version

Summary of GGGACCC (All List)

Organism Oryza sativa
PPDB Motif GGGACCC
Description function unknown
Total Entry Count 6017

Entry Sequences (6017 entries)

LocusGene modelSequenceDescription
Os01g0100900AY972084TGGGACCCPyridoxal-dependent decarboxylase family protein.
J100033B17TGGGACCCNONE
J100061H11TGGGACCCNONE
J100082C01TGGGACCCNONE
Os01g0102600AK064812GGTGGGACCCACShikimate kinase domain containing protein.
J013000E05GGTGGGACCCACNONE
J013027D08GGTGGGACCCACNONE
J013045K12GGTGGGACCCACNONE
J023119M03GGTGGGACCCACNONE
J065081F02GGTGGGACCCACNONE
J065180C08GGTGGGACCCACNONE
J065211M06GGTGGGACCCACNONE
J075073J06GGTGGGACCCACNONE
J075123A18GGTGGGACCCACNONE
J075124A07GGTGGGACCCACNONE
J075187B05GGTGGGACCCACNONE
Os01g0103600006-072-A01GTGGGTCCCACNONE
009-148-C12GTGGGTCCCACNONE
AK059848GTGGGTCCCACEmopamil-binding family protein.
AK102848GTGGGTCCCACNONE
J033036P20GTGGGTCCCACNONE
J065171N21GTGGGTCCCACNONE
J065209M02GTGGGTCCCACNONE
J075067A03GTGGGTCCCACNONE
J075110C09GTGGGTCCCACNONE
Os01g0104400006-026-B08GGGACCCGNONE
006-026-B08GTGGGTCCNONE
006-030-C01GGGACCCGNONE
006-030-C01GTGGGTCCNONE
006-055-E02GGGACCCGNONE
006-055-E02GTGGGTCCNONE
006-061-B12GGGACCCGNONE
006-061-B12GTGGGTCCNONE
006-064-F06GGGACCCGNONE
006-064-F06GTGGGTCCNONE
006-078-G10GGGACCCGNONE
006-078-G10GTGGGTCCNONE
006-079-G09GGGACCCGNONE
006-079-G09GTGGGTCCNONE
006-080-B08GGGACCCGNONE
006-080-B08GTGGGTCCNONE
006-100-E07GGGACCCGNONE
006-100-E07GTGGGTCCNONE
006-110-E01GGGACCCGNONE
006-110-E01GTGGGTCCNONE
006-118-D10GGGACCCGNONE
006-118-D10GTGGGTCCNONE
006-120-C12GGGACCCGNONE
006-120-C12GTGGGTCCNONE
AK060132GGGACCCGNONE
AK060132GTGGGTCCNONE
AK071375GGGACCCGRicin B-related lectin domain containing protein.
AK071375GTGGGTCCRicin B-related lectin domain containing protein.
AK104555GGGACCCGNONE
AK104555GTGGGTCCNONE
AK104820GGGACCCGNONE
AK104820GTGGGTCCNONE
J023121J21GGGACCCGNONE
J023121J21GTGGGTCCNONE
Os01g0104800AK067602TGAGGGACSas10/Utp3 family protein.
J013109E04TGAGGGACNONE
J033057M05TGAGGGACNONE
J043021M24TGAGGGACNONE
J090014N05TGAGGGACNONE
J090077H23TGAGGGACNONE
J090084H08TGAGGGACNONE
Os01g0131600006-030-A03TGAGGGACNONE
006-049-C10TGAGGGACNONE
006-054-E02TGAGGGACNONE
011-035-H02TGAGGGACNONE
011-036-E04TGAGGGACNONE
012-047-C08TGAGGGACNONE
012-079-F08TGAGGGACNONE
012-097-C02TGAGGGACNONE
012-100-A07TGAGGGACNONE
013-015-H05TGAGGGACNONE
013-047-A03TGAGGGACNONE
013-051-B05TGAGGGACNONE
013-061-G02TGAGGGACNONE
013-077-H02TGAGGGACNONE
015-005-D04TGAGGGACNONE
015-064-B06TGAGGGACNONE
015-072-D02TGAGGGACNONE
016-073-E09TGAGGGACNONE
016-088-H03TGAGGGACNONE
AK062063TGAGGGACNONE
AK101133TGAGGGACSimilar to AP2 domain containing protein RAP2.6 (Fragment).
AK102277TGAGGGACNONE
AK119645TGAGGGACNONE
AY341828TGAGGGACNONE
J013036O08TGAGGGACNONE
J013037M17TGAGGGACNONE
J013039B11TGAGGGACNONE
J013039L20TGAGGGACNONE
J013047B20TGAGGGACNONE
J013048E23TGAGGGACNONE
J013051E12TGAGGGACNONE
J013051F12TGAGGGACNONE
J013056B05TGAGGGACNONE
J013057N24TGAGGGACNONE
J013064D21TGAGGGACNONE
J013065G24TGAGGGACNONE
J013075L13TGAGGGACNONE
J013075L24TGAGGGACNONE
J013092F04TGAGGGACNONE
J013092F10TGAGGGACNONE
J013092M16TGAGGGACNONE
J013096K06TGAGGGACNONE
J013111F10TGAGGGACNONE
J013120B17TGAGGGACNONE
J013120P07TGAGGGACNONE
J013122F18TGAGGGACNONE
J013122H23TGAGGGACNONE
J013126I15TGAGGGACNONE
J013126L17TGAGGGACNONE
J013129C15TGAGGGACNONE
J013146A04TGAGGGACNONE
J013146A06TGAGGGACNONE
J013153F01TGAGGGACNONE
J013156O06TGAGGGACNONE
J013162D05TGAGGGACNONE
J023008N04TGAGGGACNONE
J023010D06TGAGGGACNONE
J023011I23TGAGGGACNONE
J023023I15TGAGGGACNONE
J023025C08TGAGGGACNONE
J023029H02TGAGGGACNONE
J023033C18TGAGGGACNONE
J023037D21TGAGGGACNONE
J023049F17TGAGGGACNONE
J023052B15TGAGGGACNONE
J023061D03TGAGGGACNONE
J023062M01TGAGGGACNONE
J023089D24TGAGGGACNONE
J023109J20TGAGGGACNONE
J023109M21TGAGGGACNONE
J023120N04TGAGGGACNONE
J023122A04TGAGGGACNONE
J023134F23TGAGGGACNONE
J023149E20TGAGGGACNONE
J033022A12TGAGGGACNONE
J033022C04TGAGGGACNONE
J033024K06TGAGGGACNONE
J033026F23TGAGGGACNONE
J033029J19TGAGGGACNONE
J033040H20TGAGGGACNONE
J033042P21TGAGGGACNONE
J033043F14TGAGGGACNONE
J033044G11TGAGGGACNONE
J033052L10TGAGGGACNONE
J033052O03TGAGGGACNONE
J033052P03TGAGGGACNONE
J033079B20TGAGGGACNONE
J033089D21TGAGGGACNONE
J033094P04TGAGGGACNONE
J033103N02TGAGGGACNONE
J033110J19TGAGGGACNONE
J033114E17TGAGGGACNONE
J033115K04TGAGGGACNONE
J033119I06TGAGGGACNONE
J033121L10TGAGGGACNONE
J033123H14TGAGGGACNONE
J033136H10TGAGGGACNONE
J033139L07TGAGGGACNONE
J033143G23TGAGGGACNONE
J043021F16TGAGGGACNONE
J080304G01TGAGGGACNONE
J080305H24TGAGGGACNONE
J080309B11TGAGGGACNONE
J080315N09TGAGGGACNONE
J080319J20TGAGGGACNONE
J090014D01TGAGGGACNONE
J090067F08TGAGGGACNONE
J090079P18TGAGGGACNONE
J090082K13TGAGGGACNONE
J090093K17TGAGGGACNONE
J090099G18TGAGGGACNONE
J100022K14TGAGGGACNONE
J100052G17TGAGGGACNONE
Os01g0132200AK108153TGGGTCCCConserved hypothetical protein.
Os01g0132700J065063N10TGAGGGACSurfeit locus 5 family protein.
J065164N24TGAGGGACNONE
J065167H04TGAGGGACNONE
J065187N12TGAGGGACNONE
Os01g0136200009-086-D11AGAGTGGGTCCNONE
013-096-H06AGAGTGGGTCCNONE
014-003-F08AGAGTGGGTCCNONE
014-010-A11AGAGTGGGTCCNONE
014-041-G02AGAGTGGGTCCNONE
014-071-E12AGAGTGGGTCCNONE
014-079-A06AGAGTGGGTCCNONE
AK121025AGAGTGGGTCC16.9 kDa class I heat shock protein.
J023050A14AGAGTGGGTCCNONE
J023061F18AGAGTGGGTCCNONE
J053050H23AGAGTGGGTCCNONE
J075018E12AGAGTGGGTCCNONE
J075018G01AGAGTGGGTCCNONE
J075050P17AGAGTGGGTCCNONE
J075057E02AGAGTGGGTCCNONE
J075155F14AGAGTGGGTCCNONE
J075183C11AGAGTGGGTCCNONE
J075186P15AGAGTGGGTCCNONE
Os01g0143800006-025-F03TGGGTCCCACNONE
006-028-B11TGGGTCCCACNONE
006-050-B02TGGGTCCCACNONE
006-063-C08TGGGTCCCACNONE
006-100-C05TGGGTCCCACNONE
AK066079TGGGTCCCACMitochondrial glycoprotein family protein.
AK104561TGGGTCCCACNONE
AK104721TGGGTCCCACNONE
J013052K21TGGGTCCCACNONE
J033051K24TGGGTCCCACNONE
Os01g0144600009-164-E06GGTCCCACCTGTCNONE
AK063058GGTCCCACCTGTCNONE
J065061I15GGTCCCACCTGTCNONE
J065128M13GGTCCCACCTGTCNONE
J065152N15GGTCCCACCTGTCNONE
J075170M11GGTCCCACCTGTCNONE
J090071M11GGTCCCACCTGTCNONE
J090073B22GGTCCCACCTGTCNONE
Os01g0147700AK066686GACAGGTGGGACCCACCCGRegion of unknown function, putative Zinc finger, XS and XH domain containing protein.
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE
006-081-C11GTGGGTCCAACGGCCCAGCNONE
009-050-D04GTGGGTCCAACGGCCCAGCNONE
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein.
J023058M18GTGGGTCCAACGGCCCAGCNONE
J023112H22GTGGGTCCAACGGCCCAGCNONE
J065048P05GTGGGTCCAACGGCCCAGCNONE
J100068N20GTGGGTCCAACGGCCCAGCNONE
J100073A02GTGGGTCCAACGGCCCAGCNONE
Os01g0172300AK106113GGTGGGACCCAConserved hypothetical protein.
Os01g0175100AK071289CGGGTCCCAKv1.4 voltage-gated K+ channel family protein.
J023088B10CGGGTCCCANONE
J065122H15CGGGTCCCANONE
J065140B19CGGGTCCCANONE
J100031E12CGGGTCCCANONE
J100068J03CGGGTCCCANONE
J100083E12CGGGTCCCANONE
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein.
Os01g0180300AK120377GTGGGTCCCACCACLipoprotein, type 6 family protein.
J013071N06GTGGGTCCCACCACNONE
J023088F12GTGGGTCCCACCACNONE
J100027H24GTGGGTCCCACCACNONE
J100053K15GTGGGTCCCACCACNONE
J100082M15GTGGGTCCCACCACNONE
Os01g0184800AK073377GGGACCCACGTGPhosducin family protein.
AK102544GGGACCCACGTGNONE
J023047L21GGGACCCACGTGNONE
J023135I09GGGACCCACGTGNONE
J033028G17GGGACCCACGTGNONE
J065164L07GGGACCCACGTGNONE
J065193F22GGGACCCACGTGNONE
J075035I10GGGACCCACGTGNONE
J075168H15GGGACCCACGTGNONE
Os01g0184900AF503585CACGTGGGTCCCNONE
AK066832CACGTGGGTCCCSimilar to SSRP1 protein.
AK068959CACGTGGGTCCCNONE
J013055F18CACGTGGGTCCCNONE
Os01g0198100AK119908TGGGTCCCACConserved hypothetical protein.
Os01g0206600J065041P19GTGGGACCConserved hypothetical protein.
Os01g0211600AK060710GTCCCACCCytochrome P450 family protein.
Os01g0239100Os01g0239100TGAGGGACHeat shock protein DnaJ family protein.
Os01g0239100TGAGGGACCCAHeat shock protein DnaJ family protein.
Os01g0242200AK107468GTGGGTCCZinc finger, C2H2-type domain containing protein.
Os01g0246500AK058984CCGATCCGATCCGTCCCACCSimilar to Minus dominance protein.
Os01g0258600J075028F17ACACGTGGGTCCNONE
J075061L04ACACGTGGGTCCConserved hypothetical protein.
J075071B09ACACGTGGGTCCNONE
J075093E04ACACGTGGGTCCNONE
J100033B11ACACGTGGGTCCNONE
Os01g0273300Os01g0273300GGTCCCACACGBSD domain containing protein.
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein.
AK109672TTCGTGGGTCCCACConserved hypothetical protein.
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE
J065013K07TTCGTGGGTCCCACNONE
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE
J065040E15TTCGTGGGTCCCACNONE
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE
J065127F12TTCGTGGGTCCCACNONE
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE
J075155K23TTCGTGGGTCCCACNONE
Os01g0286000AK109824GGGACCCASnf7 family protein.
Os01g0301700003-118-B08GTGGGTCCCACNONE
016-048-H09GTGGGTCCCACNONE
AK064223GTGGGTCCCACNONE
AK100563GTGGGTCCCACProtein prenyltransferase domain containing protein.
J023104I21GTGGGTCCCACNONE
Os01g0314300AK073419TGAGGGACUncharacterized domain 2 containing protein.
AK104939TGAGGGACNONE
J033044B03TGAGGGACNONE
J033060E12TGAGGGACNONE
J043037E21TGAGGGACNONE
J065019O18TGAGGGACNONE
J065025P22TGAGGGACNONE
J065042P06TGAGGGACNONE
J065074C19TGAGGGACNONE
J065074E13TGAGGGACNONE
J065094E05TGAGGGACNONE
J065108N08TGAGGGACNONE
J065134L13TGAGGGACNONE
J065152N24TGAGGGACNONE
J065162N24TGAGGGACNONE
J065170P16TGAGGGACNONE
J065177M20TGAGGGACNONE
J065187N01TGAGGGACNONE
J075012N12TGAGGGACNONE
J075046C17TGAGGGACNONE
J075055N06TGAGGGACNONE
J075141H03TGAGGGACNONE
J075150M11TGAGGGACNONE
J090005B16TGAGGGACNONE
J090079L11TGAGGGACNONE
J100039F16TGAGGGACNONE
Os01g0324400AK102854TGAGGGACNONE
AK111299TGAGGGACNONE
J033032A11TGAGGGACNONE
J033110L02TGAGGGACNONE
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE
AK064784GTGTGGGGCCCACGTGGGTCCCANONE
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein.
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein.
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE
Os01g0355400AK064594GTCCCACCConserved hypothetical protein.
AK107903GTCCCACCNONE
Os01g0379400016-006-B06GGGACCCANONE
AK064420GGGACCCANONE
AK102388GGGACCCANONE
AK110939GGGACCCACyclin-like F-box domain containing protein.
J033092D18GGGACCCANONE
J065070N09GGGACCCANONE
J065078L01GGGACCCANONE
J065083G15GGGACCCANONE
Os01g0391100AK108533CGCGTGGGACCCACCTGNONE
AK121200CGCGTGGGACCCACCTGSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18).
J023042H11CGCGTGGGACCCACCTGNONE
J023087I02CGCGTGGGACCCACCTGNONE
J065099C01CGCGTGGGACCCACCTGNONE
Os01g0500600AK067312GTCCCTCAHypothetical protein.
J013045G13GTCCCTCANONE
J013104N03GTCCCTCANONE
J033050D02GTCCCTCANONE
Os01g0506200AK073118CGGGTCCCTetratricopeptide-like helical domain containing protein.
J065002A07CGGGTCCCNONE
J065079J08CGGGTCCCNONE
J065167M18CGGGTCCCNONE
Os01g0517800J075194B21GGTCCCACProtein of unknown function DUF597 family protein.
Os01g0528300009-015-C05GTGGGTCCCACCNONE
AK062349GTGGGTCCCACCSimilar to HcrVf3 protein.
Os01g0558900AK058447TGAGGGACHypothetical protein.
Os01g0564300AK064825CGGGTCCCPeptidylprolyl isomerase, FKBP-type domain containing protein.
Os01g0588900AK071695GGACCCACTCCConserved hypothetical protein 730 family protein.
AK111103GGACCCACTCCNONE
J013134L19GGACCCACTCCNONE
J023074A10GGACCCACTCCNONE
J023109F04GGACCCACTCCNONE
J023143L07GGACCCACTCCNONE
J065022F16GGACCCACTCCNONE
J065083N22GGACCCACTCCNONE
J100040N10GGACCCACTCCNONE
J100043F13GGACCCACTCCNONE
J100075D13GGACCCACTCCNONE
J100080D22GGACCCACTCCNONE
Os01g0604100AK099765GTCCCTCAUspA domain containing protein.
J013094O21GTCCCTCANONE
Os01g0605700AK099440GTGGGTCCMtN3 and saliva related transmembrane protein family protein.
AK099440TGAGGGACMtN3 and saliva related transmembrane protein family protein.
J080001K02GTGGGTCCNONE
J080001K02TGAGGGACNONE
J080001P13GTGGGTCCNONE
J080001P13TGAGGGACNONE
J080006I22GTGGGTCCNONE
J080006I22TGAGGGACNONE
J080008F09GTGGGTCCNONE
J080008F09TGAGGGACNONE
J080014M23GTGGGTCCNONE
J080014M23TGAGGGACNONE
J080024L07GTGGGTCCNONE
J080024L07TGAGGGACNONE
J080035D17GTGGGTCCNONE
J080035D17TGAGGGACNONE
J080048D13GTGGGTCCNONE
J080048D13TGAGGGACNONE
J080056K03GTGGGTCCNONE
J080056K03TGAGGGACNONE
J080058M12GTGGGTCCNONE
J080058M12TGAGGGACNONE
J080062B20GTGGGTCCNONE
J080062B20TGAGGGACNONE
J080066B09GTGGGTCCNONE
J080066B09TGAGGGACNONE
J080069L03GTGGGTCCNONE
J080069L03TGAGGGACNONE
J080072P17GTGGGTCCNONE
J080072P17TGAGGGACNONE
J080094C01GTGGGTCCNONE
J080094C01TGAGGGACNONE
Os01g0618200AK102319GGTCCCACProtein phosphatase 2C family protein.
Os01g0618900AK099329GTGGTGGGACNONE
Os01g0622800009-061-H04GGACCCACNONE
009-167-C01GGACCCACNONE
AK063171GGACCCACConserved hypothetical protein.
Os01g0653700011-003-E09TGAGGGACNONE
AK073990TGAGGGACCyclin-like F-box domain containing protein.
AK120129TGAGGGACNONE
J033036F18TGAGGGACNONE
J033072D10TGAGGGACNONE
J033089B18TGAGGGACNONE
J033089J09TGAGGGACNONE
J033136J11TGAGGGACNONE
J065065E24TGAGGGACNONE
J090065L03TGAGGGACNONE
Os01g0654500013-057-E05GACAGGTGGGACCCANONE
AF155333GACAGGTGGGACCCANONE
AK061752GACAGGTGGGACCCASimilar to NADP-isocitrate dehydrogenase.
D21069GACAGGTGGGACCCANONE
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein.
Os01g0674500013-062-A08GGTGGGACNONE
AK072815GGTGGGACNONE
J023142B02GGTGGGACNONE
Os01g0681900AB008845GGGACCCGNADH dependent Glutamate Synthase precursor (EC 1.4.1.14).
AK105755GGGACCCGNONE
Os01g0694800015-093-H11GTCCCTCANONE
015-093-H11GTCCCTCANONE
015-093-H11GTGGGACCCACGTGGGCCCCACANONE
AK109275GTCCCTCAConserved hypothetical protein.
AK109275GTCCCTCAConserved hypothetical protein.
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein.
Os01g0695200015-090-F01GTCCCACCTGTCNONE
AK064145GTCCCACCTGTCProtein of unknown function DUF266, plant family protein.
J065163N10GTCCCACCTGTCNONE
J100051F21GTCCCACCTGTCNONE
Os01g0699400AK107168GGTCCCACProtein kinase-like domain containing protein.
Os01g0703300014-015-D07GTCCCACCNONE
AK099917GTCCCACCNONE
Os01g0703600011-041-C08TGGGACCCACNONE
AK060762TGGGACCCACNONE
AK065538TGGGACCCACSimilar to Mu1 adaptin.
J013030K02TGGGACCCACNONE
J013047M04TGGGACCCACNONE
J023009H11TGGGACCCACNONE
J065002E09TGGGACCCACNONE
J065043G09TGGGACCCACNONE
J065044C07TGGGACCCACNONE
J065187M20TGGGACCCACNONE
J065217N04TGGGACCCACNONE
J075039G19TGGGACCCACNONE
J075128P20TGGGACCCACNONE
J100037C10TGGGACCCACNONE
Os01g0706000006-098-D12TGAGGGACNONE
AK059936TGAGGGACSimilar to RNA polymerase II transcriptional coactivator KELP.
AK070545TGAGGGACNONE
AK104192TGAGGGACNONE
J023055M24TGAGGGACNONE
J033102J04TGAGGGACNONE
J065050P18TGAGGGACNONE
J065076D07TGAGGGACNONE
J065078O14TGAGGGACNONE
J065104L13TGAGGGACNONE
J065115J23TGAGGGACNONE
J065143P08TGAGGGACNONE
J065178N17TGAGGGACNONE
J065179H14TGAGGGACNONE
J065187J06TGAGGGACNONE
J075047B18TGAGGGACNONE
Os01g0706100AK072799TGAGGGACConserved hypothetical protein.
J013049G14TGAGGGACNONE
J023136E17TGAGGGACNONE
Os01g0708700AK102451GGACCCACCCGIQ calmodulin-binding region domain containing protein.
Os01g0719400012-066-H10GTGGGACCNONE
AK063516GTGGGACCConserved hypothetical protein.
Os01g0723000AK073592GGTGGGACCSimilar to Elongation factor EF-2 (Fragment).
AK102586GGTGGGACCNONE
J033048F11GGTGGGACCNONE
J033098E24GGTGGGACCNONE
Os01g0734000AK108909TGAGGGACSimilar to WRKY DNA binding protein.
AY341845TGAGGGACNONE
AY870607TGAGGGACNONE
Os01g0734600012-079-G06GGGACCCANONE
AK065450GGGACCCANONE
AK103129GGGACCCAUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK119562GGGACCCANONE
J075086F18GGGACCCANONE
J075147G07GGGACCCANONE
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein.
Os01g0754000014-081-F07TGAGGGACNONE
AK063730TGAGGGACConserved hypothetical protein.
J065219A11TGAGGGACNONE
J075136N13TGAGGGACNONE
J100051G01TGAGGGACNONE
J100053M22TGAGGGACNONE
Os01g0756300014-074-B05GTCCCACCNONE
AK069648GTCCCACCConserved hypothetical protein.
Os01g0757200AB092485GGGACCCGCGCNONE
AK060666GGGACCCGCGCNONE
AK060714GGGACCCGCGCNONE
AK099350GGGACCCGCGCNONE
AK101713GGGACCCGCGCSimilar to GA 2-oxidase 4.
Os01g0763600AK061563GACAGGTGGGTCCNONE
AK066596GACAGGTGGGTCCGlycerophosphoryl diester phosphodiesterase family protein.
J023057P15GACAGGTGGGTCCNONE
J065016A16GACAGGTGGGTCCNONE
J065039L06GACAGGTGGGTCCNONE
J090001E03GACAGGTGGGTCCNONE
J090012J18GACAGGTGGGTCCNONE
J090085E15GACAGGTGGGTCCNONE
Os01g0764000006-021-G03GGTCCCACNONE
006-021-G03GTCCCACCNONE
006-025-C07GGTCCCACNONE
006-025-C07GTCCCACCNONE
006-029-G11GGTCCCACNONE
006-029-G11GTCCCACCNONE
006-030-C04GGTCCCACNONE
006-030-C04GTCCCACCNONE
006-035-E05GGTCCCACNONE
006-035-E05GTCCCACCNONE
006-037-G01GGTCCCACNONE
006-037-G01GTCCCACCNONE
006-038-C01GGTCCCACNONE
006-038-C01GTCCCACCNONE
006-039-G05GGTCCCACNONE
006-039-G05GTCCCACCNONE
006-042-E11GGTCCCACNONE
006-042-E11GTCCCACCNONE
006-044-H04GGTCCCACNONE
006-044-H04GTCCCACCNONE
006-045-A10GGTCCCACNONE
006-045-A10GTCCCACCNONE
006-045-C05GGTCCCACNONE
006-045-C05GTCCCACCNONE
006-047-A11GGTCCCACNONE
006-047-A11GTCCCACCNONE
006-048-H10GGTCCCACNONE
006-048-H10GTCCCACCNONE
006-050-C01GGTCCCACNONE
006-050-C01GTCCCACCNONE
006-050-H11GGTCCCACNONE
006-050-H11GTCCCACCNONE
006-051-G10GGTCCCACNONE
006-051-G10GTCCCACCNONE
006-051-G11GGTCCCACNONE
006-051-G11GTCCCACCNONE
006-056-B04GGTCCCACNONE
006-056-B04GTCCCACCNONE
006-063-F04GGTCCCACNONE
006-063-F04GTCCCACCNONE
006-063-H12GGTCCCACNONE
006-063-H12GTCCCACCNONE
006-065-G09GGTCCCACNONE
006-065-G09GTCCCACCNONE
006-067-F11GGTCCCACNONE
006-067-F11GTCCCACCNONE
006-073-D10GGTCCCACNONE
006-073-D10GTCCCACCNONE
006-074-G09GGTCCCACNONE
006-074-G09GTCCCACCNONE
006-075-D04GGTCCCACNONE
006-075-D04GTCCCACCNONE
006-077-C10GGTCCCACNONE
006-077-C10GTCCCACCNONE
006-082-A10GGTCCCACNONE
006-082-A10GTCCCACCNONE
006-084-C12GGTCCCACNONE
006-084-C12GTCCCACCNONE
006-085-F05GGTCCCACNONE
006-085-F05GTCCCACCNONE
006-087-H12GGTCCCACNONE
006-087-H12GTCCCACCNONE
006-092-E10GGTCCCACNONE
006-092-E10GTCCCACCNONE
006-094-C06GGTCCCACNONE
006-094-C06GTCCCACCNONE
006-096-G11GGTCCCACNONE
006-096-G11GTCCCACCNONE
006-097-H11GGTCCCACNONE
006-097-H11GTCCCACCNONE
006-101-A07GGTCCCACNONE
006-101-A07GTCCCACCNONE
006-101-G08GGTCCCACNONE
006-101-G08GTCCCACCNONE
006-110-E08GGTCCCACNONE
006-110-E08GTCCCACCNONE
006-111-D04GGTCCCACNONE
006-111-D04GTCCCACCNONE
006-116-H04GGTCCCACNONE
006-116-H04GTCCCACCNONE
AK058894GGTCCCACNONE
AK058894GTCCCACCNONE
AK059818GGTCCCACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi).
