGNONE
J023130C22ATCCAACGNONE
J023134I23ATCCAACGNONE
J033041O13ATCCAACGNONE
J033076G10ATCCAACGNONE
J033093G06ATCCAACGNONE
J033098K17ATCCAACGNONE
J033123I11ATCCAACGNONE
J033138G06ATCCAACGNONE
J033150A18ATCCAACGNONE
J033150F08ATCCAACGNONE
J043016N16ATCCAACGNONE
J043036G23ATCCAACGNONE
J090012G21ATCCAACGNONE
J100019K02ATCCAACGNONE
Os02g0245000AK119770GGCCGGGCGGCCCGTTNONE
AK119874GGCCGGGCGGCCCGTTSWAP/Surp domain containing protein.
J065038L11GGCCGGGCGGCCCGTTNONE
J100059I06GGCCGGGCGGCCCGTTNONE
J100076C23GGCCGGGCGGCCCGTTNONE
J100081P08GGCCGGGCGGCCCGTTNONE
J100084C13GGCCGGGCGGCCCGTTNONE
Os02g0250600J075143F23AGTTGGGCCGTCLate embryogenesis abundant protein repeat containing protein.
Os02g0251900AK109286GACCGTTGSimilar to Tobacco rattle virus-induced protein variant 2.
Os02g0256000AK108573GGTTGGGCCTGGConserved hypothetical protein.
Os02g0259600006-053-A06AGCCGTTGNONE
009-117-C10AGCCGTTGNONE
AK064863AGCCGTTGSimilar to 50S ribosomal protein L21, chloroplast precursor (CL21) (CS-L7).
AK104384AGCCGTTGNONE
J013000I04AGCCGTTGNONE
Os02g0266500AK100307GGTTGGGCCTCSimilar to RASPBERRY3.
Os02g0281000J013060F14CGTTGGATNONE
J013158A09CGTTGGATNONE
J090099G01CGTTGGATNONE
Os02g0281200009-184-D06TTGGCCCAACANONE
AK063172TTGGCCCAACANONE
Os02g0282100AK058480ATCCAACGConserved hypothetical protein.
J065102L06ATCCAACGNONE
J065152P10ATCCAACGNONE
J100043L06ATCCAACGNONE
J100044G06ATCCAACGNONE
J100052L20ATCCAACGNONE
Os02g0299600AK069297CCAACGGCProtein of unknown function DUF1242 family protein.
Os02g0302900AK110752CCAACGGCTReticulon family protein.
Os02g0308800004-016-D09CCACCAACNONE
006-024-D08CCACCAACNONE
006-048-E10CCACCAACNONE
006-050-G03CCACCAACNONE
006-059-E12CCACCAACNONE
006-074-H06CCACCAACNONE
006-084-B02CCACCAACNONE
006-090-C05CCACCAACNONE
006-107-H12CCACCAACNONE
006-109-H08CCACCAACNONE
009-085-G05CCACCAACNONE
009-113-F09CCACCAACNONE
009-144-E03CCACCAACNONE
009-150-G05CCACCAACNONE
AK060903CCACCAACNONE
AK064819CCACCAACConserved hypothetical protein.
AK104098CCACCAACNONE
AK104533CCACCAACNONE
J013000E21CCACCAACNONE
Os02g0321000AK121840ACAGCCCAACCTetratricopeptide-like helical domain containing protein.
Os02g0324700006-086-H07CCAACGGCTNONE
006-106-G09CCAACGGCTNONE
AK060405CCAACGGCTConserved hypothetical protein.
AK104437CCAACGGCTNONE
Os02g0327000006-110-H11GCCGTTGGNONE
AK073631GCCGTTGGC2 domain containing protein.
AK104165GCCGTTGGNONE
J023004L22GCCGTTGGNONE
J023091P07GCCGTTGGNONE
J023115A09GCCGTTGGNONE
J023139A19GCCGTTGGNONE
J033043I10GCCGTTGGNONE
J033052D22GCCGTTGGNONE
J033066B05GCCGTTGGNONE
J043003P17GCCGTTGGNONE
J043030K22GCCGTTGGNONE
J065109P18GCCGTTGGNONE
J065130G19GCCGTTGGNONE
J065150K12GCCGTTGGNONE
J065202B18GCCGTTGGNONE
J065203K23GCCGTTGGNONE
J090012O12GCCGTTGGNONE
J090076M23GCCGTTGGNONE
J100019I12GCCGTTGGNONE
J100028N06GCCGTTGGNONE
J100030G13GCCGTTGGNONE
J100031O22GCCGTTGGNONE
J100042F17GCCGTTGGNONE
J100059C04GCCGTTGGNONE
J100067G16GCCGTTGGNONE
J100075K20GCCGTTGGNONE
J100078D05GCCGTTGGNONE
Os02g0331200011-039-B02AGCCGTTGNONE
AK063938AGCCGTTGNONE
AK100151AGCCGTTGProtein of unknown function DUF563 family protein.
AK103231AGCCGTTGNONE
J033027N19AGCCGTTGNONE
J033067H06AGCCGTTGNONE
J033076L12AGCCGTTGNONE
Os02g0445700011-046-C10AACGGGCCGTGNONE
011-046-C10CACGGCCCGTTNONE
011-046-C10GGCCCGGCCCGTTNONE
Os02g0452800J043024P15AGCCCAACCConserved hypothetical protein.
Os02g0461200012-026-A12CACGGCCCAACTNONE
AK063459CACGGCCCAACTConserved hypothetical protein.
J065183F11CACGGCCCAACTNONE
J075190G18CACGGCCCAACTNONE
Os02g0467200014-053-H06GGCCCGTTNONE
AK063704GGCCCGTTConserved hypothetical protein.
J065197J05GGCCCGTTNONE
Os02g0467400AK072333AGCCGTTGGATConserved hypothetical protein.
AK073879AGCCGTTGGATNONE
AK121931AGCCGTTGGATNONE
J065085B12AGCCGTTGGATNONE
Os02g0478050J065163G01ATCCAACGConserved hypothetical protein.
J065206E19ATCCAACGNONE
J090046D24ATCCAACGNONE
J090061F20ATCCAACGNONE
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein.
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein.
Os02g0533900AB062681CCACCAACNONE
AK061722CCACCAACNONE
AK106147CCACCAACNONE
AK121892CCACCAACSimilar to Carbon-nitrogen hydrolase family protein.
Os02g0556700AK073875ATCCAACGGCCT-complex 11 family protein.
Os02g0556800AK060580GGCCGTTGNONE
AK100187GGCCGTTGConserved hypothetical protein.
J065162A21GGCCGTTGNONE
J075093B20GGCCGTTGNONE
J075097N04GGCCGTTGNONE
Os02g0559300AK100088CAACGGCCGGCCCNONE
AK121206CAACGGCCGGCCCProtein kinase-like domain containing protein.
J023003H24CAACGGCCGGCCCNONE
J023088A16CAACGGCCGGCCCNONE
J023100K01CAACGGCCGGCCCNONE
J023127H24CAACGGCCGGCCCNONE
Os02g0565000AK120665AACGGGCCHomeodomain-like containing protein.
AK120665TCCGTCCGGCCCAACAHomeodomain-like containing protein.
J100070C12AACGGGCCNONE
J100070C12TCCGTCCGGCCCAACANONE
J100074L08AACGGGCCNONE
J100074L08TCCGTCCGGCCCAACANONE
Os02g0568100AK107582CAACGGCTSimilar to Non-phototropic hypocotyl 3.
Os02g0580700AK073664AGTTGGGCTTCConserved hypothetical protein.
J090060F24AGTTGGGCTTCNONE
Os02g0582600006-041-F11GGGGCCCAACANONE
AK059791GGGGCCCAACANONE
AK102380GGGGCCCAACAHeavy metal transport/detoxification protein domain containing protein.
J033092A09GGGGCCCAACANONE
Os02g0586400006-066-D08CGCACCGCACCGTTGGATNONE
006-073-A01CGCACCGCACCGTTGGATNONE
J065088B17CGCACCGCACCGTTGGATNONE
J075065L07CGCACCGCACCGTTGGATNONE
J100017B20CGCACCGCACCGTTGGATNONE
J100025B03CGCACCGCACCGTTGGATNONE
Os02g0586900013-044-D08AACGGGCCCAGANONE
014-087-D07AACGGGCCCAGANONE
AK063583AACGGGCCCAGASimilar to Glycine rich protein (Fragment).
AK105378AACGGGCCCAGANONE
Os02g0588700AK100801CCCACCACCAACConserved hypothetical protein.
J100030D24CCCACCACCAACNONE
J100031B19CCCACCACCAACNONE
J100032M18CCCACCACCAACNONE
J100035B04CCCACCACCAACNONE
J100055G19CCCACCACCAACNONE
Os02g0598400AK109577CCAACGGCNONE
J013132M15CCAACGGCNONE
J065057M19CCAACGGCNONE
J065134L23CCAACGGCNONE
J090026B21CCAACGGCNONE
J090029B13CCAACGGCNONE
Os02g0602300AK065609AACGGGCCGTGNONE
AK065609AACGGGCCGTGNONE
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1).
J013092L08AACGGGCCGTGNONE
J013092L08AACGGGCCGTGNONE
J090040I23AACGGGCCGTGNONE
J090040I23AACGGGCCGTGNONE
Os02g0602500015-078-E08CCGTTGGATNONE
AK064340CCGTTGGATNONE
AK073602CCGTTGGATIsy1-like splicing family protein.
J033052I23CCGTTGGATNONE
J065060C10CCGTTGGATNONE
J065192K14CCGTTGGATNONE
J100076I15CCGTTGGATNONE
Os02g0603800AK105762CCACCAACNONE
AK120769CCACCAACSimilar to Isoprenoid biosynthesis-like protein (Fragment).
Os02g0606200006-050-A05AGCCGTTGNONE
006-054-D12AGCCGTTGNONE
006-076-H01AGCCGTTGNONE
006-097-F10AGCCGTTGNONE
006-117-H06AGCCGTTGNONE
AB001885AGCCGTTGZinc finger, B-box domain containing protein.
AK061044AGCCGTTGNONE
AK104293AGCCGTTGNONE
J065168M02AGCCGTTGNONE
J065198B03AGCCGTTGNONE
J075053D02AGCCGTTGNONE
J100074J07AGCCGTTGNONE
Os02g0606900J023065M01AACGGGCCNONE
J075046E14AACGGGCCNONE
Os02g0610700014-008-A03GTTGGTGGNONE
AK059205GTTGGTGGConserved hypothetical protein.
AK100281GTTGGTGGNONE
J023074H03GTTGGTGGNONE
J065002J16GTTGGTGGNONE
J065032I20GTTGGTGGNONE
J065076A07GTTGGTGGNONE
J065142O21GTTGGTGGNONE
J065203A03GTTGGTGGNONE
J075017F24GTTGGTGGNONE
J075017G24GTTGGTGGNONE
Os02g0611400AK101310AGCCGTTGGATProtein prenyltransferase domain containing protein.
J033024H21AGCCGTTGGATNONE
J033033O21AGCCGTTGGATNONE
J065134H24AGCCGTTGGATNONE
J090087E02AGCCGTTGGATNONE
Os02g0611500AK072083CCACCAACSimilar to Eukaryotic initiation factor-like protein.
Os02g0615500AK068010TCCAACGGCNONE
AK100073TCCAACGGCProtein kinase-like domain containing protein.
J013170D14TCCAACGGCNONE
Os02g0617400AK108108CAACGGCCLipolytic enzyme, G-D-S-L family protein.
J075028E08CAACGGCCNONE
J090024M06CAACGGCCNONE
Os02g0618250009-115-E10CCAGCCCAACCNONE
014-076-A03CCAGCCCAACCNONE
J065096D10CCAGCCCAACCSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein.
J075045G01CCAGCCCAACCNONE
J075092J11CCAGCCCAACCNONE
J075134F02CCAGCCCAACCNONE
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein.
Os02g0625500011-025-C06GCCCACCAACCGCGGGGGNONE
011-025-C06GTTGGTGGGCNONE
AB050624GCCCACCAACCGCGGGGGNONE
AB050624GTTGGTGGGCNONE
AK059188AGCCCAACTNONE
AK059188GCCCACCAACCGCGGGGGNONE
AK059188GTTGGTGGGCNONE
AK059771GCCCACCAACCGCGGGGGNONE
AK059771GTTGGTGGGCNONE
AK101791GCCCACCAACCGCGGGGGSimilar to Adenosine kinase-like protein (Fragment).
AK101791GTTGGTGGGCSimilar to Adenosine kinase-like protein (Fragment).
