version

Summary of AtREG386 (All List)

OrganismArabidopsis thaliana  
IDAtREG386  
SequenceAAATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count750  

Entry Sequences (750 entries)

LocusGene modelSequenceDescription
AT1G01100AT1G01100.1AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G01100.2AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G01100.3AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G01100.4AAATGGGCCTAG60S acidic ribosomal protein P1 (RPP1A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1C) (TAIR:AT5G47700.2); Has 1664 Blast hits to 1663 proteins in 290 species: Archae - 48; Bacteria - 0; Metazoa - 686; Fungi - 343; Plants - 315; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G01170AT1G01170.1GCCCATTTozone-responsive stress-related protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515); BEST Arabidopsis thaliana protein match is: ATOZI1 (TAIR:AT4G00860.1); Has 61 Blast hits to 61 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G01170.2GCCCATTTozone-responsive stress-related protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1138 (InterPro:IPR009515); BEST Arabidopsis thaliana protein match is: ATOZI1 (TAIR:AT4G00860.1); Has 61 Blast hits to 61 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G01350AT1G01350.1TGAGCCCATTTAnucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding, nucleic acid binding; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type/C3HC4-type RING finger) family protein (TAIR:AT5G06420.2); Has 684 Blast hits to 680 proteins in 163 species: Archae - 0; Bacteria - 2; Metazoa - 306; Fungi - 148; Plants - 91; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink). 
AT1G01500AT1G01500.1TAAGCCCATTTAACGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 69 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G02060AT1G02060.1AGCCCATTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G37230.1); Has 18912 Blast hits to 5842 proteins in 180 species: Archae - 4; Bacteria - 22; Metazoa - 373; Fungi - 390; Plants - 17444; Viruses - 0; Other Eukaryotes - 679 (source: NCBI BLink). 
AT1G02180AT1G02180.1GCCCATTTAferredoxin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G02190AT1G02190.1TAAATGGGCCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink). 
AT1G02190.2TAAATGGGCCER1 protein, putative; FUNCTIONS IN: oxidoreductase activity, iron ion binding, catalytic activity; INVOLVED IN: oxidation reduction, fatty acid biosynthetic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Fatty acid hydroxylase (InterPro:IPR006694); BEST Arabidopsis thaliana protein match is: catalytic/ iron ion binding / oxidoreductase (TAIR:AT2G37700.1); Has 1933 Blast hits to 1933 proteins in 393 species: Archae - 0; Bacteria - 634; Metazoa - 240; Fungi - 255; Plants - 298; Viruses - 2; Other Eukaryotes - 504 (source: NCBI BLink). 
AT1G02560AT1G02560.1TTGGCCCATTTOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). 
AT1G02680AT1G02680.1TAAATGGGCCTATTTBP-ASSOCIATED FACTOR 13 (TAF13); FUNCTIONS IN: RNA polymerase II transcription factor activity, DNA binding; INVOLVED IN: transcription initiation, transcription from RNA polymerase II promoter; LOCATED IN: transcription factor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IID, 18 kDa subunit (InterPro:IPR003195), Histone-fold (InterPro:IPR009072); Has 401 Blast hits to 401 proteins in 119 species: Archae - 0; Bacteria - 0; Metazoa - 182; Fungi - 191; Plants - 19; Viruses - 2; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G02750AT1G02750.1CAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G02750.1CAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G02750.1TTGACTTTAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to water deprivation; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Drought induced 19 (InterPro:IPR008598); BEST Arabidopsis thaliana protein match is: drought-responsive family protein (TAIR:AT4G02200.1); Has 126 Blast hits to 126 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 125; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G02780AT1G02780.1AAAAGCCCATTTembryo defective 2386 (emb2386); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 865 Blast hits to 865 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 278; Fungi - 107; Plants - 94; Viruses - 0; Other Eukaryotes - 180 (source: NCBI BLink). 
AT1G03140AT1G03140.1ATAAAGCCCATTTAsplicing factor Prp18 family protein; INVOLVED IN: RNA splicing; LOCATED IN: spliceosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Pre-mRNA processing factor 4 (PRP4) like (InterPro:IPR014906), Splicing factor motif (InterPro:IPR003648), Prp18 (InterPro:IPR004098); BEST Arabidopsis thaliana protein match is: splicing factor Prp18 family protein (TAIR:AT1G54590.1); Has 509 Blast hits to 499 proteins in 150 species: Archae - 0; Bacteria - 4; Metazoa - 224; Fungi - 121; Plants - 35; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT1G03150AT1G03150.1TAAATGGGCTTTATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase, putative (TAIR:AT5G13780.1); Has 1587 Blast hits to 1587 proteins in 440 species: Archae - 135; Bacteria - 362; Metazoa - 485; Fungi - 260; Plants - 84; Viruses - 0; Other Eukaryotes - 261 (source: NCBI BLink). 
AT1G03350AT1G03350.1TGGCCCATTTABSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT4G13110.1); Has 9675 Blast hits to 5119 proteins in 484 species: Archae - 40; Bacteria - 3294; Metazoa - 2852; Fungi - 1070; Plants - 279; Viruses - 71; Other Eukaryotes - 2069 (source: NCBI BLink). 
AT1G03360AT1G03360.1TAAATGGGCCAARABIDOPSIS THALIANA RIBOSOMAL RNA PROCESSING 4 (ATRRP4); FUNCTIONS IN: RNA binding, exonuclease activity; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), S1, RNA binding (InterPro:IPR003029); Has 443 Blast hits to 443 proteins in 204 species: Archae - 97; Bacteria - 0; Metazoa - 111; Fungi - 87; Plants - 23; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). 
AT1G03860AT1G03860.1AAATGGGCCTCTprohibitin 2 
AT1G03860.2AAATGGGCCTCTprohibitin 2 
AT1G03860.3AAATGGGCCTCTprohibitin 2 
AT1G04010AT1G04010.1CAAAGGCCCAATTAAAAGCCCATTTphosphatidate-sterol O-acyltransferase/ phosphatidylcholine-sterol O-acyltransferase/ phosphatidylethanolamine-sterol O-acyltransferase; FUNCTIONS IN: phosphatidylcholine-sterol O-acyltransferase activity, phosphatidylethanolamine-sterol O-acyltransferase activity, phosphatidate-sterol O-acyltransferase activity; INVOLVED IN: sterol esterification, lipid metabolic process; LOCATED IN: microsome; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Lecithin:cholesterol acyltransferase (InterPro:IPR003386); BEST Arabidopsis thaliana protein match is: ATPDAT; phosphatidylcholine-sterol O-acyltransferase (TAIR:AT5G13640.1); Has 448 Blast hits to 445 proteins in 142 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 76; Plants - 80; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). 
AT1G04020AT1G04020.1AAATGGGCTTTTAATTGGGCCTTTGEncodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. 
AT1G04020.2AAATGGGCTTTTAATTGGGCCTTTGEncodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein–protein interactions.Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. 
AT1G04190AT1G04190.1TGAGGCCCATTTAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: stress-inducible protein, putative (TAIR:AT1G62740.1); Has 15524 Blast hits to 9686 proteins in 698 species: Archae - 779; Bacteria - 4552; Metazoa - 3572; Fungi - 847; Plants - 951; Viruses - 0; Other Eukaryotes - 4823 (source: NCBI BLink). 
AT1G04510AT1G04510.1AAAAGGCCCATTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). 
AT1G04510.2AAAAGGCCCATTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, nucleotide binding; INVOLVED IN: response to cadmium ion; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), U box (InterPro:IPR003613), WD40 repeat, region (InterPro:IPR017986), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943), Pre-mRNA-splicing factor 19 (InterPro:IPR013915); BEST Arabidopsis thaliana protein match is: nucleotide binding / ubiquitin-protein ligase (TAIR:AT2G33340.2); Has 39753 Blast hits to 19409 proteins in 575 species: Archae - 62; Bacteria - 5219; Metazoa - 17707; Fungi - 7589; Plants - 3300; Viruses - 0; Other Eukaryotes - 5876 (source: NCBI BLink). 
AT1G04630AT1G04630.1AAATGGGCTTAGmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G04630.1TAGCCCATTTmaternal effect embryo arrest 4 (MEE4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G33220.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G04635AT1G04635.1AAATGGGCTAEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G04635.1CTAAGCCCATTTEMBRYO DEFECTIVE 1687 (EMB1687); FUNCTIONS IN: ribonuclease activity, ribonuclease P activity; INVOLVED IN: embryonic development ending in seed dormancy, tRNA processing; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Ribonuclease P-related (InterPro:IPR002759); Has 168 Blast hits to 168 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 69; Fungi - 60; Plants - 26; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G04870AT1G04870.1AAATGGGCCGAAEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. 
AT1G04870.2AAATGGGCCGAAEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. 
AT1G05580AT1G05580.1ATAAGCCCATTTmember of Putative Na+/H+ antiporter family 
AT1G05580.2ATAAGCCCATTTmember of Putative Na+/H+ antiporter family 
AT1G07210AT1G07210.1TAAATGGGCCTGG30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). 
AT1G07745AT1G07745.1AAATGGGCTAAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination. 
AT1G07745.2AAATGGGCTAAIs a suppressor of SNI1. Encodes a member of the RecA/RAD51 family of DNA recombination and repair proteins. Both RAD51 and SNI1 have a dual role in pathogen-related gene transcription and somatic homologous recombination. 
AT1G07980AT1G07980.1TAAATGGGCCTAAANUCLEAR FACTOR Y, SUBUNIT C10 (NF-YC10); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); Has 837 Blast hits to 835 proteins in 144 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 200; Plants - 185; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). 
AT1G08350AT1G08350.1AAATGGGCendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). 
AT1G08350.2AAATGGGCendomembrane protein 70 family protein; FUNCTIONS IN: SNAP receptor activity; INVOLVED IN: membrane fusion; LOCATED IN: integral to membrane, phragmoplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G37310.1); Has 1031 Blast hits to 987 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 444; Fungi - 168; Plants - 231; Viruses - 0; Other Eukaryotes - 188 (source: NCBI BLink). 
AT1G08360AT1G08360.1GCCCATTT60S ribosomal protein L10A (RPL10aA); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: PGY1 (PIGGYBACK1); RNA binding / structural constituent of ribosome (TAIR:AT2G27530.2); Has 2469 Blast hits to 2469 proteins in 759 species: Archae - 186; Bacteria - 980; Metazoa - 354; Fungi - 122; Plants - 236; Viruses - 0; Other Eukaryotes - 591 (source: NCBI BLink). 
AT1G08490AT1G08490.1AGGGCCCATTTAChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. 
AT1G09490AT1G09490.1AGCCCATTTsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565 
AT1G09490.2AGCCCATTTsimilar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565 
AT1G09995AT1G09995.1AAATGGGCCCAGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: helicase-related (TAIR:AT1G79890.1); Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G10030AT1G10030.1GAAGCCCAATTGAAAAGCCCATTTArabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G10050AT1G10050.1ACAGGCCCGGCCCATTTAEncodes a putative glycosyl hydrolase family 10 protein (xylanase). 
AT1G10910AT1G10910.1TAAAAGCCCATTTINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PTAC2 (PLASTID TRANSCRIPTIONALLY ACTIVE2) (TAIR:AT1G74850.1); Has 17570 Blast hits to 5782 proteins in 175 species: Archae - 1; Bacteria - 18; Metazoa - 305; Fungi - 261; Plants - 16266; Viruses - 0; Other Eukaryotes - 719 (source: NCBI BLink). 
AT1G12310AT1G12310.1TAAATGGGCCAcalmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G62820.1); Has 12140 Blast hits to 10293 proteins in 1212 species: Archae - 0; Bacteria - 26; Metazoa - 5264; Fungi - 3120; Plants - 2025; Viruses - 0; Other Eukaryotes - 1705 (source: NCBI BLink). 
AT1G12760AT1G12760.1GTGGCCCATTTAprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink). 
AT1G12760.2GTGGCCCATTTAprotein binding / ubiquitin-protein ligase/ zinc ion binding; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G63170.1); Has 6688 Blast hits to 6669 proteins in 210 species: Archae - 0; Bacteria - 6; Metazoa - 2304; Fungi - 503; Plants - 2742; Viruses - 19; Other Eukaryotes - 1114 (source: NCBI BLink). 
AT1G12830AT1G12830.1TAAATGGGCTAATACTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink). 
AT1G12840AT1G12840.1TTGGCCCAGTATTAGCCCATTTAEncodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. 
AT1G13030AT1G13030.1ATATGGGCTTAAATGGGCTTTAAATAAGGCCCAATsphere organelles protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12 growth stages; Has 13894 Blast hits to 8686 proteins in 584 species: Archae - 12; Bacteria - 813; Metazoa - 5398; Fungi - 1230; Plants - 486; Viruses - 98; Other Eukaryotes - 5857 (source: NCBI BLink). 
AT1G13330AT1G13330.1TAAATGGGCTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink). 
AT1G13690AT1G13690.1AAAAAGCCCATTTAAtE1 - stimulates the ATPase activity of DnaK/DnaJ 
AT1G14270AT1G14270.1TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G14270.2TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G14270.3TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G14270.4TAAATGGGCCTTAACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: CAAX amino terminal protease family protein (TAIR:AT5G60750.1); Has 1959 Blast hits to 1957 proteins in 522 species: Archae - 48; Bacteria - 1570; Metazoa - 0; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 272 (source: NCBI BLink). 
AT1G15215AT1G15215.1TAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G15215.2TAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G15215.3TAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: sequence-specific DNA binding / transcription factor (TAIR:AT3G18380.1); Has 41 Blast hits to 40 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G15270AT1G15270.1AGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT1G15280AT1G15280.1TAAATGGGCTglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). 
AT1G15280.2TAAATGGGCTglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). 
AT1G15460AT1G15460.1TAAATGGGCCCTEncodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions. 
AT1G15930AT1G15930.1AGCCCAATTAATAGGCCCATTTAAGCCCAAAT40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). 
AT1G15930.2AGCCCAATTAATAGGCCCATTTAAGCCCAAAT40S ribosomal protein S12 (RPS12A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to cadmium ion, response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12C) (TAIR:AT2G32060.3); Has 755 Blast hits to 755 proteins in 241 species: Archae - 164; Bacteria - 0; Metazoa - 257; Fungi - 123; Plants - 63; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). 
AT1G16030AT1G16030.1ATATGGGCTTTAATAGGCCCATTTAheat shock protein 70B (Hsp70b); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to heat; LOCATED IN: cytosol, cell wall, plasma membrane, chloroplast, membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSP70 (heat shock protein 70); ATP binding (TAIR:AT3G12580.1); Has 24709 Blast hits to 24439 proteins in 3097 species: Archae - 107; Bacteria - 9686; Metazoa - 3084; Fungi - 1225; Plants - 724; Viruses - 242; Other Eukaryotes - 9641 (source: NCBI BLink). 
AT1G16040AT1G16040.1TAAATGGGCCTATTAAAGCCCATATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: GPI anchor biosynthetic process; LOCATED IN: integral to membrane, endoplasmic reticulum membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GPI biosynthesis protein Pig-F (InterPro:IPR009580); Has 210 Blast hits to 210 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 96; Fungi - 80; Plants - 30; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G17070AT1G17070.1TAAATGGGCCTTTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G17070.1TAAATGGGCTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tuftelin interacting protein 11 (InterPro:IPR014809), D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 979 Blast hits to 958 proteins in 159 species: Archae - 2; Bacteria - 0; Metazoa - 613; Fungi - 98; Plants - 108; Viruses - 1; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G17210AT1G17210.1TAAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; LOCATED IN: cytosol, nucleus, phragmoplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C3HC-like (InterPro:IPR012935), Proteinase inhibitor I32, inhibitor of apoptosis (InterPro:IPR001370); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT1G48950.1); Has 388 Blast hits to 192 proteins in 68 species: Archae - 2; Bacteria - 7; Metazoa - 100; Fungi - 38; Plants - 41; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). 
AT1G17220AT1G17220.1TAAATGGGCTTTAEncodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. 
AT1G17890AT1G17890.1AAATGGGCGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). 
AT1G17890.2AAATGGGCGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). 
AT1G17890.3AAATGGGCGER2; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: GDP-L-fucose biosynthetic process, cellular metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: GER1 (GDP-4-KETO-6-DEOXYMANNOSE-3,5-EPIMERASE-4-REDUCTASE 1); GDP-L-fucose synthase (TAIR:AT1G73250.1); Has 18894 Blast hits to 18893 proteins in 1572 species: Archae - 373; Bacteria - 8804; Metazoa - 430; Fungi - 144; Plants - 435; Viruses - 22; Other Eukaryotes - 8686 (source: NCBI BLink). 
AT1G20340AT1G20340.1CAAAGCCCATTAAGGCCCATTTrecombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. 
AT1G20350AT1G20350.1AAATGGGCCTTAATGGGCTTTGmitochondrial inner membrane translocase 
AT1G20620AT1G20620.1ATGGCCCATTTCatalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. 
AT1G20620.2ATGGCCCATTTCatalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. 
AT1G20620.5ATGGCCCATTTCatalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. 
AT1G20760AT1G20760.1AGTGGGCTTATAAAAGCCCATTTAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink). 
AT1G20760.1ATTAGGCCTATAAAGGCCCATTTAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249), EPS15 homology (EH) (InterPro:IPR000261), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G21630.1); Has 10692 Blast hits to 4147 proteins in 323 species: Archae - 12; Bacteria - 3271; Metazoa - 3323; Fungi - 1334; Plants - 262; Viruses - 16; Other Eukaryotes - 2474 (source: NCBI BLink). 
AT1G21790AT1G21790.1AAATGGGCCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G21790.1AAATGGGCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G22885AT1G22885.1AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G22885.2AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G23890AT1G23890.1TAAATGGGCCCTACTTGGGCCGTTTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT1G23890.2TAAATGGGCCCTACTTGGGCCGTTTTNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat, subgroup (InterPro:IPR013017), NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT3G14860.2); Has 1921 Blast hits to 831 proteins in 148 species: Archae - 109; Bacteria - 916; Metazoa - 129; Fungi - 0; Plants - 86; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT1G23900AT1G23900.1AAAACGGCCCAAGTAGGGCCCATTTAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane 
AT1G23900.2AAAACGGCCCAAGTAGGGCCCATTTAEncodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane 
AT1G27070AT1G27070.1AAATGGGCCTATA5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT1G27070.1GCCCATTT5'-AMP-activated protein kinase-related; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03420.1); Has 573 Blast hits to 552 proteins in 161 species: Archae - 1; Bacteria - 66; Metazoa - 210; Fungi - 126; Plants - 98; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT1G27310AT1G27310.1ATAAGGCCCATTTAEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. 