AK059818GTCCCACCSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi).
AK099142GGTCCCACNONE
AK099142GTCCCACCNONE
J013119N15GGTCCCACNONE
J013119N15GTCCCACCNONE
J013123P15GGTCCCACNONE
J013123P15GTCCCACCNONE
J023055F24GGTCCCACNONE
J023055F24GTCCCACCNONE
J023125K17GGTCCCACNONE
J023125K17GTCCCACCNONE
J053050A20GGTCCCACNONE
J053050A20GTCCCACCNONE
J053056P10GGTCCCACNONE
J053056P10GTCCCACCNONE
J053074D19GGTCCCACNONE
J053074D19GTCCCACCNONE
J053078A14GGTCCCACNONE
J053078A14GTCCCACCNONE
J053086P10GGTCCCACNONE
J053086P10GTCCCACCNONE
J053094N23GGTCCCACNONE
J053094N23GTCCCACCNONE
J053095M23GGTCCCACNONE
J053095M23GTCCCACCNONE
J065006D02GGTCCCACNONE
J065006D02GTCCCACCNONE
J065030A17GGTCCCACNONE
J065030A17GTCCCACCNONE
J065030K04GGTCCCACNONE
J065030K04GTCCCACCNONE
J065035L12GGTCCCACNONE
J065035L12GTCCCACCNONE
J065046E12GGTCCCACNONE
J065046E12GTCCCACCNONE
J065065H19GGTCCCACNONE
J065065H19GTCCCACCNONE
J065073C01GGTCCCACNONE
J065073C01GTCCCACCNONE
J065105F01GGTCCCACNONE
J065105F01GTCCCACCNONE
J065131N16GGTCCCACNONE
J065131N16GTCCCACCNONE
J065144O13GGTCCCACNONE
J065144O13GTCCCACCNONE
J065160E12GGTCCCACNONE
J065160E12GTCCCACCNONE
J065160K02GGTCCCACNONE
J065160K02GTCCCACCNONE
J065163F09GGTCCCACNONE
J065163F09GTCCCACCNONE
J065165E18GGTCCCACNONE
J065165E18GTCCCACCNONE
J065174E04GGTCCCACNONE
J065174E04GTCCCACCNONE
J065175O08GGTCCCACNONE
J065175O08GTCCCACCNONE
J065191N24GGTCCCACNONE
J065191N24GTCCCACCNONE
J065193D19GGTCCCACNONE
J065193D19GTCCCACCNONE
J065198D04GGTCCCACNONE
J065198D04GTCCCACCNONE
J065200G09GGTCCCACNONE
J065200G09GTCCCACCNONE
J075016L06GGTCCCACNONE
J075016L06GTCCCACCNONE
J075017J11GGTCCCACNONE
J075017J11GTCCCACCNONE
J075019L08GGTCCCACNONE
J075019L08GTCCCACCNONE
J075028M08GGTCCCACNONE
J075028M08GTCCCACCNONE
J075029K05GGTCCCACNONE
J075029K05GTCCCACCNONE
J075039K04GGTCCCACNONE
J075039K04GTCCCACCNONE
J075047J22GGTCCCACNONE
J075047J22GTCCCACCNONE
J075079H13GGTCCCACNONE
J075079H13GTCCCACCNONE
J075095K14GGTCCCACNONE
J075095K14GTCCCACCNONE
J075111D21GGTCCCACNONE
J075111D21GTCCCACCNONE
J075131A19GGTCCCACNONE
J075131A19GTCCCACCNONE
J075147G20GGTCCCACNONE
J075147G20GTCCCACCNONE
J075158F11GGTCCCACNONE
J075158F11GTCCCACCNONE
J075166N10GGTCCCACNONE
J075166N10GTCCCACCNONE
J075196G09GGTCCCACNONE
J075196G09GTCCCACCNONE
J075198I24GGTCCCACNONE
J075198I24GTCCCACCNONE
J090001L08GGTCCCACNONE
J090001L08GTCCCACCNONE
J090026G07GGTCCCACNONE
J090026G07GTCCCACCNONE
J090050M15GGTCCCACNONE
J090050M15GTCCCACCNONE
J090071A01GGTCCCACNONE
J090071A01GTCCCACCNONE
J090072P16GGTCCCACNONE
J090072P16GTCCCACCNONE
J090078D22GGTCCCACNONE
J090078D22GTCCCACCNONE
J090089C18GGTCCCACNONE
J090089C18GTCCCACCNONE
J100019B07GGTCCCACNONE
J100019B07GTCCCACCNONE
J100019H15GGTCCCACNONE
J100019H15GTCCCACCNONE
J100019P09GGTCCCACNONE
J100019P09GTCCCACCNONE
J100023A16GGTCCCACNONE
J100023A16GTCCCACCNONE
J100023B09GGTCCCACNONE
J100023B09GTCCCACCNONE
J100026O18GGTCCCACNONE
J100026O18GTCCCACCNONE
J100027E09GGTCCCACNONE
J100027E09GTCCCACCNONE
J100028F22GGTCCCACNONE
J100028F22GTCCCACCNONE
J100029P05GGTCCCACNONE
J100029P05GTCCCACCNONE
J100031M19GGTCCCACNONE
J100031M19GTCCCACCNONE
J100032A11GGTCCCACNONE
J100032A11GTCCCACCNONE
J100036G19GGTCCCACNONE
J100036G19GTCCCACCNONE
J100038E22GGTCCCACNONE
J100038E22GTCCCACCNONE
J100040A12GGTCCCACNONE
J100040A12GTCCCACCNONE
J100040L02GGTCCCACNONE
J100040L02GTCCCACCNONE
J100043O13GGTCCCACNONE
J100043O13GTCCCACCNONE
J100045E20GGTCCCACNONE
J100045E20GTCCCACCNONE
J100046H18GGTCCCACNONE
J100046H18GTCCCACCNONE
J100047E08GGTCCCACNONE
J100047E08GTCCCACCNONE
J100050E08GGTCCCACNONE
J100050E08GTCCCACCNONE
J100050P14GGTCCCACNONE
J100050P14GTCCCACCNONE
J100051G10GGTCCCACNONE
J100051G10GTCCCACCNONE
J100052L12GGTCCCACNONE
J100052L12GTCCCACCNONE
J100056G24GGTCCCACNONE
J100056G24GTCCCACCNONE
J100066B15GGTCCCACNONE
J100066B15GTCCCACCNONE
J100068O15GGTCCCACNONE
J100068O15GTCCCACCNONE
J100070J16GGTCCCACNONE
J100070J16GTCCCACCNONE
J100074I22GGTCCCACNONE
J100074I22GTCCCACCNONE
J100075M12GGTCCCACNONE
J100075M12GTCCCACCNONE
J100077M09GGTCCCACNONE
J100077M09GTCCCACCNONE
J100077O14GGTCCCACNONE
J100077O14GTCCCACCNONE
J100079J08GGTCCCACNONE
J100079J08GTCCCACCNONE
J100080I16GGTCCCACNONE
J100080I16GTCCCACCNONE
Os01g0764900AK066328TGAGGGACNONE
Os01g0766600AK061986GTCCCACCACNONE
AK103570GTCCCACCACBSD domain containing protein.
Os01g0778700AK064933GAGGCGTGGGTCCCConserved hypothetical protein.
Os01g0780500AF225922TGAGGGACNONE
AK068498TGAGGGACSCAMP family protein.
J013157H06TGAGGGACNONE
J033088P18TGAGGGACNONE
Os01g0789100AK069910GGTCCCACCCDP-alcohol phosphatidyltransferase family protein.
J080093C23GGTCCCACCNONE
Os01g0805400AK105954TGGGTCCCACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
Os01g0811100006-061-F11TGAGGGACNONE
AB026562TGAGGGACNONE
AK061784TGAGGGACNONE
AK103541TGAGGGACProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7).
J013020B12TGAGGGACNONE
J013022J21TGAGGGACNONE
J013056G19TGAGGGACNONE
J013060O07TGAGGGACNONE
J013110I07TGAGGGACNONE
J013160D19TGAGGGACNONE
J090035A13TGAGGGACNONE
Os01g0818000AK069848GGTCCCACCCGNONE
AK070194GGTCCCACCCGAuxin Efflux Carrier family protein.
J023041H12GGTCCCACCCGNONE
Os01g0818300AK063274GTGGGACCKH domain containing protein.
Os01g0833200AK121629GGTGGGACConserved hypothetical protein.
J023093N07GGTGGGACNONE
J033050C20GGTGGGACNONE
J080302F22GGTGGGACNONE
J080303H06GGTGGGACNONE
J080306J04GGTGGGACNONE
J080309K06GGTGGGACNONE
J080311E18GGTGGGACNONE
J080318A20GGTGGGACNONE
J100031F20GGTGGGACNONE
J100034P21GGTGGGACNONE
J100042K08GGTGGGACNONE
J100047H24GGTGGGACNONE
J100065C14GGTGGGACNONE
J100074E23GGTGGGACNONE
Os01g0835500AK100241GTCCCACCACSimilar to Respiratory burst oxidase protein.
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein.
Os01g0844200AK109255CAAGTGGGTCCDVL family protein.
Os01g0844900AK066659GGGACCCACCCGHomeodomain-like containing protein.
Os01g0846600AK070193GGACCCACTTGProtein of unknown function DUF248, methyltransferase putative family protein.
J023041I24GGACCCACTTGNONE
J065002B03GGACCCACTTGNONE
J065140C09GGACCCACTTGNONE
J090052A18GGACCCACTTGNONE
J090081O13GGACCCACTTGNONE
J100056L06GGACCCACTTGNONE
Os01g0850000006-062-F10TGGGTCCCNONE
AK105943TGGGTCCCConserved hypothetical protein.
J013151A08TGGGTCCCNONE
J075019P18TGGGTCCCNONE
Os01g0850400AJ575220TGGGACCCGNONE
AK108582TGGGACCCGSimilar to MYBY1 protein (Fragment).
Os01g0856000016-095-F09GGGACCCANONE
AK107439GGGACCCASimilar to CDC6 protein.
AK107451GGGACCCANONE
Os01g0858900AK107493GTGGGACCCACGlycosyl transferase, family 29 protein.
J065097H23GTGGGACCCACNONE
J100070A02GTGGGACCCACNONE
J100072M10GTGGGACCCACNONE
Os01g0860700009-026-D05GTGGGACCCACNONE
AK062402GTGGGACCCACConserved hypothetical protein.
Os01g0862800AK071274GTCCCACCACGCCACNo apical meristem (NAM) protein domain containing protein.
Os01g0865600AK068033GTCCCACCNONE
AK099677GTCCCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein.
J090007G21GTCCCACCNONE
J090023C20GTCCCACCNONE
J090039J16GTCCCACCNONE
J090054K15GTCCCACCNONE
Os01g0867900AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein.
Os01g0885600AK059523CGGGTCCCEsterase/lipase/thioesterase domain containing protein.
AK059523CGGGTCCCACEsterase/lipase/thioesterase domain containing protein.
J065013G01CGGGTCCCNONE
J065013G01CGGGTCCCACNONE
J065063D03CGGGTCCCNONE
J065063D03CGGGTCCCACNONE
J065143H01CGGGTCCCNONE
J065143H01CGGGTCCCACNONE
J065146F08CGGGTCCCNONE
J065146F08CGGGTCCCACNONE
J065153D14CGGGTCCCNONE
J065153D14CGGGTCCCACNONE
J065170E02CGGGTCCCNONE
J065170E02CGGGTCCCACNONE
J065175M22CGGGTCCCNONE
J065175M22CGGGTCCCACNONE
J065186E13CGGGTCCCNONE
J065186E13CGGGTCCCACNONE
J075023J16CGGGTCCCNONE
J075023J16CGGGTCCCACNONE
J075176J06CGGGTCCCNONE
J075176J06CGGGTCCCACNONE
Os01g0896400AK107067GGTCCCACCTGConserved hypothetical protein.
Os01g0897600J065120F23GTGGGTCCCACCNONE
Os01g0905400012-077-F08TGGGACCCNONE
AK063530TGGGACCCTranscriptional factor B3 family protein.
Os01g0908100AK072293CGGGTCCCACRabGAP/TBC domain containing protein.
J065010B13CGGGTCCCACNONE
J065010M12CGGGTCCCACNONE
J065047C19CGGGTCCCACNONE
J065069B18CGGGTCCCACNONE
J065071K24CGGGTCCCACNONE
J065142P04CGGGTCCCACNONE
J065170E11CGGGTCCCACNONE
Os01g0908400009-140-E01GGTCCCACCNONE
AK062957GGTCCCACCConserved hypothetical protein.
AK099301GGTCCCACCNONE
J065123M13GGTCCCACCNONE
J075020O14GGTCCCACCNONE
J075136L21GGTCCCACCNONE
Os01g0911200AK101333GGTCCCACCRibophorin II family protein.
Os01g0913100AK070387GGTCCCACCACProtein of unknown function DUF538 family protein.
J100090K15GGTCCCACCACNONE
Os01g0919900006-027-D02GTCCCACCNONE
009-156-F01GTCCCACCNONE
AK060087GTCCCACCNONE
Os01g0929000AK073334TGGGTCCCConserved hypothetical protein.
J033024D22TGGGTCCCNONE
Os01g0934300AK101422GGTGGGACCCNONE
J033038C07GGTGGGACCCNONE
Os01g0947000011-055-B03GGACCCACNONE
AK063953GGACCCACSimilar to Beta-1,3-glucanase precursor.
AK102628GGACCCACNONE
J033099K11GGACCCACNONE
Os01g0948100AK111411TGAGGGACERCC4 domain containing protein.
J090089O16TGAGGGACNONE
Os01g0961200011-099-H06GTGGGTCCCACCNONE
AK105424GTGGGTCCCACCCBS domain containing protein.
J065169J18GTGGGTCCCACCNONE
J075109H12GTGGGTCCCACCNONE
Os01g0961600011-080-G05GTGGGTCCNONE
AK063388GTGGGTCCNONE
AK071901GTGGGTCCConserved hypothetical protein.
J065078A05GTGGGTCCNONE
Os01g0972300009-034-G05TGGGTCCCACCCACTCCCACTCCNONE
AK062432TGGGTCCCACCCACTCCCACTCCDVL family protein.
Os01g0973400AK060011TGAGGGACNONE
AK068879TGAGGGACConserved hypothetical protein 48 family protein.
AK099210TGAGGGACNONE
AK104863TGAGGGACNONE
J013170C09TGAGGGACNONE
J033106K13TGAGGGACNONE
J075018P18TGAGGGACNONE
J075039C18TGAGGGACNONE
J075104L18TGAGGGACNONE
Os01g0975000AK103552GGACCCACNONE
AK119662GGACCCACProtein of unknown function DUF966 family protein.
J033132F15GGACCCACNONE
J065012J09GGACCCACNONE
J065166N08GGACCCACNONE
Os01g0976600AK072971GTGGGACCCACSimilar to Methlytransferase, UbiE/COQ5 family.
J023148G18GTGGGACCCACNONE
J075095H03GTGGGACCCACNONE
J090089M19GTGGGACCCACNONE
Os02g0103800006-046-H11GGGACCCANONE
006-046-H11GTGGGTCCCACGTGNONE
006-046-H11TGAGGGACNONE
006-060-B05GGGACCCANONE
006-060-B05GTGGGTCCCACGTGNONE
006-060-B05TGAGGGACNONE
006-097-A09GGGACCCANONE
006-097-A09GTGGGTCCCACGTGNONE
006-097-A09TGAGGGACNONE
006-102-A10GGGACCCANONE
006-102-A10GTGGGTCCCACGTGNONE
006-102-A10TGAGGGACNONE
006-104-E11GGGACCCANONE
006-104-E11GTGGGTCCCACGTGNONE
006-104-E11TGAGGGACNONE
006-112-D09GGGACCCANONE
006-112-D09GTGGGTCCCACGTGNONE
006-112-D09TGAGGGACNONE
AK061774GGGACCCANONE
AK061774GTGGGTCCCACGTGNONE
AK061774TGAGGGACNONE
AK065309GGGACCCANONE
AK065309GTGGGTCCCACGTGNONE
AK065309TGAGGGACNONE
AK106213GGGACCCASimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
AK106213GTGGGTCCCACGTGSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
AK106213TGAGGGACSimilar to Ferredoxin NADP+ reductase (EC 1.18.1.2) (Fragment).
J013002O13GGGACCCANONE
J013002O13GTGGGTCCCACGTGNONE
J013002O13TGAGGGACNONE
J013026F06GGGACCCANONE
J013026F06GTGGGTCCCACGTGNONE
J013026F06TGAGGGACNONE
J013037O14GGGACCCANONE
J013037O14GTGGGTCCCACGTGNONE
J013037O14TGAGGGACNONE
J013066N06GGGACCCANONE
J013066N06GTGGGTCCCACGTGNONE
J013066N06TGAGGGACNONE
J013108G22GGGACCCANONE
J013108G22GTGGGTCCCACGTGNONE
J013108G22TGAGGGACNONE
J023050M15GGGACCCANONE
J023050M15GTGGGTCCCACGTGNONE
J023050M15TGAGGGACNONE
J023054B21GGGACCCANONE
J023054B21GTGGGTCCCACGTGNONE
J023054B21TGAGGGACNONE
J023073C23GGGACCCANONE
J023073C23GTGGGTCCCACGTGNONE
J023073C23TGAGGGACNONE
J023086H17GGGACCCANONE
J023086H17GTGGGTCCCACGTGNONE
J023086H17TGAGGGACNONE
J023105A20GGGACCCANONE
J023105A20GTGGGTCCCACGTGNONE
J023105A20TGAGGGACNONE
J065019E16GGGACCCANONE
J065019E16GTGGGTCCCACGTGNONE
J065019E16TGAGGGACNONE
J065064G10GGGACCCANONE
J065064G10GTGGGTCCCACGTGNONE
J065064G10TGAGGGACNONE
J065071C18GGGACCCANONE
J065071C18GTGGGTCCCACGTGNONE
J065071C18TGAGGGACNONE
J065103B02GGGACCCANONE
J065103B02GTGGGTCCCACGTGNONE
J065103B02TGAGGGACNONE
J065153G06GGGACCCANONE
J065153G06GTGGGTCCCACGTGNONE
J065153G06TGAGGGACNONE
J075152G24GGGACCCANONE
J075152G24GTGGGTCCCACGTGNONE
J075152G24TGAGGGACNONE
J075166P04GGGACCCANONE
J075166P04GTGGGTCCCACGTGNONE
J075166P04TGAGGGACNONE
J080001F02GGGACCCANONE
J080001F02GTGGGTCCCACGTGNONE
J080001F02TGAGGGACNONE
J080001M07GGGACCCANONE
J080001M07GTGGGTCCCACGTGNONE
J080001M07TGAGGGACNONE
J080001O05GGGACCCANONE
J080001O05GTGGGTCCCACGTGNONE
J080001O05TGAGGGACNONE
J080003I19GGGACCCANONE
J080003I19GTGGGTCCCACGTGNONE
J080003I19TGAGGGACNONE
J080004C12GGGACCCANONE
J080004C12GTGGGTCCCACGTGNONE
J080004C12TGAGGGACNONE
J080008E17GGGACCCANONE
J080008E17GTGGGTCCCACGTGNONE
J080008E17TGAGGGACNONE
J080008M08GGGACCCANONE
J080008M08GTGGGTCCCACGTGNONE
J080008M08TGAGGGACNONE
J080010H21GGGACCCANONE
J080010H21GTGGGTCCCACGTGNONE
J080010H21TGAGGGACNONE
J080011F22GGGACCCANONE
J080011F22GTGGGTCCCACGTGNONE
J080011F22TGAGGGACNONE
J080012C16GGGACCCANONE
J080012C16GTGGGTCCCACGTGNONE
J080012C16TGAGGGACNONE
J080013D20GGGACCCANONE
J080013D20GTGGGTCCCACGTGNONE
J080013D20TGAGGGACNONE
J080018K15GGGACCCANONE
J080018K15GTGGGTCCCACGTGNONE
J080018K15TGAGGGACNONE
J080020O14GGGACCCANONE
J080020O14GTGGGTCCCACGTGNONE
J080020O14TGAGGGACNONE
J080020P21GGGACCCANONE
J080020P21GTGGGTCCCACGTGNONE
J080020P21TGAGGGACNONE
J080021A07GGGACCCANONE
J080021A07GTGGGTCCCACGTGNONE
J080021A07TGAGGGACNONE
J080021B06GGGACCCANONE
J080021B06GTGGGTCCCACGTGNONE
J080021B06TGAGGGACNONE
J080022G21GGGACCCANONE
J080022G21GTGGGTCCCACGTGNONE
J080022G21TGAGGGACNONE
J080022P14GGGACCCANONE
J080022P14GTGGGTCCCACGTGNONE
J080022P14TGAGGGACNONE
J080023H24GGGACCCANONE
J080023H24GTGGGTCCCACGTGNONE
J080023H24TGAGGGACNONE
J080023M08GGGACCCANONE
J080023M08GTGGGTCCCACGTGNONE
J080023M08TGAGGGACNONE
J080027E08GGGACCCANONE
J080027E08GTGGGTCCCACGTGNONE
J080027E08TGAGGGACNONE
J080027E18GGGACCCANONE
J080027E18GTGGGTCCCACGTGNONE
J080027E18TGAGGGACNONE
J080027O16GGGACCCANONE
J080027O16GTGGGTCCCACGTGNONE
J080027O16TGAGGGACNONE
J080029M22GGGACCCANONE
J080029M22GTGGGTCCCACGTGNONE
J080029M22TGAGGGACNONE
J080034A17GGGACCCANONE
J080034A17GTGGGTCCCACGTGNONE
J080034A17TGAGGGACNONE
J080038G04GGGACCCANONE
J080038G04GTGGGTCCCACGTGNONE
J080038G04TGAGGGACNONE
J080040F13GGGACCCANONE
J080040F13GTGGGTCCCACGTGNONE
J080040F13TGAGGGACNONE
J080040F22GGGACCCANONE
J080040F22GTGGGTCCCACGTGNONE
J080040F22TGAGGGACNONE
J080041L15GGGACCCANONE
J080041L15GTGGGTCCCACGTGNONE
J080041L15TGAGGGACNONE
J080042L04GGGACCCANONE
J080042L04GTGGGTCCCACGTGNONE
J080042L04TGAGGGACNONE
J080042M14GGGACCCANONE
J080042M14GTGGGTCCCACGTGNONE
J080042M14TGAGGGACNONE
J080043C22GGGACCCANONE
J080043C22GTGGGTCCCACGTGNONE
J080043C22TGAGGGACNONE
J080043O09GGGACCCANONE
J080043O09GTGGGTCCCACGTGNONE
J080043O09TGAGGGACNONE
J080045N17GGGACCCANONE
J080045N17GTGGGTCCCACGTGNONE
J080045N17TGAGGGACNONE
J080046N08GGGACCCANONE
J080046N08GTGGGTCCCACGTGNONE
J080046N08TGAGGGACNONE
J080047K11GGGACCCANONE
J080047K11GTGGGTCCCACGTGNONE
J080047K11TGAGGGACNONE
J080047O06GGGACCCANONE
J080047O06GTGGGTCCCACGTGNONE
J080047O06TGAGGGACNONE
J080048H10GGGACCCANONE
J080048H10GTGGGTCCCACGTGNONE
J080048H10TGAGGGACNONE
J080048N03GGGACCCANONE
J080048N03GTGGGTCCCACGTGNONE
J080048N03TGAGGGACNONE
J080050N02GGGACCCANONE
J080050N02GTGGGTCCCACGTGNONE
J080050N02TGAGGGACNONE
J080051A05GGGACCCANONE
J080051A05GTGGGTCCCACGTGNONE
J080051A05TGAGGGACNONE
J080052I20GGGACCCANONE
J080052I20GTGGGTCCCACGTGNONE
J080052I20TGAGGGACNONE
J080053E08GGGACCCANONE
J080053E08GTGGGTCCCACGTGNONE
J080053E08TGAGGGACNONE
J080055P05GGGACCCANONE
J080055P05GTGGGTCCCACGTGNONE
J080055P05TGAGGGACNONE
J080056F15GGGACCCANONE
J080056F15GTGGGTCCCACGTGNONE
J080056F15TGAGGGACNONE
J080056H07GGGACCCANONE
J080056H07GTGGGTCCCACGTGNONE
J080056H07TGAGGGACNONE
J080057M20GGGACCCANONE
J080057M20GTGGGTCCCACGTGNONE
J080057M20TGAGGGACNONE
J080059K09GGGACCCANONE
J080059K09GTGGGTCCCACGTGNONE
J080059K09TGAGGGACNONE
J080059M10GGGACCCANONE
J080059M10GTGGGTCCCACGTGNONE
J080059M10TGAGGGACNONE
J080060B12GGGACCCANONE
J080060B12GTGGGTCCCACGTGNONE
J080060B12TGAGGGACNONE
J080061N09GGGACCCANONE
J080061N09GTGGGTCCCACGTGNONE
J080061N09TGAGGGACNONE
J080062H11GGGACCCANONE
J080062H11GTGGGTCCCACGTGNONE
J080062H11TGAGGGACNONE
J080062M13GGGACCCANONE
J080062M13GTGGGTCCCACGTGNONE
J080062M13TGAGGGACNONE
J080063D14GGGACCCANONE
J080063D14GTGGGTCCCACGTGNONE
J080063D14TGAGGGACNONE
J080063G10GGGACCCANONE
J080063G10GTGGGTCCCACGTGNONE
J080063G10TGAGGGACNONE
J080063H18GGGACCCANONE
J080063H18GTGGGTCCCACGTGNONE
J080063H18TGAGGGACNONE
J080066J23GGGACCCANONE
J080066J23GTGGGTCCCACGTGNONE
J080066J23TGAGGGACNONE
J080067J06GGGACCCANONE
J080067J06GTGGGTCCCACGTGNONE
J080067J06TGAGGGACNONE
J080069I11GGGACCCANONE
J080069I11GTGGGTCCCACGTGNONE
J080069I11TGAGGGACNONE
J080069O22GGGACCCANONE
J080069O22GTGGGTCCCACGTGNONE
J080069O22TGAGGGACNONE
J080070P11GGGACCCANONE
J080070P11GTGGGTCCCACGTGNONE
J080070P11TGAGGGACNONE
J080072D06GGGACCCANONE
J080072D06GTGGGTCCCACGTGNONE
J080072D06TGAGGGACNONE
J080072J22GGGACCCANONE
J080072J22GTGGGTCCCACGTGNONE
J080072J22TGAGGGACNONE
J080075A20GGGACCCANONE
J080075A20GTGGGTCCCACGTGNONE
J080075A20TGAGGGACNONE
J080076F11GGGACCCANONE
J080076F11GTGGGTCCCACGTGNONE
J080076F11TGAGGGACNONE
J080076J24GGGACCCANONE
J080076J24GTGGGTCCCACGTGNONE
J080076J24TGAGGGACNONE
J080076K05GGGACCCANONE
J080076K05GTGGGTCCCACGTGNONE
J080076K05TGAGGGACNONE
J080077O10GGGACCCANONE
J080077O10GTGGGTCCCACGTGNONE
J080077O10TGAGGGACNONE
J080078L19GGGACCCANONE
J080078L19GTGGGTCCCACGTGNONE
J080078L19TGAGGGACNONE
J080080I08GGGACCCANONE
J080080I08GTGGGTCCCACGTGNONE
J080080I08TGAGGGACNONE
J080081J23GGGACCCANONE
J080081J23GTGGGTCCCACGTGNONE
J080081J23TGAGGGACNONE
J080083A17GGGACCCANONE
J080083A17GTGGGTCCCACGTGNONE
J080083A17TGAGGGACNONE
J080085C05GGGACCCANONE
J080085C05GTGGGTCCCACGTGNONE
J080085C05TGAGGGACNONE
J080086G24GGGACCCANONE
J080086G24GTGGGTCCCACGTGNONE
J080086G24TGAGGGACNONE
J080087H02GGGACCCANONE
J080087H02GTGGGTCCCACGTGNONE
J080087H02TGAGGGACNONE
J080089A13GGGACCCANONE
J080089A13GTGGGTCCCACGTGNONE
J080089A13TGAGGGACNONE
J080090K08GGGACCCANONE
J080090K08GTGGGTCCCACGTGNONE
J080090K08TGAGGGACNONE
J080092M01GGGACCCANONE
J080092M01GTGGGTCCCACGTGNONE
J080092M01TGAGGGACNONE
J080095A19GGGACCCANONE
J080095A19GTGGGTCCCACGTGNONE
J080095A19TGAGGGACNONE
J080095B20GGGACCCANONE
J080095B20GTGGGTCCCACGTGNONE
J080095B20TGAGGGACNONE
J100028F13GGGACCCANONE
J100028F13GTGGGTCCCACGTGNONE
J100028F13TGAGGGACNONE
J100040G22GGGACCCANONE
J100040G22GTGGGTCCCACGTGNONE
J100040G22TGAGGGACNONE
Os02g0115700AK065094GTGGGACCCACatalase isozyme A (EC 1.11.1.6) (CAT-A).
