version

Summary of AtREG388 (All List)

OrganismArabidopsis thaliana  
IDAtREG388  
SequenceGACGTGGC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGT  ACGT sequence (from -155 to -152) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;  
ACGTG  ABRE-like sequence (from -199 to -195) required for etiolation-induced expression of erd1 (early responsive to dehydration) in Arabidopsis;  
GCCAC  one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; SORLIP 1 is most over-represented, and most statistically singnificant; See also S000483, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs); Over-represented in light-induced cotyledon and root common genes and root-specific genes (Jiao et al. 2005; see S000486);  
ACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count301  

Entry Sequences (301 entries)

LocusGene modelSequenceDescription
AT1G01720AT1G01720.1TCGCCACGTCAGCBelongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. 
AT1G02260AT1G02260.1GACGTGGCAGtransmembrane protein, putative; FUNCTIONS IN: citrate transmembrane transporter activity, transporter activity; INVOLVED IN: citrate transport; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Divalent ion symporter (InterPro:IPR004680); Has 5612 Blast hits to 3945 proteins in 1017 species: Archae - 185; Bacteria - 4274; Metazoa - 237; Fungi - 56; Plants - 87; Viruses - 2; Other Eukaryotes - 771 (source: NCBI BLink). 
AT1G02700AT1G02700.1CCGCCACGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02140.1); Has 34 Blast hits to 34 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 4; Plants - 16; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G03090AT1G03090.1ATGCCACGTCACMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. 
AT1G03090.2ATGCCACGTCACMCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. 
AT1G03905AT1G03905.1CTGACGTGGCGAABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink). 
AT1G03905.1CTGACGTGGCGAABC transporter family protein; FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: POP1; transporter (TAIR:AT5G44110.1); Has 104361 Blast hits to 99730 proteins in 2063 species: Archae - 2221; Bacteria - 80319; Metazoa - 1669; Fungi - 992; Plants - 893; Viruses - 4; Other Eukaryotes - 18263 (source: NCBI BLink). 
AT1G04410AT1G04410.1GATGACGTGGCGGmalate dehydrogenase, cytosolic, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: response to cadmium ion, response to salt stress; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Malate dehydrogenase, NAD-dependent, cytosolic (InterPro:IPR011274), Lactate/malate dehydrogenase (InterPro:IPR001236), Malate dehydrogenase, NAD or NADP (InterPro:IPR010945), NAD(P)-binding (InterPro:IPR016040), L-lactate/malate dehydrogenase (InterPro:IPR001557), Malate dehydrogenase, active site (InterPro:IPR001252), Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (InterPro:IPR015955); BEST Arabidopsis thaliana protein match is: malate dehydrogenase, cytosolic, putative (TAIR:AT5G43330.1); Has 7871 Blast hits to 7869 proteins in 1725 species: Archae - 115; Bacteria - 3866; Metazoa - 1047; Fungi - 188; Plants - 460; Viruses - 0; Other Eukaryotes - 2195 (source: NCBI BLink). 
AT1G04420AT1G04420.1CCGCCACGTCATCaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395); BEST Arabidopsis thaliana protein match is: KAB1 (POTASSIUM CHANNEL BETA SUBUNIT); oxidoreductase/ potassium channel (TAIR:AT1G04690.1); Has 17372 Blast hits to 17351 proteins in 1400 species: Archae - 300; Bacteria - 9458; Metazoa - 1333; Fungi - 1228; Plants - 519; Viruses - 0; Other Eukaryotes - 4534 (source: NCBI BLink). 
AT1G05570AT1G05570.1GATGACGTGGCAGEncodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. 
AT1G07040AT1G07040.1TCGCCACGTCunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G27030.1); Has 403 Blast hits to 403 proteins in 131 species: Archae - 0; Bacteria - 232; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). 
AT1G07870AT1G07870.1GACGTGGCTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: response to salt stress, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G28590.1); Has 82095 Blast hits to 81092 proteins in 2973 species: Archae - 50; Bacteria - 7578; Metazoa - 35765; Fungi - 6178; Plants - 18436; Viruses - 378; Other Eukaryotes - 13710 (source: NCBI BLink). 