AY224510GCCCACCAACCGCGGGGGNONE
AY224510GTTGGTGGGCNONE
J013152H02GCCCACCAACCGCGGGGGNONE
J013152H02GTTGGTGGGCNONE
J023012P09GCCCACCAACCGCGGGGGNONE
J023012P09GTTGGTGGGCNONE
J023127D16GCCCACCAACCGCGGGGGNONE
J023127D16GTTGGTGGGCNONE
J033024G01GCCCACCAACCGCGGGGGNONE
J033024G01GTTGGTGGGCNONE
J033025L19GCCCACCAACCGCGGGGGNONE
J033025L19GTTGGTGGGCNONE
J033080M04GCCCACCAACCGCGGGGGNONE
J033080M04GTTGGTGGGCNONE
J033101A08GCCCACCAACCGCGGGGGNONE
J033101A08GTTGGTGGGCNONE
J033121L12GCCCACCAACCGCGGGGGNONE
J033121L12GTTGGTGGGCNONE
J043017N15GCCCACCAACCGCGGGGGNONE
J043017N15GTTGGTGGGCNONE
J065207J01GCCCACCAACCGCGGGGGNONE
J065207J01GTTGGTGGGCNONE
J090049G12GCCCACCAACCGCGGGGGNONE
J090049G12GTTGGTGGGCNONE
J100036A07GCCCACCAACCGCGGGGGNONE
J100036A07GTTGGTGGGCNONE
J100076C04GCCCACCAACCGCGGGGGNONE
J100076C04GTTGGTGGGCNONE
J100080N22GCCCACCAACCGCGGGGGNONE
J100080N22GTTGGTGGGCNONE
Os02g0628600J100044L04CCACCAACTranscriptional factor B3 family protein.
Os02g0634700AK071869AGCCCAACCNONE
J013129B13AGCCCAACCNONE
J013134D24AGCCCAACCNONE
Os02g0634900006-032-G12AGCCGTTGGCCCGTGGGNONE
006-033-E09AGCCGTTGGCCCGTGGGNONE
006-117-F10AGCCGTTGGCCCGTGGGNONE
006-118-E01AGCCGTTGGCCCGTGGGNONE
013-056-G08AGCCGTTGGCCCGTGGGNONE
AK059769AGCCGTTGGCCCGTGGGNONE
AK068583AGCCGTTGGCCCGTGGGNONE
AK072855AGCCGTTGGCCCGTGGGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2).
AK106210AGCCGTTGGCCCGTGGGNONE
J023138P05AGCCGTTGGCCCGTGGGNONE
J023143J07AGCCGTTGGCCCGTGGGNONE
J033022O09AGCCGTTGGCCCGTGGGNONE
J033111L02AGCCGTTGGCCCGTGGGNONE
J033135O03AGCCGTTGGCCCGTGGGNONE
J065005K19AGCCGTTGGCCCGTGGGNONE
J065044C17AGCCGTTGGCCCGTGGGNONE
J065116K09AGCCGTTGGCCCGTGGGNONE
J065119O21AGCCGTTGGCCCGTGGGNONE
J075014L05AGCCGTTGGCCCGTGGGNONE
J075109H16AGCCGTTGGCCCGTGGGNONE
J075117D04AGCCGTTGGCCCGTGGGNONE
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein.
Os02g0639800006-081-G07GGTTGGGCTTTNONE
012-042-E02GGTTGGGCTTTNONE
AK070367GGTTGGGCTTTNONE
AK071904GGTTGGGCTTTZinc finger, RING-type domain containing protein.
AK105980GGTTGGGCTTTNONE
Os02g0651500AK066333ACAGCCCAACTNONE
AK121865ACAGCCCAACTHypothetical protein.
J090038J11ACAGCCCAACTNONE
Os02g0655300006-024-H05TCTGGCCCAACTNONE
006-032-G04TCTGGCCCAACTNONE
006-045-F03TCTGGCCCAACTNONE
006-076-D04TCTGGCCCAACTNONE
006-086-C09TCTGGCCCAACTNONE
006-104-C07TCTGGCCCAACTNONE
AK061544TCTGGCCCAACTNONE
AK103778TCTGGCCCAACTNONE
AK106107TCTGGCCCAACTNONE
AK120006TCTGGCCCAACTNONE
AY363174TCTGGCCCAACTSimilar to 3-isopropylmalate dehydratase, small subunit.
J033145B21TCTGGCCCAACTNONE
J065021C16TCTGGCCCAACTNONE
J065182F01TCTGGCCCAACTNONE
J075063I18TCTGGCCCAACTNONE
J075151E01TCTGGCCCAACTNONE
J075198K18TCTGGCCCAACTNONE
J090026M06TCTGGCCCAACTNONE
J090081H02TCTGGCCCAACTNONE
J100061E20TCTGGCCCAACTNONE
Os02g0658300AK073923TCTGGCCCAACAConserved hypothetical protein.
J065152M15TCTGGCCCAACANONE
Os02g0659600J065119F20ATCCAACGGNONE
J065181I02ATCCAACGGConserved hypothetical protein.
J090092M04ATCCAACGGNONE
Os02g0663900AK068885GTTGGTGGSimilar to Phosphoribosyltransferase (Fragment).
Os02g0667600AK073500CCAACGGCCHarpin-induced 1 domain containing protein.
AK109748CCAACGGCCNONE
AK109816CCAACGGCCNONE
Os02g0668500006-056-A05CCAACGGCCCAGGNONE
AK060958CCAACGGCCCAGGNONE
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein.
J023117I15CCAACGGCCCAGGNONE
J065013J03CCAACGGCCCAGGNONE
J065021P16CCAACGGCCCAGGNONE
J065044B07CCAACGGCCCAGGNONE
J065059E23CCAACGGCCCAGGNONE
J065087N20CCAACGGCCCAGGNONE
J065185I04CCAACGGCCCAGGNONE
J065190G19CCAACGGCCCAGGNONE
J065199C15CCAACGGCCCAGGNONE
J065213L12CCAACGGCCCAGGNONE
J080305C01CCAACGGCCCAGGNONE
J080308C07CCAACGGCCCAGGNONE
J080310F02CCAACGGCCCAGGNONE
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein.
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein.
AK099179AAGGCCCAACAAGCCCAACTNONE
J023098L23AAGGCCCAACAAGCCCAACTNONE
J065042J21AAGGCCCAACAAGCCCAACTNONE
J065187L09AAGGCCCAACAAGCCCAACTNONE
J065190O10AAGGCCCAACAAGCCCAACTNONE
J080041G14AAGGCCCAACAAGCCCAACTNONE
J080078K08AAGGCCCAACAAGCCCAACTNONE
J080089D20AAGGCCCAACAAGCCCAACTNONE
J080094D04AAGGCCCAACAAGCCCAACTNONE
Os02g0686600AK102917AGCCCAACAMetal-dependent protein hydrolase family protein.
Os02g0686700AK111294CCACCAACProtein of unknown function DUF581 family protein.
Os02g0688900AK066093GAAGCCCAACTGPI transamidase subunit PIG-U family protein.
J065007D18GAAGCCCAACTNONE
J065040G21GAAGCCCAACTNONE
J065103G03GAAGCCCAACTNONE
J065175F18GAAGCCCAACTNONE
J065202A07GAAGCCCAACTNONE
J075006C01GAAGCCCAACTNONE
J075178F24GAAGCCCAACTNONE
Os02g0689700AK063776GAGGCCCAACCRibosomal protein L18P/L5E family protein.
Os02g0695600009-130-G03GGCCGTTGGNONE
009-141-A10GGCCGTTGGNONE
009-185-F07GGCCGTTGGNONE
AK062960GGCCGTTGGConserved hypothetical protein.
J100046B17GGCCGTTGGNONE
Os02g0697200015-013-B10AACGGGCCCACANONE
015-013-B10TGTTGGGCCGGTNONE
AK059475AACGGGCCCACANONE
AK059475TGTTGGGCCGGTNONE
AK102993AACGGGCCCACAConserved hypothetical protein.
AK102993TGTTGGGCCGGTConserved hypothetical protein.
J033079I18AACGGGCCCACANONE
J033079I18TGTTGGGCCGGTNONE
J033082A14AACGGGCCCACANONE
J033082A14TGTTGGGCCGGTNONE
J065047H08AACGGGCCCACANONE
J065047H08TGTTGGGCCGGTNONE
J065131M14AACGGGCCCACANONE
J065131M14TGTTGGGCCGGTNONE
Os02g0697500AK105680AGCCCAACCSimilar to Selenium-binding protein-like.
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein.
J090039P20CAACGGCCCGGCCCATTTNONE
Os02g0700100AK102954AGCCGTTGSimilar to WD-repeat protein.
AK102954CAACGGCTSimilar to WD-repeat protein.
Os02g0703300006-087-E06CCACCAACNONE
AK060227CCACCAACNONE
AK071752CCACCAACNONE
AK105992CCACCAACProtein of unknown function DUF1218 family protein.
J023113K24CCACCAACNONE
J065186E12CCACCAACNONE
J100079N05CCACCAACNONE
Os02g0703900AK102115AGCCCACCAACSimilar to Nodulin-like protein.
AK121966AGCCCACCAACNONE
J023109K03AGCCCACCAACNONE
J033051G23AGCCCACCAACNONE
J033084H22AGCCCACCAACNONE
J090056B12AGCCCACCAACNONE
J090059L13AGCCCACCAACNONE
J090080M03AGCCCACCAACNONE
Os02g0705000006-069-G11CAACGGTCNONE
006-096-C01CAACGGTCNONE
006-099-A07CAACGGTCNONE
AK068080CAACGGTCNmrA-like family protein.
AK104529CAACGGTCNONE
AK106021CAACGGTCNONE
J013132K15CAACGGTCNONE
Os02g0705300006-028-G05TGTTGGGCCGCNONE
006-064-H09TGTTGGGCCGCNONE
AK062089TGTTGGGCCGCNONE
AK064855TGTTGGGCCGCNONE
AK106164TGTTGGGCCGCTubby family protein.
Os02g0708300009-007-C06GGCCCGTTNONE
009-007-C06GGCCCGTTNONE
009-162-G06GGCCCGTTNONE
009-162-G06GGCCCGTTNONE
014-048-F12GGCCCGTTNONE
014-048-F12GGCCCGTTNONE
AK066348GGCCCGTTConserved hypothetical protein.
AK066348GGCCCGTTConserved hypothetical protein.
J013059F24GGCCCGTTNONE
J013059F24GGCCCGTTNONE
J023104H14GGCCCGTTNONE
J023104H14GGCCCGTTNONE
J053052O22GGCCCGTTNONE
J053052O22GGCCCGTTNONE
J053063A05GGCCCGTTNONE
J053063A05GGCCCGTTNONE
J053093P09GGCCCGTTNONE
J053093P09GGCCCGTTNONE
J065012F24GGCCCGTTNONE
J065012F24GGCCCGTTNONE
J065063P09GGCCCGTTNONE
J065063P09GGCCCGTTNONE
J065088F12GGCCCGTTNONE
J065088F12GGCCCGTTNONE
J065094I11GGCCCGTTNONE
J065094I11GGCCCGTTNONE
J065099H19GGCCCGTTNONE
J065099H19GGCCCGTTNONE
J065116H07GGCCCGTTNONE
J065116H07GGCCCGTTNONE
J065137N07GGCCCGTTNONE
J065137N07GGCCCGTTNONE
J065137N11GGCCCGTTNONE
J065137N11GGCCCGTTNONE
J065159L22GGCCCGTTNONE
J065159L22GGCCCGTTNONE
J065159P11GGCCCGTTNONE
J065159P11GGCCCGTTNONE
J065178F17GGCCCGTTNONE
J065178F17GGCCCGTTNONE
J065181E07GGCCCGTTNONE
J065181E07GGCCCGTTNONE
J075014L16GGCCCGTTNONE
J075014L16GGCCCGTTNONE
J075030P11GGCCCGTTNONE
J075030P11GGCCCGTTNONE
J075042K24GGCCCGTTNONE
J075042K24GGCCCGTTNONE
J075077I15GGCCCGTTNONE
J075077I15GGCCCGTTNONE
J075087P06GGCCCGTTNONE
J075087P06GGCCCGTTNONE
J075089F20GGCCCGTTNONE
J075089F20GGCCCGTTNONE
J075093B07GGCCCGTTNONE
J075093B07GGCCCGTTNONE
J075115J23GGCCCGTTNONE
J075115J23GGCCCGTTNONE
J075176O19GGCCCGTTNONE
J075176O19GGCCCGTTNONE
J075178A04GGCCCGTTNONE
J075178A04GGCCCGTTNONE
J075178J02GGCCCGTTNONE
J075178J02GGCCCGTTNONE
J090027L02GGCCCGTTNONE
J090027L02GGCCCGTTNONE
J100033M12GGCCCGTTNONE
J100033M12GGCCCGTTNONE
J100065O08GGCCCGTTNONE
J100065O08GGCCCGTTNONE
Os02g0712500003-128-B04GTTGGTGGNONE
AK100094GTTGGTGGProtein of unknown function DUF23 family protein.