AK099231GTGGGACCCANONE
AK099923GTGGGACCCANONE
X61626GTGGGACCCANONE
Os02g0115900AF006825CGGGTCCCNONE
AK065743CGGGTCCCEndosperm lumenal binding protein.
AK119653CGGGTCCCNONE
Os02g0119400AK060055TGGGTCCCACACGNONE
AK102774TGGGTCCCACACGSimilar to Syntaxin 52 (AtSYP52).
J033107H09TGGGTCCCACACGNONE
J075175F09TGGGTCCCACACGNONE
J090011H05TGGGTCCCACACGNONE
J090091O05TGGGTCCCACACGNONE
Os02g0119700AK108777GTCCCACCTGProtein prenyltransferase domain containing protein.
Os02g0120000AK067383GTGGGTCCProtein prenyltransferase domain containing protein.
AK101590GTGGGTCCNONE
J013100B15GTGGGTCCNONE
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS).
Os02g0137100015-082-A12GGTCCCACCNONE
016-013-D11GGTCCCACCNONE
AK073353GGTCCCACCConserved hypothetical protein 1589, plant family protein.
J013026D20GGTCCCACCNONE
J013111M05GGTCCCACCNONE
J023099B09GGTCCCACCNONE
J033025E21GGTCCCACCNONE
J033082H04GGTCCCACCNONE
J065110E11GGTCCCACCNONE
Os02g0142060J065137N15GAGACGTGAGGGACGGACSynapsin family protein.
Os02g0152500AK101341GGGACCCAFibronectin, type III-like fold domain containing protein.
J013027O15GGGACCCANONE
J013066D05GGGACCCANONE
J013089D21GGGACCCANONE
J013111N20GGGACCCANONE
J013122K23GGGACCCANONE
J023001C11GGGACCCANONE
J033034J20GGGACCCANONE
J033042M05GGGACCCANONE
J033080O14GGGACCCANONE
J033113G09GGGACCCANONE
J033123H09GGGACCCANONE
J033131A02GGGACCCANONE
J065116L13GGGACCCANONE
J065120D15GGGACCCANONE
J090012E11GGGACCCANONE
Os02g0162500009-181-F03GGTCCCACTTGNONE
AK058907GGTCCCACTTGNONE
AK121223GGTCCCACTTGSimilar to 40S ribosomal protein S14.
J023090I10GGTCCCACTTGNONE
J023136J11GGTCCCACTTGNONE
J053097J20GGTCCCACTTGNONE
J053098F01GGTCCCACTTGNONE
J065065B09GGTCCCACTTGNONE
J065082M04GGTCCCACTTGNONE
J065188O05GGTCCCACTTGNONE
J075057P15GGTCCCACTTGNONE
J075061J08GGTCCCACTTGNONE
J075061N15GGTCCCACTTGNONE
J075131I08GGTCCCACTTGNONE
J075141H13GGTCCCACTTGNONE
J080062E14GGTCCCACTTGNONE
J080062P15GGTCCCACTTGNONE
J080318G17GGTCCCACTTGNONE
J080319G19GGTCCCACTTGNONE
J090001L10GGTCCCACTTGNONE
J090024I18GGTCCCACTTGNONE
J090033F24GGTCCCACTTGNONE
J090036M16GGTCCCACTTGNONE
J090040I24GGTCCCACTTGNONE
J090048P06GGTCCCACTTGNONE
J090049B12GGTCCCACTTGNONE
J090068C02GGTCCCACTTGNONE
J090069O04GGTCCCACTTGNONE
J090084H22GGTCCCACTTGNONE
J100022L03GGTCCCACTTGNONE
J100028O14GGTCCCACTTGNONE
J100028O18GGTCCCACTTGNONE
J100032A15GGTCCCACTTGNONE
J100033D21GGTCCCACTTGNONE
J100034J23GGTCCCACTTGNONE
J100043K22GGTCCCACTTGNONE
J100052M22GGTCCCACTTGNONE
J100053N03GGTCCCACTTGNONE
J100074N24GGTCCCACTTGNONE
J100082J10GGTCCCACTTGNONE
Os02g0167700AK069128GGACCCACArmadillo-like helical domain containing protein.
Os02g0175800009-083-C02TGAGGGACNONE
009-184-H07TGAGGGACNONE
009-199-D07TGAGGGACNONE
AK058292TGAGGGACNONE
AK120215TGAGGGACConserved hypothetical protein.
J013040G12TGAGGGACNONE
J065050N21TGAGGGACNONE
J065077O07TGAGGGACNONE
J065102G05TGAGGGACNONE
J065197A04TGAGGGACNONE
J075024L24TGAGGGACNONE
J075038K01TGAGGGACNONE
J075044L04TGAGGGACNONE
J075063D23TGAGGGACNONE
J075079P13TGAGGGACNONE
J075084G03TGAGGGACNONE
J075135G07TGAGGGACNONE
J075148D17TGAGGGACNONE
J075150F13TGAGGGACNONE
J075157F06TGAGGGACNONE
J090054A05TGAGGGACNONE
J090085O04TGAGGGACNONE
J100023C04TGAGGGACNONE
J100023H23TGAGGGACNONE
J100026A16TGAGGGACNONE
J100035K13TGAGGGACNONE
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein.
Os02g0192300TGGGTCCCACTCCZinc finger, FYVE/PHD-type domain containing protein.
Os02g0194000015-020-A08TGAGGGACNONE
AK064096TGAGGGACMyb, DNA-binding domain containing protein.
J090092L06TGAGGGACNONE
Os02g0215950J090051K07TGAGGGACConserved hypothetical protein.
Os02g0216500AK103179GTGGGTCCCACHypothetical protein.
Os02g0228900AK121870GGTCCCACCSimilar to Auxin-responsive protein IAA18 (Indoleacetic acid-induced protein 18).
Os02g0234700009-036-B03GTCCCTCANONE
AK062439GTCCCTCAConserved hypothetical protein.
Os02g0271900AK120913GTGGGTCCMyb, DNA-binding domain containing protein.
AK120913GTGGGTCCMyb, DNA-binding domain containing protein.
Os02g0302900AK110752GGACCCACTCCReticulon family protein.
Os02g0303200AK107731GTGGGACCCACTTGHypothetical protein.
Os02g0312700AK072956CACGGCCCAAAGTCCCACCATP11 family protein.
AK102909CACGGCCCAAAGTCCCACCNONE
J065017G18CACGGCCCAAAGTCCCACCNONE
J075066A05CACGGCCCAAAGTCCCACCNONE
Os02g0313450009-097-E10GTCCCTCAConserved hypothetical protein.
J065156J02GTCCCTCANONE
Os02g0316200AK073932GGACCCACCyclin-like F-box domain containing protein.
AK105757GGACCCACNONE
J023039G03GGACCCACNONE
J033076K03GGACCCACNONE
J075157J22GGACCCACNONE
J090097K02GGACCCACNONE
J100053F10GGACCCACNONE
Os02g0317400AK061254GGACCCACClathrin adaptor complex, small chain family protein.
AK073474GGACCCACNONE
J033045O22GGACCCACNONE
J053023I18GGACCCACNONE
J053034H01GGACCCACNONE
J053034M24GGACCCACNONE
J065005K14GGACCCACNONE
J065092O13GGACCCACNONE
J065101K24GGACCCACNONE
J065174G18GGACCCACNONE
J065203J19GGACCCACNONE
J065218B15GGACCCACNONE
J090064B16GGACCCACNONE
Os02g0318400AK064642GGTCCCACCTGTCConserved hypothetical protein.
J075032B17GGTCCCACCTGTCNONE
Os02g0326000006-099-D01GGTGGGACNONE
AK059937GGTGGGACNONE
AK102973GGTGGGACConserved hypothetical protein.
J033115K18GGTGGGACNONE
J075069J04GGTGGGACNONE
Os02g0332200AK067672GTGGGTCCCACTTGCCACGTGSimilar to T-complex protein 1 delta subunit.
Os02g0464700AK107077GTGGGACCCACConserved hypothetical protein.
Os02g0467700AK121672GTGGGTCCGlycosyltransferase 28, C-terminal domain containing protein.
AK121672TGAGGGACGlycosyltransferase 28, C-terminal domain containing protein.
J033068B18GTGGGTCCNONE
J033068B18TGAGGGACNONE
J080035D09GTGGGTCCNONE
J080035D09TGAGGGACNONE
J080039E21GTGGGTCCNONE
J080039E21TGAGGGACNONE
J080054N01GTGGGTCCNONE
J080054N01TGAGGGACNONE
J080071C12GTGGGTCCNONE
J080071C12TGAGGGACNONE
Os02g0506500AK062572GACAGGTGGGACCNONE
AK063549GACAGGTGGGACCNONE
AK101016GACAGGTGGGACCMolybdenum cofactor biosynthesis domain containing protein.
AK109318GACAGGTGGGACCNONE
J013000C16GACAGGTGGGACCNONE
J013155N06GACAGGTGGGACCNONE
J023067A02GACAGGTGGGACCNONE
J023149E02GACAGGTGGGACCNONE
J033033J18GACAGGTGGGACCNONE
J033051O15GACAGGTGGGACCNONE
J075034C22GACAGGTGGGACCNONE
J075054O10GACAGGTGGGACCNONE
J075108L14GACAGGTGGGACCNONE
J090043O06GACAGGTGGGACCNONE
J100024P03GACAGGTGGGACCNONE
Os02g0519900006-057-B12TGGGTCCCANONE
006-113-G04TGGGTCCCANONE
006-119-D01TGGGTCCCANONE
AK060953TGGGTCCCANONE
AK068869TGGGTCCCANONE
AK099493TGGGTCCCANONE
J013027E04TGGGTCCCANONE
J023002E06TGGGTCCCANONE
J023106L15TGGGTCCCANONE
J080303F06TGGGTCCCANONE
J090065E08TGGGTCCCANONE
Os02g0521300AK120851GGGACCCGGCCCCGCGGGGGC2 domain containing protein.
AK120851GTGGGTCCCC2 domain containing protein.
Os02g0530100AK058520GGACCCACTGACGTTGGGCCCCHeavy metal transport/detoxification protein domain containing protein.
AK058520GTGGGACCCAHeavy metal transport/detoxification protein domain containing protein.
Os02g0530300014-069-H07CGGGTCCCNONE
AK063708CGGGTCCCZinc finger, A20-type domain containing protein.
Os02g0530600AK102681GTCCCACCCCCACGBRCT domain containing protein.
Os02g0534600Os02g0534600GTGGGTCCCACCConserved hypothetical protein.
Os02g0535400AK111881GGTCCCACCConserved hypothetical protein.
J033050A01GGTCCCACCNONE
J065043D01GGTCCCACCNONE
Os02g0562300AK073250GTGGGACCCACCalmodulin binding protein-like family protein.
Os02g0565000AK120665TGAGGGACHomeodomain-like containing protein.
J100070C12TGAGGGACNONE
J100074L08TGAGGGACNONE
Os02g0566400AK101019GTCCCACCTGConserved hypothetical protein.
Os02g0577900J065164K11GGACCCACConserved hypothetical protein.
J065164K11GGGACCCGConserved hypothetical protein.
J065164K11GTGGGTCCConserved hypothetical protein.
Os02g0578201J065065K19GTGGGTCCCACConserved hypothetical protein.
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein.
009-199-B01GGGACCCACCTGGGGCCCACCANONE
011-015-G12GGGACCCACCTGGGGCCCACCANONE
J023113C24GGGACCCACCTGGGGCCCACCANONE
Os02g0600200009-154-A06CACTGACAAGTGGGTCCAGANONE
AK058978CACTGACAAGTGGGTCCAGANONE
AK066974CACTGACAAGTGGGTCCAGAIQ calmodulin-binding region domain containing protein.
Os02g0608900AK068690GTGGGTCCCNONE
AK105867GTGGGTCCCSimilar to Epstein-Barr virus (B95-8 isolate) U2-IR2 domain encoding nuclear protein EBNA2, complete cds.
J065017D16GTGGGTCCCNONE
J065042D05GTGGGTCCCNONE
J065117J15GTGGGTCCCNONE
J075020G04GTGGGTCCCNONE
J075052B14GTGGGTCCCNONE
J075170K13GTGGGTCCCNONE
J075178D19GTGGGTCCCNONE
J075182F02GTGGGTCCCNONE
J075199I18GTGGGTCCCNONE
J090057A11GTGGGTCCCNONE
J100048A21GTGGGTCCCNONE
Os02g0610600006-025-A07GGGACCCACNONE
006-027-E02GGGACCCACNONE
AK060088GGGACCCACNONE
AK099572GGGACCCACSimilar to 9G8-like SR protein (RSZp22 splicing factor).
AK104726GGGACCCACNONE
J013035H21GGGACCCACNONE
J013037C12GGGACCCACNONE
J013122B01GGGACCCACNONE
J013124A03GGGACCCACNONE
J013124C15GGGACCCACNONE
J013132I24GGGACCCACNONE
J023008O06GGGACCCACNONE
J023061J24GGGACCCACNONE
J023065D02GGGACCCACNONE
J023066P12GGGACCCACNONE
J023083J10GGGACCCACNONE
J033031G05GGGACCCACNONE
J065117A05GGGACCCACNONE
J065134H09GGGACCCACNONE
J065169J22GGGACCCACNONE
J065211L11GGGACCCACNONE
J075001M01GGGACCCACNONE
J075015L09GGGACCCACNONE
J075019E07GGGACCCACNONE
J075042J19GGGACCCACNONE
J075048D15GGGACCCACNONE
J075054H24GGGACCCACNONE
J075057F09GGGACCCACNONE
J075064J05GGGACCCACNONE
J075074E16GGGACCCACNONE
J075093A05GGGACCCACNONE
J075093C08GGGACCCACNONE
J075104F23GGGACCCACNONE
J075104L04GGGACCCACNONE
J075134A01GGGACCCACNONE
J075149H04GGGACCCACNONE
J075153O06GGGACCCACNONE
J075155D03GGGACCCACNONE
J075179N18GGGACCCACNONE
J075184M05GGGACCCACNONE
J075185B17GGGACCCACNONE
J075188D22GGGACCCACNONE
J075193O07GGGACCCACNONE
J080004I08GGGACCCACNONE
J080014P04GGGACCCACNONE
J080058K19GGGACCCACNONE
J080072P16GGGACCCACNONE
J080303N22GGGACCCACNONE
J080306I22GGGACCCACNONE
J080316B03GGGACCCACNONE
J090021N05GGGACCCACNONE
J090043J11GGGACCCACNONE
J090071C02GGGACCCACNONE
J100019I09GGGACCCACNONE
J100031A01GGGACCCACNONE
J100042J07GGGACCCACNONE
J100044H08GGGACCCACNONE
J100045N20GGGACCCACNONE
J100056M18GGGACCCACNONE
J100061M03GGGACCCACNONE
J100062C16GGGACCCACNONE
J100065P08GGGACCCACNONE
J100073K23GGGACCCACNONE
Os02g0611400AK101310GGTCCCACTTGProtein prenyltransferase domain containing protein.
J033024H21GGTCCCACTTGNONE
J033033O21GGTCCCACTTGNONE
J065134H24GGTCCCACTTGNONE
J090087E02GGTCCCACTTGNONE
Os02g0613200AK064869ACACGTGGGACCCACNONE
AK065051ACACGTGGGACCCACNONE
AK098853ACACGTGGGACCCACConserved hypothetical protein.
AK098974ACACGTGGGACCCACNONE
J013000H15ACACGTGGGACCCACNONE
J013001I18ACACGTGGGACCCACNONE
J013022I18ACACGTGGGACCCACNONE
J013025D06ACACGTGGGACCCACNONE
J013037H17ACACGTGGGACCCACNONE
J013043F22ACACGTGGGACCCACNONE
J013075E01ACACGTGGGACCCACNONE
J013088D09ACACGTGGGACCCACNONE
J013088E19ACACGTGGGACCCACNONE
J013102O18ACACGTGGGACCCACNONE
J013110C08ACACGTGGGACCCACNONE
J013118C06ACACGTGGGACCCACNONE
J013119F22ACACGTGGGACCCACNONE
J013128K14ACACGTGGGACCCACNONE
J013158C17ACACGTGGGACCCACNONE
J023013P15ACACGTGGGACCCACNONE
J023044L21ACACGTGGGACCCACNONE
J033023I04ACACGTGGGACCCACNONE
J033038I22ACACGTGGGACCCACNONE
J033095M02ACACGTGGGACCCACNONE
J043022F05ACACGTGGGACCCACNONE
J080307N20ACACGTGGGACCCACNONE
J080315C02ACACGTGGGACCCACNONE
J080316A15ACACGTGGGACCCACNONE
J080316G03ACACGTGGGACCCACNONE
J090029E24ACACGTGGGACCCACNONE
J090031H15ACACGTGGGACCCACNONE
J090034F13ACACGTGGGACCCACNONE
J090047G02ACACGTGGGACCCACNONE
J090069M24ACACGTGGGACCCACNONE
J100052E15ACACGTGGGACCCACNONE
Os02g0617600AK111533GGTCCCACConserved hypothetical protein.
AK111600GGTCCCACNONE
J013030C15GGTCCCACNONE
J013094K16GGTCCCACNONE
J065038P16GGTCCCACNONE
J065083O12GGTCCCACNONE
J065208C17GGTCCCACNONE
J065212K03GGTCCCACNONE
Os02g0621700011-079-F10TGGGACCCACNONE
AK101006TGGGACCCACSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta).
AK103525TGGGACCCACNONE
J013026C02TGGGACCCACNONE
J013104M10TGGGACCCACNONE
J023003D01TGGGACCCACNONE
J023007H13TGGGACCCACNONE
J023019G09TGGGACCCACNONE
J023020L19TGGGACCCACNONE
J023022L12TGGGACCCACNONE
J023022O14TGGGACCCACNONE
J023036F16TGGGACCCACNONE
J023047D16TGGGACCCACNONE
J023052P08TGGGACCCACNONE
J023077C01TGGGACCCACNONE
J023083M06TGGGACCCACNONE
J023105A11TGGGACCCACNONE
J023117F21TGGGACCCACNONE
J023119D20TGGGACCCACNONE
J023148E03TGGGACCCACNONE
J023149B13TGGGACCCACNONE
J033029A10TGGGACCCACNONE
J033046L17TGGGACCCACNONE
J033052M04TGGGACCCACNONE
J033057M14TGGGACCCACNONE
J033066K24TGGGACCCACNONE
J033069K02TGGGACCCACNONE
J033079G14TGGGACCCACNONE
J033101E06TGGGACCCACNONE
J033116E06TGGGACCCACNONE
J033118L18TGGGACCCACNONE
J033135B13TGGGACCCACNONE
J033136C10TGGGACCCACNONE
J033136P08TGGGACCCACNONE
J043027B13TGGGACCCACNONE
J065039I03TGGGACCCACNONE
J065185N21TGGGACCCACNONE
J090008D14TGGGACCCACNONE
J090029K17TGGGACCCACNONE
J090047H20TGGGACCCACNONE
J090048N17TGGGACCCACNONE
J090085G08TGGGACCCACNONE
J090089F07TGGGACCCACNONE
Os02g0626100006-106-E04GGTCCCACNONE
015-001-G02GGTCCCACNONE
015-086-D09GGTCCCACNONE
015-098-G04GGTCCCACNONE
015-099-A02GGTCCCACNONE
Os02g0630000AK108631CGGGTCCCCyclin-like F-box domain containing protein.
J075104C09CGGGTCCCNONE
J075126N10CGGGTCCCNONE
Os02g0636700AK069779GGGACCCACGRAM domain containing protein.
Os02g0638650J090094O16CGCGTGGGTCCCPathogenesis-related transcriptional factor and ERF domain containing protein.
Os02g0643000009-051-D01TGGGTCCCANONE
AK073818TGGGTCCCASimilar to VAP27.
J023068D06TGGGTCCCANONE
J033068O06TGGGTCCCANONE
J075019O08TGGGTCCCANONE
J075140B16TGGGTCCCANONE
J100036D07TGGGTCCCANONE
J100067I05TGGGTCCCANONE
J100070D07TGGGTCCCANONE
Os02g0651500AK066333GTCCCACCCCCACTCCNONE
AK121865GTCCCACCCCCACTCCHypothetical protein.
J090038J11GTCCCACCCCCACTCCNONE
Os02g0672700AK059611CCCCCGCGGGGCCGGGTCCCDNA-directed RNA polymerase, subunit C11/M/9 family protein.
AK059611GGGACCCGDNA-directed RNA polymerase, subunit C11/M/9 family protein.
AK099179CCCCCGCGGGGCCGGGTCCCNONE
AK099179GGGACCCGNONE
J023098L23CCCCCGCGGGGCCGGGTCCCNONE
J023098L23GGGACCCGNONE
J065042J21CCCCCGCGGGGCCGGGTCCCNONE
J065042J21GGGACCCGNONE
J065187L09CCCCCGCGGGGCCGGGTCCCNONE
J065187L09GGGACCCGNONE
J065190O10CCCCCGCGGGGCCGGGTCCCNONE
J065190O10GGGACCCGNONE
J080041G14CCCCCGCGGGGCCGGGTCCCNONE
J080041G14GGGACCCGNONE
J080078K08CCCCCGCGGGGCCGGGTCCCNONE
J080078K08GGGACCCGNONE
J080089D20CCCCCGCGGGGCCGGGTCCCNONE
J080089D20GGGACCCGNONE
J080094D04CCCCCGCGGGGCCGGGTCCCNONE
J080094D04GGGACCCGNONE
Os02g0677300006-102-D12CGGGTCCCNONE
AK060550CGGGTCCCNONE
AK106041CGGGTCCCSimilar to CRT/DRE binding factor 1.