AT1G27385AT1G27385.1AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454). 
AT1G27385.2AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454). 
AT1G27385.3AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454). 
AT1G27385.4AAATGGGCCTAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF493 (InterPro:IPR007454). 
AT1G27435AT1G27435.1AAATGGGCCTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G27435.1TAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G28060AT1G28060.1AAATGGGCTTCAGCCCATAAsmall nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink). 
AT1G28120AT1G28120.1TTTAGGCCCATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin thioesterase Otubain (InterPro:IPR016615), Ovarian tumour, otubain (InterPro:IPR003323); Has 295 Blast hits to 295 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 50; Plants - 47; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). 
AT1G29250AT1G29250.1TAGCCCATTTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT2G34160.1); Has 89 Blast hits to 89 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT1G29260AT1G29260.1AAATGGGCTAEncodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function. 
AT1G29952AT1G29952.1AAATGGGCUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF34 represents a conserved upstream opening reading frame relative to major ORF AT1G29950.2 
AT1G29970AT1G29970.1CAAGCCCATTT60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT1G29970.2CAAGCCCATTT60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT1G29970.3CAAGCCCATTT60S RIBOSOMAL PROTEIN L18A-1 (RPL18AA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18ae (InterPro:IPR002670); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L18A (RPL18aA) (TAIR:AT1G29965.1); Has 615 Blast hits to 613 proteins in 202 species: Archae - 0; Bacteria - 0; Metazoa - 242; Fungi - 102; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT1G30070AT1G30070.1TAAATGGGCTTGSGS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CS domain (InterPro:IPR007052), SGS (InterPro:IPR007699), HSP20-like chaperone (InterPro:IPR008978), CS (InterPro:IPR017447); BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G30060.1); Has 228 Blast hits to 227 proteins in 91 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 14; Plants - 46; Viruses - 0; Other Eukaryotes - 48 (source: NCBI BLink). 
AT1G30380AT1G30380.1TAAATGGGCCTGEncodes subunit K of photosystem I reaction center. 
AT1G30450AT1G30450.1CCCAATTAAAAAGCCCATTTmember of Cation-chloride co-transporter family 
AT1G30450.2CCCAATTAAAAAGCCCATTTmember of Cation-chloride co-transporter family 
AT1G30450.3CCCAATTAAAAAGCCCATTTmember of Cation-chloride co-transporter family 
AT1G30520AT1G30520.1TAAAGCCCATTTEncodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. 
AT1G30680AT1G30680.1AAATGGGCCAGGCCCAATtoprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink). 
AT1G30680.1GAAGCCCATTTAtoprim domain-containing protein; FUNCTIONS IN: DNA helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: DNA replication, DNA metabolic process; CONTAINS InterPro DOMAIN/s: Toprim subdomain (InterPro:IPR006154), DNA helicase, DnaB-like, C-terminal (InterPro:IPR007694); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G30660.1); Has 875 Blast hits to 869 proteins in 115 species: Archae - 0; Bacteria - 107; Metazoa - 40; Fungi - 0; Plants - 35; Viruses - 109; Other Eukaryotes - 584 (source: NCBI BLink). 
AT1G30825AT1G30825.1AAATGGGCTCAInvolved in trichome maturation. mutant displays enlarged trichomes 
AT1G31360AT1G31360.1AAAAGCCCATTTAEncodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. 
AT1G31360.2AAAAGCCCATTTAEncodes a (d)NTP-dependent 3'->5' DNA helicase. This protein can also disrupt D loop structures and may mediate branch migration of Holliday junctions when tested in vitro. The unwinding activity of the enzyme depends on the presence of divalent cations (Mg2+, Mn2+, or Ca2+, but not Zn2+).(d)NTPs are also required with ATP and dATP supporting the greatest amount of DNA unwinding in vitro. 
AT1G31420AT1G31420.1TAATGGGCCTTAAAAATGGGCCCAATGEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. 
AT1G32490AT1G32490.1TTGGCCCATTTAEncodes a homolog of the yeast PRP2 protein, one of four related DEAH RNA helicases identified as essential cofactors for RNA splicing. 
AT1G32500AT1G32500.1GAAGCCCATTTAGCCCAAACEncodes a member of a heterogenous group of non-intrinsic ATP-binding cassette (ABC) proteins. Members of this group bear no close resemblance to each other nor to representatives of specific ABC protein subfamilies from other organisms. This grouping is arbitrary and will likely change upon acquisition of further data. 
AT1G32580AT1G32580.1ATTGGCCCATTTAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G32990AT1G32990.1TAAATGGGCTTGmutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Plastid Ribosomal Protein L11 
AT1G33330AT1G33330.1TAAATGGGCCAAGCCCApeptide chain release factor, putative; FUNCTIONS IN: translation release factor activity; INVOLVED IN: translational termination; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Class I peptide chain release factor (InterPro:IPR000352); BEST Arabidopsis thaliana protein match is: peptide chain release factor, putative (TAIR:AT1G56350.1); Has 9739 Blast hits to 9739 proteins in 1553 species: Archae - 0; Bacteria - 5377; Metazoa - 210; Fungi - 152; Plants - 96; Viruses - 10; Other Eukaryotes - 3894 (source: NCBI BLink). 
AT1G33410AT1G33410.1TAAATGGGCCGTAsuppressor of auxin resistance1 (SAR1); INVOLVED IN: response to auxin stimulus, mRNA export from nucleus, developmental process; LOCATED IN: nuclear membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 140 Blast hits to 129 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 24; Plants - 26; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G33980AT1G33980.1TAAGCCCAATAACAAGCCCATTTInvolved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) 
AT1G33980.2TAAGCCCAATAACAAGCCCATTTInvolved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) 
AT1G34220AT1G34220.1TGAGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink). 
AT1G34220.2TGAGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35730.1); Has 1839 Blast hits to 806 proteins in 168 species: Archae - 0; Bacteria - 49; Metazoa - 372; Fungi - 160; Plants - 165; Viruses - 1; Other Eukaryotes - 1092 (source: NCBI BLink). 
AT1G44750AT1G44750.1TAAATGGGCTTAMember of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. 
AT1G47250AT1G47250.1ATAAGCCCATTTEncodes 20S proteasome subunit PAF2 (PAF2). 
AT1G51965AT1G51965.1TTAAGGCCCATTTApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: PGR3 (PROTON GRADIENT REGULATION 3) (TAIR:AT4G31850.1); Has 21191 Blast hits to 6126 proteins in 185 species: Archae - 5; Bacteria - 14; Metazoa - 565; Fungi - 542; Plants - 18830; Viruses - 0; Other Eukaryotes - 1235 (source: NCBI BLink). 
AT1G53750AT1G53750.1AAAAAGCCCATTTTACACGTGGG26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, 
AT1G53940AT1G53940.1AAATGGGCEncodes a lipase, has in vitro lipase activity with p-nitrophenyl acetate and p-nitrophenyl butyrate, gene expression induced by hormones, negatively regulates auxin signaling, involved in disease resistance 
AT1G54310AT1G54310.1AAATGGGCCCAATAARNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae - 69; Bacteria - 3053; Metazoa - 33; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 462 (source: NCBI BLink). 
AT1G54360AT1G54360.1GATGGGCCCATTTEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. 
AT1G54360.2GATGGGCCCATTTEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. 
AT1G54360.3GATGGGCCCATTTEncodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. 
AT1G54490AT1G54490.1CCGGCCCAATAAAGCCCATTTAInvolved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. 
AT1G56110AT1G56110.1CCGTTAAATGGGCCTGGCCCATTGNOP56-like protein 
AT1G56190AT1G56190.1TAAAGCCCATTTAphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G56190.2TAAAGCCCATTTAphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G57660AT1G57660.1TATGGCCCAATCAGGCCCATTTA60S ribosomal protein L21 (RPL21E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (TAIR:AT1G57860.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). 
AT1G58200AT1G58200.1GAATGGGCCTAACGATGGGCCCATTTA member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. 
AT1G58200.2GAATGGGCCTAACGATGGGCCCATTTA member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. 
AT1G58210AT1G58210.1AAATGGGCCCATCGTTAGGCCCATTCEMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink). 
AT1G60900AT1G60900.1CAAGCCCATTTAU2 snRNP auxiliary factor large subunit, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: ATU2AF65A; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G36690.1); Has 85440 Blast hits to 35122 proteins in 1401 species: Archae - 56; Bacteria - 10121; Metazoa - 44645; Fungi - 7960; Plants - 5595; Viruses - 646; Other Eukaryotes - 16417 (source: NCBI BLink). 
AT1G63970AT1G63970.1TAAATGGGCTTTAEncodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF 
AT1G63970.2TAAATGGGCTTTAEncodes a protein with 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase activity. The protein's activity was confirmed by heterologous expression of phenotypic complementation of the E. coli ispF mutant. Plants defective in this gene display an albino lethal phenotype.Homolog of E. coli IspF 
AT1G63980AT1G63980.1TAAAGCCCATTTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). 
AT1G63980.2TAAAGCCCATTTAD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 18043 Blast hits to 8896 proteins in 443 species: Archae - 4; Bacteria - 1285; Metazoa - 6367; Fungi - 2641; Plants - 1110; Viruses - 255; Other Eukaryotes - 6381 (source: NCBI BLink). 
AT1G64490AT1G64490.1TCGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42060.1); Has 43 Blast hits to 42 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G64628AT1G64628.1AAGGCCCATTTAUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF57 represents a conserved upstream opening reading frame relative to major ORF AT1G64630.1 
AT1G64630AT1G64630.1AAGGCCCATTTAWITH NO LYSINE KINASE 10 (WNK10); FUNCTIONS IN: transcription factor activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: WNK8 (WITH NO LYSINE (K) KINASE 8); kinase/ protein kinase (TAIR:AT5G41990.1); Has 77185 Blast hits to 76497 proteins in 1905 species: Archae - 28; Bacteria - 5972; Metazoa - 32664; Fungi - 6701; Plants - 16849; Viruses - 382; Other Eukaryotes - 14589 (source: NCBI BLink). 
AT1G64650AT1G64650.1TAAGCCCATTTLOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). 
AT1G64650.2TAAGCCCATTTLOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF791 (InterPro:IPR008509), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27720.1); Has 565 Blast hits to 562 proteins in 197 species: Archae - 7; Bacteria - 312; Metazoa - 76; Fungi - 39; Plants - 85; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). 
AT1G64850AT1G64850.1TAAATGGGCCGTTcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G64850.1TTAAGGCCCATTTGAGCCCAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 2 (InterPro:IPR018249); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G37445.1); Has 40 Blast hits to 40 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G64880AT1G64880.1GAAGCCCATTTribosomal protein S5 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, Golgi apparatus, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: ribosomal protein S5 family protein (TAIR:AT2G33800.1); Has 10105 Blast hits to 8747 proteins in 1649 species: Archae - 225; Bacteria - 3046; Metazoa - 1648; Fungi - 368; Plants - 134; Viruses - 59; Other Eukaryotes - 4625 (source: NCBI BLink). 
AT1G65660AT1G65660.1GCCCATTTAEncodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells. 
AT1G67430AT1G67430.1CAAGGCCCATTTA60S ribosomal protein L17 (RPL17B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22/L17, eukaryotic/archaeal (InterPro:IPR005721), Ribosomal protein L22/L17, conserved site (InterPro:IPR018260); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L17 (RPL17A) (TAIR:AT1G27400.1); Has 1644 Blast hits to 1644 proteins in 483 species: Archae - 235; Bacteria - 361; Metazoa - 438; Fungi - 108; Plants - 104; Viruses - 0; Other Eukaryotes - 398 (source: NCBI BLink). 
AT1G68830AT1G68830.1GAAGCCCATTTASTN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation 
AT1G69680AT1G69680.1AAATGGGCTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Ran-interacting Mog1 protein (InterPro:IPR007681), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 202 Blast hits to 202 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 83; Plants - 25; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). 
AT1G71530AT1G71530.1GAAGCCCATTTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G33770.1); Has 90308 Blast hits to 89264 proteins in 3118 species: Archae - 44; Bacteria - 7740; Metazoa - 39791; Fungi - 8259; Plants - 17488; Viruses - 392; Other Eukaryotes - 16594 (source: NCBI BLink). 
AT1G71530.2GAAGCCCATTTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT1G33770.1); Has 90308 Blast hits to 89264 proteins in 3118 species: Archae - 44; Bacteria - 7740; Metazoa - 39791; Fungi - 8259; Plants - 17488; Viruses - 392; Other Eukaryotes - 16594 (source: NCBI BLink). 
AT1G72020AT1G72020.1TAAATGGGCCTGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 34 Blast hits to 34 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G73230AT1G73230.1AAATGGGCCAnascent polypeptide-associated complex (NAC) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative (TAIR:AT1G17880.1); Has 618 Blast hits to 618 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 331; Fungi - 126; Plants - 89; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT1G73570AT1G73570.1AGCCCATTTsuppressor of lin-12-like protein-related / sel-1 protein-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Sel1-like (InterPro:IPR006597); BEST Arabidopsis thaliana protein match is: suppressor of lin-12-like protein-related / sel-1 protein-related (TAIR:AT1G18260.1); Has 10975 Blast hits to 4576 proteins in 759 species: Archae - 0; Bacteria - 7044; Metazoa - 503; Fungi - 430; Plants - 71; Viruses - 21; Other Eukaryotes - 2906 (source: NCBI BLink). 
AT1G73840AT1G73840.1TAAATGGGCCGGResembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. 
AT1G74270AT1G74270.1GAAGCCCATTT60S ribosomal protein L35a (RPL35aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aA) (TAIR:AT1G07070.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT1G74280AT1G74280.1AAATGGGCTTChydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT1G74290.1); Has 506 Blast hits to 505 proteins in 118 species: Archae - 4; Bacteria - 217; Metazoa - 4; Fungi - 28; Plants - 184; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT1G74470AT1G74470.1AAATGGGCEncodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate. 
AT1G75190AT1G75190.1AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9739 Blast hits to 4019 proteins in 241 species: Archae - 15; Bacteria - 128; Metazoa - 5787; Fungi - 540; Plants - 188; Viruses - 208; Other Eukaryotes - 2873 (source: NCBI BLink). 
AT1G75190.2AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 9739 Blast hits to 4019 proteins in 241 species: Archae - 15; Bacteria - 128; Metazoa - 5787; Fungi - 540; Plants - 188; Viruses - 208; Other Eukaryotes - 2873 (source: NCBI BLink). 
AT1G75330AT1G75330.1AAATGGGCCTAGORNITHINE CARBAMOYLTRANSFERASE (OTC); FUNCTIONS IN: amino acid binding, ornithine carbamoyltransferase activity, carboxyl- or carbamoyltransferase activity; INVOLVED IN: amino acid metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (InterPro:IPR006132), Aspartate/ornithine carbamoyltransferase (InterPro:IPR006130), Aspartate/ornithine carbamoyltransferase, Asp/Orn-binding region (InterPro:IPR006131), Ornithine carbamoyltransferase (InterPro:IPR002292); BEST Arabidopsis thaliana protein match is: aspartate carabmoyltransferase, chloroplast / aspartate transcarbamylase / ATCase (PYRB) (TAIR:AT3G20330.1); Has 11337 Blast hits to 11337 proteins in 1659 species: Archae - 346; Bacteria - 6031; Metazoa - 180; Fungi - 195; Plants - 66; Viruses - 6; Other Eukaryotes - 4513 (source: NCBI BLink). 
AT1G75560AT1G75560.1TAAATGGGCTATTGGGCTTTAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). 
AT1G75560.2TAAATGGGCTATTGGGCTTTAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). 
AT1G75660AT1G75660.1TAAATGGGCTTCEncodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products. 
AT1G76050AT1G76050.1TATGGCCCATTTApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). 
AT1G76050.1TATGGCCCATTTApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). 
AT1G76050.1TTAAGGCCCATTTApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). 
AT1G76050.2TATGGCCCATTTApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). 
AT1G76050.2TATGGCCCATTTApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). 
AT1G76050.2TTAAGGCCCATTTApseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: pseudouridine synthesis; LOCATED IN: chloroplast; EXPRESSED IN: leaf lamina base, shoot, stem, leaf whorl, embryo; EXPRESSED DURING: D bilateral stage; CONTAINS InterPro DOMAIN/s: Pseudouridine synthase, RluD (InterPro:IPR006225), Pseudouridine synthase (InterPro:IPR006145), Pseudouridine synthase, conserved site (InterPro:IPR006224), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: pseudouridine synthase family protein (TAIR:AT3G52260.2); Has 12558 Blast hits to 12546 proteins in 1459 species: Archae - 12; Bacteria - 7400; Metazoa - 221; Fungi - 125; Plants - 119; Viruses - 0; Other Eukaryotes - 4681 (source: NCBI BLink). 
AT1G76200AT1G76200.1AAATGGGCCTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 29; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT1G76730AT1G76730.1AAAAGGCCCATTTA5-formyltetrahydrofolate cyclo-ligase family protein; FUNCTIONS IN: catalytic activity, ATP binding, 5-formyltetrahydrofolate cyclo-ligase activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: 5-formyltetrahydrofolate cyclo-ligase (InterPro:IPR002698); Has 270 Blast hits to 270 proteins in 109 species: Archae - 50; Bacteria - 73; Metazoa - 104; Fungi - 6; Plants - 17; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT1G76740AT1G76740.1TAAATGGGCCTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76840.1); Has 3136 Blast hits to 2432 proteins in 274 species: Archae - 9; Bacteria - 251; Metazoa - 1340; Fungi - 208; Plants - 114; Viruses - 8; Other Eukaryotes - 1206 (source: NCBI BLink). 
AT1G76940AT1G76940.1TAAATGGGCCTTAARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT1G21320.2); Has 450 Blast hits to 448 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 247; Fungi - 119; Plants - 55; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G77060AT1G77060.1TAAAGGCCCATTTmutase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyruvate/Phosphoenolpyruvate kinase, catalytic core (InterPro:IPR015813), Isocitrate lyase and phosphorylmutase, conserved site (InterPro:IPR018523), Isocitrate lyase and phosphorylmutase (InterPro:IPR000918); BEST Arabidopsis thaliana protein match is: mutase family protein (TAIR:AT1G21440.1); Has 6429 Blast hits to 6429 proteins in 855 species: Archae - 72; Bacteria - 2891; Metazoa - 29; Fungi - 318; Plants - 109; Viruses - 0; Other Eukaryotes - 3010 (source: NCBI BLink). 