J023003P08GTTGGTGGNONE
J033070I23GTTGGTGGNONE
J065019B12GTTGGTGGNONE
J065021D22GTTGGTGGNONE
J065063H05GTTGGTGGNONE
J065103B14GTTGGTGGNONE
J065136I12GTTGGTGGNONE
J065195F24GTTGGTGGNONE
J090045N11GTTGGTGGNONE
Os02g0714600AK068469AGCCGTTGGRibose-phosphate pyrophosphokinase 4 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 4).
AK103643AGCCGTTGGNONE
AK104867AGCCGTTGGNONE
J013000G18AGCCGTTGGNONE
J013156D24AGCCGTTGGNONE
J023002E01AGCCGTTGGNONE
J023036G15AGCCGTTGGNONE
J023057B17AGCCGTTGGNONE
J023105D01AGCCGTTGGNONE
J033039M17AGCCGTTGGNONE
J033079M15AGCCGTTGGNONE
J033117J21AGCCGTTGGNONE
Os02g0717100014-089-G06TACGGCCCGTTNONE
AK063741TACGGCCCGTTEsterase/lipase/thioesterase domain containing protein.
J065052A22TACGGCCCGTTNONE
Os02g0721100AK108167TAAGCCCAACASimilar to E2 ubiquitin-conjugating enzyme UbcH5B (Fragment).
Os02g0723200AK108140GCGGCCCAACCSimilar to Alpha galactosyltransferase (Fragment).
J090087D22GCGGCCCAACCNONE
Os02g0725300AK120054CCACCAACNONE
J013000L05CCACCAACNONE
J065194M19CCACCAACNONE
Os02g0727100AK069154GGCCGTTGAmino acid/polyamine transporter II family protein.
J023006P21GGCCGTTGNONE
J023027D19GGCCGTTGNONE
J023044N10GGCCGTTGNONE
J023088H15GGCCGTTGNONE
J023090A13GGCCGTTGNONE
J023142P16GGCCGTTGNONE
Os02g0728600AK063054GCCGTTGGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).
J065121P04GCCGTTGGNONE
Os02g0733300AK101108TCCAACGGCCGAAASimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4).
AK101108TCCAACGGTCCCACCCGSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4).
AK105446TCCAACGGCCGAAANONE
AK105446TCCAACGGTCCCACCCGNONE
Os02g0734300006-027-C05AGTTGGGCTNONE
006-027-C05CCACCAACNONE
006-027-C11AGTTGGGCTNONE
006-027-C11CCACCAACNONE
006-039-E12AGTTGGGCTNONE
006-039-E12CCACCAACNONE
006-095-H04AGTTGGGCTNONE
006-095-H04CCACCAACNONE
009-112-G07AGTTGGGCTNONE
009-112-G07CCACCAACNONE
AK059780AGTTGGGCTSimilar to Nudix hydrolase 18, mitochondrial precursor (EC 3.6.1.-) (AtNUDT18).
AK059780CCACCAACSimilar to Nudix hydrolase 18, mitochondrial precursor (EC 3.6.1.-) (AtNUDT18).
AK104571AGTTGGGCTNONE
AK104571CCACCAACNONE
J065079N09AGTTGGGCTNONE
J065079N09CCACCAACNONE
J065188A17AGTTGGGCTNONE
J065188A17CCACCAACNONE
J065209B17AGTTGGGCTNONE
J065209B17CCACCAACNONE
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein.
J013099D16AAGGCCCATAAAAGCCCAACNONE
Os02g0738200J100040B06CAACGGTCNONE
J100050N02CAACGGTCU box domain containing protein.
J100056J12CAACGGTCNONE
Os02g0740300AK067833GGCCCGTTAAA ATPase domain containing protein.
Os02g0744000AK064898AACGGGCCConserved hypothetical protein.
AK104827AACGGGCCNONE
J013000L12AACGGGCCNONE
J013156N02AACGGGCCNONE
J065001H14AACGGGCCNONE
J065038D18AACGGGCCNONE
J065039I18AACGGGCCNONE
J065047C13AACGGGCCNONE
J065053J09AACGGGCCNONE
J065064G03AACGGGCCNONE
J065066M05AACGGGCCNONE
J065068O10AACGGGCCNONE
J065090H22AACGGGCCNONE
J065113L19AACGGGCCNONE
J065121M02AACGGGCCNONE
J065122K23AACGGGCCNONE
J065138C12AACGGGCCNONE
J065153E14AACGGGCCNONE
J065156N12AACGGGCCNONE
J065158L20AACGGGCCNONE
J065166I06AACGGGCCNONE
J065174L15AACGGGCCNONE
J065175N03AACGGGCCNONE
J090092C23AACGGGCCNONE
Os02g0744900AK061968ATCCAACGGCTSimilar to Geranylgeranyl reductase (Fragment).
AK098873ATCCAACGGCTNONE
J013001C18ATCCAACGGCTNONE
J080003D07ATCCAACGGCTNONE
J080003H24ATCCAACGGCTNONE
J080010C23ATCCAACGGCTNONE
J080011I04ATCCAACGGCTNONE
J080011O03ATCCAACGGCTNONE
J080012F13ATCCAACGGCTNONE
J080020E06ATCCAACGGCTNONE
J080025H22ATCCAACGGCTNONE
J080026D15ATCCAACGGCTNONE
J080028D20ATCCAACGGCTNONE
J080029P20ATCCAACGGCTNONE
J080031K22ATCCAACGGCTNONE
J080034I05ATCCAACGGCTNONE
J080036E11ATCCAACGGCTNONE
J080036H13ATCCAACGGCTNONE
J080037E17ATCCAACGGCTNONE
J080043N05ATCCAACGGCTNONE
J080044L23ATCCAACGGCTNONE
J080047N11ATCCAACGGCTNONE
J080048O04ATCCAACGGCTNONE
J080049M01ATCCAACGGCTNONE
J080050F21ATCCAACGGCTNONE
J080054F09ATCCAACGGCTNONE
J080055N20ATCCAACGGCTNONE
J080058C02ATCCAACGGCTNONE
J080058K15ATCCAACGGCTNONE
J080062G02ATCCAACGGCTNONE
J080066H16ATCCAACGGCTNONE
J080066O05ATCCAACGGCTNONE
J080067O16ATCCAACGGCTNONE
J080068E13ATCCAACGGCTNONE
J080069P16ATCCAACGGCTNONE
J080072M11ATCCAACGGCTNONE
J080076H09ATCCAACGGCTNONE
J080081G24ATCCAACGGCTNONE
J080082J05ATCCAACGGCTNONE
J080084I10ATCCAACGGCTNONE
J080087L24ATCCAACGGCTNONE
J080089H07ATCCAACGGCTNONE
J080089M05ATCCAACGGCTNONE
J080092G18ATCCAACGGCTNONE
J080095N08ATCCAACGGCTNONE
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein.
J023132N16AACGGCCCAACCNONE
J033069F17AACGGCCCAACCNONE
Os02g0755200AK070699AGTTGGGCCATSimilar to FLOWERING LOCUS D (Fragment).
J023056I20AGTTGGGCCATNONE
J065048B13AGTTGGGCCATNONE
J065128H21AGTTGGGCCATNONE
J065201E09AGTTGGGCCATNONE
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like.
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22).
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE
Os02g0758200AK111266GCGCGCGAGCCCAACCConserved hypothetical protein.
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin.
AK121481ATCCAACGGCCCAGGNONE
J023149K16ATCCAACGGCCCAGGNONE
J033098A18ATCCAACGGCCCAGGNONE
J065017E05ATCCAACGGCCCAGGNONE
J065088E24ATCCAACGGCCCAGGNONE
J080305N16ATCCAACGGCCCAGGNONE
J080306F22ATCCAACGGCCCAGGNONE
J080306P07ATCCAACGGCCCAGGNONE
J080318H06ATCCAACGGCCCAGGNONE
J090013M21ATCCAACGGCCCAGGNONE
J100029G11ATCCAACGGCCCAGGNONE
Os02g0761200011-009-C07AGCCCAACNONE
AK073828AGCCCAACArmadillo-like helical domain containing protein.
J033046N18AGCCCAACNONE
J033068P04AGCCCAACNONE
Os02g0762400AK103084GCAGCCCAACGGCCCyclin-dependent kinase inhibitor family protein.
Os02g0763000J065017L09ATATGGGCCAACGGCCNONE
J065017L09TCCAACGGCTNONE
J065036A05ATATGGGCCAACGGCCNONE
J065036A05TCCAACGGCTNONE
J065087C01ATATGGGCCAACGGCCNONE
J065087C01TCCAACGGCTNONE
J065105A14ATATGGGCCAACGGCCNONE
J065105A14TCCAACGGCTNONE
J065164J03ATATGGGCCAACGGCCNONE
J065164J03TCCAACGGCTNONE
J065175J19ATATGGGCCAACGGCCNONE
J065175J19TCCAACGGCTNONE
J065201H07ATATGGGCCAACGGCCProtein of unknown function Cys-rich family protein.
J065201H07TCCAACGGCTProtein of unknown function Cys-rich family protein.
J075032O12ATATGGGCCAACGGCCNONE
J075032O12TCCAACGGCTNONE
J075085D24ATATGGGCCAACGGCCNONE
J075085D24TCCAACGGCTNONE
J075197C17ATATGGGCCAACGGCCNONE
J075197C17TCCAACGGCTNONE
J100032C19ATATGGGCCAACGGCCNONE
J100032C19TCCAACGGCTNONE
Os02g0766600006-039-E02CCGTTGGATNONE
009-087-E05CCGTTGGATNONE
013-049-E02CCGTTGGATNONE
AK059779CCGTTGGATProtein of unknown function DUF1685 family protein.
AK099386CCGTTGGATNONE
J033072H02CCGTTGGATNONE
J065045F21CCGTTGGATNONE
J065079P05CCGTTGGATNONE
J065121M12CCGTTGGATNONE
J065134C23CCGTTGGATNONE
J065140G23CCGTTGGATNONE
J065180P12CCGTTGGATNONE
J065212O07CCGTTGGATNONE
J100028B03CCGTTGGATNONE
J100030E05CCGTTGGATNONE
J100037O12CCGTTGGATNONE
J100050P11CCGTTGGATNONE
J100058I07CCGTTGGATNONE
J100059G05CCGTTGGATNONE
J100062H11CCGTTGGATNONE
J100064L18CCGTTGGATNONE
J100068G08CCGTTGGATNONE
Os02g0767500005-017-F10AACGGGCCCCACACGNONE
AB016065AACGGGCCCCACACGNONE
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter.
J013020K11AACGGGCCCCACACGNONE
J013066I18AACGGGCCCCACACGNONE
J023012D02AACGGGCCCCACACGNONE
J023020J16AACGGGCCCCACACGNONE
J023022H13AACGGGCCCCACACGNONE
J023044N15AACGGGCCCCACACGNONE
J023067E15AACGGGCCCCACACGNONE
J023079C06AACGGGCCCCACACGNONE
J023080B07AACGGGCCCCACACGNONE
J023081G11AACGGGCCCCACACGNONE
J023091H22AACGGGCCCCACACGNONE
J023092J03AACGGGCCCCACACGNONE
J023114D02AACGGGCCCCACACGNONE
J023121J15AACGGGCCCCACACGNONE
J023128G10AACGGGCCCCACACGNONE
J023132B15AACGGGCCCCACACGNONE
J023140G10AACGGGCCCCACACGNONE
J023142B10AACGGGCCCCACACGNONE
J033026C15AACGGGCCCCACACGNONE
J033029F21AACGGGCCCCACACGNONE
J033037I09AACGGGCCCCACACGNONE
J033046D11AACGGGCCCCACACGNONE
J033081L20AACGGGCCCCACACGNONE
J033097J19AACGGGCCCCACACGNONE
J033125D19AACGGGCCCCACACGNONE
J033125I04AACGGGCCCCACACGNONE
J033141M21AACGGGCCCCACACGNONE
J033143K08AACGGGCCCCACACGNONE
J053091N01AACGGGCCCCACACGNONE
J065093C20AACGGGCCCCACACGNONE
J065104K11AACGGGCCCCACACGNONE
J065143L16AACGGGCCCCACACGNONE
J065205I23AACGGGCCCCACACGNONE
J090057C12AACGGGCCCCACACGNONE
J090075P11AACGGGCCCCACACGNONE
Os02g0767900009-154-G01GTTGGGCCTGGNONE
009-172-H09GTTGGGCCTGGNONE
AK099885GTTGGGCCTGGGlutaredoxin 2 family protein.