Os02g0677700AK119947TGAGGGACNONE
Os02g0679200AK110789TGAGGGACTetratricopeptide-like helical domain containing protein.
Os02g0686700AK111294AGCCCACAGACAGGTGGGACCCGProtein of unknown function DUF581 family protein.
AK111294GGTCCCACProtein of unknown function DUF581 family protein.
Os02g0687900AK064814GGACCCACPeptidase S10, serine carboxypeptidase family protein.
AK064814GGACCCACPeptidase S10, serine carboxypeptidase family protein.
J023060J12GGACCCACNONE
J023060J12GGACCCACNONE
J023125B06GGACCCACNONE
J023125B06GGACCCACNONE
J023135G12GGACCCACNONE
J023135G12GGACCCACNONE
J023146L10GGACCCACNONE
J023146L10GGACCCACNONE
J033113K15GGACCCACNONE
J033113K15GGACCCACNONE
J043024O04GGACCCACNONE
J043024O04GGACCCACNONE
J090049G02GGACCCACNONE
J090049G02GGACCCACNONE
Os02g0697500AK105680CAGGTGGGACSimilar to Selenium-binding protein-like.
Os02g0697700AK120209CGGGTGGGACCConserved hypothetical protein.
J013038N05CGGGTGGGACCNONE
J013170I01CGGGTGGGACCNONE
J033144L08CGGGTGGGACCNONE
J033145L08CGGGTGGGACCNONE
J043004E24CGGGTGGGACCNONE
J065032A08CGGGTGGGACCNONE
J065166F03CGGGTGGGACCNONE
J075174D13CGGGTGGGACCNONE
J100019I19CGGGTGGGACCNONE
J100073F13CGGGTGGGACCNONE
Os02g0698100009-089-H10TGAGGGACNONE
AK060614TGAGGGACGalactose oxidase, central domain containing protein.
J090039P20TGAGGGACNONE
Os02g0702600AK102549GGTGGGACProtein of unknown function DUF315 domain containing protein.
AK102962GGTGGGACNONE
Os02g0705500006-032-F08GGGACCCGNONE
AK073952GGGACCCGNONE
AK119183GGGACCCGBasic helix-loop-helix dimerisation region bHLH domain containing protein.
Os02g0714700AK067734TGAGGGACConserved hypothetical protein.
Os02g0725100AK071759CACTGACAAGTGGGACCCNONE
Os02g0725300AK120054TGGGACCCNONE
J013000L05TGGGACCCNONE
J065194M19TGGGACCCNONE
Os02g0728600AK063054GGTCCCACSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2).
J065121P04GGTCCCACNONE
Os02g0733300AK101108TCCAACGGTCCCACCCGSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4).
AK105446TCCAACGGTCCCACCCGNONE
Os02g0735200015-035-A06TGGGACCCACNONE
015-048-A05TGGGACCCACNONE
015-091-A06TGGGACCCACNONE
016-082-G07TGGGACCCACNONE
016-086-G04TGGGACCCACNONE
AB037595TGGGACCCACNONE
AK061157TGGGACCCACNONE
AK071969TGGGACCCACNONE
AK104987TGGGACCCACNONE
AK109397TGGGACCCACGlutamine synthetase shoot isozyme (EC 6.3.1.2) (Glutamate--ammonia ligase) (Clone lambda-GS28).
X14245TGGGACCCACNONE
Os02g0743800AK064134GGACCCACCS domain containing protein.
AK111254GGACCCACNONE
Os02g0751600006-048-C01TGAGGGACNONE
006-059-E07TGAGGGACNONE
AK060441TGAGGGACNONE
AK061027TGAGGGACNONE
AK072946TGAGGGACPeptidylprolyl isomerase, FKBP-type domain containing protein.
AK104401TGAGGGACNONE
J023150D22TGAGGGACNONE
J075005E17TGAGGGACNONE
J075019F10TGAGGGACNONE
J075047K24TGAGGGACNONE
J075052B13TGAGGGACNONE
J075063M19TGAGGGACNONE
J075136P10TGAGGGACNONE
J075139E24TGAGGGACNONE
J075152K11TGAGGGACNONE
J075161A10TGAGGGACNONE
J075187F20TGAGGGACNONE
Os02g0753800AK101787CGGGTCCCACCSimilar to Annexin p35.
Os02g0753900J080009I06TGAGGGACNONE
J080034B10TGAGGGACNONE
J080045G05TGAGGGACNONE
J080074J05TGAGGGACNONE
J080082L14TGAGGGACNONE
J080083B04TGAGGGACNONE
J080089A14TGAGGGACNONE
Os02g0754500AK069965CGGGTCCCACNONE
AK105696CGGGTCCCACAmidase family protein.
Os02g0755200AK070699TGAGGGACSimilar to FLOWERING LOCUS D (Fragment).
J023056I20TGAGGGACNONE
J065048B13TGAGGGACNONE
J065128H21TGAGGGACNONE
J065201E09TGAGGGACNONE
Os02g0761400009-088-B01GTGGGACCNONE
AK060417GTGGGACCConserved hypothetical protein.
Os02g0761600AK120494TGGGACCCACConserved hypothetical protein.
Os02g0769200J065031C02GGTCCCACCTGTCNONE
J065206E04GGTCCCACCTGTCNONE
Os02g0771500006-096-D12CCCGTGGGACCCACNONE
006-096-D12GTGGGACCCACNONE
006-096-D12TGGGTCCCACNONE
009-011-G02CCCGTGGGACCCACNONE
009-011-G02GTGGGACCCACNONE
009-011-G02TGGGTCCCACNONE
AK062335CCCGTGGGACCCACNONE
AK062335GTGGGACCCACNONE
AK062335TGGGTCCCACNONE
AK106018CCCGTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018GTGGGACCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type).
AK106018TGGGTCCCACSimilar to Pap1p; poly A polymerase (Eukaryotic type).
Os02g0777950J090078H24GTCCCTCAConserved hypothetical protein.
J090078H24TGAGGGACConserved hypothetical protein.
J090078H24TGAGGGACConserved hypothetical protein.
Os02g0780800J090080O19GGACCCACTTGNONE
J090091I06GGACCCACTTGNONE
Os02g0782100AK065421TGAGGGACChorismate synthase family protein.
J065038A03TGAGGGACNONE
Os02g0788600Os02g0788600GGTCCCACCClp, N terminal domain containing protein.
Os02g0791800AK066282GGGACCCANONE
AK099697GGGACCCAWD-40 repeat containing protein.
AY445625GGGACCCANONE
J053065H07GGGACCCANONE
J065108P05GGGACCCANONE
J065154P22GGGACCCANONE
J100037P04GGGACCCANONE
J100068K05GGGACCCANONE
Os02g0796300006-087-C02TGAGGGACNONE
AK061820TGAGGGACNONE
AK073025TGAGGGACNONE
AK119386TGAGGGACSimilar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1).
J013033A22TGAGGGACNONE
J013096K18TGAGGGACNONE
J023072E02TGAGGGACNONE
J023113M08TGAGGGACNONE
J023149N08TGAGGGACNONE
Os02g0798700AK101070TGAGGGACNeurochondrin family protein.
AK103079TGAGGGACNONE
J090045L09TGAGGGACNONE
Os02g0805200AK071591GGTCCCACProliferating cell nuclear antigen (PCNA) (Cyclin).
J023105C08GGTCCCACNONE
J033030H07GGTCCCACNONE
J033050M24GGTCCCACNONE
J033069B10GGTCCCACNONE
J033121A16GGTCCCACNONE
J053023M14GGTCCCACNONE
J053033A15GGTCCCACNONE
J053054H14GGTCCCACNONE
J053055H24GGTCCCACNONE
J053082B18GGTCCCACNONE
J065001N03GGTCCCACNONE
J065011O16GGTCCCACNONE
J065026K24GGTCCCACNONE
J065056C09GGTCCCACNONE
J065067H11GGTCCCACNONE
J065097E19GGTCCCACNONE
J065118O11GGTCCCACNONE
J065124N09GGTCCCACNONE
J065143A02GGTCCCACNONE
J065213P06GGTCCCACNONE
J065215E24GGTCCCACNONE
J075051B11GGTCCCACNONE
J075065K05GGTCCCACNONE
J080306E10GGTCCCACNONE
J090042I16GGTCCCACNONE
J090066J24GGTCCCACNONE
J090092K17GGTCCCACNONE
J100029A17GGTCCCACNONE
J100052N08GGTCCCACNONE
J100071I23GGTCCCACNONE
Os02g0824900AK073217GTGGGACCNONE
AK073217TGAGGGACNONE
AK103528GTGGGACCConserved hypothetical protein.
AK103528TGAGGGACConserved hypothetical protein.
J090069J01GTGGGACCNONE
J090069J01TGAGGGACNONE
J090081B04GTGGGACCNONE
J090081B04TGAGGGACNONE
Os02g0831600AB081951GTGGGACCNONE
AK103279GTGGGACCAGO1 homologous protein.
Os03g0106400AK108687GGTGGGACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5).
Os03g0108700003-131-E01GTGGGACCCACGTGGCNONE
AK105115GTGGGACCCACGTGGCConserved hypothetical protein.
AY224538GTGGGACCCACGTGGCNONE
J065029A19GTGGGACCCACGTGGCNONE
J065109N11GTGGGACCCACGTGGCNONE
Os03g0111100AK102025GGGACCCACTTGSimilar to Dihydrofolate synthetase /folylpolyglutamate synthetase.
Os03g0114300AK121970GGGACCCACProtein kinase-like domain containing protein.
Os03g0123300003-131-G09GTCCCACCACNONE
AK058595GTCCCACCACNONE
J075056B01GTCCCACCACNONE
Os03g0128500AB037900TGGGACCCACNONE
AK067991TGGGACCCACSimilar to DNA polymerase delta small subunit (EC 2.7.7.7).
J013124O04TGGGACCCACNONE
J090032P09TGGGACCCACNONE
Os03g0130400AK070255CGTGTGGGACCAdenylate kinase, subfamily protein.
AK070255GACAGGTGGGACCAdenylate kinase, subfamily protein.
Os03g0134300AK102053ACGTGTCCCACCACSimilar to ATP phosphoribosyl transferase.
Os03g0136900AK067183GTGGGACCSimilar to Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase).
Os03g0143000AK073102TGAGGGACCCGSAM (and some other nucleotide) binding motif domain containing protein.
J033051I24TGAGGGACCCGNONE
Os03g0143600AB110188TGAGGGACNONE
AK068424TGAGGGACSimilar to Inhibitor of growth protein 1. Splice isoform 2.
AY224464TGAGGGACNONE
AY224545TGAGGGACNONE
J013154F02TGAGGGACNONE
Os03g0146000006-105-H06GGACCCACACGNONE
AK061250GGACCCACACGSimilar to RAB1X.
AK099130GGACCCACACGNONE
J023043D11GGACCCACACGNONE
J043009O17GGACCCACACGNONE
Os03g0151800AK064955GGGACCCACNONE
AK064955GTGGGACCCACNONE
AK098874GGGACCCACNONE
AK098874GTGGGACCCACNONE
AK098980GGGACCCACNONE
AK098980GTGGGACCCACNONE
AK099712GGGACCCACNONE
AK099712GTGGGACCCACNONE
AK099889GGGACCCACNONE
AK099889GTGGGACCCACNONE
AK121641GGGACCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a).
AK121641GTGGGACCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a).
J013001A05GGGACCCACNONE
J013001A05GTGGGACCCACNONE
J013001D04GGGACCCACNONE
J013001D04GTGGGACCCACNONE
J013121O12GGGACCCACNONE
J013121O12GTGGGACCCACNONE
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1).
Os03g0167000AK107307GGTGGGACConserved hypothetical protein.
J100070K07GGTGGGACNONE
Os03g0174200AK060616CAAGTGGGTCCCACNONE
AK103762CAAGTGGGTCCCACConserved hypothetical protein.
J033143G15CAAGTGGGTCCCACNONE
J090025L02CAAGTGGGTCCCACNONE
Os03g0175600AK059981GGGTCCCACGTGSimilar to Nit protein 2 (CUA002).
AK059981TGAGGGACSimilar to Nit protein 2 (CUA002).
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein.
AK071368GTCCCTCAGCN5-related N-acetyltransferase domain containing protein.
AK071368GTGGGTCCCACCGCN5-related N-acetyltransferase domain containing protein.
Os03g0178300AK121217GTCCCACCEpoxide hydrolase family protein.
Os03g0195200AK068949GGTCCCACPossible metal-binding region in RNase L inhibitor, RLI domain containing protein.
Os03g0197400AK071413TGAGGGACSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4).
AK104905TGAGGGACNONE
J053023D18TGAGGGACNONE
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein.
Os03g0213600AK100407GGTCCCACACGConserved hypothetical protein.
AK100407GGTGGGACCCACCCGConserved hypothetical protein.
Os03g0218300015-078-G09CGGGTCCCConserved hypothetical protein.
J090095I10CGGGTCCCNONE
Os03g0218400AK069202GTGGGTCCCACCSimilar to Hexose transporter.
AK099306GTGGGTCCCACCNONE
AY342321GTGGGTCCCACCNONE
J023066K08GTGGGTCCCACCNONE
J100032N19GTGGGTCCCACCNONE
Os03g0220700J100064H16TGAGGGACNONE
Os03g0225200AK065907TGGGACCCACNONE
AK074008TGGGACCCACCyclin-like domain containing protein.
J013044F04TGGGACCCACNONE
J090071F03TGGGACCCACNONE
Os03g0227000AK068454GGGACCCASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP).
Os03g0245800013-094-D06TGAGGGACNONE
AB020973TGAGGGACNONE
AK063618TGAGGGACNONE
AK120045TGAGGGACNONE
AK120048TGAGGGACSimilar to Heat shock protein 26.
J075104O17TGAGGGACNONE
Os03g0251800AK067333TGAGGGACSimilar to Possible OmpA family member precursor.
AK073337TGAGGGACNONE
Os03g0255900009-164-C12GGGACCCGNONE
AK063057GGGACCCGConserved hypothetical protein.
Os03g0271100AB095095TGAGGGACNONE
AB095095TGAGGGACNONE
AB095095TGAGGGACNONE
AK060821TGAGGGACSimilar to Sigma factor SIG2B.
AK060821TGAGGGACSimilar to Sigma factor SIG2B.
AK060821TGAGGGACSimilar to Sigma factor SIG2B.
AK067693TGAGGGACNONE
AK067693TGAGGGACNONE
AK067693TGAGGGACNONE
AK099036TGAGGGACNONE
AK099036TGAGGGACNONE
AK099036TGAGGGACNONE
Os03g0275900AK109303GGTGGGACCNONE
AK121978GGTGGGACCSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11).
Os03g0283100006-097-E01GGTCCCACCNONE
AK061849GGTCCCACCNONE
AK065887GGTCCCACCSimilar to In2-1 protein.
J013044J05GGTCCCACCNONE
J013130I02GGTCCCACCNONE
J013162M18GGTCCCACCNONE
J023014O17GGTCCCACCNONE
J023139N17GGTCCCACCNONE
Os03g0284400AF095709GGTCCCACNONE
AK061592GGTCCCACNONE
AK069064GGTCCCACSimilar to Ribosomal protein L10-like.
J013169G16GGTCCCACNONE
J023009H08GGTCCCACNONE
J065161F15GGTCCCACNONE
J080052C13GGTCCCACNONE
Os03g0285900AK073348TGAGGGACSimilar to Splicing factor RSZ33.
J033025D08TGAGGGACNONE
J033087M12TGAGGGACNONE
J065008F11TGAGGGACNONE
J065059C09TGAGGGACNONE
J065070J11TGAGGGACNONE
J065076L20TGAGGGACNONE
J065083M19TGAGGGACNONE
J065111I06TGAGGGACNONE
J065112H18TGAGGGACNONE
J065112J18TGAGGGACNONE
J065140C08TGAGGGACNONE
J065180P06TGAGGGACNONE
J065187G12TGAGGGACNONE
J065189B14TGAGGGACNONE
J090042N02TGAGGGACNONE
J090087M04TGAGGGACNONE
Os03g0288101J023001N08GGTCCCACCNONE
J033068A04GGTCCCACCNONE
J033111P19GGTCCCACCNONE
J065131H13GGTCCCACCHypothetical protein.
Os03g0297400AK060653TGAGGGACNONE
AK061403TGAGGGACNONE
AK101597TGAGGGACMalonyl CoA-acyl carrier protein transacylase family protein.
Os03g0298900006-028-C11CCCGTGGGACCCACNONE
006-028-C11GGTGGGACCCACNONE
AK060996CCCGTGGGACCCACHypothetical protein.
AK060996GGTGGGACCCACHypothetical protein.
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein.
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE
Os03g0308000016-023-H09GGTCCCACNONE
AK100355GGTCCCACUbiquitin-conjugating enzyme, E2 domain containing protein.
J023013H05GGTCCCACNONE
J023043K04GGTCCCACNONE
J023083I20GGTCCCACNONE
J033068F22GGTCCCACNONE
J033125P21GGTCCCACNONE
J065207A22GGTCCCACNONE
J100018D20GGTCCCACNONE
J100026L17GGTCCCACNONE
J100055D14GGTCCCACNONE
J100060P03GGTCCCACNONE
J100078A20GGTCCCACNONE
Os03g0312600AK073391TGAGGGACSimilar to XPA-binding protein 1 (HUSSY-23).
Os03g0313600AK067474TGAGGGACSimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment).
Os03g0321900AK073317GGGACCCGGCCGGCCCCMP/dCMP deaminase, zinc-binding domain containing protein.
Os03g0331600009-025-C11TGAGGGACNONE
AK063782TGAGGGACConserved hypothetical protein.
Os03g0338600AK066604GTGGGTCCCAtRNA pseudouridine synthase family protein.
AK066604TGAGGGACtRNA pseudouridine synthase family protein.
Os03g0339100AK111641TGAGGGACSimilar to PRL1 protein.
Os03g0341600AK067497CGGGTCCCConserved hypothetical protein.
Os03g0343700AK060603GGTGGGACCCACBrix domain containing protein.
AK102274GGTGGGACCCACNONE
J033089C06GGTGGGACCCACNONE
J090089A17GGTGGGACCCACNONE
Os03g0372900AK100417TGAGGGACCCGCyclin-like F-box domain containing protein.
Os03g0390600009-122-E09GTGGGACCNONE
J065165K04GTGGGACCNONE
Os03g0395900AK120654GGACCCACNONE
J075050E23GGACCCACNONE
Os03g0397400AB112772GGGACCCACNONE
AK069928GGGACCCACSimilar to Low affinity calcium transporter CAX2 (Fragment).
J023014O18GGGACCCACNONE
J023036P06GGGACCCACNONE
J023145E24GGGACCCACNONE
J033142I11GGGACCCACNONE
J043003A10GGGACCCACNONE
J075023H21GGGACCCACNONE
J075145O10GGGACCCACNONE
J075149A03GGGACCCACNONE
J090099B09GGGACCCACNONE
J100017L14GGGACCCACNONE
J100050K18GGGACCCACNONE
J100063P16GGGACCCACNONE
Os03g0412200AK061834GTCCCTCAConserved hypothetical protein.
J043024C24GTCCCTCANONE
J065186M10GTCCCTCANONE
Os03g0412400AK110543GGGACCCACConserved hypothetical protein.
J065080E23GGGACCCACNONE
Os03g0415500AK108435GGAGTGGGTCCCACMitochondrial import inner membrane translocase, subunit Tim17/22 family protein.
J065182P12GGAGTGGGTCCCACNONE
Os03g0418700AK099879GTGGGACCCGNONE
AK101797GTGGGACCCGConserved hypothetical protein.
Os03g0437600006-051-A10GGACCCACNONE
006-059-D02GGACCCACNONE
006-074-A04GGACCCACNONE
006-089-G11GGACCCACNONE
006-095-H02GGACCCACNONE
006-118-B09GGACCCACNONE
009-156-G04GGACCCACNONE
015-015-G01GGACCCACNONE
016-089-D06GGACCCACNONE
AK061303GGACCCACNONE
AK070773GGACCCACNONE
AK073355GGACCCACSimilar to Hydrolase.
AK104138GGACCCACNONE
AK104400GGACCCACNONE
J033030A08GGACCCACNONE
J065056E01GGACCCACNONE
J065061F16GGACCCACNONE
J065075L21GGACCCACNONE
J065102E09GGACCCACNONE
J065175K12GGACCCACNONE
J065197D14GGACCCACNONE
J065199D08GGACCCACNONE
J075029F13GGACCCACNONE
J075042F07GGACCCACNONE
J075056E23GGACCCACNONE
J075077L02GGACCCACNONE
J075086N01GGACCCACNONE
J075095I08GGACCCACNONE
J075099N21GGACCCACNONE
J075099O09GGACCCACNONE
J075109L06GGACCCACNONE
J075114H11GGACCCACNONE
J075120E09GGACCCACNONE
J075137F08GGACCCACNONE
J075154D10GGACCCACNONE
J075158A18GGACCCACNONE
J075197N10GGACCCACNONE
Os03g0562400AK063408GTGGGTCCAGADi-copper centre-containing domain containing protein.
Os03g0566600011-071-A08TGAGGGACNONE
AK063379TGAGGGACMethyltransferase FkbM domain containing protein.
Os03g0566800AK103270TGAGGGACSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3).
J023063L18TGAGGGACNONE
J023136P06TGAGGGACNONE
J033081A22TGAGGGACNONE
J033109N12TGAGGGACNONE
J033124H10TGAGGGACNONE
J033141B09TGAGGGACNONE
J090026G23TGAGGGACNONE
J090077J20TGAGGGACNONE
Os03g0569800AK070080TGAGGGACProtein prenyltransferase domain containing protein.
AK120873TGAGGGACNONE
Os03g0576900AK071314GGGCCGGGTCCCAmino acid/polyamine transporter I family protein.
J023074L08GGGCCGGGTCCCNONE
J023084D13GGGCCGGGTCCCNONE
J080011C14GGGCCGGGTCCCNONE
J080012F24GGGCCGGGTCCCNONE
J080018M05GGGCCGGGTCCCNONE
J080021G05GGGCCGGGTCCCNONE
J080021N18GGGCCGGGTCCCNONE
J080023E19GGGCCGGGTCCCNONE
J080024H14GGGCCGGGTCCCNONE
J080025E15GGGCCGGGTCCCNONE
J080038F19GGGCCGGGTCCCNONE
J080044N09GGGCCGGGTCCCNONE
J080054D05GGGCCGGGTCCCNONE
J080057J16GGGCCGGGTCCCNONE
J080060A05GGGCCGGGTCCCNONE
J080061M12GGGCCGGGTCCCNONE
J080063H13GGGCCGGGTCCCNONE
J080065O04GGGCCGGGTCCCNONE
J080066I17GGGCCGGGTCCCNONE
J080066J06GGGCCGGGTCCCNONE
J080089J22GGGCCGGGTCCCNONE
J080090I03GGGCCGGGTCCCNONE
J080091J23GGGCCGGGTCCCNONE
J080091K20GGGCCGGGTCCCNONE
J080093G24GGGCCGGGTCCCNONE
J080094I08GGGCCGGGTCCCNONE
J080096A17GGGCCGGGTCCCNONE
J090051G12GGGCCGGGTCCCNONE
Os03g0581800009-177-G11TGAGGGACCCGNONE
AK059201TGAGGGACCCGNONE
AK121839TGAGGGACCCGHypothetical protein.
J023022K06TGAGGGACCCGNONE
J023110K21TGAGGGACCCGNONE
J033100N18TGAGGGACCCGNONE
J033120D11TGAGGGACCCGNONE
J065044P15TGAGGGACCCGNONE
J065102G22TGAGGGACCCGNONE
J065149N14TGAGGGACCCGNONE
J065201L18TGAGGGACCCGNONE
J065205K10TGAGGGACCCGNONE
J075035D19TGAGGGACCCGNONE
J075073E06TGAGGGACCCGNONE
J075134M11TGAGGGACCCGNONE
J090004P12TGAGGGACCCGNONE
J090070H20TGAGGGACCCGNONE
J090087B04TGAGGGACCCGNONE
J100028F10TGAGGGACCCGNONE
J100036M18TGAGGGACCCGNONE
J100065C24TGAGGGACCCGNONE
J100080O13TGAGGGACCCGNONE
Os03g0584300009-018-H09TGAGGGACNONE
AK105133TGAGGGACProtein of unknown function UPF0136, Transmembrane family protein.
J065053M11TGAGGGACNONE
Os03g0588200011-005-E04TGAGGGACNONE
AK120221TGAGGGACFrigida-like family protein.
J100086E17TGAGGGACNONE
Os03g0596800AK073603GTGGGACCCAConserved hypothetical protein.
J033052N01GTGGGACCCANONE
Os03g0597400AK108626TGGGTCCCACProtein of unknown function DUF1618 domain containing protein.
Os03g0634000014-034-A03GTATGGGCCGGGACCCANONE
AK063673GTATGGGCCGGGACCCASimilar to THA4.
Os03g0648300AK067192GTGGGTCCGTCCGAIQ calmodulin-binding region domain containing protein.
J013098A04GTGGGTCCGTCCGANONE
J075149P13GTGGGTCCGTCCGANONE
J100044P16GTGGGTCCGTCCGANONE
J100053G19GTGGGTCCGTCCGANONE
Os03g0681900006-042-F08TGAGGGACNONE
009-043-F12TGAGGGACNONE
AK061750TGAGGGACNONE
AK062094TGAGGGACSimilar to RGP-3 (Fragment).
J033034F01TGAGGGACNONE
J033131F11TGAGGGACNONE
J033143N03TGAGGGACNONE
Os03g0684400AK100086GTGGGACCCACMg2+ transporter protein, CorA-like family protein.
Os03g0688200015-014-E12AAGGCCCAGGGTGGGTCCNONE
AK103539AAGGCCCAGGGTGGGTCCConserved hypothetical protein.