AT1G77270AT1G77270.1TTCGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07730.1); Has 365 Blast hits to 331 proteins in 76 species: Archae - 0; Bacteria - 25; Metazoa - 174; Fungi - 10; Plants - 59; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). 
AT1G77710AT1G77710.1AAATGGGCCTAAAATGGGCCTGAINVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-like, Ufm1 (InterPro:IPR005375); Has 170 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G78190AT1G78190.1AAAAGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF343 (InterPro:IPR005651); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G22270.1); Has 285 Blast hits to 285 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 117; Fungi - 81; Plants - 34; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT1G79590AT1G79590.1TAAATGGGCCTTAAEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. 
AT1G79590.2TAAATGGGCCTTAAEncodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. 
AT1G80080AT1G80080.1AAATGGGCTCAGCCCAAATEncodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. 
AT1G80270AT1G80270.1AAAAGCCCATTTADNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 5563 Blast hits to 2653 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 76; Plants - 5213; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). 
AT1G80270.2AAAAGCCCATTTADNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 5563 Blast hits to 2653 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 76; Plants - 5213; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). 
AT1G80270.3AAAAGCCCATTTADNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT1G15480.1); Has 5563 Blast hits to 2653 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 76; Plants - 5213; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). 
AT2G01060AT2G01060.1AAATGGGCmyb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G01060.2AAATGGGCmyb family transcription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: myb family transcription factor (TAIR:AT3G13040.2); Has 911 Blast hits to 902 proteins in 37 species: Archae - 0; Bacteria - 1; Metazoa - 0; Fungi - 0; Plants - 902; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G01870AT2G01870.1AAATGGGCCCAATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G02050AT2G02050.1AAATGGGCTTTTGGCCCATATNADH-ubiquinone oxidoreductase B18 subunit, putative; FUNCTIONS IN: NADH dehydrogenase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone, photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NADH-ubiquinone oxidoreductase B18 subunit (InterPro:IPR008698); Has 184 Blast hits to 184 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 97; Fungi - 49; Plants - 29; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G02880AT2G02880.1TTAAGGCCCATTTAmucin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G62270.1); Has 72 Blast hits to 72 proteins in 17 species: Archae - 0; Bacteria - 2; Metazoa - 3; Fungi - 6; Plants - 38; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT2G03140AT2G03140.1TGAGCCCATTTACAAX amino terminal protease family protein; INVOLVED IN: proteolysis; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Abortive infection protein (InterPro:IPR003675); BEST Arabidopsis thaliana protein match is: late embryogenesis abundant protein, putative / LEA protein, putative (TAIR:AT3G50790.1); Has 23018 Blast hits to 13463 proteins in 1126 species: Archae - 80; Bacteria - 6803; Metazoa - 6863; Fungi - 2179; Plants - 631; Viruses - 123; Other Eukaryotes - 6339 (source: NCBI BLink). 
AT2G03270AT2G03270.1AAATGGGCCTAAADNA-binding protein, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA binding, nucleotide binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), DNA helicase, putative (InterPro:IPR004483), DEAD-like helicase, N-terminal (InterPro:IPR014001); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT5G35970.1); Has 4398 Blast hits to 3880 proteins in 634 species: Archae - 141; Bacteria - 1267; Metazoa - 1124; Fungi - 651; Plants - 305; Viruses - 8; Other Eukaryotes - 902 (source: NCBI BLink). 
AT2G04230AT2G04230.1AAAAAGCCCATTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD (InterPro:IPR013596), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G49030.1); Has 1566 Blast hits to 1530 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 1562; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G05920AT2G05920.1AAATGGGCCTGAsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4370 Blast hits to 3848 proteins in 648 species: Archae - 130; Bacteria - 2232; Metazoa - 135; Fungi - 512; Plants - 867; Viruses - 0; Other Eukaryotes - 494 (source: NCBI BLink). 
AT2G11890AT2G11890.1AAATGGGCCAAadenylate cyclase 
AT2G11890.2AAATGGGCCAAadenylate cyclase 
AT2G16365AT2G16365.1GCCCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G16365.2GCCCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G16365.3GCCCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G16365.4GCCCATTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G16510AT2G16510.1AATAGCCCATTTAvacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). 
AT2G16510.1TAAATGGGCTTTAAvacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). 
AT2G17870AT2G17870.1AATAGGCCCATTTcold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink). 
AT2G19270AT2G19270.1AAATGGGCTTTTAAATGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mitotic checkpoint protein PRCC, C-terminal (InterPro:IPR018800); Has 1029 Blast hits to 488 proteins in 117 species: Archae - 0; Bacteria - 14; Metazoa - 432; Fungi - 124; Plants - 39; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). 
AT2G19750AT2G19750.1TTAAGGCCCATTTA40S ribosomal protein S30 (RPS30A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). 
AT2G20330AT2G20330.1TAAATGGGCCTTTAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G43770.1); Has 23940 Blast hits to 14550 proteins in 496 species: Archae - 38; Bacteria - 4162; Metazoa - 9990; Fungi - 4392; Plants - 2081; Viruses - 20; Other Eukaryotes - 3257 (source: NCBI BLink). 
AT2G20360AT2G20360.1CAAGGCCCAGGCCCATTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink). 
AT2G20360.1TAAATGGGCTTAbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: response to salt stress; LOCATED IN: mitochondrion, respiratory chain complex I, membrane; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); Has 3823 Blast hits to 3821 proteins in 711 species: Archae - 40; Bacteria - 1834; Metazoa - 120; Fungi - 89; Plants - 50; Viruses - 0; Other Eukaryotes - 1690 (source: NCBI BLink). 
AT2G20480AT2G20480.1AAATGGGCTTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 7 Blast hits to 7 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G20490AT2G20490.1AAAAAGCCCATTTNOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT2G20490.2AAAAAGCCCATTTNOP10; FUNCTIONS IN: RNA binding; INVOLVED IN: polar nucleus fusion; LOCATED IN: nucleolus, Cajal body; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleolar RNA-binding protein Nop10p (InterPro:IPR007264); Has 254 Blast hits to 254 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 74; Plants - 27; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT2G20830AT2G20830.2AAATGGGCTTCfolic acid binding / transferase; FUNCTIONS IN: folic acid binding, transferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Formiminotransferase, N-terminal (InterPro:IPR012886), Protein of unknown function DUF1715, eukaryotic (InterPro:IPR013179), Formiminotransferase (InterPro:IPR004227); Has 518 Blast hits to 515 proteins in 123 species: Archae - 8; Bacteria - 128; Metazoa - 139; Fungi - 30; Plants - 55; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink). 
AT2G20835AT2G20835.1AAATGGGCTTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15534.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G20890AT2G20890.1TAAATGGGCCTAATChloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane–delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. 
AT2G21060AT2G21060.1TGGCCCATTTglycine-rich protein (AtGRP2b) 
AT2G21190AT2G21190.1CCCGGCCCATTTAER lumen protein retaining receptor family protein; FUNCTIONS IN: ER retention sequence binding, receptor activity; INVOLVED IN: protein retention in ER lumen, protein transport; LOCATED IN: integral to membrane; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: ER lumen protein retaining receptor (InterPro:IPR000133); BEST Arabidopsis thaliana protein match is: ER lumen protein retaining receptor family protein (TAIR:AT4G38790.1); Has 626 Blast hits to 626 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 264; Fungi - 114; Plants - 120; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). 
AT2G21280AT2G21280.1TAAATGGGCCTTAAA nuclear-encoded, plastid-targeted protein (AtSulA) whose overexpression causes severe yet stochastic plastid (shown in chloroplasts and leucoplasts) division defects. The protein does not appear to interact with either AtFtsZ proteins when studied in a yeast two-hybrid system. 
AT2G21290AT2G21290.1TTAAGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 41 Blast hits to 41 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G21830AT2G21830.1AAATGGGCTCADC1 domain-containing protein; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G21850.1); Has 1741 Blast hits to 575 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 78; Fungi - 0; Plants - 1624; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). 
AT2G24490AT2G24490.1CTTAGGCCCATTTEncodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1. 
AT2G24490.2CTTAGGCCCATTTEncodes a component of Replication Protein A. Component of transcriptional gene silencing which does not affect endogenous small RNA accumulation nor DNA methylation. Localized in the nucleus. Involved in DNA repair. Interacts physically with ROS1. 
AT2G24590AT2G24590.1CGGCCCATTTTAAGCCCAAATsplicing factor, putative; FUNCTIONS IN: zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: RNA splicing; LOCATED IN: nucleolus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: SRZ-22; protein binding (TAIR:AT4G31580.2); Has 9855 Blast hits to 8604 proteins in 578 species: Archae - 6; Bacteria - 593; Metazoa - 5438; Fungi - 1074; Plants - 1815; Viruses - 79; Other Eukaryotes - 850 (source: NCBI BLink). 
AT2G25210AT2G25210.1TAAATGGGCCTTTGTGGCCCAAT60S ribosomal protein L39 (RPL39A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 574 Blast hits to 574 proteins in 219 species: Archae - 142; Bacteria - 0; Metazoa - 205; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT2G26140AT2G26140.1TAAGCCCATTTencodes an FtsH protease that is localized to the mitochondrion 
AT2G26530AT2G26530.1AAATGGGCTAAunknown function 
AT2G26530.2AAATGGGCTAAunknown function 
AT2G29360AT2G29360.1GAGGCCCATTTtropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29150.1); Has 83809 Blast hits to 83613 proteins in 2239 species: Archae - 475; Bacteria - 45716; Metazoa - 5149; Fungi - 4359; Plants - 1662; Viruses - 5; Other Eukaryotes - 26443 (source: NCBI BLink). 
AT2G29400AT2G29400.1TAGCCCATTTACAGGCCCAATAAType 1 protein phosphatase, expressed in roots, rosettes and flowers 
AT2G29560AT2G29560.1CTTATTGGGCCTAAAATGGGCTTTTAenolase, putative; FUNCTIONS IN: phosphopyruvate hydratase activity; INVOLVED IN: glycolysis; LOCATED IN: phosphopyruvate hydratase complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Enolase (InterPro:IPR000941); BEST Arabidopsis thaliana protein match is: LOS2; copper ion binding / phosphopyruvate hydratase (TAIR:AT2G36530.1); Has 9375 Blast hits to 9353 proteins in 2216 species: Archae - 179; Bacteria - 3114; Metazoa - 1311; Fungi - 220; Plants - 152; Viruses - 0; Other Eukaryotes - 4399 (source: NCBI BLink). 
AT2G30580AT2G30580.1AAAAGCCCATTTAEncodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. DRIP2 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. 
AT2G31490AT2G31490.1TAAATGGGCTTATGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G32415AT2G32415.1AAATGGGCCTGT3'-5' exonuclease/ nucleic acid binding; FUNCTIONS IN: 3'-5' exonuclease activity, nucleic acid binding; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process; LOCATED IN: intracellular; EXPRESSED IN: shoot apex, cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Helicase and RNase D C-terminal, HRDC (InterPro:IPR002121), 3'-5' exonuclease (InterPro:IPR002562); BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / helicase and RNase D C-terminal domain-containing protein / HRDC domain-containing protein (TAIR:AT5G35910.1); Has 2895 Blast hits to 2797 proteins in 774 species: Archae - 0; Bacteria - 1374; Metazoa - 367; Fungi - 93; Plants - 108; Viruses - 0; Other Eukaryotes - 953 (source: NCBI BLink). 
AT2G32980AT2G32980.1TGGGCTAAGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 31; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G34250AT2G34250.1CAAAGCCCATTTGACCCprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G34250.2CAAAGCCCATTTGACCCprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G36485AT2G36485.1TAAATGGGCCTAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: PCFS4 (PCF11P-SIMILAR PROTEIN 4); zinc ion binding (TAIR:AT4G04885.1); Has 87 Blast hits to 87 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 33; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G36660AT2G36660.1AAATGGGCpolyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins. 
AT2G36720AT2G36720.1AAATGGGCATTAGGCCCAATTGPHD finger transcription factor, putative; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G27980.1); Has 3291 Blast hits to 2704 proteins in 149 species: Archae - 0; Bacteria - 0; Metazoa - 2475; Fungi - 268; Plants - 355; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). 
AT2G36930AT2G36930.1TAAATGGGCCTTGzinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type (InterPro:IPR007087); Has 506 Blast hits to 289 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 257; Fungi - 153; Plants - 39; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). 
AT2G37340AT2G37340.1GAAGCCCATTTencodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. 
AT2G37340.1GAAGCCCATTTAencodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. 
AT2G37340.1TAAATGGGCCTTATencodes an RS-containing Zinc knuckle protein with molecular mass of 33kDa that is localized to nuclear specks. 
AT2G37660AT2G37660.1ATGGCCCATTTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: defense response to bacterium; LOCATED IN: thylakoid, apoplast, chloroplast stroma, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT5G02240.1); Has 1711 Blast hits to 1685 proteins in 445 species: Archae - 20; Bacteria - 1147; Metazoa - 3; Fungi - 23; Plants - 245; Viruses - 0; Other Eukaryotes - 273 (source: NCBI BLink). 
AT2G38290AT2G38290.2AAATGGGCTencodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. 
AT2G39280AT2G39280.1AAATGGGCTRAB GTPase activator; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RabGAP/TBC domain-containing protein (TAIR:AT3G55020.1); Has 4701 Blast hits to 4645 proteins in 231 species: Archae - 15; Bacteria - 84; Metazoa - 2806; Fungi - 708; Plants - 245; Viruses - 9; Other Eukaryotes - 834 (source: NCBI BLink). 
AT2G39290AT2G39290.1AGCCCATTTEncodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. 
AT2G39460AT2G39460.1AAAAGGCCCATTTAEncodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. 
AT2G39460.2AAAAGGCCCATTTAEncodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. 
AT2G39930AT2G39930.1TTAAGGCCCGGCCCTAAAGCCCATTTAEncodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. 
AT2G40316AT2G40316.1TAAATGGGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G40316.2TAAATGGGCCGTTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 100 Blast hits to 100 proteins in 36 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 39; Plants - 20; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G41780AT2G41780.1TAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G41780.2TAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G41840AT2G41840.1TCAGGCCCATTTAAGCCCACT40S ribosomal protein S2 (RPS2C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S5, eukaryotic/archaeal (InterPro:IPR005711), Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal, conserved site (InterPro:IPR018192), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S2 (RPS2B) (TAIR:AT1G59359.1); Has 9044 Blast hits to 7622 proteins in 1716 species: Archae - 183; Bacteria - 3055; Metazoa - 2026; Fungi - 746; Plants - 385; Viruses - 17; Other Eukaryotes - 2632 (source: NCBI BLink). 
AT2G42210AT2G42210.1TAAATGGGCTAHomologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. 
AT2G42210.2TAAATGGGCTAHomologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. 
AT2G42210.3TAAATGGGCTAHomologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. 
AT2G42210.4TAAATGGGCTAHomologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. 
AT2G42230AT2G42230.1CTTAATGGGCCGTTTAAAGCCCATTTAtubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT2G42230.2CTTAATGGGCCGTTTAAAGCCCATTTAtubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT3G57890.1); Has 235 Blast hits to 235 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 135; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT2G43720AT2G43720.1TAAATGGGCCCAATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31725.1); Has 203 Blast hits to 203 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 158; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT2G44270AT2G44270.1CAAAGCCCATTTATGGCCCACAATP binding; FUNCTIONS IN: ATP binding; INVOLVED IN: tRNA processing; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Uncharacterised protein family UPF0021 (InterPro:IPR000541), PP-loop (InterPro:IPR011063), 2-thiocytidine tRNA biosynthesis protein, TtcA (InterPro:IPR012089); BEST Arabidopsis thaliana protein match is: ATP binding (TAIR:AT1G76170.1); Has 3072 Blast hits to 3023 proteins in 1040 species: Archae - 205; Bacteria - 2091; Metazoa - 125; Fungi - 122; Plants - 38; Viruses - 0; Other Eukaryotes - 491 (source: NCBI BLink). 
AT2G44650AT2G44650.1TAAATGGGCTEncodes a chloroplast-localized chaperonin 10 whose mRNA is expressed in leaves and stems but not roots. 
AT2G44680AT2G44680.1AAAAGCCCATTTEncodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock. 
AT2G44680.2AAAAGCCCATTTEncodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock. 
AT2G45460AT2G45460.1GTGGCCCATTTAforkhead-associated domain-containing protein / FHA domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253), TSC-22 / Dip / Bun (InterPro:IPR000580); BEST Arabidopsis thaliana protein match is: CIP1 (COP1-INTERACTIVE PROTEIN 1); protein binding (TAIR:AT5G41790.1); Has 72255 Blast hits to 40875 proteins in 1850 species: Archae - 633; Bacteria - 10532; Metazoa - 36222; Fungi - 5255; Plants - 2524; Viruses - 286; Other Eukaryotes - 16803 (source: NCBI BLink). 
AT2G45530AT2G45530.1GTAGGCCCATTTAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G37950.1); Has 621 Blast hits to 621 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 262; Fungi - 5; Plants - 312; Viruses - 3; Other Eukaryotes - 39 (source: NCBI BLink). 
AT2G45730AT2G45730.1TAAATGGGCTeukaryotic initiation factor 3 gamma subunit family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation, regulation of translational initiation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic initiation factor 3, gamma subunit (InterPro:IPR007316), tRNA (adenine-N(1)-)-methyltransferase, non-catalytic TRM6 subunit (InterPro:IPR017423); Has 291 Blast hits to 275 proteins in 145 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 98; Plants - 21; Viruses - 0; Other Eukaryotes - 68 (source: NCBI BLink). 
AT2G46230AT2G46230.1ATTAGGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT2G46230.2ATTAGGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984), Nucleotide binding protein, PINc (InterPro:IPR006596); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G26530.1); Has 493 Blast hits to 493 proteins in 165 species: Archae - 21; Bacteria - 0; Metazoa - 192; Fungi - 143; Plants - 53; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT2G46370AT2G46370.1AAATGGGCEncodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. 
AT2G46370.2AAATGGGCEncodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. 