Os02g0771200011-006-B07ATCCAACGGTCNONE
AK066823ATCCAACGGTCConserved hypothetical protein.
AK071059ATCCAACGGTCNONE
J013075K03ATCCAACGGTCNONE
Os02g0771700011-075-D10CAACGGTCNONE
011-075-D10GTTGGGCCCCNONE
011-086-E10CAACGGTCNONE
011-086-E10GTTGGGCCCCNONE
AK058571CAACGGTCGlycoside hydrolase, family 17 protein.
AK058571GTTGGGCCCCGlycoside hydrolase, family 17 protein.
AK102185CAACGGTCNONE
AK102185GTTGGGCCCCNONE
J023001D03CAACGGTCNONE
J023001D03GTTGGGCCCCNONE
J023041N11CAACGGTCNONE
J023041N11GTTGGGCCCCNONE
J033086N13CAACGGTCNONE
J033086N13GTTGGGCCCCNONE
J033106K14CAACGGTCNONE
J033106K14GTTGGGCCCCNONE
J033125P22CAACGGTCNONE
J033125P22GTTGGGCCCCNONE
Os02g0772500AK100349AGCCCAACAProtein prenyltransferase domain containing protein.
J023082M21AGCCCAACANONE
J065047H11AGCCCAACANONE
J065055F20AGCCCAACANONE
J065082I22AGCCCAACANONE
J100074B04AGCCCAACANONE
Os02g0774300AK065228GCAGCCCAACASimilar to Heat shock 70 kDa protein, mitochondrial precursor.
Os02g0775900AK119974GGTTGGGCCGGAConserved hypothetical protein.
Os02g0776800AB042415ATCCAACGGCTNONE
AK072308ATCCAACGGCTReplication protein A 70kDa.
AK101212ATCCAACGGCTNONE
J033031B02ATCCAACGGCTNONE
J090004E18ATCCAACGGCTNONE
J090084C24ATCCAACGGCTNONE
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE
AK072784GCTGGGCCGGCCCAACNONE
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein.
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein.
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE
J023075M13GCTGGGCCGGCCCAACNONE
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE
J023077P14GCTGGGCCGGCCCAACNONE
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE
J023123C16GCTGGGCCGGCCCAACNONE
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE
J023142P06GCTGGGCCGGCCCAACNONE
Os02g0782200AK070439AGCCCAACTNONE
AK101869AGCCCAACTNOT2/NOT3/NOT5 domain containing protein.
Os02g0788400AK060351GTTGGTGGNONE
AK103497GTTGGTGGSimilar to Eukaryotic translation initiation factor 3 subunit-like protein.
Os02g0788800AK066747AACGGGCCAmino acid/polyamine transporter II family protein.
Os02g0789600AK101046CAACGGTCNONE
AK112100CAACGGTCSimilar to DEM2.
Os02g0791400009-106-F11AACGGGCCGGANONE
AK062787AACGGGCCGGACytochrome oxidase c, subunit VIb family protein.
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein.
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE
Os02g0796900009-121-E06AGCCCAACANONE
D29725AGCCCAACASimilar to 60S ribosomal protein L39.
J075016N24AGCCCAACANONE
J075085F03AGCCCAACANONE
J075147P11AGCCCAACANONE
J075180E16AGCCCAACANONE
J075182A19AGCCCAACANONE
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein.
Os02g0801900006-113-E02AACGGGCCGTGNONE
006-113-E02AACGGGCCGTGNONE
006-113-E02CACGGCCCGTTNONE
AK109488AACGGGCCGTGNONE
AK109488AACGGGCCGTGNONE
AK109488CACGGCCCGTTNONE
AK109498AACGGGCCGTGConserved hypothetical protein.
AK109498AACGGGCCGTGConserved hypothetical protein.
AK109498CACGGCCCGTTConserved hypothetical protein.
J065007D19AACGGGCCGTGNONE
J065007D19AACGGGCCGTGNONE
J065007D19CACGGCCCGTTNONE
J065035G11AACGGGCCGTGNONE
J065035G11AACGGGCCGTGNONE
J065035G11CACGGCCCGTTNONE
J065044E05AACGGGCCGTGNONE
J065044E05AACGGGCCGTGNONE
J065044E05CACGGCCCGTTNONE
J065112N01AACGGGCCGTGNONE
J065112N01AACGGGCCGTGNONE
J065112N01CACGGCCCGTTNONE
J065143B03AACGGGCCGTGNONE
J065143B03AACGGGCCGTGNONE
J065143B03CACGGCCCGTTNONE
J065159A16AACGGGCCGTGNONE
J065159A16AACGGGCCGTGNONE
J065159A16CACGGCCCGTTNONE
J090007K23AACGGGCCGTGNONE
J090007K23AACGGGCCGTGNONE
J090007K23CACGGCCCGTTNONE
J090045N09AACGGGCCGTGNONE
J090045N09AACGGGCCGTGNONE
J090045N09CACGGCCCGTTNONE
J090049L20AACGGGCCGTGNONE
J090049L20AACGGGCCGTGNONE
J090049L20CACGGCCCGTTNONE
Os02g0803600AK064750CCACCAACLongin-like domain containing protein.
Os02g0807750J075136J04CAACGGCCGAGATHypothetical protein.
Os02g0812500AK106918AGCCGTTGCyclin-like F-box domain containing protein.
Os02g0813600AK107210AGCCGTTGVery-long-chain 3-ketoacyl-CoA synthase family protein.
Os02g0815300AK061607TGTTGGGCCATConserved hypothetical protein.
J075088I01TGTTGGGCCATNONE
Os02g0816700009-132-E07AGTTGGGCCCAATTNONE
AK059572AGTTGGGCCCAATTConserved hypothetical protein.
Os02g0816800013-089-A09AATTGGGCCCAACTNONE
013-089-A09GGACGCGTCCACCAACNONE
AK102271AATTGGGCCCAACTNAD-dependent epimerase/dehydratase family protein.
AK102271GGACGCGTCCACCAACNAD-dependent epimerase/dehydratase family protein.
J013105O04AATTGGGCCCAACTNONE
J013105O04GGACGCGTCCACCAACNONE
J013124I08AATTGGGCCCAACTNONE
J013124I08GGACGCGTCCACCAACNONE
J023002E08AATTGGGCCCAACTNONE
J023002E08GGACGCGTCCACCAACNONE
J023025C01AATTGGGCCCAACTNONE
J023025C01GGACGCGTCCACCAACNONE
J023037O12AATTGGGCCCAACTNONE
J023037O12GGACGCGTCCACCAACNONE
J023049N06AATTGGGCCCAACTNONE
J023049N06GGACGCGTCCACCAACNONE
J023069G18AATTGGGCCCAACTNONE
J023069G18GGACGCGTCCACCAACNONE
J033029M02AATTGGGCCCAACTNONE
J033029M02GGACGCGTCCACCAACNONE
J033037L22AATTGGGCCCAACTNONE
J033037L22GGACGCGTCCACCAACNONE
J033089A08AATTGGGCCCAACTNONE
J033089A08GGACGCGTCCACCAACNONE
J033103L07AATTGGGCCCAACTNONE
J033103L07GGACGCGTCCACCAACNONE
J033125L19AATTGGGCCCAACTNONE
J033125L19GGACGCGTCCACCAACNONE
J090008N20AATTGGGCCCAACTNONE
J090008N20GGACGCGTCCACCAACNONE
J090041F23AATTGGGCCCAACTNONE
J090041F23GGACGCGTCCACCAACNONE
J090092H16AATTGGGCCCAACTNONE
J090092H16GGACGCGTCCACCAACNONE
Os02g0821200AK062099AGCCCAACARibosomal L28e protein family protein.
J013108I22AGCCCAACANONE
J023064L18AGCCCAACANONE
J023115G17AGCCCAACANONE
J033093D09AGCCCAACANONE
J053025G17AGCCCAACANONE
J053054J01AGCCCAACANONE
J065095B03AGCCCAACANONE
J065110E08AGCCCAACANONE
J065114F23AGCCCAACANONE
J065152G14AGCCCAACANONE
J080022M24AGCCCAACANONE
J080041G10AGCCCAACANONE
J080043E22AGCCCAACANONE
J080046G15AGCCCAACANONE
J090018A08AGCCCAACANONE
J090067B05AGCCCAACANONE
J090088G12AGCCCAACANONE
J100042G06AGCCCAACANONE
J100066H17AGCCCAACANONE
J100068M21AGCCCAACANONE
Os02g0821800014-086-A11CAACGGCCNONE
AK071291CAACGGCCNONE
J023088O08CAACGGCCNONE
J033130D23CAACGGCCNONE
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein.
J065055C02AGTTGGGCCGTTGGNONE
J065098A17AGTTGGGCCGTTGGNONE
J065119B13AGTTGGGCCGTTGGNONE
J065146F10AGTTGGGCCGTTGGNONE
J065209G06AGTTGGGCCGTTGGNONE
J080001K12AGTTGGGCCGTTGGNONE
J080004O17AGTTGGGCCGTTGGNONE
J080005P21AGTTGGGCCGTTGGNONE
J080009M18AGTTGGGCCGTTGGNONE
J080013O18AGTTGGGCCGTTGGNONE
J080014B04AGTTGGGCCGTTGGNONE
J080014O21AGTTGGGCCGTTGGNONE
J080015B04AGTTGGGCCGTTGGNONE
J080016B17AGTTGGGCCGTTGGNONE
J080017G09AGTTGGGCCGTTGGNONE
J080022A17AGTTGGGCCGTTGGNONE
J080024M10AGTTGGGCCGTTGGNONE
J080025F17AGTTGGGCCGTTGGNONE
J080025O16AGTTGGGCCGTTGGNONE
J080029H09AGTTGGGCCGTTGGNONE
J080030G24AGTTGGGCCGTTGGNONE
J080031E02AGTTGGGCCGTTGGNONE
J080032A18AGTTGGGCCGTTGGNONE
J080032G24AGTTGGGCCGTTGGNONE
J080033C05AGTTGGGCCGTTGGNONE
J080033N19AGTTGGGCCGTTGGNONE
J080035H10AGTTGGGCCGTTGGNONE
J080035L05AGTTGGGCCGTTGGNONE
J080042N09AGTTGGGCCGTTGGNONE
J080044C14AGTTGGGCCGTTGGNONE
J080048K16AGTTGGGCCGTTGGNONE
J080050L07AGTTGGGCCGTTGGNONE
J080051L06AGTTGGGCCGTTGGNONE
J080051P22AGTTGGGCCGTTGGNONE
J080053D09AGTTGGGCCGTTGGNONE
J080053J15AGTTGGGCCGTTGGNONE
J080053O12AGTTGGGCCGTTGGNONE
J080057L01AGTTGGGCCGTTGGNONE
J080062E08AGTTGGGCCGTTGGNONE
J080062I09AGTTGGGCCGTTGGNONE
J080063A21AGTTGGGCCGTTGGNONE
J080063E04AGTTGGGCCGTTGGNONE
J080063E08AGTTGGGCCGTTGGNONE
J080064D15AGTTGGGCCGTTGGNONE
J080064N15AGTTGGGCCGTTGGNONE
J080068F13AGTTGGGCCGTTGGNONE
J080070L16AGTTGGGCCGTTGGNONE
J080072O17AGTTGGGCCGTTGGNONE
J080075A07AGTTGGGCCGTTGGNONE
J080076H10AGTTGGGCCGTTGGNONE
J080077K19AGTTGGGCCGTTGGNONE
J080078E19AGTTGGGCCGTTGGNONE
J080082A02AGTTGGGCCGTTGGNONE
J080083O05AGTTGGGCCGTTGGNONE
J080091I07AGTTGGGCCGTTGGNONE
J080094K10AGTTGGGCCGTTGGNONE
J080094N03AGTTGGGCCGTTGGNONE
J080096F09AGTTGGGCCGTTGGNONE
J080097O04AGTTGGGCCGTTGGNONE
J090037B19AGTTGGGCCGTTGGNONE
J100017A13AGTTGGGCCGTTGGNONE
J100068N22AGTTGGGCCGTTGGNONE
J100072C06AGTTGGGCCGTTGGNONE
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein.