Os03g0703000006-041-G10TGAGGGACNONE
006-105-H09TGAGGGACNONE
011-081-D12TGAGGGACNONE
AK059920TGAGGGACNONE
J033055L14TGAGGGACNONE
J065021C12TGAGGGACNONE
J065132L04TGAGGGACNONE
J065184C03TGAGGGACNONE
J090007D24TGAGGGACNONE
J090008N18TGAGGGACNONE
J090014H20TGAGGGACNONE
J090023B02TGAGGGACNONE
J090024F24TGAGGGACNONE
J090059I23TGAGGGACNONE
J090070I22TGAGGGACNONE
J090081H20TGAGGGACNONE
J090094K11TGAGGGACNONE
Os03g0704200AK071176GCCACGTGGGTCCCACCZinc finger, MYND-type domain containing protein.
J023083O08GCCACGTGGGTCCCACCNONE
Os03g0704400AK101297TGAGGGACProtein kinase domain containing protein.
AK101297TGAGGGACProtein kinase domain containing protein.
J033033I19TGAGGGACNONE
J033033I19TGAGGGACNONE
J090009M06TGAGGGACNONE
J090009M06TGAGGGACNONE
Os03g0711800AK122108GTCCCACCSimilar to IRE homolog 1 (Fragment).
Os03g0713100J013039M09GGTCCCACCACNONE
J023007K01GGTCCCACCACNONE
J023073H01GGTCCCACCACNONE
J023087M20GGTCCCACCACNONE
J023142E01GGTCCCACCACNONE
J033048E03GGTCCCACCACNONE
J033048F03GGTCCCACCACSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1).
J033058C11GGTCCCACCACNONE
J033074M20GGTCCCACCACNONE
J033084M11GGTCCCACCACNONE
J033091I23GGTCCCACCACNONE
J033100C08GGTCCCACCACNONE
J033123K19GGTCCCACCACNONE
J090006P21GGTCCCACCACNONE
J090045O16GGTCCCACCACNONE
J100087M13GGTCCCACCACNONE
Os03g0721700AK106706TGAGGGACProtein of unknown function DUF569 family protein.
Os03g0725000AK059294TGAGGGACNONE
J043026H11TGAGGGACNONE
J065187O06TGAGGGACNONE
J090066M23TGAGGGACNONE
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE
006-023-C08TCTGGACCCACCTGTCAGTGNONE
006-029-H02TCTGGACCCACCTGTCAGTGNONE
006-032-B03TCTGGACCCACCTGTCAGTGNONE
006-035-C10TCTGGACCCACCTGTCAGTGNONE
006-040-H05TCTGGACCCACCTGTCAGTGNONE
006-043-C02TCTGGACCCACCTGTCAGTGNONE
006-046-B11TCTGGACCCACCTGTCAGTGNONE
006-046-E05TCTGGACCCACCTGTCAGTGNONE
006-046-H04TCTGGACCCACCTGTCAGTGNONE
006-048-A09TCTGGACCCACCTGTCAGTGNONE
006-050-A02TCTGGACCCACCTGTCAGTGNONE
006-063-A02TCTGGACCCACCTGTCAGTGNONE
006-064-A09TCTGGACCCACCTGTCAGTGNONE
006-070-G11TCTGGACCCACCTGTCAGTGNONE
006-072-G04TCTGGACCCACCTGTCAGTGNONE
006-077-G12TCTGGACCCACCTGTCAGTGNONE
006-080-F04TCTGGACCCACCTGTCAGTGNONE
006-080-H01TCTGGACCCACCTGTCAGTGNONE
006-084-D10TCTGGACCCACCTGTCAGTGNONE
006-084-G06TCTGGACCCACCTGTCAGTGNONE
006-085-H10TCTGGACCCACCTGTCAGTGNONE
006-086-C05TCTGGACCCACCTGTCAGTGNONE
006-087-D10TCTGGACCCACCTGTCAGTGNONE
006-096-C09TCTGGACCCACCTGTCAGTGNONE
006-100-F10TCTGGACCCACCTGTCAGTGNONE
006-108-D12TCTGGACCCACCTGTCAGTGNONE
006-115-G10TCTGGACCCACCTGTCAGTGNONE
006-119-C09TCTGGACCCACCTGTCAGTGNONE
006-120-E05TCTGGACCCACCTGTCAGTGNONE
011-042-H01TCTGGACCCACCTGTCAGTGNONE
011-075-B11TCTGGACCCACCTGTCAGTGNONE
013-003-D03TCTGGACCCACCTGTCAGTGNONE
013-028-B11TCTGGACCCACCTGTCAGTGNONE
013-031-A01TCTGGACCCACCTGTCAGTGNONE
013-035-F03TCTGGACCCACCTGTCAGTGNONE
013-051-D02TCTGGACCCACCTGTCAGTGNONE
013-055-D06TCTGGACCCACCTGTCAGTGNONE
013-059-H03TCTGGACCCACCTGTCAGTGNONE
013-076-A09TCTGGACCCACCTGTCAGTGNONE
013-076-B01TCTGGACCCACCTGTCAGTGNONE
013-090-F09TCTGGACCCACCTGTCAGTGNONE
013-100-A05TCTGGACCCACCTGTCAGTGNONE
013-100-F05TCTGGACCCACCTGTCAGTGNONE
013-100-G12TCTGGACCCACCTGTCAGTGNONE
014-006-G08TCTGGACCCACCTGTCAGTGNONE
015-003-B07TCTGGACCCACCTGTCAGTGNONE
016-093-C06TCTGGACCCACCTGTCAGTGNONE
AF030548TCTGGACCCACCTGTCAGTGNONE
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin).
AK119247TCTGGACCCACCTGTCAGTGNONE
AK119362TCTGGACCCACCTGTCAGTGNONE
AK119638TCTGGACCCACCTGTCAGTGNONE
J013066P16TCTGGACCCACCTGTCAGTGNONE
J023022H18TCTGGACCCACCTGTCAGTGNONE
J023087O13TCTGGACCCACCTGTCAGTGNONE
J023121I16TCTGGACCCACCTGTCAGTGNONE
J023123M09TCTGGACCCACCTGTCAGTGNONE
J033022M05TCTGGACCCACCTGTCAGTGNONE
J033087C05TCTGGACCCACCTGTCAGTGNONE
J065022K07TCTGGACCCACCTGTCAGTGNONE
J065024E22TCTGGACCCACCTGTCAGTGNONE
J065041G05TCTGGACCCACCTGTCAGTGNONE
J065045M11TCTGGACCCACCTGTCAGTGNONE
J065082K10TCTGGACCCACCTGTCAGTGNONE
J065121K18TCTGGACCCACCTGTCAGTGNONE
J065137O07TCTGGACCCACCTGTCAGTGNONE
J065144B12TCTGGACCCACCTGTCAGTGNONE
J065152E04TCTGGACCCACCTGTCAGTGNONE
J065159D24TCTGGACCCACCTGTCAGTGNONE
J065217E02TCTGGACCCACCTGTCAGTGNONE
J075014N22TCTGGACCCACCTGTCAGTGNONE
J075064O17TCTGGACCCACCTGTCAGTGNONE
J080316L10TCTGGACCCACCTGTCAGTGNONE
J080318L20TCTGGACCCACCTGTCAGTGNONE
J090034D01TCTGGACCCACCTGTCAGTGNONE
J090034P05TCTGGACCCACCTGTCAGTGNONE
J090041H08TCTGGACCCACCTGTCAGTGNONE
J090042F20TCTGGACCCACCTGTCAGTGNONE
J090042I15TCTGGACCCACCTGTCAGTGNONE
J090050O17TCTGGACCCACCTGTCAGTGNONE
J090054L13TCTGGACCCACCTGTCAGTGNONE
J090062A12TCTGGACCCACCTGTCAGTGNONE
J090068I22TCTGGACCCACCTGTCAGTGNONE
J090070J23TCTGGACCCACCTGTCAGTGNONE
J090070M18TCTGGACCCACCTGTCAGTGNONE
J090084L07TCTGGACCCACCTGTCAGTGNONE
J090087H13TCTGGACCCACCTGTCAGTGNONE
J090095H10TCTGGACCCACCTGTCAGTGNONE
J090099M17TCTGGACCCACCTGTCAGTGNONE
J100022O10TCTGGACCCACCTGTCAGTGNONE
J100048A05TCTGGACCCACCTGTCAGTGNONE
J100057O06TCTGGACCCACCTGTCAGTGNONE
X91806TCTGGACCCACCTGTCAGTGNONE
Os03g0735000AK069296GTGGGTCCCACGCGSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC 2.7.7.27) (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment).
Os03g0736300AK104929GGGACCCGTGGGGCNONE
Os03g0780500005-002-D07TGGGACCCGNONE
AK061643TGGGACCCGSimilar to Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205) (IMP dehydrogenase) (IMPDH) (IMPD).
Os03g0780600AK120180GGGACCCACNONE
AK120180TGGGTCCCACCNONE
D13224GGGACCCACTubulin beta-1 chain (Beta-1 tubulin).
D13224TGGGTCCCACCTubulin beta-1 chain (Beta-1 tubulin).
J013033M18GGGACCCACNONE
J013033M18TGGGTCCCACCNONE
J033022G05GGGACCCACNONE
J033022G05TGGGTCCCACCNONE
J033028A16GGGACCCACNONE
J033028A16TGGGTCCCACCNONE
J033050M08GGGACCCACNONE
J033050M08TGGGTCCCACCNONE
J090053F04GGGACCCACNONE
J090053F04TGGGTCCCACCNONE
J090064E19GGGACCCACNONE
J090064E19TGGGTCCCACCNONE
J090083J24GGGACCCACNONE
J090083J24TGGGTCCCACCNONE
J100024I23GGGACCCACNONE
J100024I23TGGGTCCCACCNONE
Os03g0785800AB071806TGGGTCCCSimilar to Transcription factor PCF6 (Fragment).
J090057A17TGGGTCCCNONE
Os03g0786600AK109838GGGTCCCACProtein of unknown function DUF860, plant family protein.
Os03g0791800013-037-A12CACGTGGGACCCANONE
013-037-A12CGTGGACCCACNONE
AB079798CACGTGGGACCCANONE
AB079798CGTGGACCCACNONE
AK067703CACGTGGGACCCARad6 (Ubiquitin carrier protein).
AK067703CGTGGACCCACRad6 (Ubiquitin carrier protein).
AK120251CACGTGGGACCCANONE
AK120251CGTGGACCCACNONE
J013045G10CACGTGGGACCCANONE
J013045G10CGTGGACCCACNONE
J023102B18CACGTGGGACCCANONE
J023102B18CGTGGACCCACNONE
J065020J23CACGTGGGACCCANONE
J065020J23CGTGGACCCACNONE
J065127I21CACGTGGGACCCANONE
J065127I21CGTGGACCCACNONE
J065151E11CACGTGGGACCCANONE
J065151E11CGTGGACCCACNONE
J075076B05CACGTGGGACCCANONE
J075076B05CGTGGACCCACNONE
J075116C15CACGTGGGACCCANONE
J075116C15CGTGGACCCACNONE
J075136A07CACGTGGGACCCANONE
J075136A07CGTGGACCCACNONE
J100029G21CACGTGGGACCCANONE
J100029G21CGTGGACCCACNONE
J100030K01CACGTGGGACCCANONE
J100030K01CGTGGACCCACNONE
J100041J02CACGTGGGACCCANONE
J100041J02CGTGGACCCACNONE
J100049C22CACGTGGGACCCANONE
J100049C22CGTGGACCCACNONE
J100057G17CACGTGGGACCCANONE
J100057G17CGTGGACCCACNONE
J100086L12CACGTGGGACCCANONE
J100086L12CGTGGACCCACNONE
Os03g0793100AK067897GTCCCTCAGlycosyl transferase, family 43 protein.
AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein.
J033125G24GTCCCTCANONE
J033125G24GTGGGACCCACGTGGGCCCCACANONE
J065132N21GTCCCTCANONE
J065132N21GTGGGACCCACGTGGGCCCCACANONE
Os03g0796600003-113-D10TGAGGGACGCGTGTCCCTCANONE
011-076-B12TGAGGGACGCGTGTCCCTCANONE
AK105257TGAGGGACGCGTGTCCCTCAProtein of unknown function DUF506, plant family protein.
J075105C03TGAGGGACGCGTGTCCCTCANONE
J080036O17TGAGGGACGCGTGTCCCTCANONE
J080064E16TGAGGGACGCGTGTCCCTCANONE
J080069E03TGAGGGACGCGTGTCCCTCANONE
J080079E23TGAGGGACGCGTGTCCCTCANONE
J090036H20TGAGGGACGCGTGTCCCTCANONE
J100029L10TGAGGGACGCGTGTCCCTCANONE
J100055G09TGAGGGACGCGTGTCCCTCANONE
Os03g0797700005-001-F11GTCCCACCNONE
AK061648GTCCCACCConserved hypothetical protein.
AK098876GTCCCACCNONE
J013001D18GTCCCACCNONE
J033070I21GTCCCACCNONE
J065124F13GTCCCACCNONE
J065218D02GTCCCACCNONE
J090080A22GTCCCACCNONE
J100032P18GTCCCACCNONE
Os03g0801800AK067130TGAGGGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J090079D17TGAGGGACNONE
J090087F23TGAGGGACNONE
Os03g0806800003-102-E03GTCCCTCANONE
009-036-G10GTCCCTCANONE
AK061623GTCCCTCAConserved hypothetical protein.
AK120337GTCCCTCANONE
J013059N15GTCCCTCANONE
J013059P10GTCCCTCANONE
J013059P11GTCCCTCANONE
Os03g0820400009-042-F06ACGCGTCCCACCNONE
009-046-E08ACGCGTCCCACCNONE
009-079-B08ACGCGTCCCACCNONE
009-111-H09ACGCGTCCCACCNONE
009-150-D10ACGCGTCCCACCNONE
015-073-H11ACGCGTCCCACCNONE
AK119690ACGCGTCCCACCSimilar to ZPT2-13.
AY286473ACGCGTCCCACCNONE
AY305864ACGCGTCCCACCNONE
J100051O21ACGCGTCCCACCNONE
Os03g0822400013-072-A06CCACTGACAAGTGGGTCCCNONE
013-072-A06GGTCCCACNONE
014-009-H06CCACTGACAAGTGGGTCCCNONE
014-009-H06GGTCCCACNONE
014-025-G05CCACTGACAAGTGGGTCCCNONE
014-025-G05GGTCCCACNONE
014-033-G02CCACTGACAAGTGGGTCCCNONE
014-033-G02GGTCCCACNONE
014-038-G06CCACTGACAAGTGGGTCCCNONE
014-038-G06GGTCCCACNONE
014-047-H10CCACTGACAAGTGGGTCCCNONE
014-047-H10GGTCCCACNONE
014-054-H04CCACTGACAAGTGGGTCCCNONE
014-054-H04GGTCCCACNONE
014-055-F05CCACTGACAAGTGGGTCCCNONE
014-055-F05GGTCCCACNONE
014-075-E04CCACTGACAAGTGGGTCCCNONE
014-075-E04GGTCCCACNONE
014-084-B02CCACTGACAAGTGGGTCCCNONE
014-084-B02GGTCCCACNONE
014-087-F10CCACTGACAAGTGGGTCCCNONE
014-087-F10GGTCCCACNONE
014-098-D02CCACTGACAAGTGGGTCCCNONE
014-098-D02GGTCCCACNONE
014-099-B04CCACTGACAAGTGGGTCCCNONE
014-099-B04GGTCCCACNONE
014-100-H10CCACTGACAAGTGGGTCCCNONE
014-100-H10GGTCCCACNONE
AK070075CCACTGACAAGTGGGTCCCConserved hypothetical protein.
AK070075GGTCCCACConserved hypothetical protein.
AK102425CCACTGACAAGTGGGTCCCNONE
AK102425GGTCCCACNONE
J065134M15CCACTGACAAGTGGGTCCCNONE
J065134M15GGTCCCACNONE
J090053B16CCACTGACAAGTGGGTCCCNONE
J090053B16GGTCCCACNONE
Os03g0829100AK072669GGACCCACSimilar to Soluble epoxide hydrolase.
J013073C22GGACCCACNONE
J033067O15GGACCCACNONE
J065021D04GGACCCACNONE
J065102E20GGACCCACNONE
Os03g0832600AK120137CAAGTGGGTCCCACSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase).
Os03g0837900AK068346CACGCCACTGACAAGTGGGACCCACStreptomyces cyclase/dehydrase family protein.
Os03g0844800AK071813GGCCGTGGGACCCGCGCConserved hypothetical protein.
J023114B14GGCCGTGGGACCCGCGCNONE
Os03g0845700009-075-D05TGAGGGACNONE
AK062622TGAGGGACSimilar to RPB17 (Fragment).
J065068H03TGAGGGACNONE
J065075A18TGAGGGACNONE
J065118C19TGAGGGACNONE
J075001B15TGAGGGACNONE
J075048D11TGAGGGACNONE
J075056D01TGAGGGACNONE
J075092P03TGAGGGACNONE
J075111I04TGAGGGACNONE
Os03g0856200AK064097GTGGGTCCNONE
AK120953GTGGGTCCSimilar to KAP-2.
Os03g0860600AK071828TGAGGGACSimilar to 2-oxoglutarate-dependent oxygenase.
AK071828TGAGGGACSimilar to 2-oxoglutarate-dependent oxygenase.
J023118E08TGAGGGACNONE
J023118E08TGAGGGACNONE
J100032J11TGAGGGACNONE
J100032J11TGAGGGACNONE
Os03g0861300AK109024GGTGGGACSimilar to Aquaporin.
Os04g0116200AK064677GGACCCACProtein of unknown function DUF827, plant family protein.
J065017D03GGACCCACNONE
J065095C04GGACCCACNONE
J065211O18GGACCCACNONE
J065219H18GGACCCACNONE
Os04g0117100009-025-D02GGGACCCACCCCACCCGGCCCAAGNONE
009-056-D03GGGACCCACCCCACCCGGCCCAAGNONE
009-145-F01GGGACCCACCCCACCCGGCCCAAGNONE
009-146-C06GGGACCCACCCCACCCGGCCCAAGNONE
009-186-C05GGGACCCACCCCACCCGGCCCAAGNONE
AK060395GGGACCCACCCCACCCGGCCCAAGNONE
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein.
J033090J17GGGACCCACCCCACCCGGCCCAAGNONE
J065058O06GGGACCCACCCCACCCGGCCCAAGNONE
J065058P05GGGACCCACCCCACCCGGCCCAAGNONE
J065141C14GGGACCCACCCCACCCGGCCCAAGNONE
J065162F07GGGACCCACCCCACCCGGCCCAAGNONE
J065199N16GGGACCCACCCCACCCGGCCCAAGNONE
J065214I05GGGACCCACCCCACCCGGCCCAAGNONE
J075003L04GGGACCCACCCCACCCGGCCCAAGNONE
J075014C14GGGACCCACCCCACCCGGCCCAAGNONE
J075063K14GGGACCCACCCCACCCGGCCCAAGNONE
J075111N19GGGACCCACCCCACCCGGCCCAAGNONE
J075138E13GGGACCCACCCCACCCGGCCCAAGNONE
J075189E23GGGACCCACCCCACCCGGCCCAAGNONE
J080304J23GGGACCCACCCCACCCGGCCCAAGNONE
J080310L07GGGACCCACCCCACCCGGCCCAAGNONE
J080318A16GGGACCCACCCCACCCGGCCCAAGNONE
J100054P14GGGACCCACCCCACCCGGCCCAAGNONE
Os04g0118400AK062196TGGGTCCCANONE
J090004F04TGGGTCCCANONE
J090036N24TGGGTCCCANONE
J090082A04TGGGTCCCANONE
Os04g0218900AK071049GTGGGTCCTRAF-like domain containing protein.
J023004C03GTGGGTCCNONE
J023060C17GTGGGTCCNONE
J023077B16GTGGGTCCNONE
J023106C15GTGGGTCCNONE
Os04g0258900009-146-B02GTGGGACCCACGTGGGTCCCACNONE
009-146-B02TGAGGGACNONE
AK062983GTGGGACCCACGTGGGTCCCACCyclin-like F-box domain containing protein.
AK062983TGAGGGACCyclin-like F-box domain containing protein.
Os04g0259800AK111548GGACCCACCTGConserved hypothetical protein.
Os04g0274400AK062600GGACCCACYL1 nuclear, C-terminal domain containing protein.
J065051G04GGACCCACNONE
Os04g0275966J065015F20GGACCCACCTGConserved hypothetical protein.
J065118M18GGACCCACCTGNONE
Os04g0278000AK120988CGTGTGGGACCCACCACSimilar to PRLI-interacting factor G (Fragment).
Os04g0313300AK121730GGACCCACTTGConserved hypothetical protein.
J033082F07GGACCCACTTGNONE
Os04g0319800J065187N03GGTCCCACGCGSimilar to Cytokinin-O-glucosyltransferase 2 (EC 2.4.1.-) (Zeatin O- glucosyltransferase 2).
Os04g0320200012-089-H09TGAGGGACNONE
AK069513TGAGGGACUDP-glucuronosyl/UDP-glucosyltransferase family protein.
AK104028TGAGGGACNONE
AK119256TGAGGGACNONE
J023020H09TGAGGGACNONE
J065112F21TGAGGGACNONE
J100036M07TGAGGGACNONE
Os04g0329500015-081-E12GTGGGACCNONE
AK064343GTGGGACCProtein of unknown function DUF295 family protein.
AK073994GTGGGACCNONE
J033072H16GTGGGACCNONE
Os04g0378200AK103076GGTCCCACGGGSterile alpha motif SAM domain containing protein.
J033118E02GGTCCCACGGGNONE
J065065F15GGTCCCACGGGNONE
J090080I24GGTCCCACGGGNONE
Os04g0390500AK066575CTGACAGGTGGGTCCNONE
AK099908CTGACAGGTGGGTCCNONE
AK100148CTGACAGGTGGGTCCNONE
Os04g0405500011-007-D12CGCGTCGCGTCCCTCANONE
AK063263CGCGTCGCGTCCCTCAConserved hypothetical protein.
J065166G19CGCGTCGCGTCCCTCANONE
J075180M09CGCGTCGCGTCCCTCANONE
Os04g0430100009-125-A01TGAGGGACNONE
AK102190TGAGGGACSimilar to 40S ribosomal protein S10-1.
J033087A06TGAGGGACNONE
J053032M06TGAGGGACNONE
J065033D05TGAGGGACNONE
J065045D15TGAGGGACNONE
J065045K10TGAGGGACNONE
J065049N05TGAGGGACNONE
J065064N09TGAGGGACNONE
J065068F17TGAGGGACNONE
J065088F17TGAGGGACNONE
J065104N22TGAGGGACNONE
J065117B19TGAGGGACNONE
J065119O12TGAGGGACNONE
J065134G24TGAGGGACNONE
J065150G16TGAGGGACNONE
J065176C03TGAGGGACNONE
J065212M23TGAGGGACNONE
J075009P18TGAGGGACNONE
J075019G06TGAGGGACNONE
J075037H14TGAGGGACNONE
J075057C13TGAGGGACNONE
J075100E14TGAGGGACNONE
J075120I16TGAGGGACNONE
J075130F07TGAGGGACNONE
J075156M16TGAGGGACNONE
J100043J03TGAGGGACNONE
Os04g0435700AK100857GCCACGTGGGACCSimilar to UVB-resistance protein UVR8.
Os04g0443200AK107991TGGGACCCAProtein of unknown function DUF538 family protein.
Os04g0444900AK063657GGGACCCACSimilar to Alfin-1.
AK098960GGGACCCACNONE
J065037L14GGGACCCACNONE
J065037P22GGGACCCACNONE
J065173O15GGGACCCACNONE
Os04g0462500006-073-E08GGCCGTGGGACCCACNONE
AK062065GGCCGTGGGACCCACNONE
AK071311GGCCGTGGGACCCACSimilar to 14-3-3-like protein GF14-6.
AK071822GGCCGTGGGACCCACNONE
AK099243GGCCGTGGGACCCACNONE
AK101938GGCCGTGGGACCCACNONE
J013056F02GGCCGTGGGACCCACNONE
J023020E08GGCCGTGGGACCCACNONE
J023085B16GGCCGTGGGACCCACNONE
J023117D08GGCCGTGGGACCCACNONE
J023133K12GGCCGTGGGACCCACNONE
J033025G04GGCCGTGGGACCCACNONE
J033052A15GGCCGTGGGACCCACNONE
J033074G16GGCCGTGGGACCCACNONE
J033090A16GGCCGTGGGACCCACNONE
J033122A07GGCCGTGGGACCCACNONE
J033133G09GGCCGTGGGACCCACNONE
J065002F16GGCCGTGGGACCCACNONE
J065030M09GGCCGTGGGACCCACNONE
J065056B11GGCCGTGGGACCCACNONE
J065115I10GGCCGTGGGACCCACNONE
J065120O09GGCCGTGGGACCCACNONE
J065124G21GGCCGTGGGACCCACNONE
J075031C14GGCCGTGGGACCCACNONE
J075040H07GGCCGTGGGACCCACNONE
J075047F04GGCCGTGGGACCCACNONE
J075065F14GGCCGTGGGACCCACNONE
J075066G20GGCCGTGGGACCCACNONE
J075105D01GGCCGTGGGACCCACNONE
J075147B04GGCCGTGGGACCCACNONE
J075149A12GGCCGTGGGACCCACNONE
J075172D07GGCCGTGGGACCCACNONE
J075190J11GGCCGTGGGACCCACNONE
J090038H18GGCCGTGGGACCCACNONE
J090087G05GGCCGTGGGACCCACNONE
J100025A10GGCCGTGGGACCCACNONE
J100025O10GGCCGTGGGACCCACNONE
J100027D02GGCCGTGGGACCCACNONE
J100027P06GGCCGTGGGACCCACNONE
J100032K04GGCCGTGGGACCCACNONE
J100056D21GGCCGTGGGACCCACNONE
J100060J08GGCCGTGGGACCCACNONE
J100063N19GGCCGTGGGACCCACNONE
J100064C14GGCCGTGGGACCCACNONE
J100064K18GGCCGTGGGACCCACNONE
J100070L21GGCCGTGGGACCCACNONE
J100072M17GGCCGTGGGACCCACNONE
J100074F21GGCCGTGGGACCCACNONE
J100087E05GGCCGTGGGACCCACNONE
U65956GGCCGTGGGACCCACNONE
Os04g0479000AK106344TGAGGGACSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein).