AT2G46370.3AAATGGGCEncodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. 
AT2G46520AT2G46520.1AATAGCCCATTTAACCGACTTAcellular apoptosis susceptibility protein, putative / importin-alpha re-exporter, putative; FUNCTIONS IN: protein transporter activity, importin-alpha export receptor activity, binding; INVOLVED IN: intracellular protein transport, cell proliferation, protein import into nucleus, docking; LOCATED IN: nucleus, nuclear pore, membrane, cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Importin-beta, N-terminal (InterPro:IPR001494), CAS/CSE, C-terminal (InterPro:IPR005043), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024), Exportin, Cse1-like (InterPro:IPR013713); BEST Arabidopsis thaliana protein match is: binding / protein transporter (TAIR:AT3G59020.2); Has 841 Blast hits to 834 proteins in 152 species: Archae - 0; Bacteria - 0; Metazoa - 412; Fungi - 251; Plants - 70; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT2G47170AT2G47170.1TAAATGGGCCGAATTGGGCTGAGene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT2G47790AT2G47790.1TAAATGGGCCGAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 8923 Blast hits to 5742 proteins in 332 species: Archae - 8; Bacteria - 1962; Metazoa - 3030; Fungi - 2021; Plants - 501; Viruses - 0; Other Eukaryotes - 1401 (source: NCBI BLink). 
AT2G47840AT2G47840.1TATAGGCCCATTTAtic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). 
AT2G47940AT2G47940.1AAATGGGCEncodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. 
AT2G47940.2AAATGGGCEncodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. 
AT2G48100AT2G48100.1AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT2G48100.2AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT2G48100.3AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT2G48100.4AAATGGGCCTTTAAexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT2G48160AT2G48160.1TAAATGGGCCATEXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G63070.1); Has 1292 Blast hits to 1135 proteins in 175 species: Archae - 2; Bacteria - 174; Metazoa - 679; Fungi - 194; Plants - 113; Viruses - 2; Other Eukaryotes - 128 (source: NCBI BLink). 
AT3G01320AT3G01320.1TAAATGGGCCTATTEncodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190). 
AT3G01520AT3G01520.1AAATGGGCTAAuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G14680.1); Has 1147 Blast hits to 1145 proteins in 292 species: Archae - 54; Bacteria - 658; Metazoa - 30; Fungi - 22; Plants - 354; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT3G01560AT3G01560.1TTCGGCCCATTTAproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Protein of unknown function DUF1421 (InterPro:IPR010820), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT5G14540.1); Has 76923 Blast hits to 40691 proteins in 1566 species: Archae - 110; Bacteria - 8440; Metazoa - 31149; Fungi - 13515; Plants - 10280; Viruses - 1804; Other Eukaryotes - 11625 (source: NCBI BLink). 
AT3G01700AT3G01700.1GCCCATTTEncodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. 
AT3G02050AT3G02050.1TAAATGGGCCTTGpotassium transporter KUP3p (KUP3) 
AT3G02065AT3G02065.1AAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.1TATGGCCCAGTAAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.2AAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.2TATGGCCCAGTAAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.3AAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.3TATGGCCCAGTAAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02555AT3G02555.1AAATGGGCCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G02560AT3G02560.1TTTAACGGCCCATTT40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). 
AT3G02560.2TTTAACGGCCCATTT40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). 
AT3G03010AT3G03010.1AAATGGGCCGTTaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae - 158; Bacteria - 4; Metazoa - 158; Fungi - 86; Plants - 40; Viruses - 8; Other Eukaryotes - 171 (source: NCBI BLink). 
AT3G03010.2AAATGGGCCGTTaminoacyl-tRNA hydrolase; FUNCTIONS IN: aminoacyl-tRNA hydrolase activity; INVOLVED IN: translation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidyl-tRNA hydrolase, PTH2 (InterPro:IPR002833); BEST Arabidopsis thaliana protein match is: aminoacyl-tRNA hydrolase (TAIR:AT5G16870.1); Has 625 Blast hits to 625 proteins in 230 species: Archae - 158; Bacteria - 4; Metazoa - 158; Fungi - 86; Plants - 40; Viruses - 8; Other Eukaryotes - 171 (source: NCBI BLink). 
AT3G03020AT3G03020.1AACGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03020.2AACGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03150AT3G03150.1AAATGGGCTTAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03160AT3G03160.1TCAGCCCATTTAAGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03210AT3G03210.1TAAATGGGCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03210.1TGGGCTAAATGGGCTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03600AT3G03600.1AAATGGGCCGGStructural component of the mitochondrial ribosome small subunit 
AT3G03610AT3G03610.1CCGGCCCATTTphagocytosis and cell motility protein ELMO1-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: phagocytosis; LOCATED IN: cytoskeleton; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Engulfment and cell motility, ELMO (InterPro:IPR006816); BEST Arabidopsis thaliana protein match is: phagocytosis and cell motility protein ELMO1-related (TAIR:AT1G03620.1); Has 636 Blast hits to 636 proteins in 97 species: Archae - 0; Bacteria - 0; Metazoa - 422; Fungi - 25; Plants - 106; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). 
AT3G04160AT3G04160.1CTAATGGGCCTAATTAAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 1599 Blast hits to 1235 proteins in 157 species: Archae - 0; Bacteria - 45; Metazoa - 652; Fungi - 193; Plants - 164; Viruses - 0; Other Eukaryotes - 545 (source: NCBI BLink). 
AT3G04620AT3G04620.1CTTAGGCCCATTTAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT3G04620.1TCAGGCCCATTTAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Alba, DNA/RNA-binding protein (InterPro:IPR002775), Uncharacterised conserved protein UCP030333, DNA/RNA-binding Alba-related (InterPro:IPR014560); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT1G29250.1); Has 89 Blast hits to 89 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT3G04770AT3G04770.1TTTTGGGCTTGAAAGCCCATTTA40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). 
AT3G04770.2TTTTGGGCTTGAAAGCCCATTTA40S ribosomal protein SA B (RPSAb); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S2 (InterPro:IPR001865), Ribosomal protein S2, conserved site (InterPro:IPR018130), Ribosomal protein S2, eukaryotic/archaeal (InterPro:IPR005707); BEST Arabidopsis thaliana protein match is: P40; structural constituent of ribosome (TAIR:AT1G72370.2); Has 2091 Blast hits to 2089 proteins in 628 species: Archae - 182; Bacteria - 757; Metazoa - 444; Fungi - 181; Plants - 133; Viruses - 0; Other Eukaryotes - 394 (source: NCBI BLink). 
AT3G05020AT3G05020.1AAATGGGCTGAencodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. 
AT3G05590AT3G05590.1CTAAGCCCATTTEncodes cytoplasmic ribosomal protein L18. 
AT3G05590.1TAAATGGGCCAATEncodes cytoplasmic ribosomal protein L18. 
AT3G05730AT3G05730.1AAATGGGCTEncodes a defensin-like (DEFL) family protein. 
AT3G06310AT3G06310.1AAATGGGCTATTNADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G06310.2AAATGGGCTATTNADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G06320AT3G06320.1AATAGCCCATTTribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). 
AT3G07100AT3G07100.1TAAATGGGCTprotein transport protein Sec24, putative; FUNCTIONS IN: protein binding, transporter activity, zinc ion binding; INVOLVED IN: intracellular protein transport, transport, ER to Golgi vesicle-mediated transport; LOCATED IN: COPII vesicle coat; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec23/Sec24 helical region (InterPro:IPR006900), Sec23/Sec24 beta-sandwich (InterPro:IPR012990), Sec23/Sec24 trunk region (InterPro:IPR006896), Zinc finger, Sec23/Sec24-type (InterPro:IPR006895), Gelsolin region (InterPro:IPR007123); BEST Arabidopsis thaliana protein match is: CEF (clone eighty-four); protein binding / transporter/ zinc ion binding (TAIR:AT3G44340.1); Has 74720 Blast hits to 37673 proteins in 1279 species: Archae - 56; Bacteria - 8492; Metazoa - 38339; Fungi - 10824; Plants - 6948; Viruses - 1820; Other Eukaryotes - 8241 (source: NCBI BLink). 
AT3G08630AT3G08630.1AAATGGGCCCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: alphavirus core protein family (TAIR:AT3G08640.1); Has 3471 Blast hits to 1913 proteins in 226 species: Archae - 0; Bacteria - 450; Metazoa - 1700; Fungi - 130; Plants - 787; Viruses - 19; Other Eukaryotes - 385 (source: NCBI BLink). 
AT3G08640AT3G08640.1CGCACGTGGGAAATGGGCCGATalphavirus core protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08630.1); Has 10912 Blast hits to 4701 proteins in 450 species: Archae - 4; Bacteria - 2405; Metazoa - 4145; Fungi - 556; Plants - 2369; Viruses - 93; Other Eukaryotes - 1340 (source: NCBI BLink). 
AT3G08780AT3G08780.1GCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G08780.2GCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G09080AT3G09080.1TTATGGGCCCATTTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae - 36; Bacteria - 2713; Metazoa - 3924; Fungi - 1952; Plants - 817; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink). 
AT3G09085AT3G09085.1AAATGGGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink). 
AT3G09200AT3G09200.1TAAATGGGCCTAAT60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink). 
AT3G09200.2TAAATGGGCCTAAT60S acidic ribosomal protein P0 (RPP0B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to salt stress, response to cold, translation; LOCATED IN: in 7 components; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813), Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 1212 Blast hits to 1209 proteins in 357 species: Archae - 223; Bacteria - 1; Metazoa - 420; Fungi - 182; Plants - 109; Viruses - 0; Other Eukaryotes - 277 (source: NCBI BLink). 
AT3G09720AT3G09720.1ATTTGGGCTTTAATAGGCCCATTTADEAD/DEAH box helicase, putative; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ethylene-responsive DEAD box RNA helicase, putative (RH30) (TAIR:AT5G63120.2); Has 31352 Blast hits to 30822 proteins in 1800 species: Archae - 599; Bacteria - 13582; Metazoa - 5089; Fungi - 3376; Plants - 1453; Viruses - 31; Other Eukaryotes - 7222 (source: NCBI BLink). 
AT3G09850AT3G09850.1TACGTGGCCCATTTD111/G-patch domain-containing protein; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); Has 3479 Blast hits to 2376 proteins in 234 species: Archae - 15; Bacteria - 783; Metazoa - 1588; Fungi - 375; Plants - 208; Viruses - 9; Other Eukaryotes - 501 (source: NCBI BLink). 
AT3G09860AT3G09860.1AAATGGGCCACGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G10630AT3G10630.1TAAATGGGCCATglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 2500 Blast hits to 2492 proteins in 519 species: Archae - 97; Bacteria - 1438; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 3; Other Eukaryotes - 935 (source: NCBI BLink). 
AT3G11730AT3G11730.1TCGGCCCATTTAEncodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. 
AT3G11745AT3G11745.1GCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G12930AT3G12930.1ACAGGCCCATTTINVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Iojap-related protein (InterPro:IPR004394); Has 2517 Blast hits to 2517 proteins in 833 species: Archae - 0; Bacteria - 1551; Metazoa - 22; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 909 (source: NCBI BLink). 
AT3G13050AT3G13050.1AAATGGGCCTTACtransporter-related; FUNCTIONS IN: carbohydrate transmembrane transporter activity, transporter activity, sugar:hydrogen symporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Sugar transporter, conserved site (InterPro:IPR005829), Major facilitator superfamily MFS-1 (InterPro:IPR011701), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: AtOCT4 (Arabidopsis thaliana ORGANIC CATION/CARNITINE TRANSPORTER4); carbohydrate transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT3G20660.1); Has 24061 Blast hits to 23627 proteins in 1387 species: Archae - 383; Bacteria - 12067; Metazoa - 4488; Fungi - 4369; Plants - 1324; Viruses - 0; Other Eukaryotes - 1430 (source: NCBI BLink). 
AT3G14067AT3G14067.1GCCCATTTsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast, plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4847 Blast hits to 4214 proteins in 722 species: Archae - 147; Bacteria - 2629; Metazoa - 66; Fungi - 489; Plants - 902; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). 
AT3G14390AT3G14390.1AAATGGGCCAdiaminopimelate decarboxylase, putative / DAP carboxylase, putative; FUNCTIONS IN: diaminopimelate decarboxylase activity; INVOLVED IN: lysine biosynthetic process via diaminopimelate; LOCATED IN: chloroplast; EXPRESSED IN: guard cell, cultured cell; CONTAINS InterPro DOMAIN/s: Diaminopimelate decarboxylase (InterPro:IPR002986), Alanine racemase/group IV decarboxylase, C-terminal (InterPro:IPR009006), Orn/DAP/Arg decarboxylase 2 (InterPro:IPR000183); BEST Arabidopsis thaliana protein match is: diaminopimelate decarboxylase, putative / DAP carboxylase, putative (TAIR:AT5G11880.1); Has 9248 Blast hits to 9226 proteins in 1454 species: Archae - 98; Bacteria - 4313; Metazoa - 392; Fungi - 133; Plants - 315; Viruses - 27; Other Eukaryotes - 3970 (source: NCBI BLink). 
AT3G14730AT3G14730.1CAAGCCCATTTApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 48; Plants - 14121; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). 
AT3G14730.1TAAATGGGCCTATTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 14433 Blast hits to 4909 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 53; Fungi - 48; Plants - 14121; Viruses - 0; Other Eukaryotes - 211 (source: NCBI BLink). 
AT3G14860AT3G14860.1TAAATGGGCNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). 
AT3G14860.2TAAATGGGCNHL repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NHL repeat (InterPro:IPR001258), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: NHL repeat-containing protein (TAIR:AT1G70280.2); Has 1587 Blast hits to 698 proteins in 116 species: Archae - 75; Bacteria - 803; Metazoa - 45; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 573 (source: NCBI BLink). 
AT3G15180AT3G15180.1TAAATGGGCCAGGCCTTATproteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae - 0; Bacteria - 1; Metazoa - 56; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G15180.1TAAATGGGCCAGGCCTTATproteasome-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 82 Blast hits to 82 proteins in 33 species: Archae - 0; Bacteria - 1; Metazoa - 56; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G15352AT3G15352.1AAATGGGCCTAGCCCACTEncodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex. 
AT3G16080AT3G16080.1CCAGGCCCATTTA60S ribosomal protein L37 (RPL37C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37e, conserved site (InterPro:IPR018267), Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37e (InterPro:IPR001569), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37 (RPL37B) (TAIR:AT1G52300.1); Has 707 Blast hits to 707 proteins in 247 species: Archae - 202; Bacteria - 0; Metazoa - 220; Fungi - 103; Plants - 72; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). 
AT3G16780AT3G16780.1GTAGGCCCATTTA60S ribosomal protein L19 (RPL19B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19/L19e (InterPro:IPR000196), Ribosomal protein L19/L19e, domain 3 (InterPro:IPR015974), Ribosomal protein L19/L19e, domain 1 (InterPro:IPR015972); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L19 (RPL19C) (TAIR:AT4G02230.1); Has 848 Blast hits to 848 proteins in 295 species: Archae - 206; Bacteria - 0; Metazoa - 265; Fungi - 106; Plants - 93; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 
AT3G16950AT3G16950.1AAATGGGCTAencodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. 
AT3G16950.2AAATGGGCTAencodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. 
AT3G17300AT3G17300.1TAAATGGGCCGTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G17300.2TAAATGGGCCGTTEXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 28 Blast hits to 28 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G17590AT3G17590.1TGAGCCCATTTAAAGCCCACTAEncodes the Arabidopsis homologue of yeast SNF5 and represents a conserved subunit of plant SWI/SNF complexes. 
AT3G17890AT3G17890.1TAAATGGGCTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 13 Blast hits to 13 proteins in 6 species: Archae - 0; Bacteria - 4; Metazoa - 5; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G17900AT3G17900.1AGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 25 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G17930AT3G17930.1TTGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 195 Blast hits to 195 proteins in 62 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G18030AT3G18030.1ATGGCCCATTTflavin mononucleotide flavoprotein involved in salt and osmotic tolerance HAL3A encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis. HAL3A is predominant over another gene with the presumably same function (HAL3B). 
AT3G18130AT3G18130.1AGAGGCCCATTTAEncodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1C has no phenotype on its own and probably acts redundantly with RACK1A and RACK1B. 
AT3G18190AT3G18190.1ACAGGCCCATTTAchaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), Chaperonin TCP-1, conserved site (InterPro:IPR002194), T-complex protein 1, delta subunit (InterPro:IPR012717); BEST Arabidopsis thaliana protein match is: T-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative (TAIR:AT1G24510.1); Has 14434 Blast hits to 14373 proteins in 2596 species: Archae - 394; Bacteria - 6460; Metazoa - 1798; Fungi - 981; Plants - 478; Viruses - 2; Other Eukaryotes - 4321 (source: NCBI BLink). 
AT3G18380AT3G18380.1AAATGGGCCTTTAATGGGsequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G18380.2AAATGGGCCTTTAATGGGsequence-specific DNA binding / transcription factor; FUNCTIONS IN: transcription factor activity, sequence-specific DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G15215.2); Has 44 Blast hits to 42 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G18390AT3G18390.1CCCATTAAAGGCCCATTTembryo defective 1865 (EMB1865); FUNCTIONS IN: RNA binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT3G23070.1); Has 1149 Blast hits to 1011 proteins in 124 species: Archae - 5; Bacteria - 10; Metazoa - 293; Fungi - 119; Plants - 305; Viruses - 46; Other Eukaryotes - 371 (source: NCBI BLink). 
AT3G19130AT3G19130.1TAAATGGGCCCRNA-binding protein 47B (ATRBP47B); FUNCTIONS IN: RNA binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP47A (Arabidopsis thaliana RNA-binding protein 47a); RNA binding (TAIR:AT1G49600.1); Has 30014 Blast hits to 17093 proteins in 630 species: Archae - 14; Bacteria - 1495; Metazoa - 16452; Fungi - 3232; Plants - 4155; Viruses - 9; Other Eukaryotes - 4657 (source: NCBI BLink). 
AT3G20050AT3G20050.1AAATGGGCTTTGEncodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1). 