J075055J16GCAGCCCATACAACGGGCCCAACTNONE
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein.
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1.
AY224582GCCGGCCCAGCCCAACANONE
J023034L01GCCGGCCCAGCCCAACANONE
J023034M01GCCGGCCCAGCCCAACANONE
J090010G06GCCGGCCCAGCCCAACANONE
J090020D07GCCGGCCCAGCCCAACANONE
J100041L04GCCGGCCCAGCCCAACANONE
J100061D05GCCGGCCCAGCCCAACANONE
J100070L18GCCGGCCCAGCCCAACANONE
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein.
J033069G13TGTTGGGCTGGGCCGGCNONE
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein.
Os02g0831800009-150-D09GTTGGTGGGCCATNONE
AK060519GTTGGTGGGCCATSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2.
J075143E03GTTGGTGGGCCATNONE
J100077H12GTTGGTGGGCCATNONE
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2).
Os02g0833400014-050-E05GGCCGTTGNONE
AK063696GGCCGTTGNONE
AK073112GGCCGTTGConserved hypothetical protein.
J013158K22GGCCGTTGNONE
J033024H02GGCCGTTGNONE
J065038D20GGCCGTTGNONE
J065044M04GGCCGTTGNONE
J065073D22GGCCGTTGNONE
J065161A22GGCCGTTGNONE
J090080A20GGCCGTTGNONE
Os03g0101600006-047-B09GTTGGTGGNONE
006-082-H11GTTGGTGGNONE
AK061143GTTGGTGGNONE
AK069374GTTGGTGGSimilar to Quinone oxidoreductase.
J023012O14GTTGGTGGNONE
Os03g0108000014-001-C09AACGGGCCGAGNONE
AK102520AACGGGCCGAGSimilar to Dual specificity phosphatase Cdc25 (EC 3.1.3.48) (Arath;CDC25).
J023083K07AACGGGCCGAGNONE
J023110F13AACGGGCCGAGNONE
J033095O09AACGGGCCGAGNONE
J065219M15AACGGGCCGAGNONE
J075009G03AACGGGCCGAGNONE
J080301C17AACGGGCCGAGNONE
J080301I02AACGGGCCGAGNONE
J080301O05AACGGGCCGAGNONE
J080305C08AACGGGCCGAGNONE
J080305D11AACGGGCCGAGNONE
J080311B05AACGGGCCGAGNONE
J080316A17AACGGGCCGAGNONE
J080317K12AACGGGCCGAGNONE
J100087M06AACGGGCCGAGNONE
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor.
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein.
J013047E20CCACGGCCCGGCCCAACTNONE
J065026F21CCACGGCCCGGCCCAACTNONE
J065047B03CCACGGCCCGGCCCAACTNONE
J065054J12CCACGGCCCGGCCCAACTNONE
J065079M24CCACGGCCCGGCCCAACTNONE
J065093M07CCACGGCCCGGCCCAACTNONE
J065153F02CCACGGCCCGGCCCAACTNONE
J065155E21CCACGGCCCGGCCCAACTNONE
J065179H15CCACGGCCCGGCCCAACTNONE
J075019N02CCACGGCCCGGCCCAACTNONE
J075089E01CCACGGCCCGGCCCAACTNONE
J090066I18CCACGGCCCGGCCCAACTNONE
J090087K20CCACGGCCCGGCCCAACTNONE
J100079F05CCACGGCCCGGCCCAACTNONE
Os03g0119000006-027-A04ATCCAACGGNONE
006-096-F10ATCCAACGGNONE
AK071417ATCCAACGGProlyl 4-hydroxylase, alpha subunit domain containing protein.
AK104225ATCCAACGGNONE
AK104441ATCCAACGGNONE
J013129D22ATCCAACGGNONE
J023091L16ATCCAACGGNONE
J090094H21ATCCAACGGNONE
Os03g0120200AK102865CCACCAACNONE
Os03g0121300AK120047TCAGCCCAACTNONE
Os03g0123600006-064-G05ATCCAACGGCCGAAANONE
AK101248ATCCAACGGCCGAAANONE
AK105012ATCCAACGGCCGAAAProtein of unknown function Cys-rich family protein.
AK109354ATCCAACGGCCGAAANONE
J033032D06ATCCAACGGCCGAAANONE
J080308A01ATCCAACGGCCGAAANONE
J090071H02ATCCAACGGCCGAAANONE
J100048C10ATCCAACGGCCGAAANONE
Os03g0124300AK069148CAAGCCCAACCConserved hypothetical protein.
AK106076CAAGCCCAACCNONE
J023003G19CAAGCCCAACCNONE
Os03g0124850Os03g0124850CCCATCCAACGNONE
Os03g0126000AK121680GTTGGTGGSimilar to Phosphorybosyl anthranilate transferase 1.
AY224452GTTGGTGGNONE
Os03g0126800J075039C05CCACCAACNONE
J075172P07CCACCAACNONE
J075176L13CCACCAACNONE
J075180L10CCACCAACNONE
J090019H18CCACCAACNONE
J090024P22CCACCAACNONE
Os03g0127900009-144-F12GCCGTTGGANONE
AK062977GCCGTTGGASodium/hydrogen exchanger family protein.
Os03g0128300AK064718CCAACGGCTConserved hypothetical protein.
Os03g0129100003-009-E09CCAACGGCCNONE
AF384030CCAACGGCCNONE
AK098993CCAACGGCCSeven transmembrane protein MLO2.
AK111990CCAACGGCCNONE
J013098A12CCAACGGCCNONE
J023020M16CCAACGGCCNONE
J043001L02CCAACGGCCNONE
Os03g0130700AK110670GGCTGGGCCCAACANONE
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein.
Os03g0134300AK102053CGTTGGATSimilar to ATP phosphoribosyl transferase.
Os03g0135300004-017-A10ATCCAACGNONE
006-046-A11ATCCAACGNONE
006-110-B05ATCCAACGNONE
AF309384ATCCAACGNONE
AK071745ATCCAACGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18).
AK104680ATCCAACGNONE
J013100M12ATCCAACGNONE
J023107J18ATCCAACGNONE
J033081B13ATCCAACGNONE
J033087L03ATCCAACGNONE
J065120N18ATCCAACGNONE
J075032C15ATCCAACGNONE
J075172P14ATCCAACGNONE
J090049B05ATCCAACGNONE
Os03g0136200004-011-E10AACGGGCCTTGNONE
006-067-A08AACGGGCCTTGNONE
011-007-E02AACGGGCCTTGNONE
011-099-H10AACGGGCCTTGNONE
012-044-D08AACGGGCCTTGNONE
013-045-G12AACGGGCCTTGNONE
013-062-C09AACGGGCCTTGNONE
013-072-F09AACGGGCCTTGNONE
013-085-B12AACGGGCCTTGNONE
013-097-E09AACGGGCCTTGNONE
013-097-F09AACGGGCCTTGNONE
014-013-C09AACGGGCCTTGNONE
014-082-D08AACGGGCCTTGNONE
015-071-A09AACGGGCCTTGNONE
AF042333AACGGGCCTTGNONE
AK060887AACGGGCCTTGNONE
AK121681AACGGGCCTTG24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2).
J013073N14AACGGGCCTTGNONE
J013123F01AACGGGCCTTGNONE
J023050A02AACGGGCCTTGNONE
J033046H22AACGGGCCTTGNONE
J033070A11AACGGGCCTTGNONE
J065059G11AACGGGCCTTGNONE
J065068F10AACGGGCCTTGNONE
J065164A10AACGGGCCTTGNONE
J075031F07AACGGGCCTTGNONE
J075054J01AACGGGCCTTGNONE
J075086M04AACGGGCCTTGNONE
J075118K23AACGGGCCTTGNONE
J075122A09AACGGGCCTTGNONE
J075123D06AACGGGCCTTGNONE
J075129A22AACGGGCCTTGNONE
J075161E07AACGGGCCTTGNONE
J075179H04AACGGGCCTTGNONE
J075181C06AACGGGCCTTGNONE
J075186A12AACGGGCCTTGNONE
J090014H16AACGGGCCTTGNONE
J090045G17AACGGGCCTTGNONE
J090048B09AACGGGCCTTGNONE
J090052J23AACGGGCCTTGNONE
J090052K22AACGGGCCTTGNONE
J090059F10AACGGGCCTTGNONE
J090080F19AACGGGCCTTGNONE
J100039J08AACGGGCCTTGNONE
J100044K02AACGGGCCTTGNONE
J100051E16AACGGGCCTTGNONE
J100053F08AACGGGCCTTGNONE
J100056F07AACGGGCCTTGNONE
J100058A10AACGGGCCTTGNONE
Os03g0137600006-057-G05CCACCAACNONE
006-089-H04CCACCAACNONE
006-105-G08CCACCAACNONE
006-107-A12CCACCAACNONE
AK058690CCACCAACNONE
AK061189CCACCAACConserved hypothetical protein.
AK099311CCACCAACNONE
AK104115CCACCAACNONE
J023149H01CCACCAACNONE
J100054J06CCACCAACNONE
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein.
Os03g0142900011-054-A05CAACGGCCCATTNONE
AK067103CAACGGCCCATTNONE
AK120438CAACGGCCCATTProtein of unknown function DUF946, plant family protein.
J013097D18CAACGGCCCATTNONE
J013098E18CAACGGCCCATTNONE
J013099I17CAACGGCCCATTNONE
J013108C09CAACGGCCCATTNONE
J023045J15CAACGGCCCATTNONE
J033034E13CAACGGCCCATTNONE
J033095F07CAACGGCCCATTNONE
J033102N22CAACGGCCCATTNONE
J065016C14CAACGGCCCATTNONE
J065034E13CAACGGCCCATTNONE
J065065F21CAACGGCCCATTNONE
J065159M09CAACGGCCCATTNONE
J075012C13CAACGGCCCATTNONE
J075017P18CAACGGCCCATTNONE
J075018M03CAACGGCCCATTNONE
J075021H19CAACGGCCCATTNONE
J075070K23CAACGGCCCATTNONE
J075077B18CAACGGCCCATTNONE
J075085E20CAACGGCCCATTNONE
J075090N23CAACGGCCCATTNONE
J075137M16CAACGGCCCATTNONE
J075151E03CAACGGCCCATTNONE
J090042L02CAACGGCCCATTNONE
J090060C21CAACGGCCCATTNONE
J090089I17CAACGGCCCATTNONE
J100024L19CAACGGCCCATTNONE
J100025A06CAACGGCCCATTNONE
J100033C24CAACGGCCCATTNONE
J100052J17CAACGGCCCATTNONE
J100063H10CAACGGCCCATTNONE
J100073P04CAACGGCCCATTNONE
J100075D01CAACGGCCCATTNONE
J100077J17CAACGGCCCATTNONE
J100087F03CAACGGCCCATTNONE
J100087F09CAACGGCCCATTNONE
Os03g0143000AK073102AAACGGCCCGTTSAM (and some other nucleotide) binding motif domain containing protein.
J033051I24AAACGGCCCGTTNONE
Os03g0145600015-010-B10GGCCCGTTNONE
AK106243GGCCCGTTQuinonprotein alcohol dehydrogenase-like domain containing protein.
Os03g0146300011-078-E08ATCCAACGGCCNONE
014-009-B07ATCCAACGGCCNONE
AK121395ATCCAACGGCCSimilar to Cyclin-dependent kinases regulatory subunit.
AY583319ATCCAACGGCCNONE
J013104I06ATCCAACGGCCNONE
J023130M16ATCCAACGGCCNONE
J053037E13ATCCAACGGCCNONE
J075104M08ATCCAACGGCCNONE
J075144I22ATCCAACGGCCNONE
J100057B09ATCCAACGGCCNONE
Os03g0146400AK111974CACGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment).
AK111974GGCCCGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment).
AK120554CACGGCCCGTTNONE
AK120554GGCCCGGCCCGTTNONE
J075060J10CACGGCCCGTTNONE
J075060J10GGCCCGGCCCGTTNONE
Os03g0148000AK110468ATCCAACGGProtein of unknown function DUF677 family protein.
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein.
AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein.
Os03g0151800AK064955AGCCCAACCNONE
AK098874AGCCCAACCNONE
AK098980AGCCCAACCNONE
AK099712AGCCCAACCNONE
AK099889AGCCCAACCNONE
AK121641AGCCCAACCSimilar to Cell division control protein 48 homolog A (AtCDC48a).