Os04g0480900AK109889TGGGACCCACGlycoside hydrolase, family 5 protein.
Os04g0485200006-033-B07GTGGGTCCCACTTGNONE
AK061463GTGGGTCCCACTTGNONE
J023037H14GTGGGTCCCACTTGNONE
J023083B19GTGGGTCCCACTTGNONE
J023104H04GTGGGTCCCACTTGNONE
J043022C03GTGGGTCCCACTTGNONE
Os04g0495900AK061559GGGTCCCAConserved hypothetical protein.
Os04g0496600AK065058TGAGGGACConserved hypothetical protein.
J013001J09TGAGGGACNONE
J013037C18TGAGGGACNONE
J013126H05TGAGGGACNONE
J090062G17TGAGGGACNONE
Os04g0502300009-116-F02TGAGGGACNONE
009-130-H06TGAGGGACNONE
AK120520TGAGGGACSimilar to 40S ribosomal protein S11.
J013124K01TGAGGGACNONE
J023102F03TGAGGGACNONE
J033094F17TGAGGGACNONE
J053054C22TGAGGGACNONE
J065024N13TGAGGGACNONE
J065083J18TGAGGGACNONE
J065132O14TGAGGGACNONE
J065156M09TGAGGGACNONE
J065176N15TGAGGGACNONE
J065208H08TGAGGGACNONE
J075054B03TGAGGGACNONE
J090053E20TGAGGGACNONE
J100075B09TGAGGGACNONE
J100089H12TGAGGGACNONE
Os04g0516900AK108714GTCCCACCConserved hypothetical protein.
Os04g0521800006-043-D11GTGGGACCNONE
AK061536GTGGGACCNONE
AK102934GTGGGACCPeptidase M20 family protein.
AK103369GTGGGACCNONE
Os04g0543200AK101961GGTCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
AK102135GGTCCCACNONE
Os04g0548000011-097-D07GTGGGACCCACNONE
AK073099GTGGGACCCACNONE
AK104979GTGGGACCCACProtein of unknown function DUF862, eukaryotic domain containing protein.
J065102C18GTGGGACCCACNONE
J075076A16GTGGGACCCACNONE
J075082L09GTGGGACCCACNONE
J075092L18GTGGGACCCACNONE
J075092N01GTGGGACCCACNONE
J075122P14GTGGGACCCACNONE
J075148L06GTGGGACCCACNONE
Os04g0549300AK063296GTGGGACCCASimilar to GA protein (Fragment).
J065073I11GTGGGACCCANONE
J065172C13GTGGGACCCANONE
J090004B10GTGGGACCCANONE
J090039N18GTGGGACCCANONE
J090088F09GTGGGACCCANONE
Os04g0556300009-065-A04GGGACCCGNONE
009-124-C05GGGACCCGNONE
AK062772GGGACCCGGlutathione peroxidase.
AY100689GGGACCCGNONE
J065008N06GGGACCCGNONE
J065012C13GGGACCCGNONE
J065017J06GGGACCCGNONE
J065033M15GGGACCCGNONE
J065086O21GGGACCCGNONE
J065102K04GGGACCCGNONE
J065141D21GGGACCCGNONE
J065159K20GGGACCCGNONE
J065164C12GGGACCCGNONE
J065170F10GGGACCCGNONE
J065181F20GGGACCCGNONE
J065205N07GGGACCCGNONE
J065209N21GGGACCCGNONE
J075001M12GGGACCCGNONE
J075007D22GGGACCCGNONE
J075026H04GGGACCCGNONE
J075042O08GGGACCCGNONE
J075044G20GGGACCCGNONE
J075057D10GGGACCCGNONE
J075096L23GGGACCCGNONE
J075104K12GGGACCCGNONE
J075119H14GGGACCCGNONE
J075136C14GGGACCCGNONE
J075172D01GGGACCCGNONE
J075184M01GGGACCCGNONE
J075186E06GGGACCCGNONE
J075192M08GGGACCCGNONE
J080006D18GGGACCCGNONE
J080044G16GGGACCCGNONE
J080087G15GGGACCCGNONE
J100021I05GGGACCCGNONE
J100039D10GGGACCCGNONE
J100073B05GGGACCCGNONE
J100074M12GGGACCCGNONE
Os04g0558400AK061440GGTCCCACCTGACAGGAcyl-CoA thioesterase family protein.
AK102197GGTCCCACCTGACAGGNONE
J013046K23GGTCCCACCTGACAGGNONE
J013090O17GGTCCCACCTGACAGGNONE
J033087D05GGTCCCACCTGACAGGNONE
J065029A16GGTCCCACCTGACAGGNONE
J065121A13GGTCCCACCTGACAGGNONE
J090063H18GGTCCCACCTGACAGGNONE
J100048C18GGTCCCACCTGACAGGNONE
Os04g0558500J065017H16GTGGGTCCCACConserved hypothetical protein.
Os04g0563300AK100487CCCACGTGGGTCCCACyclin-like F-box domain containing protein.
J023097O18CCCACGTGGGTCCCANONE
J065100E16CCCACGTGGGTCCCANONE
J075022C23CCCACGTGGGTCCCANONE
J075023L18CCCACGTGGGTCCCANONE
J075040N10CCCACGTGGGTCCCANONE
J075061L14CCCACGTGGGTCCCANONE
J075069B15CCCACGTGGGTCCCANONE
J075106C16CCCACGTGGGTCCCANONE
J075138P13CCCACGTGGGTCCCANONE
J075139H18CCCACGTGGGTCCCANONE
J075139L06CCCACGTGGGTCCCANONE
J075149B07CCCACGTGGGTCCCANONE
J075177N21CCCACGTGGGTCCCANONE
Os04g0566900AK072344TGAGGGACConserved hypothetical protein.
Os04g0577700AK108703CGGGTCCCProtein of unknown function DUF623, plant domain containing protein.
Os04g0589200AK068571TGAGGGACConserved hypothetical protein.
AK102463TGAGGGACNONE
J075083K10TGAGGGACNONE
Os04g0598000013-056-C01TGAGGGACNONE
AK121673TGAGGGACConserved hypothetical protein.
J013055M22TGAGGGACNONE
J023038C06TGAGGGACNONE
J033068C09TGAGGGACNONE
J075026L16TGAGGGACNONE
J075099K14TGAGGGACNONE
J075121B18TGAGGGACNONE
J075156K08TGAGGGACNONE
J075190I04TGAGGGACNONE
J080315E20TGAGGGACNONE
J090049E09TGAGGGACNONE
J100024F09TGAGGGACNONE
J100041H21TGAGGGACNONE
J100073L07TGAGGGACNONE
J100077K04TGAGGGACNONE
J100080P09TGAGGGACNONE
J100087E22TGAGGGACNONE
Os04g0606800009-159-H11GGTCCCACCNONE
AK072824GGTCCCACCConserved hypothetical protein.
J033070J06GGTCCCACCNONE
J033119D03GGTCCCACCNONE
J100043F05GGTCCCACCNONE
J100050A01GGTCCCACCNONE
Os04g0607200J065082C16TGAGGGACNONE
J065167I02TGAGGGACNONE
Os04g0607400AK109823TGGGTCCCConserved hypothetical protein.
Os04g0617050J065197A20GTGGGACCCACCTGTNONE
J090067K01GTGGGACCCACCTGTAuxin responsive SAUR protein family protein.
Os04g0626400006-050-B09TGAGGGACNONE
006-072-C12TGAGGGACNONE
006-092-C11TGAGGGACNONE
AK059851TGAGGGACCalycin-like family protein.
AK100069TGAGGGACNONE
AK104062TGAGGGACNONE
AK104663TGAGGGACNONE
Os04g0629500009-120-G06GGACCCACNONE
AK072821GGACCCACSimilar to Thioredoxin h.
AK103985GGACCCACNONE
AK121437GGACCCACNONE
J013111B13GGACCCACNONE
J013128N16GGACCCACNONE
J023098G05GGACCCACNONE
J023139A03GGACCCACNONE
J023140C07GGACCCACNONE
J065045N21GGACCCACNONE
J065054G17GGACCCACNONE
J065054L01GGACCCACNONE
J100044H07GGACCCACNONE
J100064L04GGACCCACNONE
Os04g0631200013-003-B06ACGCGTGGGTCCCNONE
AK059277ACGCGTGGGTCCCSimilar to Xyloglucan endotransglycosylase (Fragment).
AK099331ACGCGTGGGTCCCNONE
J033024P08ACGCGTGGGTCCCNONE
J033041G02ACGCGTGGGTCCCNONE
J053075H12ACGCGTGGGTCCCNONE
J065016B13ACGCGTGGGTCCCNONE
J090075B22ACGCGTGGGTCCCNONE
J100084K17ACGCGTGGGTCCCNONE
Os04g0642100011-074-F06TGGGTCCCACCNONE
J043006J10TGGGTCCCACCSimilar to Microtubule-associated protein EB1.
J043006P09TGGGTCCCACCNONE
Os04g0652900AK071125GGGACCCAPeptidyl-tRNA hydrolase, PTH2 domain containing protein.
J023082K03GGGACCCANONE
J075142E01GGGACCCANONE
Os04g0654600AK111497TGGGACCCAProtein kinase-like domain containing protein.
J013000H21TGGGACCCANONE
Os04g0661300AK070723GGTCCCACConserved hypothetical protein.
AK103942GGTCCCACNONE
Os04g0668900AF085174GTCCCACCNONE
AK067891GTCCCACCSimilar to Plastid terminal oxidase.
Os04g0670800AK073170TGAGGGACNONE
Os04g0685600AK067506GGACCCACExo70 exocyst complex subunit family protein.
J013108D21GGACCCACNONE
J023041E19GGACCCACNONE
J065006M21GGACCCACNONE
J065060B21GGACCCACNONE
J065086K07GGACCCACNONE
J065121N03GGACCCACNONE
J065201M22GGACCCACNONE
J075004H05GGACCCACNONE
J075005G06GGACCCACNONE
J075032N07GGACCCACNONE
J075055M01GGACCCACNONE
J075057A20GGACCCACNONE
J075078L23GGACCCACNONE
J075137G04GGACCCACNONE
J090026N09GGACCCACNONE
J090044L05GGACCCACNONE
Os04g0686700AK105746CACTGACAGTGGGTCCKelch repeat containing protein.
AK105746TGGGACCCACKelch repeat containing protein.
J065021K04CACTGACAGTGGGTCCNONE
J065021K04TGGGACCCACNONE
J065097E18CACTGACAGTGGGTCCNONE
J065097E18TGGGACCCACNONE
J075004C12CACTGACAGTGGGTCCNONE
J075004C12TGGGACCCACNONE
J080301H10CACTGACAGTGGGTCCNONE
J080301H10TGGGACCCACNONE
J090087N02CACTGACAGTGGGTCCNONE
J090087N02TGGGACCCACNONE
J100060E19CACTGACAGTGGGTCCNONE
J100060E19TGGGACCCACNONE
Os04g0690866014-091-B08GTCCCTCAConserved hypothetical protein.
014-091-B08GTGGGACCCACGTGConserved hypothetical protein.
J065085H18GTCCCTCANONE
J065085H18GTGGGACCCACGTGNONE
J065099J05GTCCCTCANONE
J065099J05GTGGGACCCACGTGNONE
J065194D12GTCCCTCANONE
J065194D12GTGGGACCCACGTGNONE
J065197H01GTCCCTCANONE
J065197H01GTGGGACCCACGTGNONE
Os05g0102500009-183-E08GGTCCCACGCGTNONE
AK063894GGTCCCACGCGTNONE
AK073341GGTCCCACGCGTConserved hypothetical protein.
J023022C11GGTCCCACGCGTNONE
J065095B14GGTCCCACGCGTNONE
J065130O12GGTCCCACGCGTNONE
J065142P07GGTCCCACGCGTNONE
J065155L18GGTCCCACGCGTNONE
Os05g0104800006-022-G08TGGGACCCANONE
AK070215TGGGACCCASimilar to Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p32 subunit) (eIF3f).
AK104207TGGGACCCANONE
AK104554TGGGACCCANONE
J023043K07TGGGACCCANONE
J023079C24TGGGACCCANONE
J033050A14TGGGACCCANONE
J033095G11TGGGACCCANONE
J033097D16TGGGACCCANONE
J033108J11TGGGACCCANONE
J053037E01TGGGACCCANONE
J053061I17TGGGACCCANONE
J065040F22TGGGACCCANONE
J065055B15TGGGACCCANONE
J065091N23TGGGACCCANONE
J090062J16TGGGACCCANONE
J100065J21TGGGACCCANONE
Os05g0110100009-015-D08GTGGGACCCGNONE
009-023-C09GTGGGACCCGNONE
009-031-B11GTGGGACCCGNONE
009-034-C02GTGGGACCCGNONE
009-050-B08GTGGGACCCGNONE
009-065-D12GTGGGACCCGNONE
009-090-G08GTGGGACCCGNONE
009-111-H07GTGGGACCCGNONE
009-136-F12GTGGGACCCGNONE
009-138-E06GTGGGACCCGNONE
009-138-G12GTGGGACCCGNONE
009-141-D08GTGGGACCCGNONE
009-143-D01GTGGGACCCGNONE
009-179-D09GTGGGACCCGNONE
009-179-E03GTGGGACCCGNONE
009-196-A09GTGGGACCCGNONE
009-199-F04GTGGGACCCGNONE
013-021-E05GTGGGACCCGNONE
013-076-C04GTGGGACCCGNONE
013-096-F06GTGGGACCCGNONE
014-071-A05GTGGGACCCGNONE
014-077-F09GTGGGACCCGNONE
AK099779GTGGGACCCGNONE
AK121142GTGGGACCCGConserved hypothetical protein.
J013095A16GTGGGACCCGNONE
J013111A17GTGGGACCCGNONE
J013132G04GTGGGACCCGNONE
J023077M04GTGGGACCCGNONE
J065001B11GTGGGACCCGNONE
J065001E11GTGGGACCCGNONE
J065057G10GTGGGACCCGNONE
J065057L08GTGGGACCCGNONE
J065080E07GTGGGACCCGNONE
J065087K10GTGGGACCCGNONE
J065091M15GTGGGACCCGNONE
J065167A15GTGGGACCCGNONE
J075018F02GTGGGACCCGNONE
J075063F20GTGGGACCCGNONE
J075064F18GTGGGACCCGNONE
J075066N19GTGGGACCCGNONE
J075073I02GTGGGACCCGNONE
J075080P17GTGGGACCCGNONE
J075081F11GTGGGACCCGNONE
J075085E03GTGGGACCCGNONE
J075101G18GTGGGACCCGNONE
J075149N08GTGGGACCCGNONE
J075158I21GTGGGACCCGNONE
J075161M20GTGGGACCCGNONE
J075190F12GTGGGACCCGNONE
J075194K16GTGGGACCCGNONE
J080001E08GTGGGACCCGNONE
J080001F21GTGGGACCCGNONE
J080001H19GTGGGACCCGNONE
J080001O15GTGGGACCCGNONE
J080005I22GTGGGACCCGNONE
J080006K23GTGGGACCCGNONE
J080014D20GTGGGACCCGNONE
J080014I05GTGGGACCCGNONE
J080014K21GTGGGACCCGNONE
J080017I24GTGGGACCCGNONE
J080017K11GTGGGACCCGNONE
J080018F11GTGGGACCCGNONE
J080022L18GTGGGACCCGNONE
J080024N23GTGGGACCCGNONE
J080027J23GTGGGACCCGNONE
J080029B14GTGGGACCCGNONE
J080032F14GTGGGACCCGNONE
J080032K19GTGGGACCCGNONE
J080032O21GTGGGACCCGNONE
J080033P17GTGGGACCCGNONE
J080034I06GTGGGACCCGNONE
J080039F24GTGGGACCCGNONE
J080040O13GTGGGACCCGNONE
J080042B02GTGGGACCCGNONE
J080043E12GTGGGACCCGNONE
J080043J15GTGGGACCCGNONE
J080043N09GTGGGACCCGNONE
J080052J08GTGGGACCCGNONE
J080053K01GTGGGACCCGNONE
J080053K19GTGGGACCCGNONE
J080055J09GTGGGACCCGNONE
J080058D07GTGGGACCCGNONE
J080062F11GTGGGACCCGNONE
J080063J24GTGGGACCCGNONE
J080066H04GTGGGACCCGNONE
J080066I09GTGGGACCCGNONE
J080067B02GTGGGACCCGNONE
J080067N09GTGGGACCCGNONE
J080068D22GTGGGACCCGNONE
J080068K13GTGGGACCCGNONE
J080069N19GTGGGACCCGNONE
J080070D07GTGGGACCCGNONE
J080070E05GTGGGACCCGNONE
J080071G04GTGGGACCCGNONE
J080077G05GTGGGACCCGNONE
J080077O06GTGGGACCCGNONE
J080085F05GTGGGACCCGNONE
J080086E07GTGGGACCCGNONE
J080089G16GTGGGACCCGNONE
J080092K15GTGGGACCCGNONE
J080094A08GTGGGACCCGNONE
J080097A09GTGGGACCCGNONE
J080097J07GTGGGACCCGNONE
J090027N01GTGGGACCCGNONE
J090081J05GTGGGACCCGNONE
Os05g0115100015-002-G01TGGGACCCACCACNONE
016-075-D04TGGGACCCACCACNONE
AK106226TGGGACCCACCACProtein of unknown function DUF1635 family protein.
AK110672TGGGACCCACCACNONE
J075034O20TGGGACCCACCACNONE
Os05g0116500AK102231GGGACCCACCACConserved hypothetical protein.
J033088A05GGGACCCACCACNONE
Os05g0119300004-011-B09GTCCCACCNONE
006-063-A03GTCCCACCNONE
006-077-E12GTCCCACCNONE
006-079-E12GTCCCACCNONE
006-100-B11GTCCCACCNONE
009-109-A12GTCCCACCNONE
009-123-C07GTCCCACCNONE
009-163-D09GTCCCACCNONE
009-170-D11GTCCCACCNONE
009-173-C01GTCCCACCNONE
009-192-E01GTCCCACCNONE
011-048-G01GTCCCACCNONE
AK060883GTCCCACCNONE
AK068289GTCCCACCNONE
AK071554GTCCCACCNONE
AK099495GTCCCACCXYPPX repeat containing protein.
AY348312GTCCCACCNONE
J013037L16GTCCCACCNONE
J013088P04GTCCCACCNONE
J013099D14GTCCCACCNONE
J013146E19GTCCCACCNONE
J013147E18GTCCCACCNONE
J023104E19GTCCCACCNONE
J023128O20GTCCCACCNONE
J023132D16GTCCCACCNONE
J023143E13GTCCCACCNONE
J033028F15GTCCCACCNONE
J033133D24GTCCCACCNONE
J053091M07GTCCCACCNONE
J075029L15GTCCCACCNONE
J075097M12GTCCCACCNONE
J075103J11GTCCCACCNONE
J075138J10GTCCCACCNONE
J075172K18GTCCCACCNONE
J080001C15GTCCCACCNONE
J080002M13GTCCCACCNONE
J080009K01GTCCCACCNONE
J080010N01GTCCCACCNONE
J080011D23GTCCCACCNONE
J080013C13GTCCCACCNONE
J080013M16GTCCCACCNONE
J080018J02GTCCCACCNONE
J080020F03GTCCCACCNONE
J080020G05GTCCCACCNONE
J080021D05GTCCCACCNONE
J080030A19GTCCCACCNONE
J080031A16GTCCCACCNONE
J080033J23GTCCCACCNONE
J080035H07GTCCCACCNONE
J080039M24GTCCCACCNONE
J080042B16GTCCCACCNONE
J080043B03GTCCCACCNONE
J080045G01GTCCCACCNONE
J080045K17GTCCCACCNONE
J080047A09GTCCCACCNONE
J080047I22GTCCCACCNONE
J080048M14GTCCCACCNONE
J080049J02GTCCCACCNONE
J080052C15GTCCCACCNONE
J080052E11GTCCCACCNONE
J080052M22GTCCCACCNONE
J080056O21GTCCCACCNONE
J080059J04GTCCCACCNONE
J080059O17GTCCCACCNONE
J080064N04GTCCCACCNONE
J080066A03GTCCCACCNONE
J080066I22GTCCCACCNONE
J080069C13GTCCCACCNONE
J080069J03GTCCCACCNONE
J080069N04GTCCCACCNONE
J080071A01GTCCCACCNONE
J080071C03GTCCCACCNONE
J080071J02GTCCCACCNONE
J080080D17GTCCCACCNONE
J080084O06GTCCCACCNONE
J080085O20GTCCCACCNONE
J080086H15GTCCCACCNONE
J080094K06GTCCCACCNONE
J080095C05GTCCCACCNONE
J080095G04GTCCCACCNONE
J080096F03GTCCCACCNONE
J080096F20GTCCCACCNONE
J090004H05GTCCCACCNONE
J090012P10GTCCCACCNONE
J090021B09GTCCCACCNONE
J090034M08GTCCCACCNONE
J090046G21GTCCCACCNONE
J090055K24GTCCCACCNONE
J090055L05GTCCCACCNONE
J090057H17GTCCCACCNONE
J090082K21GTCCCACCNONE
J100022A07GTCCCACCNONE
J100022M02GTCCCACCNONE
J100069K11GTCCCACCNONE
J100086C24GTCCCACCNONE
Os05g0129400AK102359GTCCCTCAAnkyrin repeat containing protein.
AK102359TGGGACCCACGTGGGTCCCACAnkyrin repeat containing protein.
J033091I05GTCCCTCANONE
J033091I05TGGGACCCACGTGGGTCCCACNONE
Os05g0132100AK069689GGGACCCACAMP-dependent synthetase and ligase domain containing protein.
AK105618GGGACCCACNONE
Os05g0139200AK108058TGAGGGACCyclin-like F-box domain containing protein.
AK108058TGCGGCCCACATGGGTCCCACCyclin-like F-box domain containing protein.
Os05g0162600012-069-E09GTGGGACCCACNONE
AK063518GTGGGACCCACSimilar to Splicing factor RSZ33.
AK121854GTGGGACCCACNONE
J065178M11GTGGGACCCACNONE
J090016J24GTGGGACCCACNONE
J090023E07GTGGGACCCACNONE
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6).
Os05g0168500AK100711GGACCCACNonaspanin (TM9SF) family protein.
J013034G08GGACCCACNONE
J013039B03GGACCCACNONE
J013056H15GGACCCACNONE
J023003H09GGACCCACNONE
J023012B03GGACCCACNONE
J023115H14GGACCCACNONE
J023150N08GGACCCACNONE
J033055J19GGACCCACNONE
J053063M15GGACCCACNONE
J065013M18GGACCCACNONE
J065089N08GGACCCACNONE
J065209C13GGACCCACNONE
J100072F03GGACCCACNONE
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein.
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE
Os05g0190500004-013-C07GTCCCTCANONE
009-077-A01GTCCCTCANONE
009-158-G03GTCCCTCANONE
009-186-C08GTCCCTCANONE
AK060968GTCCCTCANONE
AK104246GTCCCTCANONE
AK104460GTCCCTCANONE
AK104519GTCCCTCANONE
AK109335GTCCCTCASimilar to Acid phosphatase.
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein.
J075140P14GTCCCTCAConserved hypothetical protein.
Os05g0197300AK106389TGGGACCCACTCCIQ calmodulin-binding region domain containing protein.
Os05g0198000J080004C03CGGGTCCCProtein of unknown function DUF247, plant family protein.
J080004C03GTGGGACCProtein of unknown function DUF247, plant family protein.
J080004M24CGGGTCCCNONE
J080004M24GTGGGACCNONE
J080004O15CGGGTCCCNONE
J080004O15GTGGGACCNONE
J080006E14CGGGTCCCNONE
J080006E14GTGGGACCNONE
J080006I07CGGGTCCCNONE
J080006I07GTGGGACCNONE
J080007N13CGGGTCCCNONE
J080007N13GTGGGACCNONE
J080009C21CGGGTCCCNONE
J080009C21GTGGGACCNONE
J080009L03CGGGTCCCNONE
J080009L03GTGGGACCNONE
J080010F10CGGGTCCCNONE
J080010F10GTGGGACCNONE
J080015H04CGGGTCCCNONE
J080015H04GTGGGACCNONE
J080015L04CGGGTCCCNONE
J080015L04GTGGGACCNONE
J080018C21CGGGTCCCNONE
J080018C21GTGGGACCNONE
J080022M22CGGGTCCCNONE
J080022M22GTGGGACCNONE
J080027O19CGGGTCCCNONE
J080027O19GTGGGACCNONE
J080030I07CGGGTCCCNONE
J080030I07GTGGGACCNONE
J080037P07CGGGTCCCNONE
J080037P07GTGGGACCNONE
J080044C18CGGGTCCCNONE
J080044C18GTGGGACCNONE
J080049F14CGGGTCCCNONE
J080049F14GTGGGACCNONE
J080050F04CGGGTCCCNONE
J080050F04GTGGGACCNONE
J080052B18CGGGTCCCNONE
J080052B18GTGGGACCNONE
J080081B11CGGGTCCCNONE
J080081B11GTGGGACCNONE
J080083G12CGGGTCCCNONE
J080083G12GTGGGACCNONE
J080086A11CGGGTCCCNONE
J080086A11GTGGGACCNONE
J080087C06CGGGTCCCNONE
J080087C06GTGGGACCNONE
J080088E06CGGGTCCCNONE
J080088E06GTGGGACCNONE
J080091O21CGGGTCCCNONE
J080091O21GTGGGACCNONE
J080094N23CGGGTCCCNONE
J080094N23GTGGGACCNONE
Os05g0200700AK110596GTGGGTCCCConserved hypothetical protein.