AT3G20270AT3G20270.1AAATGGGCTTTTTlipid-binding serum glycoprotein family protein; FUNCTIONS IN: lipid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Bactericidal permeability-increasing protein, alpha/beta domain (InterPro:IPR017943), Lipid-binding serum glycoprotein, N-terminal (InterPro:IPR017942), Lipid-binding serum glycoprotein, C-terminal (InterPro:IPR001124); BEST Arabidopsis thaliana protein match is: lipid-binding serum glycoprotein family protein (TAIR:AT1G04970.1); Has 353 Blast hits to 347 proteins in 49 species: Archae - 2; Bacteria - 0; Metazoa - 298; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT3G21110AT3G21110.1TTGGCCCATTTA5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. 
AT3G21110.2TTGGCCCATTTA5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. 
AT3G21210AT3G21210.1TCAGCCCATTTTAGGCCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade, response to stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), UspA (InterPro:IPR006016), Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, PHD-type (InterPro:IPR001965), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT1G34480.1); Has 1530 Blast hits to 740 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 1494; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT3G21670AT3G21670.1GCCCATTTnitrate transporter (NTP3); FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: nitrate transporter (NTP2) (TAIR:AT2G26690.1); Has 4540 Blast hits to 4334 proteins in 779 species: Archae - 0; Bacteria - 2064; Metazoa - 555; Fungi - 289; Plants - 1121; Viruses - 0; Other Eukaryotes - 511 (source: NCBI BLink). 
AT3G22630AT3G22630.1AAAAGCCCATTTEncodes 20S proteasome beta subunit PBD1 (PBD1). 
AT3G22630.1TAAATGGGCCTTATEncodes 20S proteasome beta subunit PBD1 (PBD1). 
AT3G23490AT3G23490.1CCCATTTAAAAGCCCATTTAcyanase 
AT3G23490.1TCAGCCCATTTAcyanase 
AT3G24820AT3G24820.1CCAGGCCCATTTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 97 Blast hits to 97 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G24830AT3G24830.1AAATGGGCCTGG60S ribosomal protein L13A (RPL13aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aA) (TAIR:AT3G07110.1); Has 1473 Blast hits to 1473 proteins in 438 species: Archae - 212; Bacteria - 283; Metazoa - 292; Fungi - 127; Plants - 164; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink). 
AT3G25800AT3G25800.1TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit 
AT3G25800.2TGGGCCAAAAGGCCCGTTAAAGCCCATTTAone of three genes encoding the protein phosphatase 2A regulatory subunit 
AT3G26410AT3G26410.1TAAATGGGCTTTATTGGGCCCATGmethyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G26420AT3G26420.1CATGGGCCCAATAAAGCCCATTTAZinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. 
AT3G27430AT3G27430.1AAAAGGCCCATTTAEncodes 20S proteasome beta subunit PBB1 (PBB1). 
AT3G27430.1TAAATGGGCTCAEncodes 20S proteasome beta subunit PBB1 (PBB1). 
AT3G27430.2AAAAGGCCCATTTAEncodes 20S proteasome beta subunit PBB1 (PBB1). 
AT3G27430.2TAAATGGGCTCAEncodes 20S proteasome beta subunit PBB1 (PBB1). 
AT3G27530AT3G27530.1TAAATGGGCCCATATThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC6 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (225 aa) portion of the protein. 
AT3G27630AT3G27630.1ATGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40460.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G29160AT3G29160.1AAATGGGCencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. 
AT3G29160.2AAATGGGCencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. 
AT3G29160.3AAATGGGCencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. 
AT3G46020AT3G46020.1CTTAATGGCCCATTTARNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink). 
AT3G46020.1TAAGCCCATTTRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G59860.1); Has 20832 Blast hits to 15264 proteins in 631 species: Archae - 8; Bacteria - 979; Metazoa - 12428; Fungi - 2358; Plants - 2944; Viruses - 0; Other Eukaryotes - 2115 (source: NCBI BLink). 
AT3G46030AT3G46030.1CTTAATGGCCCATTTAHTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink). 
AT3G46030.1TAAGCCCATTTHTB11; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: HTB9; DNA binding (TAIR:AT3G45980.1); Has 2721 Blast hits to 2706 proteins in 276 species: Archae - 0; Bacteria - 1; Metazoa - 1863; Fungi - 166; Plants - 361; Viruses - 0; Other Eukaryotes - 330 (source: NCBI BLink). 
AT3G46040AT3G46040.1AAATGGGCCTAATRegulated by TCP20. 
AT3G46040.1AAATGGGCTTARegulated by TCP20. 
AT3G46040.1TAAATGGGCCATTAAGRegulated by TCP20. 
AT3G46310AT3G46310.1GAAGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G46310.1TAAATGGGCCTAAGCCCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G46520AT3G46520.1CTTAGGCCCAAATGGGCTCAMember of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. 
AT3G46790AT3G46790.1AAGGCCCATTTEncodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation. 
AT3G47120AT3G47120.1TAAATGGGCCTCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT5G19960.1); Has 20793 Blast hits to 16950 proteins in 655 species: Archae - 10; Bacteria - 1203; Metazoa - 11844; Fungi - 2178; Plants - 3009; Viruses - 0; Other Eukaryotes - 2549 (source: NCBI BLink). 
AT3G47960AT3G47960.1AAATGGGCCTACproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT5G62680.1); Has 2355 Blast hits to 2218 proteins in 361 species: Archae - 0; Bacteria - 385; Metazoa - 535; Fungi - 246; Plants - 1124; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT3G49000AT3G49000.1AAATGGGCTAARNA polymerase III subunit RPC82 family protein; FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA polymerase III subunit RPC82-related, helix-turn-helix (InterPro:IPR013197), RNA polymerase III Rpc82, C -terminal (InterPro:IPR008806); Has 175 Blast hits to 170 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 89; Fungi - 45; Plants - 23; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT3G49470AT3G49470.1AAATGGGCNASCENT POLYPEPTIDE-ASSOCIATED COMPLEX SUBUNIT ALPHA-LIKE PROTEIN 2 (NACA2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Nascent polypeptide-associated complex, alpha subunit (InterPro:IPR016641), Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide associated complex alpha chain protein, putative / alpha-NAC, putative (TAIR:AT4G10480.1); Has 1168 Blast hits to 1151 proteins in 231 species: Archae - 23; Bacteria - 6; Metazoa - 522; Fungi - 246; Plants - 124; Viruses - 7; Other Eukaryotes - 240 (source: NCBI BLink). 
AT3G49500AT3G49500.1TAAATGGGCCTATEncodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance. 
AT3G49560AT3G49560.1TAAATGGGCTTTTTTCAGGCCCAGmitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: in 6 components; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT5G24650.1); Has 56 Blast hits to 54 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G49800AT3G49800.1CTAAGCCCATTTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G50590AT3G50590.1TTAAAGCCCATTTAGGCCCATTAAACGACAnucleotide binding; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1880 Blast hits to 1646 proteins in 270 species: Archae - 0; Bacteria - 344; Metazoa - 848; Fungi - 287; Plants - 145; Viruses - 23; Other Eukaryotes - 233 (source: NCBI BLink). 
AT3G51940AT3G51940.1ATTAGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G03990.1); Has 134 Blast hits to 107 proteins in 33 species: Archae - 0; Bacteria - 32; Metazoa - 27; Fungi - 16; Plants - 34; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT3G52420AT3G52420.1GAAGCCCAAACCGGCCCATTTencodes a 7 kDa chloroplast outer envelope membrane protein. 
AT3G52480AT3G52480.1AAATGGGCCGTTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; Has 11 Blast hits to 11 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G52730AT3G52730.1AAATGGGCTTAubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G52730.1TAAATGGGCTAubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrial envelope, mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinol-cytochrome C reductase, UQCRX/QCR9-like (InterPro:IPR008027); Has 46 Blast hits to 46 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 16; Plants - 27; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G52750AT3G52750.1TATAGGCCCATTTANuclear gene that encodes a plastidial division protein (FtsZ2-2). 
AT3G52860AT3G52860.1TAAATGGGCCCCCATTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 68 Blast hits to 68 proteins in 28 species: Archae - 0; Bacteria - 2; Metazoa - 36; Fungi - 13; Plants - 13; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G52870AT3G52870.1AAATGGGCCATcalmodulin-binding family protein; FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: calmodulin-binding family protein (TAIR:AT3G13600.1); Has 194 Blast hits to 147 proteins in 38 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 80; Plants - 105; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G54360AT3G54360.1CAGGCCCATTTAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); Has 679 Blast hits to 624 proteins in 99 species: Archae - 16; Bacteria - 83; Metazoa - 469; Fungi - 12; Plants - 26; Viruses - 8; Other Eukaryotes - 65 (source: NCBI BLink). 
AT3G54860AT3G54860.1TGAGGCCCATTTCTAAGCCCATTTAHomologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. 
AT3G54860.2TGAGGCCCATTTCTAAGCCCATTTAHomologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. 
AT3G54920AT3G54920.1GCCCATTTAPowdery mildew resistant mutant encodes a pectate lyase-like protein 
AT3G55170AT3G55170.1TGAGGCCCATTTA60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT3G55170.1TTAAGGCCCATTTA60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT3G55170.2TGAGGCCCATTTA60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT3G55170.2TTAAGGCCCATTTA60S ribosomal protein L35 (RPL35C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35A) (TAIR:AT3G09500.1); Has 875 Blast hits to 875 proteins in 318 species: Archae - 116; Bacteria - 162; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT3G55460AT3G55460.1AAAACGCGATAAGGCCAAAAGCCCATTTAencodes an SC35-like splicing factor that is localized to nuclear specks. 
AT3G55460.1TAAATGGGCCAAencodes an SC35-like splicing factor that is localized to nuclear specks. 
AT3G56720AT3G56720.1TAAATGGGCTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5618 Blast hits to 4117 proteins in 284 species: Archae - 6; Bacteria - 147; Metazoa - 3194; Fungi - 606; Plants - 492; Viruses - 13; Other Eukaryotes - 1160 (source: NCBI BLink). 
AT3G57030AT3G57030.1AAATGGGCTTCstrictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 821 Blast hits to 814 proteins in 170 species: Archae - 1; Bacteria - 197; Metazoa - 197; Fungi - 12; Plants - 301; Viruses - 0; Other Eukaryotes - 113 (source: NCBI BLink). 
AT3G57440AT3G57440.1TAAATGGGCCATAAGGCCunknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G57480AT3G57480.1TAAATGGGCCTGTzinc finger (C2H2 type, AN1-like) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type, AN1-like) family protein (TAIR:AT2G41835.1); Has 368 Blast hits to 368 proteins in 124 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 75; Plants - 47; Viruses - 0; Other Eukaryotes - 49 (source: NCBI BLink). 
AT3G57890AT3G57890.1AAATGGGCCTCTtubulin-specific chaperone C-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CARP motif (InterPro:IPR006599), C-CAP/cofactor C-like domain (InterPro:IPR017901), Tubulin binding cofactor C (InterPro:IPR012945); BEST Arabidopsis thaliana protein match is: tubulin-specific chaperone C-related (TAIR:AT2G42230.2); Has 286 Blast hits to 286 proteins in 65 species: Archae - 0; Bacteria - 0; Metazoa - 177; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT3G58730AT3G58730.1TTAGCCCATTTvacuolar ATP synthase subunit D (VATD) / V-ATPase D subunit / vacuolar proton pump D subunit (VATPD); FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: vacuolar membrane, plasma membrane, vacuole, membrane, plant-type vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, V1/A1 complex, subunit D (InterPro:IPR002699); Has 941 Blast hits to 939 proteins in 387 species: Archae - 165; Bacteria - 273; Metazoa - 208; Fungi - 93; Plants - 54; Viruses - 0; Other Eukaryotes - 148 (source: NCBI BLink). 
AT3G61360AT3G61360.1AAATGGGCTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02420.1); Has 11229 Blast hits to 4504 proteins in 162 species: Archae - 1; Bacteria - 22; Metazoa - 203; Fungi - 245; Plants - 10371; Viruses - 0; Other Eukaryotes - 387 (source: NCBI BLink). 
AT3G61610AT3G61610.1GCCCATTTaldose 1-epimerase family protein; FUNCTIONS IN: carbohydrate binding, isomerase activity, aldose 1-epimerase activity, catalytic activity; INVOLVED IN: galactose metabolic process, N-terminal protein myristoylation, carbohydrate metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Aldose 1-epimerase (InterPro:IPR008183), Glycoside hydrolase-type carbohydrate-binding, subgroup (InterPro:IPR014718); BEST Arabidopsis thaliana protein match is: aldose 1-epimerase family protein (TAIR:AT4G23730.1); Has 1254 Blast hits to 1253 proteins in 495 species: Archae - 0; Bacteria - 821; Metazoa - 38; Fungi - 84; Plants - 140; Viruses - 0; Other Eukaryotes - 171 (source: NCBI BLink). 
AT3G63140AT3G63140.1TAAATGGGCCCATTTEncodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. 
AT3G63310AT3G63310.1AAATGGGCTglutamate binding; FUNCTIONS IN: glutamate binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0005 (InterPro:IPR006214); BEST Arabidopsis thaliana protein match is: glutamate binding (TAIR:AT1G03070.1); Has 3660 Blast hits to 3660 proteins in 893 species: Archae - 0; Bacteria - 1631; Metazoa - 704; Fungi - 90; Plants - 142; Viruses - 53; Other Eukaryotes - 1040 (source: NCBI BLink). 
AT4G00026AT4G00026.1AAAAAGCCCATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim21 (InterPro:IPR013261); Has 168 Blast hits to 168 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 52; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT4G00030AT4G00030.1AAATGGGCTTTTTplastid-lipid associated protein PAP / fibrillin family protein; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 126 Blast hits to 126 proteins in 26 species: Archae - 0; Bacteria - 11; Metazoa - 0; Fungi - 0; Plants - 112; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G00090AT4G00090.1AAATGGGCTTTGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). 
AT4G00090.1TAAATGGGCTTTGtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: nucleotide binding (TAIR:AT4G32990.1); Has 14797 Blast hits to 8355 proteins in 382 species: Archae - 36; Bacteria - 3895; Metazoa - 5230; Fungi - 2687; Plants - 864; Viruses - 0; Other Eukaryotes - 2085 (source: NCBI BLink). 
AT4G00585AT4G00585.1TAAATGGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 29 Blast hits to 29 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 6; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G00585.1TAAATGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 29 Blast hits to 29 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 6; Plants - 20; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G00590AT4G00590.1TAAGCCCATTTAasparaginase 2 family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase T2, asparaginase 2 (InterPro:IPR000246); BEST Arabidopsis thaliana protein match is: L-asparaginase, putative / L-asparagine amidohydrolase, putative (TAIR:AT3G16150.1); Has 2162 Blast hits to 2119 proteins in 522 species: Archae - 71; Bacteria - 869; Metazoa - 420; Fungi - 151; Plants - 90; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). 
AT4G00590.1TTAAGGCCCATTTAasparaginase 2 family protein; FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase T2, asparaginase 2 (InterPro:IPR000246); BEST Arabidopsis thaliana protein match is: L-asparaginase, putative / L-asparagine amidohydrolase, putative (TAIR:AT3G16150.1); Has 2162 Blast hits to 2119 proteins in 522 species: Archae - 71; Bacteria - 869; Metazoa - 420; Fungi - 151; Plants - 90; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). 
AT4G00860AT4G00860.1AAATGGGCCCATAATGGCCCAATATputative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. 
AT4G00895AT4G00895.1AATAGCCCATTTATP synthase delta chain-related; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: proton-transporting ATP synthase complex, catalytic core F(1), chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); Has 40 Blast hits to 40 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G00895.1ATTAGGCCCATTTAATP synthase delta chain-related; FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: proton-transporting ATP synthase complex, catalytic core F(1), chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, OSCP/delta subunit (InterPro:IPR000711); Has 40 Blast hits to 40 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 11; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G01400AT4G01400.2TAAGCCCATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: COG4 transport (InterPro:IPR013167), Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G46100.1); Has 11639 Blast hits to 3936 proteins in 180 species: Archae - 0; Bacteria - 2; Metazoa - 206; Fungi - 141; Plants - 11004; Viruses - 0; Other Eukaryotes - 286 (source: NCBI BLink). 
AT4G01560AT4G01560.1ATAGGCCCATTTmaternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT4G01570AT4G01570.1AAATGGGCCTATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink). 
AT4G01590AT4G01590.1ACTGGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink). 
AT4G01590.2ACTGGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G35680.1); Has 2034 Blast hits to 1379 proteins in 150 species: Archae - 0; Bacteria - 99; Metazoa - 666; Fungi - 320; Plants - 99; Viruses - 74; Other Eukaryotes - 776 (source: NCBI BLink). 
AT4G01940AT4G01940.1ATCGGCCCATTTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. 
AT4G02080AT4G02080.1TAAATGGGCTTATTGGGA member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. 
AT4G02195AT4G02195.1TAAATGGGCCTAAAAAGGCCCAAATmember of SYP4 Gene Family 
AT4G02580AT4G02580.1AAATGGGCCTTTAANADH-ubiquinone oxidoreductase 24 kDa subunit, putative; FUNCTIONS IN: electron carrier activity, NAD or NADH binding, oxidoreductase activity, NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: response to oxidative stress, mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: mitochondrion, respiratory chain complex I; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), NADH dehydrogenase (ubiquinone), 24 kDa subunit (InterPro:IPR002023), Thioredoxin-like fold (InterPro:IPR012336); Has 4003 Blast hits to 4003 proteins in 890 species: Archae - 12; Bacteria - 1956; Metazoa - 160; Fungi - 76; Plants - 28; Viruses - 0; Other Eukaryotes - 1771 (source: NCBI BLink). 
AT4G02590AT4G02590.1AGCCCATTTAunfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02590.2AGCCCATTTAunfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02590.3AGCCCATTTAunfertilized embryo sac 12 (UNE12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: double fertilization forming a zygote and endosperm, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (TAIR:AT1G03040.1); Has 1644 Blast hits to 1644 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 3; Plants - 1615; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02930AT4G02930.1AAATGGGCTTAelongation factor Tu, putative / EF-Tu, putative; FUNCTIONS IN: translation elongation factor activity, ATP binding; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, cell wall; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, bacterial and organelle (InterPro:IPR004541), Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: ATRABE1B (ARABIDOPSIS RAB GTPASE HOMOLOG E1B); GTP binding / GTPase/ translation elongation factor (TAIR:AT4G20360.1); Has 60152 Blast hits to 60103 proteins in 12753 species: Archae - 783; Bacteria - 22701; Metazoa - 13343; Fungi - 6902; Plants - 1303; Viruses - 3; Other Eukaryotes - 15117 (source: NCBI BLink). 