J013001A05AGCCCAACCNONE
J013001D04AGCCCAACCNONE
J013121O12AGCCCAACCNONE
Os03g0152800AK066205AGTTGGGCTProtein kinase-like domain containing protein.
AK100518AGTTGGGCTNONE
Os03g0152900Os03g0152900GCCGTTGGATKinesin, motor region domain containing protein.
Os03g0157900J043036K05GCCCACCAACNONE
J043036K05GCCCCACCCACCAACNONE
Os03g0159600AK106743CCAACGGCGTCCGATSimilar to Rab28 protein.
J075041K15CCAACGGCGTCCGATNONE
J075051E03CCAACGGCGTCCGATNONE
J075055P19CCAACGGCGTCCGATNONE
J075096D01CCAACGGCGTCCGATNONE
Os03g0160200AK064836GCCCAGATCCAACGGCTConserved hypothetical protein.
AK071081GCCCAGATCCAACGGCTNONE
AK100712GCCCAGATCCAACGGCTNONE
AK104859GCCCAGATCCAACGGCTNONE
J013000F21GCCCAGATCCAACGGCTNONE
J013024G05GCCCAGATCCAACGGCTNONE
J013035E12GCCCAGATCCAACGGCTNONE
J013041A17GCCCAGATCCAACGGCTNONE
J013045D10GCCCAGATCCAACGGCTNONE
J013045F04GCCCAGATCCAACGGCTNONE
J013046F04GCCCAGATCCAACGGCTNONE
J013047F10GCCCAGATCCAACGGCTNONE
J013051E10GCCCAGATCCAACGGCTNONE
J013059J07GCCCAGATCCAACGGCTNONE
J013059O17GCCCAGATCCAACGGCTNONE
J013060A20GCCCAGATCCAACGGCTNONE
J013063J23GCCCAGATCCAACGGCTNONE
J013066D19GCCCAGATCCAACGGCTNONE
J013069O08GCCCAGATCCAACGGCTNONE
J013088K24GCCCAGATCCAACGGCTNONE
J013098G04GCCCAGATCCAACGGCTNONE
J013100I15GCCCAGATCCAACGGCTNONE
J013102E18GCCCAGATCCAACGGCTNONE
J013102O09GCCCAGATCCAACGGCTNONE
J013119M18GCCCAGATCCAACGGCTNONE
J013123I19GCCCAGATCCAACGGCTNONE
J013146H15GCCCAGATCCAACGGCTNONE
J013149A14GCCCAGATCCAACGGCTNONE
J023003A05GCCCAGATCCAACGGCTNONE
J023013O19GCCCAGATCCAACGGCTNONE
J023044M05GCCCAGATCCAACGGCTNONE
J023048O03GCCCAGATCCAACGGCTNONE
J023049L17GCCCAGATCCAACGGCTNONE
J023060D22GCCCAGATCCAACGGCTNONE
J023060F20GCCCAGATCCAACGGCTNONE
J023069G09GCCCAGATCCAACGGCTNONE
J023086E11GCCCAGATCCAACGGCTNONE
J023091I09GCCCAGATCCAACGGCTNONE
J023091M19GCCCAGATCCAACGGCTNONE
J023101D06GCCCAGATCCAACGGCTNONE
J023109B03GCCCAGATCCAACGGCTNONE
J023113B14GCCCAGATCCAACGGCTNONE
J023114B19GCCCAGATCCAACGGCTNONE
J023115H16GCCCAGATCCAACGGCTNONE
J023134F22GCCCAGATCCAACGGCTNONE
J023139I06GCCCAGATCCAACGGCTNONE
J023150C02GCCCAGATCCAACGGCTNONE
J033033A14GCCCAGATCCAACGGCTNONE
J033058O11GCCCAGATCCAACGGCTNONE
J033060H13GCCCAGATCCAACGGCTNONE
J033075P14GCCCAGATCCAACGGCTNONE
J033084O05GCCCAGATCCAACGGCTNONE
J033087G04GCCCAGATCCAACGGCTNONE
J033092E18GCCCAGATCCAACGGCTNONE
J033101G23GCCCAGATCCAACGGCTNONE
J033112I05GCCCAGATCCAACGGCTNONE
J033118E14GCCCAGATCCAACGGCTNONE
J033118P04GCCCAGATCCAACGGCTNONE
J033123C07GCCCAGATCCAACGGCTNONE
J043003C01GCCCAGATCCAACGGCTNONE
J043024B21GCCCAGATCCAACGGCTNONE
J043030N04GCCCAGATCCAACGGCTNONE
J043039J02GCCCAGATCCAACGGCTNONE
J043039N08GCCCAGATCCAACGGCTNONE
J075006N21GCCCAGATCCAACGGCTNONE
J075008A16GCCCAGATCCAACGGCTNONE
J075018J16GCCCAGATCCAACGGCTNONE
J075023G04GCCCAGATCCAACGGCTNONE
J075134F18GCCCAGATCCAACGGCTNONE
J075181B05GCCCAGATCCAACGGCTNONE
J090014O14GCCCAGATCCAACGGCTNONE
J090020H22GCCCAGATCCAACGGCTNONE
J090022G17GCCCAGATCCAACGGCTNONE
J090023J24GCCCAGATCCAACGGCTNONE
J090033H01GCCCAGATCCAACGGCTNONE
J090038A03GCCCAGATCCAACGGCTNONE
J090041O22GCCCAGATCCAACGGCTNONE
J090049E10GCCCAGATCCAACGGCTNONE
J090063E24GCCCAGATCCAACGGCTNONE
J090080N12GCCCAGATCCAACGGCTNONE
J100021G23GCCCAGATCCAACGGCTNONE
J100028P06GCCCAGATCCAACGGCTNONE
J100060L21GCCCAGATCCAACGGCTNONE
J100077D16GCCCAGATCCAACGGCTNONE
J100088I09GCCCAGATCCAACGGCTNONE
Os03g0160900J065071D24CGGGCCCAACTNONE
J065132L03CGGGCCCAACTHypothetical protein.
J075189L19CGGGCCCAACTNONE
Os03g0161000AK120446CGTTGGATConserved hypothetical protein.
AK120446CGTTGGATConserved hypothetical protein.
J013045A18CGTTGGATNONE
J013045A18CGTTGGATNONE
J013099P14CGTTGGATNONE
J013099P14CGTTGGATNONE
J023077D21CGTTGGATNONE
J023077D21CGTTGGATNONE
J023091B08CGTTGGATNONE
J023091B08CGTTGGATNONE
J023134M05CGTTGGATNONE
J023134M05CGTTGGATNONE
J065078D20CGTTGGATNONE
J065078D20CGTTGGATNONE
J065102P15CGTTGGATNONE
J065102P15CGTTGGATNONE
J065139A01CGTTGGATNONE
J065139A01CGTTGGATNONE
J065166H24CGTTGGATNONE
J065166H24CGTTGGATNONE
J065182J24CGTTGGATNONE
J065182J24CGTTGGATNONE
J065192E15CGTTGGATNONE
J065192E15CGTTGGATNONE
J065204N16CGTTGGATNONE
J065204N16CGTTGGATNONE
J065218E18CGTTGGATNONE
J065218E18CGTTGGATNONE
J090048M16CGTTGGATNONE
J090048M16CGTTGGATNONE
Os03g0161400Os03g0161400TCGGCCCAACCIQ calmodulin-binding region domain containing protein.
Os03g0168200AK099530AGTTGGGCCAAConserved hypothetical protein.
Os03g0169100006-030-B01CCACCAACNONE
006-098-E09CCACCAACNONE
AF047444CCACCAACNONE
AK061772CCACCAACNONE
AK066306CCACCAACRibulose-phosphate 3-epimerase, chloroplast precursor (EC 5.1.3.1) (Pentose-5-phosphate 3-epimerase) (PPE) (RPE) (R5P3E).
AK099215CCACCAACNONE
J013025E07CCACCAACNONE
J013040K21CCACCAACNONE
J013045P06CCACCAACNONE
J013058K11CCACCAACNONE
J013063E18CCACCAACNONE
J013072B22CCACCAACNONE
J013096J08CCACCAACNONE
J075189H20CCACCAACNONE
J080039H06CCACCAACNONE
J080040H17CCACCAACNONE
Os03g0172200AK069130AGCCCAACTArmadillo-like helical domain containing protein.
Os03g0174200AK060616CATCCCCCCAACGGTCNONE
AK103762CATCCCCCCAACGGTCConserved hypothetical protein.
J033143G15CATCCCCCCAACGGTCNONE
J090025L02CATCCCCCCAACGGTCNONE
Os03g0175200J090059M15ATCCAACGNONE
Os03g0175600AK059981GTTGGGCCCCACSimilar to Nit protein 2 (CUA002).
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein.
Os03g0181600AK067807TAAGCCCACCAACGGCTSimilar to GATA transcription factor 25 (ZIM-like 2 protein).
AK067807TACGGCCCAACTSimilar to GATA transcription factor 25 (ZIM-like 2 protein).
AK101197TAAGCCCACCAACGGCTNONE
AK101197TACGGCCCAACTNONE
Os03g0186800AK100356CACGGCCCAACAModifier of rudimentary, Modr family protein.
Os03g0191100AK066434CCACCAACNONE
AK070661CCACCAACMitochondrial substrate carrier family protein.
AK103991CCACCAACNONE
Os03g0192400009-081-A03AGTTGGGCCGGTNONE
009-159-B02AGTTGGGCCGGTNONE
AK070573AGTTGGGCCGGTGRIM-19 family protein.
J023056B01AGTTGGGCCGGTNONE
J023075G06AGTTGGGCCGGTNONE
J033048K16AGTTGGGCCGGTNONE
J033048L16AGTTGGGCCGGTNONE
J053031H23AGTTGGGCCGGTNONE
J065002H14AGTTGGGCCGGTNONE
J065006G22AGTTGGGCCGGTNONE
J065032G13AGTTGGGCCGGTNONE
J065056A09AGTTGGGCCGGTNONE
J065078I01AGTTGGGCCGGTNONE
J065095G01AGTTGGGCCGGTNONE
J065095I18AGTTGGGCCGGTNONE
J065134M18AGTTGGGCCGGTNONE
J065158P07AGTTGGGCCGGTNONE
J065165K17AGTTGGGCCGGTNONE
J065181J12AGTTGGGCCGGTNONE
J065189N09AGTTGGGCCGGTNONE
J065200D13AGTTGGGCCGGTNONE
J065202H20AGTTGGGCCGGTNONE
J065215K20AGTTGGGCCGGTNONE
J075049N19AGTTGGGCCGGTNONE
J075147J16AGTTGGGCCGGTNONE
J090081E19AGTTGGGCCGGTNONE
J100017C16AGTTGGGCCGGTNONE
J100039M16AGTTGGGCCGGTNONE
J100043E23AGTTGGGCCGGTNONE
J100063L12AGTTGGGCCGGTNONE
J100079F22AGTTGGGCCGGTNONE
Os03g0192500AK068957CCACCAACGGTCProtein phosphatase 2C-like domain containing protein.
AY603974CCACCAACGGTCNONE
Os03g0197400AK071413AAGGCCCAACCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4).
AK104905AAGGCCCAACCNONE
J053023D18AAGGCCCAACCNONE
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE
AK059522GGTTGGGCTGTNONE
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment).
AK103101GGTTGGGCTGTSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment).
J075015H19CTGGCCCAACTTGGGCCCATCCNONE
J075015H19GGTTGGGCTGTNONE
J075036K08CTGGCCCAACTTGGGCCCATCCNONE
J075036K08GGTTGGGCTGTNONE
J075040J23CTGGCCCAACTTGGGCCCATCCNONE
J075040J23GGTTGGGCTGTNONE
J075041H18CTGGCCCAACTTGGGCCCATCCNONE
J075041H18GGTTGGGCTGTNONE
J075053H18CTGGCCCAACTTGGGCCCATCCNONE
J075053H18GGTTGGGCTGTNONE
J075055K15CTGGCCCAACTTGGGCCCATCCNONE
J075055K15GGTTGGGCTGTNONE
J075111K03CTGGCCCAACTTGGGCCCATCCNONE
J075111K03GGTTGGGCTGTNONE
J075125B22CTGGCCCAACTTGGGCCCATCCNONE
J075125B22GGTTGGGCTGTNONE
J075195L10CTGGCCCAACTTGGGCCCATCCNONE
J075195L10GGTTGGGCTGTNONE
Os03g0209400006-064-D01AGCCGTTGGATNONE
AK059829AGCCGTTGGATGot1-like protein family protein.