Os05g0207400AK070191GGACCCACRINGv domain containing protein.
AK104023GGACCCACNONE
Os05g0220900AK109172GTGGGTCCCACNONE
AK109172TGAGGGACNONE
AK109456GTGGGTCCCACPrefoldin domain containing protein.
AK109456TGAGGGACPrefoldin domain containing protein.
Os05g0243300AK108395TGAGGGACSimilar to 50S ribosomal protein L13.
J090098J16TGAGGGACNONE
J100042H03TGAGGGACNONE
J100088D02TGAGGGACNONE
Os05g0291700AK073234GTGGGTCCNONE
AK099865GTGGGTCCConserved hypothetical protein.
AK108453GTGGGTCCNONE
Os05g0295800AK070232ACACGTGGGTCCSimilar to Glyoxalase I (EC 4.4.1.5).
J023043J03ACACGTGGGTCCNONE
Os05g0300700014-079-G07GGTGGGACCCACNONE
AK063728GGTGGGACCCACNONE
AK067846GGTGGGACCCACConserved hypothetical protein.
Os05g0316200AK060608TGAGGGACNONE
AK101705TGAGGGACConserved hypothetical protein.
AK111481TGAGGGACNONE
Os05g0319800AK100483GTGGGACCCACSimilar to Plasma membrane H+ ATPase (EC 3.6.3.6).
Os05g0322900006-057-H12GGTCCCACCTGNONE
014-051-A08GGTCCCACCTGNONE
AK063697GGTCCCACCTGNONE
AK066255GGTCCCACCTGSimilar to WRKY transcription factor 45.
AK103959GGTCCCACCTGNONE
AY870611GGTCCCACCTGNONE
J100068H13GGTCCCACCTGNONE
Os05g0325200J090038J19TGAGGGACCyclin-like domain containing protein.
J090038J19TGGGTCCCACCyclin-like domain containing protein.
Os05g0326400AK061394GGGACCCAConserved hypothetical protein.
AK061394TGGGTCCCConserved hypothetical protein.
J065165L02GGGACCCANONE
J065165L02TGGGTCCCNONE
Os05g0346100012-005-C07GTGGGTCCNONE
AK066689GTGGGTCCPhox-like domain containing protein.
J013073J06GTGGGTCCNONE
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE
AF020787GGACCCACCTGTCAGTGNONE
AK061712GGACCCACCTGTCAGTGNONE
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein.
J033060G23GGACCCACCTGTCAGTGNONE
J033112P14GGACCCACCTGTCAGTGNONE
J033127J04GGACCCACCTGTCAGTGNONE
J090015L18GGACCCACCTGTCAGTGNONE
J090047K03GGACCCACCTGTCAGTGNONE
J090097J17GGACCCACCTGTCAGTGNONE
Os05g0350600AK066244GGGACCCACSimilar to Atranbp1b protein.
J075100E12GGGACCCACNONE
J090024D03GGGACCCACNONE
J100027C02GGGACCCACNONE
J100053P05GGGACCCACNONE
J100055P22GGGACCCACNONE
Os05g0354400AK065144GGTGGGACCCAProtein of unknown function DUF231, plant domain containing protein.
Os05g0357200014-046-H09GGTCCCACCNONE
AK064069GGTCCCACCNONE
AK072064GGTCCCACCMitochondrial substrate carrier family protein.
J065038M01GGTCCCACCNONE
J065121C16GGTCCCACCNONE
J075173E09GGTCCCACCNONE
J080307A20GGTCCCACCNONE
J090046B19GGTCCCACCNONE
J100033N12GGTCCCACCNONE
J100036G01GGTCCCACCNONE
J100057B19GGTCCCACCNONE
Os05g0357600009-143-F04TGGGACCCANONE
AK112055TGGGACCCANONE
Os05g0358000006-083-G07CGGGTCCCACCNONE
006-083-G07GTCCCACCACNONE
AK061141CGGGTCCCACCNONE
AK061141GTCCCACCACNONE
AK070900CGGGTCCCACCNONE
AK070900GTCCCACCACNONE
AK101263CGGGTCCCACCDrought induced 19 family protein.
AK101263GTCCCACCACDrought induced 19 family protein.
J023098C13CGGGTCCCACCNONE
J023098C13GTCCCACCACNONE
J033032J06CGGGTCCCACCNONE
J033032J06GTCCCACCACNONE
J065014A09CGGGTCCCACCNONE
J065014A09GTCCCACCACNONE
J065121L01CGGGTCCCACCNONE
J065121L01GTCCCACCACNONE
J065130K19CGGGTCCCACCNONE
J065130K19GTCCCACCACNONE
J065208B21CGGGTCCCACCNONE
J065208B21GTCCCACCACNONE
J075080G14CGGGTCCCACCNONE
J075080G14GTCCCACCACNONE
J075135L01CGGGTCCCACCNONE
J075135L01GTCCCACCACNONE
J075180J15CGGGTCCCACCNONE
J075180J15GTCCCACCACNONE
Os05g0365300AK067015CGGGTCCCNONE
AK120289CGGGTCCCSimilar to NBS-LRR protein (Fragment).
J013050D17CGGGTCCCNONE
Os05g0365500AK072352TGAGGGACProtein prenyltransferase domain containing protein.
J043027P13TGAGGGACNONE
Os05g0372400AK068781GGACACGTGGGTCCCACLipase, class 3 family protein.
AK068781TGGGTCCCACLipase, class 3 family protein.
Os05g0376300AK110968GGTCCCACNONE
Os05g0377000Os05g0377000TGAGGGACSimilar to Acyl carrier protein (ACP).
Os05g0383000009-135-E10GGGACCCACGTGNONE
AK058345GGGACCCACGTGTetratricopeptide-like helical domain containing protein.
AK102079GGGACCCACGTGNONE
J033082J04GGGACCCACGTGNONE
J033142L02GGGACCCACGTGNONE
Os05g0387600011-059-E01GTCCCACCNONE
AK105254GTCCCACCNONE
AK120230GTCCCACCProtein kinase-like domain containing protein.
Os05g0392801J090025K15GTCCCTCAConserved hypothetical protein.
J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein.
J090053E06GTCCCTCANONE
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE
Os05g0401300009-111-H03GGGACCCGNONE
009-111-H03GTCCCTCANONE
AK060678GGGACCCGTwin-arginine translocation pathway signal domain containing protein.
AK060678GTCCCTCATwin-arginine translocation pathway signal domain containing protein.
Os05g0406800AK062566GGACCCACNONE
AK099640GGACCCACLeucine rich repeat, N-terminal domain containing protein.
J013060B14GGACCCACNONE
J090013F14GGACCCACNONE
J090062E13GGACCCACNONE
J090063D09GGACCCACNONE
J090075H10GGACCCACNONE
J090096E22GGACCCACNONE
Os05g0413200006-067-C03CGCGTGGGACCGTCCGATCNONE
006-080-C03CGCGTGGGACCGTCCGATCNONE
006-095-G10CGCGTGGGACCGTCCGATCNONE
006-115-G11CGCGTGGGACCGTCCGATCNONE
013-040-E05CGCGTGGGACCGTCCGATCNONE
AB104732CGCGTGGGACCGTCCGATCNONE
AK122099CGCGTGGGACCGTCCGATCBeta-tubulin.
J033087H20CGCGTGGGACCGTCCGATCNONE
J033117C18CGCGTGGGACCGTCCGATCNONE
J033125G10CGCGTGGGACCGTCCGATCNONE
Os05g0422900AK073629TGAGGGACConserved hypothetical protein.
J023126I07TGAGGGACNONE
J023143K12TGAGGGACNONE
J033051N08TGAGGGACNONE
J033128I04TGAGGGACNONE
J065067M02TGAGGGACNONE
J080312N05TGAGGGACNONE
J100032G23TGAGGGACNONE
Os05g0423701J100057H19GTCCCTCAGlycoside hydrolase, family 9 protein.
Os05g0440100015-006-F06CACGTGGGTCCCACNONE
015-006-F06TGAGGGACNONE
015-076-D04CACGTGGGTCCCACNONE
015-076-D04TGAGGGACNONE
AK073094CACGTGGGTCCCACNONE
AK073094TGAGGGACNONE
AK102786CACGTGGGTCCCACHistone deacetylase superfamily protein.
AK102786TGAGGGACHistone deacetylase superfamily protein.
J033107M16CACGTGGGTCCCACNONE
J033107M16TGAGGGACNONE
Os05g0467300006-113-H02TGGGACCCGNONE
AK061873TGGGACCCGSelT/selW/selH selenoprotein family protein.
AK098945TGGGACCCGNONE
J013050H09TGGGACCCGNONE
J023108B17TGGGACCCGNONE
J065189J01TGGGACCCGNONE
J075011H05TGGGACCCGNONE
J075019G20TGGGACCCGNONE
Os05g0485300AK102064GGGACCCAProtein of unknown function DUF887, TLC-like family protein.
Os05g0490000011-076-C07GGTGGGACCCANONE
015-026-D07GGTGGGACCCANONE
015-074-A08GGTGGGACCCANONE
AK064335GGTGGGACCCANONE
AK101340GGTGGGACCCAKrr1 family protein.
J033034J18GGTGGGACCCANONE
Os05g0490300AK071818CGGGTCCCCyclin-like F-box domain containing protein.
J023114L14CGGGTCCCNONE
Os05g0498400009-129-A03GTGGGTCCCANONE
009-192-D10GTGGGTCCCANONE
009-194-D06GTGGGTCCCANONE
AK058219GTGGGTCCCASimilar to Protein translation factor SUI1.
AK070301GTGGGTCCCANONE
J043038N18GTGGGTCCCANONE
J065027A13GTGGGTCCCANONE
J075040J15GTGGGTCCCANONE
J075165B14GTGGGTCCCANONE
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment).
AK100773GTGTCACTGACAGTGGGACCCACCACNONE
AK103289GTGTCACTGACAGTGGGACCCACCACNONE
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE
Os05g0507000AK108025CACGTGGGACCCAConserved hypothetical protein.
Os05g0508300Os05g0508300GTGGGACCSimilar to Papain-like cysteine peptidase XBCP3.
Os05g0512000AK102433GGACCCACGTGGCZinc finger, RING-type domain containing protein.
Os05g0515600Os05g0515600GGTCCCACSimilar to O-methyltransferase ZRP4 (EC 2.1.1.-) (OMT).
Os05g0515600GTGGGTCCSimilar to O-methyltransferase ZRP4 (EC 2.1.1.-) (OMT).
Os05g0519700014-100-B04GTGGGACCCNONE
AF332981GTGGGACCCNONE
AK100903GTGGGACCCNONE
AK105433GTGGGACCCHeat shock protein 101.
Os05g0519800AK069435GGGTCCCACProtein of unknown function DUF28 family protein.
J023024L22GGGTCCCACNONE
Os05g0535900AK101539GGAGTGGGACCCACNONE
AK101555GGAGTGGGACCCACIQ calmodulin-binding region domain containing protein.
J013047J05GGAGTGGGACCCACNONE
Os05g0551700AK071216CGGGTCCCCCACTTGtRNA isopentenyltransferase family protein.
Os05g0553700006-100-D08TGAGGGACNONE
AK099747TGAGGGACNONE
AK101606TGAGGGACNONE
AK103396TGAGGGACSimilar to Syntaxin 71 (AtSYP71).
J033022M23TGAGGGACNONE
J090086G01TGAGGGACNONE
Os05g0555300009-032-C03TGAGGGACNONE
009-125-E08TGAGGGACNONE
009-149-C12TGAGGGACNONE
009-172-C01TGAGGGACNONE
AK062890TGAGGGACFerredoxin domain containing protein.
AK062997TGAGGGACNONE
Os05g0565000AK102673TGAGGGACSimilar to 60S ribosomal protein L18a-1.
J033102C12TGAGGGACNONE
J033124C13TGAGGGACNONE
J043003L04TGAGGGACNONE
J043006N08TGAGGGACNONE
Os05g0567500AK073046GGACCCACNONE
AK121133GGACCCACDNA glycosylase family protein.
J023075P20GGACCCACNONE
Os05g0583400AK101992TGAGGGACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit).
AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit).
Os05g0583500AK100131TGGGTCCCAPX-associated domain containing protein.
Os05g0584900012-044-B12GTCCCACCTGTCNONE
012-082-A03GTCCCACCTGTCNONE
AK105309GTCCCACCTGTCC4-dicarboxylate transporter/malic acid transport protein family protein.
J053069A10GTCCCACCTGTCNONE
J065070I05GTCCCACCTGTCNONE
J075096O04GTCCCACCTGTCNONE
J075136D21GTCCCACCTGTCNONE
Os05g0585900AK062575GTGGGTCCCACTCCMitochondrial substrate carrier family protein.
AK098854GTGGGTCCCACTCCNONE
J013000H16GTGGGTCCCACTCCNONE
J033118D07GTGGGTCCCACTCCNONE
Os05g0586600AB096011GGTGGGCCCAGGGACCCGPlastid sigma factor SIG5.
AB096071GGTGGGCCCAGGGACCCGNONE
AK105697GGTGGGCCCAGGGACCCGNONE
Os05g0588700AK100256GGGACCCAHistone deacetylase interacting domain containing protein.
J023061J06GGGACCCANONE
Os06g0102600J065187I04GTGGGTCCCHypothetical protein.
J065187I04TGAGGGACHypothetical protein.
Os06g0102800AK068790GTGGGTCCConserved hypothetical protein.
Os06g0103500003-106-F05GGTGGGACNONE
AK060849GGTGGGACNONE
AK063051GGTGGGACNONE
AK098983GGTGGGACNONE
AK100758GGTGGGACSimilar to Acyl-coenzyme A oxidase 1, peroxisomal (EC 1.3.3.6) (AOX 1) (Long- chain acyl-CoA oxidase) (AtCX1).
J013025E24GGTGGGACNONE
J013044A02GGTGGGACNONE
J013055H14GGTGGGACNONE
J013060P16GGTGGGACNONE
J013072I11GGTGGGACNONE
J013111N01GGTGGGACNONE
J013156E03GGTGGGACNONE
J013170E13GGTGGGACNONE
J023008P06GGTGGGACNONE
J023013I11GGTGGGACNONE
J023029P06GGTGGGACNONE
J023034A11GGTGGGACNONE
J023036A17GGTGGGACNONE
J023037E18GGTGGGACNONE
J023042P07GGTGGGACNONE
J023075M15GGTGGGACNONE
J023095G16GGTGGGACNONE
J023119B01GGTGGGACNONE
J023119G12GGTGGGACNONE
J023132L08GGTGGGACNONE
J023138M18GGTGGGACNONE
J023145O18GGTGGGACNONE
J033029D15GGTGGGACNONE
J033029F17GGTGGGACNONE
J033029F18GGTGGGACNONE
J033031K15GGTGGGACNONE
J033050B08GGTGGGACNONE
J033067L14GGTGGGACNONE
J033074E14GGTGGGACNONE
J033079J08GGTGGGACNONE
J033089E23GGTGGGACNONE
J033121B18GGTGGGACNONE
J033123G01GGTGGGACNONE
J033138E04GGTGGGACNONE
J033138K18GGTGGGACNONE
J033139A16GGTGGGACNONE
J043012J18GGTGGGACNONE
J090031C24GGTGGGACNONE
J100041P08GGTGGGACNONE
Os06g0115200J100029D05GGGACCCANONE
J100048P05GGGACCCAQuinonprotein alcohol dehydrogenase-like domain containing protein.
Os06g0124900009-128-B12TGGGACCCNONE
009-186-H09TGGGACCCNONE
AK062901TGGGACCCConserved hypothetical protein.
J013056D13TGGGACCCNONE
J013056D17TGGGACCCNONE
J013066A13TGGGACCCNONE
J013066C03TGGGACCCNONE
J013066F01TGGGACCCNONE
J023078D03TGGGACCCNONE
J033113N02TGGGACCCNONE
J065019F09TGGGACCCNONE
J065048C21TGGGACCCNONE
J065077L13TGGGACCCNONE
J065082J09TGGGACCCNONE
J065113H16TGGGACCCNONE
J065147A20TGGGACCCNONE
J065180A13TGGGACCCNONE
J065198M18TGGGACCCNONE
J065207K19TGGGACCCNONE
J075109H13TGGGACCCNONE
Os06g0125200015-099-F09GGTGGGACNONE
AK102200GGTGGGACProtein of unknown function DUF581 family protein.
J033030E04GGTGGGACNONE
J033058K06GGTGGGACNONE
J033060O13GGTGGGACNONE
J033068B04GGTGGGACNONE
J033087E11GGTGGGACNONE
J033113N12GGTGGGACNONE
J065110P15GGTGGGACNONE
J075174B01GGTGGGACNONE
Os06g0136700AK065081GGGACCCASteroid nuclear receptor, ligand-binding domain containing protein.
AK065081TGAGGGACSteroid nuclear receptor, ligand-binding domain containing protein.
J013001L08GGGACCCANONE
J013001L08TGAGGGACNONE
J013039I03GGGACCCANONE
J013039I03TGAGGGACNONE
Os06g0136900AK107405GTGGGTCCCACCGCACProtein of unknown function DUF296 domain containing protein.
Os06g0137700006-069-H03GGGTCCCACNONE
011-035-G09GGGTCCCACNONE
016-001-C08GGGTCCCACNONE
AK061097GGGTCCCACNONE
AK073547GGGTCCCACNONE
AK106455GGGTCCCACSimilar to GDP-mannose 4,6 dehydratase 1 (EC 4.2.1.47) (GDP-D-mannose dehydratase 1) (GMD 1).
Os06g0160700012-100-G07GGTGGGACNONE
AF165890GGTGGGACNONE
AK109458GGTGGGACSimilar to Starch synthase I, chloroplast precursor (EC 2.4.1.21) (Soluble starch synthase 1) (SSS 1).
AY299404GGTGGGACNONE
D16202GGTGGGACNONE
J033126L01GGTGGGACNONE
J065192J01GGTGGGACNONE
J090009J02GGTGGGACNONE
Os06g0166500016-094-H06TGGGTCCCNONE
AK102541TGGGTCCCSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20).
Os06g0174350J043034B05GTCCCTCAConserved hypothetical protein.
Os06g0179800AK065817GGTCCCACCACNONE
AK121252GGTCCCACCACLeucine rich repeat, N-terminal domain containing protein.
Os06g0213900AK106922GTCGCGTCCCACCConserved hypothetical protein.
J090028K09GTCGCGTCCCACCNONE
J100078N13GTCGCGTCCCACCNONE
Os06g0215600006-037-G11GGTCCCACNONE
006-098-D08GGTCCCACNONE
006-106-G02GGTCCCACNONE
AK061212GGTCCCACSimilar to Oxo-phytodienoic acid reductase.
AK104039GGTCCCACNONE
AK104193GGTCCCACNONE
AK104256GGTCCCACNONE
Os06g0215900011-006-B01GGGTCCCACNONE
011-088-G08GGGTCCCACNONE
AK072596GGGTCCCACSimilar to Oxo-phytodienoic acid reductase.
AK105590GGGTCCCACNONE
J023125E21GGGTCCCACNONE
J033051F13GGGTCCCACNONE
J033091L21GGGTCCCACNONE
J033107E18GGGTCCCACNONE
J043034N06GGGTCCCACNONE
J065021A14GGGTCCCACNONE
J065136F10GGGTCCCACNONE
J065142G20GGGTCCCACNONE
J065166I12GGGTCCCACNONE
J065171G17GGGTCCCACNONE
J065179A21GGGTCCCACNONE
J065190J04GGGTCCCACNONE
J065214E03GGGTCCCACNONE
J100022N12GGGTCCCACNONE
J100025A03GGGTCCCACNONE
J100034H20GGGTCCCACNONE
J100054C23GGGTCCCACNONE
J100057K17GGGTCCCACNONE
J100061L01GGGTCCCACNONE
J100077K16GGGTCCCACNONE
J100078D16GGGTCCCACNONE
J100084G04GGGTCCCACNONE
Os06g0217700009-074-A04GTGGGTCCCANONE
AK062617GTGGGTCCCAConserved hypothetical protein.
Os06g0226000J065039K05GTCCCTCANONE
J065055N12GTCCCTCANONE
J065068D18GTCCCTCANONE
J065108A17GTCCCTCANONE
J065192L08GTCCCTCANONE
Os06g0231300AK073934GGTCCCACCTGTCATCCACCHSP20-like chaperone domain containing protein.
Os06g0233000009-177-C07CGGGTCCCACNONE
009-177-C07GGACCCACNONE
AK063118CGGGTCCCACConserved hypothetical protein.
AK063118GGACCCACConserved hypothetical protein.
Os06g0241200AK100783GGTCCCACHypothetical protein.
AK100783TGTGGGCCCCACATGTCAGTGGGTCCCAHypothetical protein.
Os06g0245600Os06g0245600GTCCCTCAphosphotransferase system, PEP-utilising enzyme, N-terminal domain containing protein.
Os06g0246600AK107692GTGGGTCCCASimilar to Glutamate receptor 3.3 precursor (Ligand-gated ion channel 3.3).
Os06g0264300AK061556CAGGTGGGTCCNONE
AK061556GTGGGTCCCACNONE
AK073271CAGGTGGGTCCSimilar to RAD23, isoform I.
AK073271GTGGGTCCCACSimilar to RAD23, isoform I.
Os06g0265000AK100247GGGACCCACSimilar to Asparagine synthetase.
D83378GGGACCCACNONE
J013033O15GGGACCCACNONE
J013037K20GGGACCCACNONE
J013058I07GGGACCCACNONE
J033125M21GGGACCCACNONE
J033142B02GGGACCCACNONE
J043030E23GGGACCCACNONE
J043034K11GGGACCCACNONE
J053050B10GGGACCCACNONE
J053061I09GGGACCCACNONE
J053068F17GGGACCCACNONE
J053074G11GGGACCCACNONE
J053095N11GGGACCCACNONE
J090028M17GGGACCCACNONE
J090031O08GGGACCCACNONE
J090094C22GGGACCCACNONE
J100045M24GGGACCCACNONE
J100055P03GGGACCCACNONE
J100073O10GGGACCCACNONE
J100081K21GGGACCCACNONE
U55873GGGACCCACNONE
Os06g0285400AK105829GTCCCTCANONE
Os06g0294600AK058424TGGGTCCCNONE
AK059089TGGGTCCCCytochrome P450 family protein.
Os06g0324000AK109614GTCCCTCAConserved hypothetical protein.
AK109614GTCCCTCAConserved hypothetical protein.
AK109614GTGGGACCCACGTGGACCConserved hypothetical protein.
Os06g0325500011-037-D06GGGACCCANONE
011-093-G07GGGACCCANONE
AK063974GGGACCCAProtein of unknown function DUF89 family protein.
AK099286GGGACCCANONE
J065124G18GGGACCCANONE
J065160K08GGGACCCANONE
J065207O08GGGACCCANONE
J075011D18GGGACCCANONE
J075012D02GGGACCCANONE
J075090F13GGGACCCANONE
J075164A04GGGACCCANONE
J075198I19GGGACCCANONE
Os06g0353700J065177D24GGACCCACCTGConserved hypothetical protein.
Os06g0482200AK119703TGAGGGACThioredoxin fold domain containing protein.
J065014B11TGAGGGACNONE
J065055E22TGAGGGACNONE
J065092L13TGAGGGACNONE
J065113E21TGAGGGACNONE
J065191D11TGAGGGACNONE
J065214F18TGAGGGACNONE
J075104E18TGAGGGACNONE
J075149O19TGAGGGACNONE
J075170I11TGAGGGACNONE
Os06g0547400011-042-A11TGGGACCCANONE
AK121950TGGGACCCASimilar to Peroxidase P7 (EC 1.11.1.7) (TP7).
J013124J24TGGGACCCANONE
J033044D10TGGGACCCANONE
J033055K11TGGGACCCANONE
J033064N09TGGGACCCANONE
J033107J23TGGGACCCANONE
J065061E07TGGGACCCANONE
J065112E18TGGGACCCANONE
J065138C02TGGGACCCANONE
J065187O10TGGGACCCANONE
J100034G11TGGGACCCANONE
J100043F12TGGGACCCANONE
Os06g0550800J065058J22GGTCCCACCTGConserved hypothetical protein.
Os06g0551400009-003-D11ACAGGTGGGACCNONE
011-025-C09ACAGGTGGGACCNONE
AK066548ACAGGTGGGACCRas-related protein RIC2.
D13758ACAGGTGGGACCNONE
J013069H14ACAGGTGGGACCNONE
J053037J07ACAGGTGGGACCNONE
J065011J03ACAGGTGGGACCNONE
J065078L15ACAGGTGGGACCNONE
J065103H24ACAGGTGGGACCNONE
J065157A07ACAGGTGGGACCNONE
J065213P12ACAGGTGGGACCNONE
J090007P04ACAGGTGGGACCNONE
J090052N23ACAGGTGGGACCNONE
Os06g0553100J065130H10CGGGTCCCNONE
J075102G23CGGGTCCCNONE
J075147H23CGGGTCCCHeat shock factor (HSF)-type, DNA-binding domain containing protein.
Os06g0556300AK063985TGAGGGACCyclin-like F-box domain containing protein.
AK101552TGAGGGACNONE
Os06g0560400AK103575TGAGGGACNONE
AK108074TGAGGGACProtein of unknown function DUF862, eukaryotic domain containing protein.
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein.
Os06g0595900AK066655TGAGGGACCCGTranscription elongation factor S-II, central region domain containing protein.
J075022F02TGAGGGACCCGNONE
J075055H13TGAGGGACCCGNONE
J075188H14TGAGGGACCCGNONE
Os06g0609900AK109324GGTCCCACACGConserved hypothetical protein.
AK109324GGTGGGACCCACConserved hypothetical protein.
Os06g0610300009-078-D07GTCCCTCANONE
AK062635GTCCCTCAConserved hypothetical protein.
Os06g0621300AK068751TGGGACCCACGTGGACCConserved hypothetical protein.
J013159I20TGGGACCCACGTGGACCNONE
Os06g0647900AK073750TGAGGGACConserved hypothetical protein.