AT4G03030AT4G03030.1AAATGGGCTTAkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT3G63220.2); Has 1405 Blast hits to 1314 proteins in 98 species: Archae - 0; Bacteria - 31; Metazoa - 962; Fungi - 4; Plants - 358; Viruses - 9; Other Eukaryotes - 41 (source: NCBI BLink). 
AT4G03260AT4G03260.1GTAAGGCCCATTTAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). 
AT4G03260.2GTAAGGCCCATTTAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT1G78230.1); Has 10652 Blast hits to 7869 proteins in 473 species: Archae - 12; Bacteria - 2927; Metazoa - 5462; Fungi - 520; Plants - 576; Viruses - 25; Other Eukaryotes - 1130 (source: NCBI BLink). 
AT4G03280AT4G03280.1TAAATGGGCTAEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. 
AT4G03280.2TAAATGGGCTAEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. 
AT4G06634AT4G06634.1TAAAAGCCCATTTzinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). 
AT4G06634.2TAAAAGCCCATTTzinc finger (C2H2 type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087), Zinc finger, C2H2-type/integrase, DNA-binding (InterPro:IPR013087); BEST Arabidopsis thaliana protein match is: ELF6 (EARLY FLOWERING 6); transcription factor (TAIR:AT5G04240.1); Has 105509 Blast hits to 34937 proteins in 883 species: Archae - 4; Bacteria - 37; Metazoa - 99278; Fungi - 2690; Plants - 257; Viruses - 38; Other Eukaryotes - 3205 (source: NCBI BLink). 
AT4G07950AT4G07950.1AAATGGGCCTTAADNA-directed RNA polymerase III family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: RNA elongation, regulation of transcription, DNA-dependent, transcription, regulation of transcription; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Zinc finger, TFIIS-type (InterPro:IPR001222), DNA-directed RNA polymerase, M/15 kDa subunit (InterPro:IPR001529); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase III family protein (TAIR:AT1G01210.1); Has 795 Blast hits to 795 proteins in 228 species: Archae - 146; Bacteria - 0; Metazoa - 234; Fungi - 176; Plants - 62; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT4G10040AT4G10040.1TGAGCCCATTTEncodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. 
AT4G10710AT4G10710.1TAAATGGGCCACencodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16. 
AT4G10770AT4G10770.1AAATGGGColigopeptide transporter 
AT4G11380AT4G11380.1TAAATGGGCTAAbeta-adaptin, putative; FUNCTIONS IN: protein transporter activity, protein binding, clathrin binding, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport, protein transport; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (InterPro:IPR008152), Armadillo-like helical (InterPro:IPR011989), Clathrin/coatomer adaptor, adaptin-like, N-terminal (InterPro:IPR002553), Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (InterPro:IPR013037), Clathrin adaptor, beta-adaptin, appendage, C-terminal subdomain (InterPro:IPR015151), Beta2-adaptin/TATA-box binding, C-terminal (InterPro:IPR012295), Armadillo-type fold (InterPro:IPR016024), Adaptor protein complex, beta subunit (InterPro:IPR016342), Clathrin/coatomer adaptor, adaptin-like, appendage, C-terminal subdomain (InterPro:IPR009028), Clathrin/coatomer adaptor, adaptin-like, appendage, Ig-like subdomain (InterPro:IPR013041); BEST Arabidopsis thaliana protein match is: beta-adaptin, putative (TAIR:AT4G23460.1); Has 2658 Blast hits to 2594 proteins in 201 species: Archae - 6; Bacteria - 21; Metazoa - 1263; Fungi - 569; Plants - 229; Viruses - 0; Other Eukaryotes - 570 (source: NCBI BLink). 
AT4G14110AT4G14110.1TAGTGGGCTTGGCCCATTTARepresses photomorphogenesis and induces skotomorphogenesis in the dark. A component of the COP9 signalosome complex. 
AT4G14490AT4G14490.1TAAAAGCCCATTTAAGGCCCATTAAforkhead-associated domain-containing protein / FHA domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: SMAD/FHA domain (InterPro:IPR008984), Forkhead-associated (InterPro:IPR000253); BEST Arabidopsis thaliana protein match is: forkhead-associated domain-containing protein / FHA domain-containing protein / AT hook motif-containing protein (TAIR:AT3G02400.1); Has 1075 Blast hits to 1048 proteins in 243 species: Archae - 14; Bacteria - 671; Metazoa - 68; Fungi - 54; Plants - 81; Viruses - 0; Other Eukaryotes - 187 (source: NCBI BLink). 
AT4G14570AT4G14570.1AAATGGGCacylaminoacyl-peptidase-related; FUNCTIONS IN: serine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S9, prolyl oligopeptidase active site region (InterPro:IPR001375); BEST Arabidopsis thaliana protein match is: serine-type peptidase (TAIR:AT5G36210.1); Has 6161 Blast hits to 6149 proteins in 818 species: Archae - 138; Bacteria - 2948; Metazoa - 891; Fungi - 224; Plants - 152; Viruses - 0; Other Eukaryotes - 1808 (source: NCBI BLink). 
AT4G14905AT4G14905.1AAATGGGCTTTATAGGCCCATTTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G14905.2AAATGGGCTTTATAGGCCCATTTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G39240.1); Has 1209 Blast hits to 1171 proteins in 90 species: Archae - 0; Bacteria - 13; Metazoa - 536; Fungi - 5; Plants - 603; Viruses - 14; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G14950AT4G14950.1AAATGGGCTTTAAAGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT4G14950.2AAATGGGCTTTAAAGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT4G14950.3AAATGGGCTTTAAAGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05360.1); Has 269 Blast hits to 264 proteins in 96 species: Archae - 0; Bacteria - 13; Metazoa - 155; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT4G15260AT4G15260.1TAAATGGGCCAUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B5 (UDP-GLUCOSYL TRANSFERASE 71B5); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT4G15280.1); Has 4447 Blast hits to 4433 proteins in 286 species: Archae - 0; Bacteria - 156; Metazoa - 1629; Fungi - 12; Plants - 2597; Viruses - 18; Other Eukaryotes - 35 (source: NCBI BLink). 
AT4G16450AT4G16450.1TAAATGGGCTCATTCGGGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 50 Blast hits to 50 proteins in 24 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 25; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G16500AT4G16500.1TATATGGGCCCATTTAcysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G16970AT4G16970.1AAATGGGCCTGTATP binding / kinase/ protein kinase/ protein serine/threonine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: casein kinase II alpha chain, putative (TAIR:AT2G23070.1); Has 28325 Blast hits to 23063 proteins in 766 species: Archae - 4; Bacteria - 1025; Metazoa - 12500; Fungi - 3604; Plants - 4846; Viruses - 36; Other Eukaryotes - 6310 (source: NCBI BLink). 
AT4G17190AT4G17190.1TAAATGGGCCACAAAAAGCCCATTTAEncodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers. 
AT4G17190.2TAAATGGGCCACAAAAAGCCCATTTAEncodes a protein with farnesyl diphosphate synthase activity, which catalyzes the rate limiting step in isoprenoid biosynthesis. Its mRNA is most abundantly expressed in flowers. 
AT4G17300AT4G17300.1TAAATGGGCTTATAsparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. 
AT4G17620AT4G17620.1AAATGGGCCTTTAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink). 
AT4G17620.2AAATGGGCCTTTAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RAI1 like (InterPro:IPR013961); Has 42738 Blast hits to 8762 proteins in 679 species: Archae - 96; Bacteria - 22048; Metazoa - 7737; Fungi - 2748; Plants - 703; Viruses - 217; Other Eukaryotes - 9189 (source: NCBI BLink). 
AT4G17840AT4G17840.1TATGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35260.1); Has 1905 Blast hits to 183 proteins in 52 species: Archae - 0; Bacteria - 24; Metazoa - 708; Fungi - 70; Plants - 25; Viruses - 2; Other Eukaryotes - 1076 (source: NCBI BLink). 
AT4G18100AT4G18100.1TGAGCCCATTTA60S ribosomal protein L32 (RPL32A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: callus, pollen tube, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L32e (InterPro:IPR001515), Ribosomal protein L32e, conserved site (InterPro:IPR018263); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L32 (RPL32B) (TAIR:AT5G46430.2); Has 1112 Blast hits to 1112 proteins in 342 species: Archae - 217; Bacteria - 0; Metazoa - 540; Fungi - 96; Plants - 104; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT4G19130AT4G19130.1AAATGGGCCTATADNA binding / nucleic acid binding / zinc ion binding; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Replication factor-A, C-terminal (InterPro:IPR013955), Replication factor-a protein 1 Rpa1 (InterPro:IPR004591), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Zinc finger, CCHC-type (InterPro:IPR001878), Replication factor-A protein 1, N-terminal (InterPro:IPR007199); BEST Arabidopsis thaliana protein match is: replication protein, putative (TAIR:AT5G45400.1); Has 609 Blast hits to 584 proteins in 169 species: Archae - 16; Bacteria - 0; Metazoa - 189; Fungi - 98; Plants - 176; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT4G19140AT4G19140.1TATAGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G19710AT4G19710.1TAAATGGGCCAAEncodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. 
AT4G19710.2TAAATGGGCCAAEncodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. 
AT4G21215AT4G21215.1AAATGGGCunknown protein; LOCATED IN: cellular_component unknown; Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G21215.2AAATGGGCunknown protein; LOCATED IN: cellular_component unknown; Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G22240AT4G22240.1GAGGCCCATTTAplastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: fruit, guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: FIB (FIBRILLIN); structural molecule (TAIR:AT4G04020.1); Has 296 Blast hits to 296 proteins in 63 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT4G22720AT4G22720.1TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTAglycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). 
AT4G22720.2TTATTGGGCTAGGCCCATTTATAAACGACGCCGTTTAglycoprotease M22 family protein; FUNCTIONS IN: endopeptidase activity, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M22, O-sialoglycoprotein endopeptidase (InterPro:IPR009180), Peptidase M22, glycoprotease, subgroup (InterPro:IPR017861), Peptidase M22, glycoprotease (InterPro:IPR000905); BEST Arabidopsis thaliana protein match is: glycoprotease M22 family protein (TAIR:AT2G45270.1); Has 6754 Blast hits to 6730 proteins in 1648 species: Archae - 187; Bacteria - 2972; Metazoa - 216; Fungi - 190; Plants - 122; Viruses - 0; Other Eukaryotes - 3067 (source: NCBI BLink). 
AT4G23600AT4G23600.1AAATGGGCEncodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. 
AT4G23600.2AAATGGGCEncodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. 
AT4G23600.3AAATGGGCEncodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. 
AT4G24770AT4G24770.1AGCCCATTTEncodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). 
AT4G24920AT4G24920.1GCCGTTTAAAATGGGCTTTGprotein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT5G50460.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT4G25550AT4G25550.1TAAATGGGCCGGprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 53; Plants - 42; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT4G25550.1TAAATGGGCCTAAAprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cleavage and polyadenylation specificity factor, 25 kDa subunit (InterPro:IPR016706); BEST Arabidopsis thaliana protein match is: CFIM-25 (TAIR:AT4G29820.1); Has 291 Blast hits to 289 proteins in 130 species: Archae - 0; Bacteria - 0; Metazoa - 138; Fungi - 53; Plants - 42; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT4G25670AT4G25670.1AAATGGGCunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25690.2); Has 46 Blast hits to 40 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 38; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G25890AT4G25890.1GTGGCCCATTTA60S acidic ribosomal protein P3 (RPP3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3B) (TAIR:AT5G57290.2); Has 578 Blast hits to 577 proteins in 136 species: Archae - 0; Bacteria - 6; Metazoa - 262; Fungi - 76; Plants - 177; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). 
AT4G26000AT4G26000.1AAATGGGCTAAEncodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. 
AT4G26190AT4G26190.1TAAATGGGCCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36550.1); Has 24148 Blast hits to 14674 proteins in 713 species: Archae - 56; Bacteria - 1518; Metazoa - 9576; Fungi - 1916; Plants - 955; Viruses - 87; Other Eukaryotes - 10040 (source: NCBI BLink). 
AT4G26240AT4G26240.1AATAGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 17 Blast hits to 17 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G26670AT4G26670.1TAAATGGGCTAmitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter (TAIR:AT5G55510.1); Has 467 Blast hits to 467 proteins in 116 species: Archae - 0; Bacteria - 0; Metazoa - 219; Fungi - 144; Plants - 82; Viruses - 0; Other Eukaryotes - 22 (source: NCBI BLink). 
AT4G26870AT4G26870.1TAAGCCCATTTaspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative; FUNCTIONS IN: aspartate-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, nucleic acid binding, ATP binding; INVOLVED IN: response to cadmium ion, tRNA aminoacylation for protein translation; LOCATED IN: cytoplasm; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartyl-tRNA synthetase, class IIb, archea/euk type (InterPro:IPR004523), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Aspartyl-tRNA synthetase, class IIb (InterPro:IPR002312), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Aminoacyl-tRNA synthetase, class II (D, K and N) (InterPro:IPR004364), Aminoacyl-tRNA synthetase, class II (D, K and N)-like (InterPro:IPR018150); BEST Arabidopsis thaliana protein match is: aspartyl-tRNA synthetase, putative / aspartate--tRNA ligase, putative (TAIR:AT4G31180.2); Has 18508 Blast hits to 15212 proteins in 1719 species: Archae - 299; Bacteria - 10385; Metazoa - 672; Fungi - 662; Plants - 233; Viruses - 0; Other Eukaryotes - 6257 (source: NCBI BLink). 
AT4G27370AT4G27370.1TAAAGGCCCATTTAmember of Myosin-like proteins 
AT4G27380AT4G27380.1TAAATGGGCCTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT4G27740AT4G27740.1AAATGGGCCTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27745.1); Has 684 Blast hits to 682 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 389; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT4G28230AT4G28230.1GGGCTATTTGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; Has 385 Blast hits to 299 proteins in 88 species: Archae - 0; Bacteria - 7; Metazoa - 168; Fungi - 23; Plants - 22; Viruses - 2; Other Eukaryotes - 163 (source: NCBI BLink). 
AT4G28540AT4G28540.1GTTAGGCCCATTTACASEIN KINASE I-LIKE 6 (CKL6); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ADK1 (dual specificity kinase 1); kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT1G03930.1); Has 46100 Blast hits to 45721 proteins in 1424 species: Archae - 12; Bacteria - 5612; Metazoa - 19980; Fungi - 4668; Plants - 5911; Viruses - 338; Other Eukaryotes - 9579 (source: NCBI BLink). 
AT4G28660AT4G28660.1AAATGGGCTTATSimilar to PsbW subunit of photosystem II. 
AT4G28770AT4G28770.1CTAAGCCCATTTAFUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetraspanin (InterPro:IPR018499); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20230.1); Has 94 Blast hits to 94 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G28770.1TAGCCCATTTAFUNCTIONS IN: molecular_function unknown; LOCATED IN: plasma membrane, vacuole, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetraspanin (InterPro:IPR018499); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20230.1); Has 94 Blast hits to 94 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 93; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G29070AT4G29070.1TCGGCCCATTTTGAGCCCAATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G29070.2TCGGCCCATTTTGAGCCCAATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G29520AT4G29520.1TTGGCCCATTTLOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Saposin B (InterPro:IPR008139); Has 120 Blast hits to 120 proteins in 43 species: Archae - 2; Bacteria - 0; Metazoa - 42; Fungi - 10; Plants - 19; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT4G29530AT4G29530.1AAATGGGCCAA2,3-diketo-5-methylthio-1-phosphopentane phosphatase family; FUNCTIONS IN: phosphatase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G17710.1); Has 269 Blast hits to 267 proteins in 80 species: Archae - 0; Bacteria - 19; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT4G30500AT4G30500.1TGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23940.1); Has 218 Blast hits to 218 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 72; Plants - 29; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT4G30580AT4G30580.1AAATGGGCCATEncodes a plastidic lysophosphatidic acid acyltransferase (LPAAT). Is critical for chloroplasts phosphatidic acid biosynthesis. The null allele is embryo lethal. 
AT4G30660AT4G30660.1CCAGGCCCATTTAhydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT4G30660.2CCAGGCCCATTTAhydrophobic protein, putative / low temperature and salt responsive protein, putative; INVOLVED IN: hyperosmotic salinity response, response to cold; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0057 (InterPro:IPR000612); BEST Arabidopsis thaliana protein match is: hydrophobic protein, putative / low temperature and salt responsive protein, putative (TAIR:AT2G24040.1); Has 792 Blast hits to 792 proteins in 279 species: Archae - 0; Bacteria - 358; Metazoa - 42; Fungi - 194; Plants - 182; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT4G31120AT4G31120.1TAAATGGGCTAInvolved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. 
AT4G31120.2TAAATGGGCTAInvolved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. 
AT4G31420AT4G31420.1GAATGGGCCAAATGGGCTAzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 160; Plants - 53; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). 
AT4G31420.2GAATGGGCCAAATGGGCTAzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: FZF; transcription factor (TAIR:AT2G24500.1); Has 503 Blast hits to 486 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 160; Plants - 53; Viruses - 0; Other Eukaryotes - 83 (source: NCBI BLink). 
AT4G32272AT4G32272.1TAAATGGGCTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF250 (InterPro:IPR004853); BEST Arabidopsis thaliana protein match is: UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter-related (TAIR:AT4G31600.1); Has 1302 Blast hits to 1300 proteins in 174 species: Archae - 0; Bacteria - 4; Metazoa - 376; Fungi - 239; Plants - 567; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink). 
AT4G32590AT4G32590.1TAAATGGGCTTGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32590.1TAAATGGGCTTGTTAATGGGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32590.2TAAATGGGCTTGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32590.2TAAATGGGCTTGTTAATGGGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32590.3TAAATGGGCTTGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32590.3TAAATGGGCTTGTTAATGGGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32590.4TAAATGGGCTTGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32590.4TAAATGGGCTTGTTAATGGGferredoxin-related; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); BEST Arabidopsis thaliana protein match is: NDF4 (NDH-DEPENDENT CYCLIC ELECTRON FLOW 1); electron carrier/ iron-sulfur cluster binding (TAIR:AT3G16250.1); Has 619 Blast hits to 619 proteins in 113 species: Archae - 0; Bacteria - 282; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT4G32660AT4G32660.1AAAAAGCCCATTTEncodes protein kinase AME3. 
AT4G32660.1GAAGCCCATTTEncodes protein kinase AME3. 