J075020J24AGCCGTTGGATNONE
J075021D13AGCCGTTGGATNONE
J075024F20AGCCGTTGGATNONE
J075030B10AGCCGTTGGATNONE
J075042D12AGCCGTTGGATNONE
J075053D16AGCCGTTGGATNONE
J075060J09AGCCGTTGGATNONE
J075097J19AGCCGTTGGATNONE
J075138D24AGCCGTTGGATNONE
J100030P20AGCCGTTGGATNONE
J100052N12AGCCGTTGGATNONE
Os03g0210400AK065966AACGGGCCProtein prenyltransferase domain containing protein.
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein.
Os03g0214400AK067931CCACCAACSimilar to Digalactosyldiacylglycerol synthase 2.
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein.
Os03g0218300015-078-G09GGCCGTTGConserved hypothetical protein.
J090095I10GGCCGTTGNONE
Os03g0219400AK100702CCACCAACGlycoside hydrolase, family 20 protein.
AK121985CCACCAACNONE
J023114O06CCACCAACNONE
J100043M20CCACCAACNONE
Os03g0220100006-023-B05GCAGCCCAACNONE
006-023-B05GTTGGTGGNONE
006-034-F08GCAGCCCAACNONE
006-034-F08GTTGGTGGNONE
006-093-A02GCAGCCCAACNONE
006-093-A02GTTGGTGGNONE
006-093-A06GCAGCCCAACNONE
006-093-A06GTTGGTGGNONE
011-078-E04GCAGCCCAACNONE
011-078-E04GTTGGTGGNONE
012-092-C04GCAGCCCAACNONE
012-092-C04GTTGGTGGNONE
AK066587GCAGCCCAACSimilar to Very-long-chain fatty acid condensing enzyme CUT1.
AK066587GTTGGTGGSimilar to Very-long-chain fatty acid condensing enzyme CUT1.
AK104714GCAGCCCAACNONE
AK104714GTTGGTGGNONE
AK106150GCAGCCCAACNONE
AK106150GTTGGTGGNONE
J013067C12GCAGCCCAACNONE
J013067C12GTTGGTGGNONE
J013074H08GCAGCCCAACNONE
J013074H08GTTGGTGGNONE
J013124K13GCAGCCCAACNONE
J013124K13GTTGGTGGNONE
J065007A03GCAGCCCAACNONE
J065007A03GTTGGTGGNONE
J065037H21GCAGCCCAACNONE
J065037H21GTTGGTGGNONE
J065081F03GCAGCCCAACNONE
J065081F03GTTGGTGGNONE
J090074C06GCAGCCCAACNONE
J090074C06GTTGGTGGNONE
Os03g0222800014-005-F12CCGAGCCGTTGNONE
AK109454CCGAGCCGTTGNONE
J065172P19CCGAGCCGTTGNONE
Os03g0227000AK068454CTGGCCCAACASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP).
Os03g0227500009-168-C09AGCCGTTGNONE
AK063077AGCCGTTGHypothetical protein.
J065005B20AGCCGTTGNONE
J075023J22AGCCGTTGNONE
J075097F10AGCCGTTGNONE
Os03g0231600AK105963CCACCAACSimilar to Branched-chain-amino-acid aminotransferase 3, chloroplast precursor (EC 2.6.1.42) (Atbcat-3).
AK120579CCACCAACNONE
Os03g0233500AK073139ATCCAACGGUBA-like domain containing protein.
Os03g0238800AY224467CAACGGCCConserved hypothetical protein.
AY224467GTGGGGCCTGGCCACCAACConserved hypothetical protein.
J013042E23CAACGGCCNONE
J013042E23GTGGGGCCTGGCCACCAACNONE
Os03g0240700009-086-G10AATGGGCCTAGCCCAACANONE
009-086-G10GGCCCGGCCCAACANONE
AK071799AATGGGCCTAGCCCAACAConserved hypothetical protein.
AK071799GGCCCGGCCCAACAConserved hypothetical protein.
J023112A13AATGGGCCTAGCCCAACANONE
J023112A13GGCCCGGCCCAACANONE
J043022A01AATGGGCCTAGCCCAACANONE
J043022A01GGCCCGGCCCAACANONE
J065106A01AATGGGCCTAGCCCAACANONE
J065106A01GGCCCGGCCCAACANONE
J075023P22AATGGGCCTAGCCCAACANONE
J075023P22GGCCCGGCCCAACANONE
J075138I21AATGGGCCTAGCCCAACANONE
J075138I21GGCCCGGCCCAACANONE
J075173L02AATGGGCCTAGCCCAACANONE
J075173L02GGCCCGGCCCAACANONE
Os03g0240800006-092-D05TGTTGGGCCGGGCCNONE
006-092-D05TGTTGGGCTAGGCCCATTNONE
AK059292TGTTGGGCCGGGCCNONE
AK059292TGTTGGGCTAGGCCCATTNONE
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp.
AK061178TGTTGGGCTAGGCCCATTSimilar to AGL157Cp.
AK121552TGTTGGGCCGGGCCNONE
AK121552TGTTGGGCTAGGCCCATTNONE
J023131D06TGTTGGGCCGGGCCNONE
J023131D06TGTTGGGCTAGGCCCATTNONE
J033033E14TGTTGGGCCGGGCCNONE
J033033E14TGTTGGGCTAGGCCCATTNONE
J033105B01TGTTGGGCCGGGCCNONE
J033105B01TGTTGGGCTAGGCCCATTNONE
J033114L18TGTTGGGCCGGGCCNONE
J033114L18TGTTGGGCTAGGCCCATTNONE
J033132N24TGTTGGGCCGGGCCNONE
J033132N24TGTTGGGCTAGGCCCATTNONE
J065032H03TGTTGGGCCGGGCCNONE
J065032H03TGTTGGGCTAGGCCCATTNONE
J065115J20TGTTGGGCCGGGCCNONE
J065115J20TGTTGGGCTAGGCCCATTNONE
J065150C05TGTTGGGCCGGGCCNONE
J065150C05TGTTGGGCTAGGCCCATTNONE
J080302A11TGTTGGGCCGGGCCNONE
J080302A11TGTTGGGCTAGGCCCATTNONE
J080302H16TGTTGGGCCGGGCCNONE
J080302H16TGTTGGGCTAGGCCCATTNONE
J080305M12TGTTGGGCCGGGCCNONE
J080305M12TGTTGGGCTAGGCCCATTNONE
J080306F13TGTTGGGCCGGGCCNONE
J080306F13TGTTGGGCTAGGCCCATTNONE
J080312A06TGTTGGGCCGGGCCNONE
J080312A06TGTTGGGCTAGGCCCATTNONE
J090088P09TGTTGGGCCGGGCCNONE
J090088P09TGTTGGGCTAGGCCCATTNONE
Os03g0242300AK065146GGCCCGTTConserved hypothetical protein.
J013002A22GGCCCGTTNONE
J023088H11GGCCCGTTNONE
J065083M12GGCCCGTTNONE
J065169P06GGCCCGTTNONE
J100037B08GGCCCGTTNONE
Os03g0245200003-116-E09AACGGGCCNONE
AK062288AACGGGCCProtein of unknown function DUF1210 family protein.
J075022G03AACGGGCCNONE
J075088C24AACGGGCCNONE
J075110L07AACGGGCCNONE
J075112K01AACGGGCCNONE
J075131F24AACGGGCCNONE
J075149D10AACGGGCCNONE
Os03g0245800013-094-D06CCAACGGCNONE
AB020973CCAACGGCNONE
AK063618CCAACGGCNONE
AK120045CCAACGGCNONE
AK120048CCAACGGCSimilar to Heat shock protein 26.
J075104O17CCAACGGCNONE
Os03g0248600AK073611AACGGGCCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2).
AK099342AACGGGCCNONE
AK099342CCAACGGCCCGGCNONE
AK104877AACGGGCCNONE
AK104877CCAACGGCCCGGCNONE
J013026L10AACGGGCCNONE
J013026L10CCAACGGCCCGGCNONE
J013055P12AACGGGCCNONE
J013055P12CCAACGGCCCGGCNONE
J023091A14AACGGGCCNONE
J023091A14CCAACGGCCCGGCNONE
J033034G07AACGGGCCNONE
J033034G07CCAACGGCCCGGCNONE
J033048H19AACGGGCCNONE
J033048H19CCAACGGCCCGGCNONE
J033128D07AACGGGCCNONE
J033128D07CCAACGGCCCGGCNONE
J065060L24AACGGGCCNONE
J065060L24CCAACGGCCCGGCNONE
J065176A19AACGGGCCNONE
J065176A19CCAACGGCCCGGCNONE
J090018K08AACGGGCCNONE
J090018K08CCAACGGCCCGGCNONE
J090023C03AACGGGCCNONE
J090023C03CCAACGGCCCGGCNONE
Os03g0249400009-059-H08AGTTGGGCCGAGANONE
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment).
J053031I05AGTTGGGCCGAGANONE
J053052E06AGTTGGGCCGAGANONE
J053061K22AGTTGGGCCGAGANONE
J065108I02AGTTGGGCCGAGANONE
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein.
Os03g0257600Os03g0257600CAACGGCCProtein of unknown function DUF292, eukaryotic domain containing protein.
Os03g0257600TCGGCCCAACProtein of unknown function DUF292, eukaryotic domain containing protein.
Os03g0257900009-150-G06CCTCGCCCACCAACNONE
009-150-G06TGTTGGGCCAANONE
009-181-H05CCTCGCCCACCAACNONE
009-181-H05TGTTGGGCCAANONE
AK063892CCTCGCCCACCAACNONE
AK063892TGTTGGGCCAANONE
AK100114CCTCGCCCACCAACSimilar to Lectin-like receptor kinase 7;2.
AK100114TGTTGGGCCAASimilar to Lectin-like receptor kinase 7;2.
AK103486CCTCGCCCACCAACNONE
AK103486TGTTGGGCCAANONE
J023006K11CCTCGCCCACCAACNONE
J023006K11TGTTGGGCCAANONE
J075005E15CCTCGCCCACCAACNONE
J075005E15TGTTGGGCCAANONE
J075007K24CCTCGCCCACCAACNONE
J075007K24TGTTGGGCCAANONE
J075034G06CCTCGCCCACCAACNONE
J075034G06TGTTGGGCCAANONE
J075051I19CCTCGCCCACCAACNONE
J075051I19TGTTGGGCCAANONE
J075076A08CCTCGCCCACCAACNONE
J075076A08TGTTGGGCCAANONE
J075096H04CCTCGCCCACCAACNONE
J075096H04TGTTGGGCCAANONE
J075115I09CCTCGCCCACCAACNONE
J075115I09TGTTGGGCCAANONE
J075132K23CCTCGCCCACCAACNONE
J075132K23TGTTGGGCCAANONE
J075147C17CCTCGCCCACCAACNONE
J075147C17TGTTGGGCCAANONE
J090059O20CCTCGCCCACCAACNONE
J090059O20TGTTGGGCCAANONE
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein.
AK066143TCAGCCCAACAConserved hypothetical protein.
Os03g0262500AK071153AGCCGTTGNONE
AK120384AGCCGTTGConserved hypothetical protein.
J023078H24AGCCGTTGNONE
Os03g0265900009-004-C01CCACCAACNONE
009-004-C01TGTTGGGCCTTNONE
009-045-B03CCACCAACNONE
009-045-B03TGTTGGGCCTTNONE
AK099963CCACCAACNONE
AK099963TGTTGGGCCTTNONE
AK120374CCACCAACConserved hypothetical protein.
AK120374TGTTGGGCCTTConserved hypothetical protein.
J013036A19CCACCAACNONE
J013036A19TGTTGGGCCTTNONE
J013070J20CCACCAACNONE
J013070J20TGTTGGGCCTTNONE
J013071C06CCACCAACNONE
J013071C06TGTTGGGCCTTNONE
J013088C01CCACCAACNONE
J013088C01TGTTGGGCCTTNONE
J013112H21CCACCAACNONE
J013112H21TGTTGGGCCTTNONE
J065114K10CCACCAACNONE
J065114K10TGTTGGGCCTTNONE
J100028M20CCACCAACNONE
J100028M20TGTTGGGCCTTNONE
Os03g0266000AK068775AAGGCCCAACAOvarian tumour, otubain domain containing protein.
AK068775GTTGGTGGOvarian tumour, otubain domain containing protein.
AK104949AAGGCCCAACANONE
AK104949GTTGGTGGNONE
J075149K24AAGGCCCAACANONE
J075149K24GTTGGTGGNONE
J075184C19AAGGCCCAACANONE
J075184C19GTTGGTGGNONE
Os03g0268300AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2.