J033029K17TGAGGGACNONE
J033070L21TGAGGGACNONE
Os06g0650900AK071882GTGGGTCCNONE
AK107961GTGGGTCCHeat shock protein DnaJ family protein.
Os06g0664400Os06g0664400TGAGGGACHMG-I and HMG-Y, DNA-binding domain containing protein.
Os06g0665500015-073-H04GGACCCACGCGNONE
AK073262GGACCCACGCGAmidase, hydantoinase/carbamoylase family protein.
J023095H01GGACCCACGCGNONE
J023150C12GGACCCACGCGNONE
J033026H23GGACCCACGCGNONE
J033136A22GGACCCACGCGNONE
J043021O11GGACCCACGCGNONE
J065054C02GGACCCACGCGNONE
J065117N17GGACCCACGCGNONE
J075020B19GGACCCACGCGNONE
J075021C15GGACCCACGCGNONE
J075030E13GGACCCACGCGNONE
J075046B01GGACCCACGCGNONE
J075052L03GGACCCACGCGNONE
J075071L10GGACCCACGCGNONE
J075083L22GGACCCACGCGNONE
J075108H22GGACCCACGCGNONE
J075112G22GGACCCACGCGNONE
J075112I23GGACCCACGCGNONE
J075115C09GGACCCACGCGNONE
J075118B03GGACCCACGCGNONE
J075123H10GGACCCACGCGNONE
J075123J08GGACCCACGCGNONE
J075124J05GGACCCACGCGNONE
J075125O04GGACCCACGCGNONE
J075143D17GGACCCACGCGNONE
J075157I06GGACCCACGCGNONE
J090031B18GGACCCACGCGNONE
J100030M07GGACCCACGCGNONE
J100037E19GGACCCACGCGNONE
J100087H18GGACCCACGCGNONE
Os06g0667600AK058606TGAGGGACNONE
AK071621TGAGGGACSimilar to Glycine decarboxylase complex H-protein.
J023101D03TGAGGGACNONE
J033095E17TGAGGGACNONE
J065020B16TGAGGGACNONE
Os06g0668200011-004-A12GTGGGACCCACNONE
AK070705GTGGGACCCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3).
AK101622GTGGGACCCACNONE
D10408GTGGGACCCACNONE
J033044L05GTGGGACCCACNONE
J033052L01GTGGGACCCACNONE
J033086F09GTGGGACCCACNONE
J033096I19GTGGGACCCACNONE
J053072J20GTGGGACCCACNONE
J065074N09GTGGGACCCACNONE
J065075K09GTGGGACCCACNONE
J065130L15GTGGGACCCACNONE
J065136P12GTGGGACCCACNONE
J065137M09GTGGGACCCACNONE
J065139O15GTGGGACCCACNONE
J075003J03GTGGGACCCACNONE
J075021J20GTGGGACCCACNONE
Os06g0677600009-200-F02CGCGTGGGTCCNONE
AK063252CGCGTGGGTCCLike-Sm ribonucleoprotein, core family protein.
J075028G10CGCGTGGGTCCNONE
J075189D08CGCGTGGGTCCNONE
J090045C02CGCGTGGGTCCNONE
Os06g0678200AK059456GTGGGTCCNONE
AK071299GTGGGTCCSimilar to Geranyl diphosphate synthase.
Os06g0713800AK059671GTCCCACCNONE
AK101018GTCCCACCNONE
J023149I23GTCCCACCNONE
X64619GTCCCACCAlpha-amylase isozyme 2A precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase).
Os06g0714000AK069538CGGGTCCCACCACProtein of unknown function UPF0183 family protein.
AK069538TGGGTCCCACCACProtein of unknown function UPF0183 family protein.
J023020A02CGGGTCCCACCACNONE
J023020A02TGGGTCCCACCACNONE
J023039H03CGGGTCCCACCACNONE
J023039H03TGGGTCCCACCACNONE
J100042E23CGGGTCCCACCACNONE
J100042E23TGGGTCCCACCACNONE
J100069N01CGGGTCCCACCACNONE
J100069N01TGGGTCCCACCACNONE
J100089L13CGGGTCCCACCACNONE
J100089L13TGGGTCCCACCACNONE
Os06g0728700AK111637TGGGTCCCACHomeodomain-like containing protein.
AK119632TGGGTCCCACNONE
J075015J02TGGGTCCCACNONE
J075016L14TGGGTCCCACNONE
J075078O03TGGGTCCCACNONE
J075098O14TGGGTCCCACNONE
J075171L20TGGGTCCCACNONE
Os06g0731700J065089G16GTGGTGGGACNONE
J065157E16GTGGTGGGACNONE
Os07g0100200006-022-D06GTCCCACCNONE
011-025-B06GTCCCACCNONE
012-069-A07GTCCCACCNONE
AK060986GTCCCACCNONE
AK073305GTCCCACCSimilar to PDX1-like protein 4.
J023055C05GTCCCACCNONE
J033024J11GTCCCACCNONE
J065045F14GTCCCACCNONE
J075097C22GTCCCACCNONE
Os07g0102100AK066544CAGGTGGGACNONE
AK099800CAGGTGGGACSimilar to Potassium transporter 1 (OsHAK1). Splice isoform 2.
Os07g0107900011-004-F03GTGGCGTGGGTCCNONE
011-089-F01GTGGCGTGGGTCCNONE
AK073520GTGGCGTGGGTCCNONE
AK073651GTGGCGTGGGTCCConserved hypothetical protein.
J013118M08GTGGCGTGGGTCCNONE
J033042E18GTGGCGTGGGTCCNONE
J033066E10GTGGCGTGGGTCCNONE
J080303I24GTGGCGTGGGTCCNONE
J080316O19GTGGCGTGGGTCCNONE
J090019H13GTGGCGTGGGTCCNONE
Os07g0112600AK109561GTCCCTCAConserved hypothetical protein.
Os07g0124600AK073437GTGGGACCCACCTGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J033042K24GTGGGACCCACCTGTCNONE
J033136G07GTGGGACCCACCTGTCNONE
J065092I12GTGGGACCCACCTGTCNONE
J065132F04GTGGGACCCACCTGTCNONE
J065143I11GTGGGACCCACCTGTCNONE
Os07g0136300AK064609CGGGTGGGACCConserved hypothetical protein.
Os07g0152800AK065458TGGGTCCCAConserved hypothetical protein.
J013022G05TGGGTCCCANONE
J013023D18TGGGTCCCANONE
J013048J16TGGGTCCCANONE
J013055I03TGGGTCCCANONE
J013057F12TGGGTCCCANONE
J023109A22TGGGTCCCANONE
J023148E09TGGGTCCCANONE
J033069G17TGGGTCCCANONE
J033092I18TGGGTCCCANONE
J033093C02TGGGTCCCANONE
J033141M17TGGGTCCCANONE
J043016M18TGGGTCCCANONE
J090016D12TGGGTCCCANONE
J090071B10TGGGTCCCANONE
J090098K07TGGGTCCCANONE
J100035K14TGGGTCCCANONE
Os07g0154900009-142-E09GTGGGACCCACNONE
AK062969GTGGGACCCACConserved hypothetical protein.
Os07g0158300006-049-G04TGAGGGACNONE
AK099188TGAGGGACNONE
AK104773TGAGGGACNONE
J013106F16TGAGGGACNONE
J013123H22TGAGGGACNONE
J023029J02TGAGGGACNONE
J023029J03TGAGGGACNONE
J033138N08TGAGGGACNONE
J075011F05TGAGGGACNONE
J075022F10TGAGGGACNONE
J075071L13TGAGGGACNONE
J075094B08TGAGGGACNONE
J075119B21TGAGGGACNONE
J075140L02TGAGGGACNONE
J075199O21TGAGGGACNONE
J080001I17TGAGGGACNONE
J080005M04TGAGGGACNONE
J080011P17TGAGGGACNONE
J080026B14TGAGGGACNONE
J080026C12TGAGGGACNONE
J080030N16TGAGGGACNONE
J080035K23TGAGGGACNONE
J080039J22TGAGGGACNONE
J080045D04TGAGGGACNONE
J080050C06TGAGGGACNONE
J080050K14TGAGGGACNONE
J080051I09TGAGGGACNONE
J080053F18TGAGGGACNONE
J080053G10TGAGGGACNONE
J080055F05TGAGGGACNONE
J080057E22TGAGGGACNONE
J080058F17TGAGGGACNONE
J080063C18TGAGGGACNONE
J080065E02TGAGGGACNONE
J080066E06TGAGGGACNONE
J080067O05TGAGGGACNONE
J080068N15TGAGGGACNONE
J080071O04TGAGGGACNONE
J080074A20TGAGGGACNONE
J080074E14TGAGGGACNONE
J080074L05TGAGGGACNONE
J080075E08TGAGGGACNONE
J080075H07TGAGGGACNONE
J080077D04TGAGGGACNONE
J080077N15TGAGGGACNONE
J080078A07TGAGGGACNONE
J080079H22TGAGGGACNONE
J080080F20TGAGGGACNONE
J080080M22TGAGGGACNONE
J080081K09TGAGGGACNONE
J080081L04TGAGGGACNONE
J080090K09TGAGGGACNONE
J080093O13TGAGGGACNONE
J080094A18TGAGGGACNONE
J080094E10TGAGGGACNONE
J080094H06TGAGGGACNONE
J080096I21TGAGGGACNONE
J100081A19TGAGGGACNONE
Os07g0164100AK111557GGACCCACHistone deacetylase superfamily protein.
Os07g0164200009-038-C11GTGGGTCCNONE
AK059382GTGGGTCCTranslation factor domain containing protein.
AK107096GTGGGTCCNONE
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein).
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE
Os07g0185000015-028-H12GACAGGTGGGACNONE
AK072273GACAGGTGGGACNONE
AK100930GACAGGTGGGACSimilar to MAP kinase (Ser/Thr kinase).
J100026K08GACAGGTGGGACNONE
J100062M04GACAGGTGGGACNONE
J100073N07GACAGGTGGGACNONE
J100088M04GACAGGTGGGACNONE
Os07g0223100006-044-G07CCCACGCGTCCCACCNONE
006-071-E10CCCACGCGTCCCACCNONE
006-077-A04CCCACGCGTCCCACCNONE
009-162-H05CCCACGCGTCCCACCNONE
J023050M10CCCACGCGTCCCACCNONE
J023055F05CCCACGCGTCCCACCNONE
J023060I11CCCACGCGTCCCACCNONE
J023101M01CCCACGCGTCCCACCNONE
J065059J21CCCACGCGTCCCACCNONE
J065087I18CCCACGCGTCCCACCNONE
J065113L17CCCACGCGTCCCACCNONE
J065123E19CCCACGCGTCCCACCNONE
J065137O04CCCACGCGTCCCACCNONE
J065217M03CCCACGCGTCCCACCNONE
J090012O14CCCACGCGTCCCACCNONE
J090014C13CCCACGCGTCCCACCNONE
J090060C24CCCACGCGTCCCACCNONE
J100037H14CCCACGCGTCCCACCNONE
J100060E10CCCACGCGTCCCACCNONE
J100067L04CCCACGCGTCCCACCNONE
J100075G09CCCACGCGTCCCACCNONE
J100077C15CCCACGCGTCCCACCNONE
Os07g0256200AK072904GGACCCACTGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein.
J023148I23GGACCCACTGACNONE
Os07g0272800AK107279TGAGGGACHypothetical protein.
J065124H15TGAGGGACNONE
Os07g0280200AK108656TGGGTCCCAMP-dependent synthetase and ligase domain containing protein.
Os07g0300900AK061941GTGGGACCSimilar to Lysine-sensitive aspartate kinase.
AK102162GTGGGACCNONE
Os07g0408700004-019-E03CAAGTGGGACCCACNONE
015-093-D01CAAGTGGGACCCACNONE
AJ251298CAAGTGGGACCCACNONE
AK060916CAAGTGGGACCCACNONE
AK099606CAAGTGGGACCCACSimilar to Spermidine synthase 2 (EC 2.5.1.16) (Putrescine aminopropyltransferase 2) (SPDSY 2).
J013052G01CAAGTGGGACCCACNONE
Os07g0419800J080309B06GGACCCACNONE
Os07g0442000AK068559GTGGGACCCACGGGCCCACCACyclin-like F-box domain containing protein.
Os07g0479300AK120117GGTCCCACCGCCCACCCPeptidase S10, serine carboxypeptidase family protein.
D17587GGTCCCACCGCCCACCCNONE
Os07g0481000AK071382GTCCCTCASimilar to Pollen-specific kinase partner protein.
AK101192GTCCCTCANONE
J023056G13GTCCCTCANONE
J023106H11GTCCCTCANONE
J033030H11GTCCCTCANONE
J033074F11GTCCCTCANONE
J033130I21GTCCCTCANONE
J065023H20GTCCCTCANONE
J065079P18GTCCCTCANONE
J065121D13GTCCCTCANONE
J065217L07GTCCCTCANONE
Os07g0513200015-004-B02CGGGTGGGACNONE
AK101410CGGGTGGGACNONE
AK106227CGGGTGGGACNONE
AK119451CGGGTGGGACProtein prenyltransferase domain containing protein.
Os07g0525400AK121393GTCCCACCRabGAP/TBC domain containing protein.
J023064H22GTCCCACCNONE
J023092K07GTCCCACCNONE
J023129N03GTCCCACCNONE
J023142K04GTCCCACCNONE
Os07g0551300AK102758TGGGACCCACSimilar to KI domain interacting kinase 1.
Os07g0561500J090084P16TGAGGGACGlucose/ribitol dehydrogenase family protein.
J090084P16TGAGGGACGlucose/ribitol dehydrogenase family protein.
Os07g0562700003-111-G08GTGGGTCCCANONE
004-013-E07GTGGGTCCCANONE
006-021-D03GTGGGTCCCANONE
006-021-D07GTGGGTCCCANONE
006-021-F09GTGGGTCCCANONE
006-023-D01GTGGGTCCCANONE
006-024-F04GTGGGTCCCANONE
006-024-G09GTGGGTCCCANONE
006-024-G11GTGGGTCCCANONE
006-025-A10GTGGGTCCCANONE
006-025-B08GTGGGTCCCANONE
006-025-E10GTGGGTCCCANONE
006-025-F10GTGGGTCCCANONE
006-026-B04GTGGGTCCCANONE
006-026-C08GTGGGTCCCANONE
006-026-D03GTGGGTCCCANONE
006-026-F03GTGGGTCCCANONE
006-026-F08GTGGGTCCCANONE
006-026-F12GTGGGTCCCANONE
006-027-A10GTGGGTCCCANONE
006-027-C03GTGGGTCCCANONE
006-028-C03GTGGGTCCCANONE
006-029-E02GTGGGTCCCANONE
006-029-G05GTGGGTCCCANONE
006-030-A10GTGGGTCCCANONE
006-030-C06GTGGGTCCCANONE
006-030-D03GTGGGTCCCANONE
006-030-D06GTGGGTCCCANONE
006-030-G05GTGGGTCCCANONE
006-031-B10GTGGGTCCCANONE
006-031-D04GTGGGTCCCANONE
006-031-D11GTGGGTCCCANONE
006-031-H09GTGGGTCCCANONE
006-032-C09GTGGGTCCCANONE
006-032-H09GTGGGTCCCANONE
006-033-B02GTGGGTCCCANONE
006-033-B09GTGGGTCCCANONE
006-033-E01GTGGGTCCCANONE
006-033-F06GTGGGTCCCANONE
006-033-G03GTGGGTCCCANONE
006-034-A08GTGGGTCCCANONE
006-034-C09GTGGGTCCCANONE
006-034-F06GTGGGTCCCANONE
006-035-B12GTGGGTCCCANONE
006-035-C12GTGGGTCCCANONE
006-035-H04GTGGGTCCCANONE
006-035-H12GTGGGTCCCANONE
006-036-A05GTGGGTCCCANONE
006-036-A09GTGGGTCCCANONE
006-036-B10GTGGGTCCCANONE
006-036-C03GTGGGTCCCANONE
006-036-E06GTGGGTCCCANONE
006-037-H11GTGGGTCCCANONE
006-038-G01GTGGGTCCCANONE
006-039-B01GTGGGTCCCANONE
006-039-B12GTGGGTCCCANONE
006-039-C02GTGGGTCCCANONE
006-039-E06GTGGGTCCCANONE
006-039-G12GTGGGTCCCANONE
006-040-G07GTGGGTCCCANONE
006-041-H04GTGGGTCCCANONE
006-042-A11GTGGGTCCCANONE
006-042-E07GTGGGTCCCANONE
006-042-F12GTGGGTCCCANONE
006-043-C01GTGGGTCCCANONE
006-045-H12GTGGGTCCCANONE
006-046-A12GTGGGTCCCANONE
006-046-F03GTGGGTCCCANONE
006-047-A07GTGGGTCCCANONE
006-047-A09GTGGGTCCCANONE
006-047-E10GTGGGTCCCANONE
006-047-G12GTGGGTCCCANONE
006-048-B04GTGGGTCCCANONE
006-049-D01GTGGGTCCCANONE
006-049-G02GTGGGTCCCANONE
006-049-G10GTGGGTCCCANONE
006-049-H04GTGGGTCCCANONE
006-050-D05GTGGGTCCCANONE
006-050-F05GTGGGTCCCANONE
006-051-B05GTGGGTCCCANONE
006-051-G12GTGGGTCCCANONE
006-052-D12GTGGGTCCCANONE
006-053-D06GTGGGTCCCANONE
006-054-H02GTGGGTCCCANONE
006-055-A03GTGGGTCCCANONE
006-055-C01GTGGGTCCCANONE
006-055-E07GTGGGTCCCANONE
006-055-H06GTGGGTCCCANONE
006-056-F06GTGGGTCCCANONE
006-057-D03GTGGGTCCCANONE
006-057-D05GTGGGTCCCANONE
006-057-G01GTGGGTCCCANONE
006-058-A03GTGGGTCCCANONE
006-058-B06GTGGGTCCCANONE
006-059-A09GTGGGTCCCANONE
006-059-H11GTGGGTCCCANONE
006-060-A04GTGGGTCCCANONE
006-060-A09GTGGGTCCCANONE
006-060-C11GTGGGTCCCANONE
006-060-D08GTGGGTCCCANONE
006-061-A04GTGGGTCCCANONE
006-061-E01GTGGGTCCCANONE
006-061-G10GTGGGTCCCANONE
006-061-H12GTGGGTCCCANONE
006-062-B07GTGGGTCCCANONE
006-062-G03GTGGGTCCCANONE
006-062-H12GTGGGTCCCANONE
006-063-D05GTGGGTCCCANONE
006-063-E04GTGGGTCCCANONE
006-063-F05GTGGGTCCCANONE
006-063-G05GTGGGTCCCANONE
006-064-B07GTGGGTCCCANONE
006-065-C11GTGGGTCCCANONE
006-065-H02GTGGGTCCCANONE
006-067-C12GTGGGTCCCANONE
006-067-F10GTGGGTCCCANONE
006-068-E02GTGGGTCCCANONE
006-068-G04GTGGGTCCCANONE
006-069-A02GTGGGTCCCANONE
006-071-A07GTGGGTCCCANONE
006-072-F11GTGGGTCCCANONE
006-072-F12GTGGGTCCCANONE
006-073-E12GTGGGTCCCANONE
006-073-F08GTGGGTCCCANONE
006-073-H07GTGGGTCCCANONE
006-074-A07GTGGGTCCCANONE
006-075-A12GTGGGTCCCANONE
006-075-B01GTGGGTCCCANONE
006-075-H10GTGGGTCCCANONE
006-075-H12GTGGGTCCCANONE
006-076-B06GTGGGTCCCANONE
006-077-A09GTGGGTCCCANONE
006-077-D05GTGGGTCCCANONE
006-078-C11GTGGGTCCCANONE
006-078-D12GTGGGTCCCANONE
006-078-E02GTGGGTCCCANONE
006-079-A01GTGGGTCCCANONE
006-079-E02GTGGGTCCCANONE
006-079-F03GTGGGTCCCANONE
006-080-G11GTGGGTCCCANONE
006-081-C02GTGGGTCCCANONE
006-081-C08GTGGGTCCCANONE
006-082-B06GTGGGTCCCANONE
006-082-C11GTGGGTCCCANONE
006-082-H04GTGGGTCCCANONE
006-083-E04GTGGGTCCCANONE
006-083-H12GTGGGTCCCANONE
006-084-C08GTGGGTCCCANONE
006-084-E07GTGGGTCCCANONE
006-084-E10GTGGGTCCCANONE
006-085-E06GTGGGTCCCANONE
006-085-E10GTGGGTCCCANONE
006-086-F06GTGGGTCCCANONE
006-087-D08GTGGGTCCCANONE
006-087-F03GTGGGTCCCANONE
006-087-F10GTGGGTCCCANONE
006-087-G07GTGGGTCCCANONE
006-088-A02GTGGGTCCCANONE
006-089-A04GTGGGTCCCANONE
006-089-B12GTGGGTCCCANONE
006-089-D06GTGGGTCCCANONE
006-089-D10GTGGGTCCCANONE
006-089-H05GTGGGTCCCANONE
006-090-C06GTGGGTCCCANONE
006-091-A03GTGGGTCCCANONE
006-091-E04GTGGGTCCCANONE
006-091-H12GTGGGTCCCANONE
006-092-A08GTGGGTCCCANONE
006-092-F01GTGGGTCCCANONE
006-092-G08GTGGGTCCCANONE
006-093-B12GTGGGTCCCANONE
006-093-D04GTGGGTCCCANONE
006-093-F01GTGGGTCCCANONE
006-094-A08GTGGGTCCCANONE
006-094-F01GTGGGTCCCANONE
006-094-F03GTGGGTCCCANONE
006-095-C12GTGGGTCCCANONE
006-095-E10GTGGGTCCCANONE
006-095-E12GTGGGTCCCANONE
006-095-G06GTGGGTCCCANONE
006-096-B12GTGGGTCCCANONE
006-096-C12GTGGGTCCCANONE
006-096-G02GTGGGTCCCANONE
006-097-D01GTGGGTCCCANONE
006-097-D07GTGGGTCCCANONE
006-097-F04GTGGGTCCCANONE
006-098-C07GTGGGTCCCANONE
006-098-D04GTGGGTCCCANONE
006-099-E06GTGGGTCCCANONE
006-099-F02GTGGGTCCCANONE
006-099-F10GTGGGTCCCANONE
006-100-A07GTGGGTCCCANONE
006-100-B10GTGGGTCCCANONE
006-100-G01GTGGGTCCCANONE
006-100-H06GTGGGTCCCANONE
006-101-D01GTGGGTCCCANONE
006-101-F03GTGGGTCCCANONE
006-102-A12GTGGGTCCCANONE
006-102-B11GTGGGTCCCANONE
006-102-C03GTGGGTCCCANONE
006-102-F11GTGGGTCCCANONE
006-103-A08GTGGGTCCCANONE
006-103-B06GTGGGTCCCANONE
006-103-D01GTGGGTCCCANONE
006-103-F02GTGGGTCCCANONE
006-104-B02GTGGGTCCCANONE
006-104-C01GTGGGTCCCANONE
006-104-F09GTGGGTCCCANONE
006-104-H11GTGGGTCCCANONE
006-105-A03GTGGGTCCCANONE
006-105-D09GTGGGTCCCANONE
006-106-B10GTGGGTCCCANONE
006-107-A06GTGGGTCCCANONE
006-107-C04GTGGGTCCCANONE
006-107-E03GTGGGTCCCANONE
006-107-F05GTGGGTCCCANONE
006-108-C09GTGGGTCCCANONE
006-109-C09GTGGGTCCCANONE
006-109-D10GTGGGTCCCANONE
006-109-E06GTGGGTCCCANONE
006-109-E10GTGGGTCCCANONE
006-110-A06GTGGGTCCCANONE
006-110-C11GTGGGTCCCANONE
006-111-A02GTGGGTCCCANONE
006-111-F02GTGGGTCCCANONE
006-112-A08GTGGGTCCCANONE
006-112-H06GTGGGTCCCANONE
006-113-A08GTGGGTCCCANONE
006-113-B01GTGGGTCCCANONE
006-113-C05GTGGGTCCCANONE
006-113-D01GTGGGTCCCANONE
006-113-D04GTGGGTCCCANONE
006-113-D06GTGGGTCCCANONE
006-113-E09GTGGGTCCCANONE
006-114-F06GTGGGTCCCANONE
006-116-B02GTGGGTCCCANONE
006-117-B07GTGGGTCCCANONE
006-117-G04GTGGGTCCCANONE
006-118-D01GTGGGTCCCANONE
006-118-D12GTGGGTCCCANONE
006-118-F12GTGGGTCCCANONE
006-118-G12GTGGGTCCCANONE
006-119-B08GTGGGTCCCANONE
006-120-E09GTGGGTCCCANONE
006-120-G05GTGGGTCCCANONE
006-120-G10GTGGGTCCCANONE
009-022-D12GTGGGTCCCANONE
009-051-H08GTGGGTCCCANONE
009-065-F05GTGGGTCCCANONE
009-070-A06GTGGGTCCCANONE
009-073-B07GTGGGTCCCANONE
009-092-C10GTGGGTCCCANONE
009-093-D03GTGGGTCCCANONE
009-103-B04GTGGGTCCCANONE
009-106-H08GTGGGTCCCANONE
009-120-B05GTGGGTCCCANONE
009-121-F05GTGGGTCCCANONE
009-122-B04GTGGGTCCCANONE
009-122-D08GTGGGTCCCANONE
009-123-F07GTGGGTCCCANONE
009-125-G02GTGGGTCCCANONE
009-128-F02GTGGGTCCCANONE
009-128-H07GTGGGTCCCANONE
009-131-C06GTGGGTCCCANONE
009-132-F08GTGGGTCCCANONE
009-133-G08GTGGGTCCCANONE
009-134-D09GTGGGTCCCANONE
009-135-F01GTGGGTCCCANONE
009-149-E11GTGGGTCCCANONE
009-153-H04GTGGGTCCCANONE
009-161-E04GTGGGTCCCANONE