AT4G32660.2AAAAAGCCCATTTEncodes protein kinase AME3. 
AT4G32660.2GAAGCCCATTTEncodes protein kinase AME3. 
AT4G32660.3AAAAAGCCCATTTEncodes protein kinase AME3. 
AT4G32660.3GAAGCCCATTTEncodes protein kinase AME3. 
AT4G34700AT4G34700.1CAAAGGCCCATTTcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT4G34710AT4G34710.1TAAATGGGCCCencodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. 
AT4G34710.2TAAATGGGCCCencodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. 
AT4G35140AT4G35140.1TAAATGGGCCAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G38480.1); Has 7738 Blast hits to 5690 proteins in 350 species: Archae - 10; Bacteria - 1449; Metazoa - 3242; Fungi - 1387; Plants - 483; Viruses - 0; Other Eukaryotes - 1167 (source: NCBI BLink). 
AT4G36280AT4G36280.1AAATGGGCCTATAATP-binding region, ATPase-like domain-containing protein; FUNCTIONS IN: ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATP-binding region, ATPase-like (InterPro:IPR003594); BEST Arabidopsis thaliana protein match is: ATP-binding region, ATPase-like domain-containing protein (TAIR:AT4G36290.1); Has 306 Blast hits to 292 proteins in 51 species: Archae - 0; Bacteria - 16; Metazoa - 167; Fungi - 0; Plants - 91; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT4G36420AT4G36420.1ATAGGCCCATAAAGGCCCATTTribosomal protein L12 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L12, chloroplast (InterPro:IPR015608), Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (InterPro:IPR014719), Ribosomal protein L7/L12, oligomerisation (InterPro:IPR008932), Ribosomal protein L7/L12, C-terminal (InterPro:IPR013823); BEST Arabidopsis thaliana protein match is: ribosomal protein L12 family protein (TAIR:AT1G70190.1); Has 5784 Blast hits to 5784 proteins in 1564 species: Archae - 0; Bacteria - 3201; Metazoa - 134; Fungi - 85; Plants - 177; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). 
AT4G36800AT4G36800.1AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1. 
AT4G36800.2AAATGGGCCTAACGGGCTTTAATGGGCCAARUB1 conjugating enzyme that conjugates CUL1 and is involved in auxin response and embryogenesis. RCE1 protein physically interacts with RBX1, which may be the E3 for CUL1. 
AT4G37280AT4G37280.1TAAATGGGCMRG family protein; FUNCTIONS IN: chromatin binding; INVOLVED IN: chromatin assembly or disassembly; LOCATED IN: chromatin, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Histone H4 acetyltransferase, NuA4 complex, Eaf3/MRG15 subunit (InterPro:IPR017398), MRG (InterPro:IPR008676), Chromo domain (InterPro:IPR000953); BEST Arabidopsis thaliana protein match is: chromatin binding (TAIR:AT1G02740.1); Has 950 Blast hits to 825 proteins in 140 species: Archae - 0; Bacteria - 2; Metazoa - 688; Fungi - 159; Plants - 55; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). 
AT4G37440AT4G37440.1GTGGCCCATTTunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae - 0; Bacteria - 5; Metazoa - 46; Fungi - 9; Plants - 44; Viruses - 3; Other Eukaryotes - 59 (source: NCBI BLink). 
AT4G37440.2GTGGCCCATTTunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae - 0; Bacteria - 5; Metazoa - 46; Fungi - 9; Plants - 44; Viruses - 3; Other Eukaryotes - 59 (source: NCBI BLink). 
AT4G38380AT4G38380.1AAAAGGCCCATTTAantiporter/ drug transporter; FUNCTIONS IN: drug transporter activity, antiporter activity; INVOLVED IN: multidrug transport; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Multi antimicrobial extrusion protein MatE (InterPro:IPR002528); BEST Arabidopsis thaliana protein match is: MATE efflux family protein (TAIR:AT2G38330.1); Has 7271 Blast hits to 7248 proteins in 1132 species: Archae - 174; Bacteria - 5061; Metazoa - 70; Fungi - 101; Plants - 194; Viruses - 0; Other Eukaryotes - 1671 (source: NCBI BLink). 
AT4G39210AT4G39210.1AAATGGGCCTGGEncodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots. 
AT4G39240AT4G39240.1ATATGGGCCTAAGCCCATTTkelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch repeat type 2 (InterPro:IPR011498), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: kelch repeat-containing F-box family protein (TAIR:AT4G14905.2); Has 1294 Blast hits to 1212 proteins in 90 species: Archae - 10; Bacteria - 44; Metazoa - 634; Fungi - 4; Plants - 571; Viruses - 7; Other Eukaryotes - 24 (source: NCBI BLink). 
AT4G39630AT4G39630.1GCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; Has 11 Blast hits to 11 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G01650AT5G01650.1TTAAGGCCCATTTmacrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1). 
AT5G01650.2TTAAGGCCCATTTmacrophage migration inhibitory factor family protein / MIF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: inflammatory response, response to other organism; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tautomerase (InterPro:IPR014347), Macrophage migration inhibitory factor (InterPro:IPR001398); BEST Arabidopsis thaliana protein match is: macrophage migration inhibitory factor family protein / MIF family protein (TAIR:AT5G57170.1). 
AT5G01960AT5G01960.1GCCCATTTAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G65040.3); Has 3886 Blast hits to 3874 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 2090; Fungi - 415; Plants - 660; Viruses - 46; Other Eukaryotes - 675 (source: NCBI BLink). 
AT5G01960.1TTAAAGCCCATTTAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G65040.3); Has 3886 Blast hits to 3874 proteins in 280 species: Archae - 0; Bacteria - 0; Metazoa - 2090; Fungi - 415; Plants - 660; Viruses - 46; Other Eukaryotes - 675 (source: NCBI BLink). 
AT5G02370AT5G02370.1TAAATGGGCCCAAAAAAGGCCkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink). 
AT5G02470AT5G02470.1AAAAGGCCCATTTAcore cell cycle genes 
AT5G02470.2AAAAGGCCCATTTAcore cell cycle genes 
AT5G02470.3AAAAGGCCCATTTAcore cell cycle genes 
AT5G02790AT5G02790.1AAATGGGCTTAIn2-1 protein, putative; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Glutathione S-transferase, N-terminal (InterPro:IPR004045), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: In2-1 protein, putative (TAIR:AT5G02780.1); Has 2811 Blast hits to 2774 proteins in 481 species: Archae - 2; Bacteria - 698; Metazoa - 592; Fungi - 122; Plants - 984; Viruses - 0; Other Eukaryotes - 413 (source: NCBI BLink). 
AT5G03070AT5G03070.1TAAATGGGCTATTPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT5G03080AT5G03080.1AATAGCCCATTTAphosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); Has 539 Blast hits to 533 proteins in 226 species: Archae - 7; Bacteria - 211; Metazoa - 103; Fungi - 102; Plants - 38; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT5G03380AT5G03380.1TAAATGGGCCCATTTAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). 
AT5G03380.2TAAATGGGCCCATTTAheavy-metal-associated domain-containing protein; FUNCTIONS IN: metal ion binding; INVOLVED IN: metal ion transport; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Heavy metal transport/detoxification protein (InterPro:IPR006121); BEST Arabidopsis thaliana protein match is: heavy-metal-associated domain-containing protein (TAIR:AT2G36950.1); Has 3445 Blast hits to 2574 proteins in 351 species: Archae - 9; Bacteria - 365; Metazoa - 931; Fungi - 228; Plants - 1424; Viruses - 0; Other Eukaryotes - 488 (source: NCBI BLink). 
AT5G03560AT5G03560.1TAAATGGGCTAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G03560.2TAAATGGGCTAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G04270AT5G04270.1GAAGCCCATTTAzinc ion binding; FUNCTIONS IN: zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, DHHC-type (InterPro:IPR001594); BEST Arabidopsis thaliana protein match is: zinc finger (DHHC type) family protein (TAIR:AT3G09320.1); Has 3947 Blast hits to 3944 proteins in 182 species: Archae - 0; Bacteria - 0; Metazoa - 1934; Fungi - 520; Plants - 397; Viruses - 0; Other Eukaryotes - 1096 (source: NCBI BLink). 
AT5G05110AT5G05110.1AAATGGGCTTAcysteine protease inhibitor, putative / cystatin, putative; FUNCTIONS IN: cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT3G12490.2); Has 445 Blast hits to 422 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 436; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G05110.1AAATGGGCTTTcysteine protease inhibitor, putative / cystatin, putative; FUNCTIONS IN: cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT3G12490.2); Has 445 Blast hits to 422 proteins in 77 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 436; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G05450AT5G05450.1AAATGGGCCGAADEAD/DEAH box helicase, putative (RH18); FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G71370.1); Has 26025 Blast hits to 25450 proteins in 1685 species: Archae - 410; Bacteria - 10515; Metazoa - 4736; Fungi - 3110; Plants - 1301; Viruses - 7; Other Eukaryotes - 5946 (source: NCBI BLink). 
AT5G05610AT5G05610.1GATGGGCCATGGGCCAGGCCCATTTAL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT5G05610.2GATGGGCCATGGGCCAGGCCCATTTAL1 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT5G06110AT5G06110.1AAATGGGCTTADNAJ heat shock N-terminal domain-containing protein / cell division protein-related; FUNCTIONS IN: heat shock protein binding, DNA binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ, conserved site (InterPro:IPR018253), MYB-like (InterPro:IPR017877), SANT, DNA-binding (InterPro:IPR001005), Myb, DNA-binding (InterPro:IPR014778), Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 30941 Blast hits to 21178 proteins in 1608 species: Archae - 101; Bacteria - 5693; Metazoa - 11416; Fungi - 3019; Plants - 1271; Viruses - 136; Other Eukaryotes - 9305 (source: NCBI BLink). 
AT5G06260AT5G06260.1TTAAAGCCCATTTnucleolar protein-related; FUNCTIONS IN: calcium ion binding; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TLDc (InterPro:IPR006571), EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992); BEST Arabidopsis thaliana protein match is: calcium ion binding (TAIR:AT4G34070.1); Has 925 Blast hits to 924 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 578; Fungi - 44; Plants - 76; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink). 
AT5G06340AT5G06340.1AAATGGGCCCAATAARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). 
AT5G06370AT5G06370.1AGGGCCCATTTNC domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053); BEST Arabidopsis thaliana protein match is: NC domain-containing protein (TAIR:AT3G02700.1); Has 102 Blast hits to 101 proteins in 29 species: Archae - 0; Bacteria - 28; Metazoa - 4; Fungi - 0; Plants - 67; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT5G07090AT5G07090.1AAATGGGCCTAT40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). 
AT5G07090.2AAATGGGCCTAT40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). 
AT5G08190AT5G08190.1AAAAAGCCCATTTNUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G08190.2AAAAAGCCCATTTNUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G08540AT5G08540.1TAAATGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G09390AT5G09390.1TTAAGGCCCATTTCD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G09390.2TTAAGGCCCATTTCD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G09880AT5G09880.1TAAATGGGCCTTTTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae - 65; Bacteria - 4369; Metazoa - 40620; Fungi - 8054; Plants - 5837; Viruses - 419; Other Eukaryotes - 15750 (source: NCBI BLink). 
AT5G10100AT5G10100.1GTAGGCCCATTTAtrehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: embryo, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT5G65140.1); Has 1468 Blast hits to 1466 proteins in 515 species: Archae - 29; Bacteria - 765; Metazoa - 195; Fungi - 100; Plants - 258; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). 
AT5G11680AT5G11680.1AAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT5G13310AT5G13310.1GCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G13970.1); Has 356 Blast hits to 305 proteins in 95 species: Archae - 0; Bacteria - 44; Metazoa - 138; Fungi - 38; Plants - 34; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT5G14200AT5G14200.1AAATGGGCCAATThe AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. 
AT5G14200.2AAATGGGCCAATThe AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. 
AT5G14200.3AAATGGGCCAATThe AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. 
AT5G14430AT5G14430.1ACAGGCCCATTTAdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G14430.2ACAGGCCCATTTAdehydration-responsive protein-related; LOCATED IN: Golgi apparatus, plasma membrane, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: dehydration-responsive protein-related (TAIR:AT4G14360.2); Has 583 Blast hits to 572 proteins in 73 species: Archae - 0; Bacteria - 103; Metazoa - 0; Fungi - 0; Plants - 469; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT5G15320AT5G15320.1AGAGGCCCATTTAAAGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G15320.2AGAGGCCCATTTAAAGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G01130.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G15350AT5G15350.1AAATGGGCTATTplastocyanin-like domain-containing protein; FUNCTIONS IN: electron carrier activity, copper ion binding; LOCATED IN: anchored to plasma membrane, plasma membrane, vacuole, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plastocyanin-like (InterPro:IPR003245), Cupredoxin (InterPro:IPR008972); BEST Arabidopsis thaliana protein match is: plastocyanin-like domain-containing protein (TAIR:AT4G12880.1); Has 768 Blast hits to 760 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 768; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G16380AT5G16380.1ATATGGGCTGAATAAGGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07470.1); Has 277 Blast hits to 277 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 276; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G16470AT5G16470.1AAATGGGCzinc finger (C2H2 type) family protein; FUNCTIONS IN: transcription factor activity, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880); BEST Arabidopsis thaliana protein match is: zinc finger (C2H2 type) family protein (TAIR:AT3G02790.1); Has 57 Blast hits to 57 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G17550AT5G17550.1AAATGGGCTTAPEX19-2; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: peroxisome organization; LOCATED IN: peroxisome; CONTAINS InterPro DOMAIN/s: Pex19 protein (InterPro:IPR006708); BEST Arabidopsis thaliana protein match is: PEX19-1 (peroxin 19-1) (TAIR:AT3G03490.1); Has 291 Blast hits to 285 proteins in 122 species: Archae - 0; Bacteria - 4; Metazoa - 130; Fungi - 93; Plants - 19; Viruses - 0; Other Eukaryotes - 45 (source: NCBI BLink). 
AT5G17560AT5G17560.1TAAGCCCATTTBolA-like family protein; FUNCTIONS IN: transcription regulator activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BolA-like protein (InterPro:IPR002634); BEST Arabidopsis thaliana protein match is: BolA-like family protein (TAIR:AT1G55805.1); Has 1368 Blast hits to 1368 proteins in 267 species: Archae - 2; Bacteria - 509; Metazoa - 31; Fungi - 15; Plants - 67; Viruses - 0; Other Eukaryotes - 744 (source: NCBI BLink). 
AT5G17620AT5G17620.1AAATGGGCCAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant nuclear matrix 1 (InterPro:IPR010604); Has 62 Blast hits to 62 proteins in 32 species: Archae - 0; Bacteria - 19; Metazoa - 8; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G18110AT5G18110.1CTAAGGCCCATTTANOVEL CAP-BINDING PROTEIN (NCBP); FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 4E (eIF-4E) (InterPro:IPR001040); BEST Arabidopsis thaliana protein match is: EIF4E (EUKARYOTIC TRANSLATION INITATION FACTOR 4E); RNA binding / RNA cap binding / protein binding / translation initiation factor (TAIR:AT4G18040.1); Has 1298 Blast hits to 1298 proteins in 204 species: Archae - 0; Bacteria - 0; Metazoa - 608; Fungi - 226; Plants - 212; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink). 
AT5G18120AT5G18120.1TAAATGGGCCTTAGEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. 
AT5G18400AT5G18400.1AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.1TAAATGGGCCGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.2AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.2TAAATGGGCCGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.3AAATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.3TAAATGGGCCGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18440AT5G18440.1TGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G18440.2TGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G19620AT5G19620.1TAAATGGGCTTTAAAtOEP80 is paralog to the chloroplastic protein translocation channel Toc75 
AT5G19930AT5G19930.1CTATTGGGTCAGCCCATTTGAGGCCCATGintegral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink). 
AT5G19940AT5G19940.1CATGGGCCTCAAATGGGCTGACCCAATAGplastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G19940.2CATGGGCCTCAAATGGGCTGACCCAATAGplastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G20220AT5G20220.1AAATGGGCzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, zinc ion binding, nucleic acid binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 2110 Blast hits to 1542 proteins in 192 species: Archae - 0; Bacteria - 8; Metazoa - 481; Fungi - 459; Plants - 190; Viruses - 714; Other Eukaryotes - 258 (source: NCBI BLink). 
AT5G20220.2AAATGGGCzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding, zinc ion binding, nucleic acid binding; INVOLVED IN: protein folding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 2110 Blast hits to 1542 proteins in 192 species: Archae - 0; Bacteria - 8; Metazoa - 481; Fungi - 459; Plants - 190; Viruses - 714; Other Eukaryotes - 258 (source: NCBI BLink). 
AT5G22875AT5G22875.1TACGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G22875.2TACGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G23200AT5G23200.1AAATGGGCCCAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G23230AT5G23230.1CTAGGCCCATTTNICOTINAMIDASE 2 (NIC2); FUNCTIONS IN: nicotinamidase activity, catalytic activity; INVOLVED IN: NAD metabolic process, metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); BEST Arabidopsis thaliana protein match is: NIC3 (NICOTINAMIDASE 3); catalytic/ nicotinamidase (TAIR:AT5G23220.1); Has 4281 Blast hits to 4279 proteins in 809 species: Archae - 137; Bacteria - 3598; Metazoa - 0; Fungi - 94; Plants - 51; Viruses - 0; Other Eukaryotes - 401 (source: NCBI BLink). 
AT5G23290AT5G23290.1TAAATGGGCCAATATGGGCCTTATPREFOLDIN 5 (PDF5); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin alpha-like (InterPro:IPR004127), Prefoldin (InterPro:IPR009053), Prefoldin alpha subunit (InterPro:IPR011599); Has 365 Blast hits to 365 proteins in 170 species: Archae - 46; Bacteria - 3; Metazoa - 137; Fungi - 83; Plants - 26; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT5G23900AT5G23900.1CCAGGCCCATTTA60S ribosomal protein L13 (RPL13D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13e, conserved site (InterPro:IPR018256), Ribosomal protein L13e (InterPro:IPR001380); BEST Arabidopsis thaliana protein match is: ATBBC1 (ARABIDOPSIS THALIANA BREAST BASIC CONSERVED 1); structural constituent of ribosome (TAIR:AT3G49010.3); Has 546 Blast hits to 546 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 227; Fungi - 113; Plants - 98; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT5G25100AT5G25100.1ATTAGGCCCATTTAendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT5G10840.1); Has 1029 Blast hits to 1012 proteins in 169 species: Archae - 0; Bacteria - 14; Metazoa - 445; Fungi - 142; Plants - 236; Viruses - 0; Other Eukaryotes - 192 (source: NCBI BLink). 