J013043J22TAGGCCCAAGCCCAACCNONE
J013057J23TAGGCCCAAGCCCAACCNONE
J013149I10TAGGCCCAAGCCCAACCNONE
J013149M20TAGGCCCAAGCCCAACCNONE
J013151D14TAGGCCCAAGCCCAACCNONE
J013162O11TAGGCCCAAGCCCAACCNONE
J023001F12TAGGCCCAAGCCCAACCNONE
J023031B21TAGGCCCAAGCCCAACCNONE
J023080A07TAGGCCCAAGCCCAACCNONE
J023081N04TAGGCCCAAGCCCAACCNONE
J023090C08TAGGCCCAAGCCCAACCNONE
J023134G05TAGGCCCAAGCCCAACCNONE
J023139G17TAGGCCCAAGCCCAACCNONE
J023143I10TAGGCCCAAGCCCAACCNONE
J023147D04TAGGCCCAAGCCCAACCNONE
J023147O15TAGGCCCAAGCCCAACCNONE
J033102K23TAGGCCCAAGCCCAACCNONE
J033106C17TAGGCCCAAGCCCAACCNONE
J075033G19TAGGCCCAAGCCCAACCNONE
J075039J18TAGGCCCAAGCCCAACCNONE
J075050K20TAGGCCCAAGCCCAACCNONE
J075075J03TAGGCCCAAGCCCAACCNONE
J075080E16TAGGCCCAAGCCCAACCNONE
J075086L08TAGGCCCAAGCCCAACCNONE
J075091K19TAGGCCCAAGCCCAACCNONE
J075099O20TAGGCCCAAGCCCAACCNONE
J075104I06TAGGCCCAAGCCCAACCNONE
J075137C16TAGGCCCAAGCCCAACCNONE
J075152G03TAGGCCCAAGCCCAACCNONE
J075176N12TAGGCCCAAGCCCAACCNONE
J100086K11TAGGCCCAAGCCCAACCNONE
Os03g0270700AK119531TGTTGGGCCGTANONE
Os03g0276500011-014-A06ACCGGCCCAACNONE
012-043-E04ACCGGCCCAACNONE
012-096-G01ACCGGCCCAACNONE
014-005-A07ACCGGCCCAACNONE
014-031-F09ACCGGCCCAACNONE
014-040-C09ACCGGCCCAACNONE
014-092-G02ACCGGCCCAACNONE
AK072830ACCGGCCCAACNONE
AK099275ACCGGCCCAACNONE
AK109474ACCGGCCCAACSimilar to Heat shock protein 70.
J013036E08ACCGGCCCAACNONE
J013047P03ACCGGCCCAACNONE
J013048H14ACCGGCCCAACNONE
J013060E24ACCGGCCCAACNONE
J013093N10ACCGGCCCAACNONE
J013123K11ACCGGCCCAACNONE
J013153C09ACCGGCCCAACNONE
J023010D20ACCGGCCCAACNONE
J023027O13ACCGGCCCAACNONE
J023029B01ACCGGCCCAACNONE
J023063G14ACCGGCCCAACNONE
J023083D09ACCGGCCCAACNONE
J023091M13ACCGGCCCAACNONE
J023121M10ACCGGCCCAACNONE
J023126D10ACCGGCCCAACNONE
J023139H01ACCGGCCCAACNONE
J023145B18ACCGGCCCAACNONE
J033029G15ACCGGCCCAACNONE
J033050K13ACCGGCCCAACNONE
J033057L09ACCGGCCCAACNONE
J033092M15ACCGGCCCAACNONE
J065007N14ACCGGCCCAACNONE
J065038E07ACCGGCCCAACNONE
J065043A09ACCGGCCCAACNONE
J065100C19ACCGGCCCAACNONE
J065117C02ACCGGCCCAACNONE
J065213I04ACCGGCCCAACNONE
J090001F01ACCGGCCCAACNONE
J090025D07ACCGGCCCAACNONE
J090037C11ACCGGCCCAACNONE
J090047N11ACCGGCCCAACNONE
J090053O05ACCGGCCCAACNONE
J090070F11ACCGGCCCAACNONE
J090082O16ACCGGCCCAACNONE
J090085F20ACCGGCCCAACNONE
J090096N08ACCGGCCCAACNONE
Os03g0276600AK066437GTTGGTGGHypothetical protein.
Os03g0278500AK070850CCCATCCAACGGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein.
J023031B16CCCATCCAACGGNONE
Os03g0278900006-049-H12AGCCGTTGGATNONE
006-049-H12TACGGCCCGTTNONE
006-049-H12TGGATGGGCTAATGGGCCCAACTNONE
006-082-A07AGCCGTTGGATNONE
006-082-A07TACGGCCCGTTNONE
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE
009-169-C04AGCCGTTGGATNONE
009-169-C04TACGGCCCGTTNONE
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE
AK066019AGCCGTTGGATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein.
AK066019TACGGCCCGTTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein.
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein.
AK105925AGCCGTTGGATNONE
AK105925TACGGCCCGTTNONE
AK105925TGGATGGGCTAATGGGCCCAACTNONE
AY224460AGCCGTTGGATNONE
AY224460TACGGCCCGTTNONE
AY224460TGGATGGGCTAATGGGCCCAACTNONE
J065021K17AGCCGTTGGATNONE
J065021K17TACGGCCCGTTNONE
J065021K17TGGATGGGCTAATGGGCCCAACTNONE
J065141H24AGCCGTTGGATNONE
J065141H24TACGGCCCGTTNONE
J065141H24TGGATGGGCTAATGGGCCCAACTNONE
J065142J20AGCCGTTGGATNONE
J065142J20TACGGCCCGTTNONE
J065142J20TGGATGGGCTAATGGGCCCAACTNONE
J065152J03AGCCGTTGGATNONE
J065152J03TACGGCCCGTTNONE
J065152J03TGGATGGGCTAATGGGCCCAACTNONE
J065163A13AGCCGTTGGATNONE
J065163A13TACGGCCCGTTNONE
J065163A13TGGATGGGCTAATGGGCCCAACTNONE
J065191I21AGCCGTTGGATNONE
J065191I21TACGGCCCGTTNONE
J065191I21TGGATGGGCTAATGGGCCCAACTNONE
J065193K12AGCCGTTGGATNONE
J065193K12TACGGCCCGTTNONE
J065193K12TGGATGGGCTAATGGGCCCAACTNONE
J075003D01AGCCGTTGGATNONE
J075003D01TACGGCCCGTTNONE
J075003D01TGGATGGGCTAATGGGCCCAACTNONE
J075017D24AGCCGTTGGATNONE
J075017D24TACGGCCCGTTNONE
J075017D24TGGATGGGCTAATGGGCCCAACTNONE
J075060F20AGCCGTTGGATNONE
J075060F20TACGGCCCGTTNONE
J075060F20TGGATGGGCTAATGGGCCCAACTNONE
J075154C11AGCCGTTGGATNONE
J075154C11TACGGCCCGTTNONE
J075154C11TGGATGGGCTAATGGGCCCAACTNONE
J075173F04AGCCGTTGGATNONE
J075173F04TACGGCCCGTTNONE
J075173F04TGGATGGGCTAATGGGCCCAACTNONE
Os03g0285800AF216315GACCGTTGNONE
AF332873GACCGTTGNONE
AF479883GACCGTTGNONE
AF479884GACCGTTGNONE
AJ250311GACCGTTGNONE
AJ486975GACCGTTGNONE
AK067339GACCGTTGMAP Kinase.
AK104834GACCGTTGNONE
J013102O17GACCGTTGNONE
J023055N19GACCGTTGNONE
J023099F06GACCGTTGNONE
J065144H06GACCGTTGNONE
J065153A14GACCGTTGNONE
J065212K01GACCGTTGNONE
Os03g0287900009-074-B07TCCGGGCCAGCCCAACCNONE
014-027-E07TCCGGGCCAGCCCAACCNONE
AK063663TCCGGGCCAGCCCAACCSimilar to Protein disulfide isomerase.
J065009N21TCCGGGCCAGCCCAACCNONE
Os03g0288900AK100329CCAACGGCConserved hypothetical protein.
J023080H15CCAACGGCNONE
J033136I21CCAACGGCNONE
J065036A16CCAACGGCNONE
J065186A16CCAACGGCNONE
J065187B08CCAACGGCNONE
J065202E24CCAACGGCNONE
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE
J053029J05TTGGCCCATATAAGGCCCAACTNONE
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein.
J065024G23TTGGCCCATATAAGGCCCAACTNONE
J065036F08TTGGCCCATATAAGGCCCAACTNONE
J065066M11TTGGCCCATATAAGGCCCAACTNONE
J065143G19TTGGCCCATATAAGGCCCAACTNONE
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE
AK106050CACGTGGGCCCAACTNONE
Os03g0297100006-113-D12CTGGCCCAACNONE
AK059192CTGGCCCAACNONE
AK061276CTGGCCCAACSimilar to 40S ribosomal protein S7.
AK122143CTGGCCCAACNONE
J023012D24CTGGCCCAACNONE
J023041A08CTGGCCCAACNONE
J033067H08CTGGCCCAACNONE
J033119B03CTGGCCCAACNONE
J033131K19CTGGCCCAACNONE
J033136J20CTGGCCCAACNONE
J053027D07CTGGCCCAACNONE
J065191B01CTGGCCCAACNONE
J065205G10CTGGCCCAACNONE
J075112A12CTGGCCCAACNONE
J075136D05CTGGCCCAACNONE
J080069C17CTGGCCCAACNONE
J090073P06CTGGCCCAACNONE
J100026B16CTGGCCCAACNONE
J100068P21CTGGCCCAACNONE
J100069E15CTGGCCCAACNONE
J100081D07CTGGCCCAACNONE
J100088C15CTGGCCCAACNONE
Os03g0297400AK060653ACAGCCCAACNONE
AK061403ACAGCCCAACNONE
AK101597ACAGCCCAACMalonyl CoA-acyl carrier protein transacylase family protein.
Os03g0298600009-095-C02TCCACGCCACCAACNONE
AK066846TCCACGCCACCAACTetratricopeptide-like helical domain containing protein.
Os03g0302200AK120853AACGGGCCZinc finger, RING-type domain containing protein.
J023023P20AACGGGCCNONE
J023064E11AACGGGCCNONE
J033036C20AACGGGCCNONE
J043029P08AACGGGCCNONE
J065124C11AACGGGCCNONE
J090001K02AACGGGCCNONE
J090021D03AACGGGCCNONE
J090034D03AACGGGCCNONE
J090062J10AACGGGCCNONE
J100037A15AACGGGCCNONE
J100067M23AACGGGCCNONE
Os03g0302700006-099-F12CATCCACCAACNONE
AK112010CATCCACCAACZinc finger, RING-type domain containing protein.
AK121656CATCCACCAACNONE
J075090A19CATCCACCAACNONE
J075148M06CATCCACCAACNONE
Os03g0302900011-005-H01AGCCGTTGNONE
011-005-H01CCACCAACNONE
AK069222AGCCGTTGConserved hypothetical protein.
AK069222CCACCAACConserved hypothetical protein.
J023014L15AGCCGTTGNONE
J023014L15CCACCAACNONE
J033023G12AGCCGTTGNONE
J033023G12CCACCAACNONE
J090008H16AGCCGTTGNONE
J090008H16CCACCAACNONE
Os03g0305500AK070638GGTTGGGCCTTArgininosuccinate lyase domain containing protein.
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE
016-023-H09CTGGCCCAACNONE
016-023-H09TAGGCCCAACANONE
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein.
AK100355CTGGCCCAACUbiquitin-conjugating enzyme, E2 domain containing protein.
AK100355TAGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein.
J023013H05CGACACGTGGGCCCAACANONE
J023013H05CTGGCCCAACNONE
J023013H05TAGGCCCAACANONE
J023043K04CGACACGTGGGCCCAACANONE
J023043K04CTGGCCCAACNONE
J023043K04TAGGCCCAACANONE
J023083I20CGACACGTGGGCCCAACANONE
J023083I20CTGGCCCAACNONE
J023083I20TAGGCCCAACANONE
J033068F22CGACACGTGGGCCCAACANONE
J033068F22CTGGCCCAACNONE
J033068F22TAGGCCCAACANONE
J033125P21CGACACGTGGGCCCAACANONE
J033125P21CTGGCCCAACNONE
J033125P21TAGGCCCAACANONE
J065207A22CGACACGTGGGCCCAACANONE
J065207A22CTGGCCCAACNONE
J065207A22TAGGCCCAACANONE