AT5G25475AT5G25475.1TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25475.2TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25475.3TAAATGGGCCTTATTCGGCCCGTTADNA binding; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: DNA binding (TAIR:AT5G25470.2); Has 59 Blast hits to 59 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 59; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G25510AT5G25510.1TAAATGGGCCTTAGserine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 492; Fungi - 97; Plants - 156; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). 
AT5G25510.1TAAATGGGCTTTAAserine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative; FUNCTIONS IN: protein phosphatase type 2A regulator activity; INVOLVED IN: signal transduction; LOCATED IN: chloroplast, protein phosphatase type 2A complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2A, regulatory B subunit, B56 (InterPro:IPR002554); BEST Arabidopsis thaliana protein match is: ATB' GAMMA; poly(U) binding / protein phosphatase type 2A regulator (TAIR:AT4G15415.2); Has 855 Blast hits to 848 proteins in 138 species: Archae - 0; Bacteria - 0; Metazoa - 492; Fungi - 97; Plants - 156; Viruses - 0; Other Eukaryotes - 110 (source: NCBI BLink). 
AT5G25520AT5G25520.1CTAAGGCCCATTTAtranscription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). 
AT5G25520.1TTAAAGCCCATTTAtranscription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). 
AT5G25520.2CTAAGGCCCATTTAtranscription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). 
AT5G25520.2TTAAAGCCCATTTAtranscription elongation factor-related; INVOLVED IN: transcription; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), Transcription elongation factor S-II, central region (InterPro:IPR003618); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT5G11430.1); Has 1708 Blast hits to 1348 proteins in 195 species: Archae - 0; Bacteria - 102; Metazoa - 757; Fungi - 263; Plants - 95; Viruses - 7; Other Eukaryotes - 484 (source: NCBI BLink). 
AT5G25930AT5G25930.1ATGGCCCATTTleucine-rich repeat family protein / protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: AtRLP52 (Receptor Like Protein 52); kinase/ protein binding (TAIR:AT5G25910.1); Has 141916 Blast hits to 99081 proteins in 3479 species: Archae - 73; Bacteria - 11637; Metazoa - 53989; Fungi - 7333; Plants - 48905; Viruses - 349; Other Eukaryotes - 19630 (source: NCBI BLink). 
AT5G28370AT5G28370.1AAATGGGCCCAACTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae - 7; Bacteria - 27; Metazoa - 841; Fungi - 534; Plants - 20012; Viruses - 0; Other Eukaryotes - 1085 (source: NCBI BLink). 
AT5G35530AT5G35530.1AAATGGGCCTTAAAAGGCCGGGCCTTG40S ribosomal protein S3 (RPS3C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3A) (TAIR:AT2G31610.1); Has 3856 Blast hits to 3855 proteins in 1171 species: Archae - 174; Bacteria - 1930; Metazoa - 296; Fungi - 95; Plants - 109; Viruses - 0; Other Eukaryotes - 1252 (source: NCBI BLink). 
AT5G35735AT5G35735.1AAATGGGCauxin-responsive family protein; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP037471 (InterPro:IPR017214), Protein of unknown function DUF568, DOMON-like (InterPro:IPR007613), DOMON related (InterPro:IPR005018), Cytochrome b561/ferric reductase transmembrane (InterPro:IPR006593); BEST Arabidopsis thaliana protein match is: auxin-responsive protein, putative (TAIR:AT5G47530.1); Has 377 Blast hits to 377 proteins in 72 species: Archae - 0; Bacteria - 6; Metazoa - 82; Fungi - 31; Plants - 251; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT5G38480AT5G38480.1GTTGGGCCCAGTGGCCCATTTAgeneral regulatory factor, a 14-3-3 gene 
AT5G38480.2GTTGGGCCCAGTGGCCCATTTAgeneral regulatory factor, a 14-3-3 gene 
AT5G38650AT5G38650.1AAAAGCCCAAATGGGCCTTGproteasome maturation factor UMP1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteasome maturation factor UMP1 (InterPro:IPR008012); BEST Arabidopsis thaliana protein match is: proteasome maturation factor UMP1 family protein (TAIR:AT1G67250.1); Has 161 Blast hits to 161 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 87; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT5G38860AT5G38860.1TAAATGGGCTTTTBES1-interacting Myc-like protein 3 (BIM3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM2 (BES1-interacting Myc-like protein 2); DNA binding / transcription factor (TAIR:AT1G69010.1); Has 805 Blast hits to 803 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 24; Plants - 651; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT5G39950AT5G39950.1TAAATGGGCencodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. 
AT5G39950.1TAAATGGGCTAAencodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. 
AT5G40200AT5G40200.1TCAGGCCCATTTEncodes a putative DegP protease. 
AT5G41190AT5G41190.1ATTTGGGCCTTGTGAGGCCCATTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nin one binding (NOB1) Zn-ribbon like (InterPro:IPR014881), D-site 20S pre-rRNA nuclease (InterPro:IPR017117); Has 855 Blast hits to 653 proteins in 196 species: Archae - 53; Bacteria - 16; Metazoa - 335; Fungi - 168; Plants - 29; Viruses - 10; Other Eukaryotes - 244 (source: NCBI BLink). 
AT5G41600AT5G41600.1TAAATGGGCCCAATGVIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 648; Fungi - 2; Plants - 271; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT5G41600.1TAAATGGGCCTTAAVIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 648; Fungi - 2; Plants - 271; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT5G42060AT5G42060.1ATCGGCCCATTTAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64490.1); Has 37 Blast hits to 36 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G43330AT5G43330.1TAAATGGGCTTAmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: cellular carbohydrate metabolic process, glycolysis, malate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT1G04410.1); Has 8255 Blast hits to 8253 proteins in 1762 species: Archae - 116; Bacteria - 4254; Metazoa - 1034; Fungi - 184; Plants - 466; Viruses - 0; Other Eukaryotes - 2201 (source: NCBI BLink). 
AT5G43680AT5G43680.1TAAATGGGCTTCACGGCCCATATunknown protein; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 145 Blast hits to 145 proteins in 56 species: Archae - 0; Bacteria - 106; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G45360AT5G45360.1TATGGCCCATTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 132 Blast hits to 132 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 76; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT5G45360.1TTAGCCCATTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 132 Blast hits to 132 proteins in 38 species: Archae - 0; Bacteria - 2; Metazoa - 76; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT5G45990AT5G45990.1TAAATGGGCCATcrooked neck protein, putative / cell cycle protein, putative; FUNCTIONS IN: binding; INVOLVED IN: RNA processing; LOCATED IN: intracellular; CONTAINS InterPro DOMAIN/s: RNA-processing protein, HAT helix (InterPro:IPR003107), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: crooked neck protein, putative / cell cycle protein, putative (TAIR:AT5G41770.1); Has 3943 Blast hits to 1642 proteins in 191 species: Archae - 15; Bacteria - 34; Metazoa - 1807; Fungi - 1089; Plants - 496; Viruses - 0; Other Eukaryotes - 502 (source: NCBI BLink). 
AT5G46030AT5G46030.1TAAATGGGCCTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF701, zinc-binding putative (InterPro:IPR007808); Has 2456 Blast hits to 1418 proteins in 196 species: Archae - 2; Bacteria - 26; Metazoa - 1582; Fungi - 186; Plants - 111; Viruses - 40; Other Eukaryotes - 509 (source: NCBI BLink). 
AT5G47030AT5G47030.1AAATGGGCTTTAAEncodes the mitochondrial ATP synthase subunit delta. 
AT5G47435AT5G47435.1CTTATTGGGCCCATTTencodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. 
AT5G47435.1GCCCATTTencodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. 
AT5G47435.2CTTATTGGGCCCATTTencodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. 
AT5G47435.2GCCCATTTencodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. 
AT5G47700AT5G47700.1TAAATGGGCCTAAT60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink). 
AT5G47700.2TAAATGGGCCTAAT60S acidic ribosomal protein P1 (RPP1C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P1 (RPP1A) (TAIR:AT1G01100.4); Has 1683 Blast hits to 1682 proteins in 292 species: Archae - 49; Bacteria - 5; Metazoa - 682; Fungi - 360; Plants - 319; Viruses - 0; Other Eukaryotes - 268 (source: NCBI BLink). 
AT5G50240AT5G50240.3TTATTGGGCCTATAAAAGCCCATTTAL-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. 
AT5G50460AT5G50460.1AGCCCATTTAprotein transport protein SEC61 gamma subunit, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, protein transport, protein targeting; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein translocase SEC61 complex gamma subunit (InterPro:IPR008158), Protein secE/sec61-gamma protein (InterPro:IPR001901); BEST Arabidopsis thaliana protein match is: protein transport protein SEC61 gamma subunit, putative (TAIR:AT4G24920.1); Has 409 Blast hits to 409 proteins in 150 species: Archae - 2; Bacteria - 0; Metazoa - 186; Fungi - 85; Plants - 66; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT5G50870AT5G50870.1AAATGGGCTTCubiquitin-conjugating enzyme 27 (UBC27); FUNCTIONS IN: ubiquitin-protein ligase activity; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: UBC8 (UBIQUITIN CONJUGATING ENZYME 8); protein binding / ubiquitin-protein ligase (TAIR:AT5G41700.4); Has 7501 Blast hits to 7499 proteins in 306 species: Archae - 0; Bacteria - 0; Metazoa - 3692; Fungi - 1438; Plants - 1085; Viruses - 19; Other Eukaryotes - 1267 (source: NCBI BLink). 
AT5G51340AT5G51340.1AACGGGCCTAAATGGGCCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 149 Blast hits to 96 proteins in 39 species: Archae - 0; Bacteria - 2; Metazoa - 115; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G51620AT5G51620.1AAATGGGCCCAGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G51620.2AAATGGGCCCAGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G51620.3AAATGGGCCCAGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: emb2731 (embryo defective 2731) (TAIR:AT5G55940.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G52380AT5G52380.1AATAGGCCCATTTAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G43590.1); Has 2838 Blast hits to 1585 proteins in 218 species: Archae - 0; Bacteria - 0; Metazoa - 882; Fungi - 700; Plants - 374; Viruses - 490; Other Eukaryotes - 392 (source: NCBI BLink). 
AT5G52380.1GAAGCCCATTTAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: zinc knuckle (CCHC-type) family protein (TAIR:AT3G43590.1); Has 2838 Blast hits to 1585 proteins in 218 species: Archae - 0; Bacteria - 0; Metazoa - 882; Fungi - 700; Plants - 374; Viruses - 490; Other Eukaryotes - 392 (source: NCBI BLink). 
AT5G52920AT5G52920.1TAAATGGGCTTATencodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. 
AT5G53530AT5G53530.1TAAATGGGCTTGHomolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. 
AT5G53940AT5G53940.1AAATGGGCCCAGTTAAGGCCCAACAyippee family protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yippee-like protein (InterPro:IPR004910); BEST Arabidopsis thaliana protein match is: yippee family protein (TAIR:AT2G40110.1); Has 696 Blast hits to 696 proteins in 148 species: Archae - 0; Bacteria - 0; Metazoa - 401; Fungi - 132; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT5G54270AT5G54270.1TAAATGGGCLhcb3 protein is a component of the main light harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II). 
AT5G55000AT5G55000.1TAAGCCCATTTAFH protein interacting protein FIP2 
AT5G55000.2TAAGCCCATTTAFH protein interacting protein FIP2 
AT5G55160AT5G55160.1AGCCCATTTGAGCCCATTAAGEncodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays. 
AT5G55160.2AGCCCATTTGAGCCCATTAAGEncodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. SUMO2 can form SUMO chains through lysine residue 10 during in vitro assays. 
AT5G55310AT5G55310.1AAATGGGCCTTEncodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. 
AT5G55670AT5G55670.1CAAGCCCATTTRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT1G13190.1); Has 39714 Blast hits to 21553 proteins in 936 species: Archae - 21; Bacteria - 7210; Metazoa - 18978; Fungi - 3959; Plants - 3841; Viruses - 192; Other Eukaryotes - 5513 (source: NCBI BLink). 
AT5G56710AT5G56710.1ATTTGGGCCGTAAATGGGCTA60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). 
AT5G56710.2ATTTGGGCCGTAAATGGGCTA60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). 
AT5G56900AT5G56900.1GAAGCCCATTTACwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT5G56900.2GAAGCCCATTTACwfJ-like family protein / zinc finger (CCCH-type) family protein; FUNCTIONS IN: zinc ion binding, catalytic activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), Histidine triad-like motif (InterPro:IPR011146), Protein similar to CwfJ, C-terminal 1 (InterPro:IPR006768), Protein similar to CwfJ, C-terminal 2 (InterPro:IPR006767); BEST Arabidopsis thaliana protein match is: CwfJ-like family protein (TAIR:AT1G56290.1); Has 671 Blast hits to 575 proteins in 129 species: Archae - 0; Bacteria - 8; Metazoa - 298; Fungi - 245; Plants - 51; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT5G56910AT5G56910.1TAAATGGGCTTCINVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G56920.1); Has 34 Blast hits to 34 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G57290AT5G57290.1AAATGGGCTTTG60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G57290.2AAATGGGCTTTG60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G57290.3AAATGGGCTTTG60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G57440AT5G57440.1TGAACCGGCCCATTTAa member of haloacid dehalogenase-like hydrolase family 
AT5G57815AT5G57815.1TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTAcytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT5G58005AT5G58005.1TTTTGGGCCGGGCCTAAATGGGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 28; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G58005.2TTTTGGGCCGGGCCTAAATGGGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 87 Blast hits to 87 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 33; Fungi - 28; Plants - 24; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G58090AT5G58090.1AAATGGGCTTGglycosyl hydrolase family 17 protein; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: X8 (InterPro:IPR012946), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 17 (InterPro:IPR000490), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 17 protein (TAIR:AT4G31140.1); Has 1739 Blast hits to 1690 proteins in 137 species: Archae - 0; Bacteria - 12; Metazoa - 0; Fungi - 53; Plants - 1666; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G58100AT5G58100.1CAAGCCCATTTunknown protein; INVOLVED IN: pollen exine formation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28720.1); Has 82 Blast hits to 62 proteins in 14 species: Archae - 2; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 61; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT5G58220AT5G58220.1AAAAGGCCCATTTTransthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). 
AT5G58220.2AAAAGGCCCATTTTransthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). 
AT5G58220.3AAAAGGCCCATTTTransthyretin-Like protein (TTL); FUNCTIONS IN: steroid binding; INVOLVED IN: regulation of cell growth by extracellular stimulus, brassinosteroid mediated signaling; LOCATED IN: extrinsic to internal side of plasma membrane, peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bifunctional hydroxyisourate hydrolase/2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase (InterPro:IPR017129), OHCU_decarboxylase (InterPro:IPR018020), Hydroxyisourate hydrolase (InterPro:IPR014306), Transthyretin/hydroxyisourate hydrolase (InterPro:IPR000895); Has 2194 Blast hits to 2194 proteins in 493 species: Archae - 2; Bacteria - 1026; Metazoa - 464; Fungi - 57; Plants - 26; Viruses - 0; Other Eukaryotes - 619 (source: NCBI BLink). 
AT5G58230AT5G58230.1AAATGGGCCTTTTEncodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1. 
AT5G58290AT5G58290.1AAAAGGCCCATTTA26S proteasome AAA-ATPase subunit RPT3 (RPT3) mRNA, 
AT5G58420AT5G58420.1TAAATGGGCCTCT40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT5G58800AT5G58800.1TGAGCCCATTTAquinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). 
AT5G58800.2TGAGCCCATTTAquinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). 
AT5G59780AT5G59780.1AAATGGGCEncodes a putative transcription factor (MYB59). 
AT5G60140AT5G60140.1TTAAGGCCCATTTtranscriptional factor B3 family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Transcriptional factor B3 (InterPro:IPR003340); BEST Arabidopsis thaliana protein match is: transcriptional factor B3 family protein (TAIR:AT5G60130.1); Has 35622 Blast hits to 9758 proteins in 600 species: Archae - 149; Bacteria - 18835; Metazoa - 6044; Fungi - 2604; Plants - 1070; Viruses - 420; Other Eukaryotes - 6500 (source: NCBI BLink). 
AT5G60820AT5G60820.1CAAGCCCATTTAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G08139.1); Has 6800 Blast hits to 6591 proteins in 264 species: Archae - 0; Bacteria - 123; Metazoa - 2390; Fungi - 543; Plants - 2247; Viruses - 74; Other Eukaryotes - 1423 (source: NCBI BLink). 
AT5G61020AT5G61020.1TCAGCCCATTTECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT5G61020.2TCAGCCCATTTECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT5G61970AT5G61970.1TAAATGGGCCTGGsignal recognition particle-related / SRP-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 286 Blast hits to 286 proteins in 120 species: Archae - 2; Bacteria - 4; Metazoa - 134; Fungi - 62; Plants - 27; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). 
AT5G63080AT5G63080.1ATAATGGGCCTATAAATGGGCCGTAtranscription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transferase, transferring glycosyl groups (TAIR:AT1G78280.1); Has 1321 Blast hits to 1316 proteins in 215 species: Archae - 0; Bacteria - 213; Metazoa - 766; Fungi - 131; Plants - 81; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT5G64140AT5G64140.1GTGGCCCATTTAEncodes a putative ribosomal protein S28. 
AT5G65650AT5G65650.1AAATGGGCTTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1195 (InterPro:IPR010608); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G36660.1); Has 43 Blast hits to 43 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G66140AT5G66140.1ATAAGGCCCATTTAEncodes alpha5 subunit of 20S proteosome complex involved in protein degradation. 
AT5G66290AT5G66290.1TGGGCCCAATAAAATGGGCTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G66680AT5G66680.1TTCGGCCCATTTEncodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. 
AT5G66910AT5G66910.1AAATGGGCCGTAdisease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae - 22; Bacteria - 1182; Metazoa - 2936; Fungi - 103; Plants - 14487; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). 
AT5G66930AT5G66930.1AAATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). 
AT5G66930.2AAATGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). 
AT5G67370AT5G67370.1AAATGGGCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1230 (InterPro:IPR009631); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11840.1); Has 264 Blast hits to 264 proteins in 69 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.