AT1G08830AT1G08830.1CTGACGTGGCTTTTTEncodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. 
AT1G08830.2CTGACGTGGCTTTTTEncodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. 
AT1G09520AT1G09520.1GTGCCACGTCAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G10090AT1G10090.1ATGCCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF221 (InterPro:IPR003864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G58520.1); Has 914 Blast hits to 823 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 448; Plants - 243; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT1G11890AT1G11890.1AGCCACGTCATCmember of SEC22 Gene Family 
AT1G13640AT1G13640.1GTGACGTGGCACphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 401 Blast hits to 395 proteins in 120 species: Archae - 0; Bacteria - 2; Metazoa - 139; Fungi - 53; Plants - 136; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink). 
AT1G14140AT1G14140.1TTGCCACGTCGmitochondrial substrate carrier family protein; FUNCTIONS IN: transporter activity, binding; INVOLVED IN: transport, mitochondrial transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial substrate carrier (InterPro:IPR001993), Mitochondrial substrate/solute carrier (InterPro:IPR018108), Adenine nucleotide translocator 1 (InterPro:IPR002113); BEST Arabidopsis thaliana protein match is: ATUCP2 (UNCOUPLING PROTEIN 2); oxidative phosphorylation uncoupler (TAIR:AT5G58970.1); Has 20970 Blast hits to 10141 proteins in 366 species: Archae - 0; Bacteria - 0; Metazoa - 10383; Fungi - 5794; Plants - 2960; Viruses - 3; Other Eukaryotes - 1830 (source: NCBI BLink). 
AT1G16150AT1G16150.1AGCCACGTCATEncodes a cell-wall associated kinase like protein of the receptor-like kinase (RLK) superfamily. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. 
AT1G18330AT1G18330.1CTGACGTGGCACEARLY-PHYTOCHROME-RESPONSIVE1 
AT1G18330.2CTGACGTGGCACEARLY-PHYTOCHROME-RESPONSIVE1 
AT1G20340AT1G20340.1AAAACGCCACGTCATrecombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. 
AT1G20350AT1G20350.1ATGACGTGGCGTTTTmitochondrial inner membrane translocase 
AT1G20630AT1G20630.1AGCCACGTCCatalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. 
AT1G20696AT1G20696.1GATGACGTGGCEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. 
AT1G20696.2GATGACGTGGCEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. 
AT1G20696.3GATGACGTGGCEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. 
AT1G21750AT1G21750.1AAGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. 
AT1G21750.2AAGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. 
AT1G23200AT1G23200.1TGACGTGGCTpectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: endomembrane system, cell wall, plant-type cell wall; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT2G45220.1); Has 1490 Blast hits to 1459 proteins in 273 species: Archae - 6; Bacteria - 408; Metazoa - 1; Fungi - 133; Plants - 940; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G26270AT1G26270.1AAGCCACGTCAphosphatidylinositol 3- and 4-kinase family protein; FUNCTIONS IN: inositol or phosphatidylinositol kinase activity, phosphotransferase activity, alcohol group as acceptor; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol 3- and 4-kinase, catalytic (InterPro:IPR000403); BEST Arabidopsis thaliana protein match is: phosphatidylinositol 3- and 4-kinase family protein (TAIR:AT2G03890.1); Has 429 Blast hits to 418 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 149; Fungi - 63; Plants - 133; Viruses - 0; Other Eukaryotes - 82 (source: NCBI BLink). 
AT1G29330AT1G29330.1ATTGCCACGTCATCEncodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. 
AT1G30520AT1G30520.1CTGCCACGTCATCEncodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. 
AT1G32130AT1G32130.1GATGACGTGGCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TFIIS N-terminal (InterPro:IPR017923), IWS1, C-terminal (InterPro:IPR008654); BEST Arabidopsis thaliana protein match is: IWS1 C-terminus family protein (TAIR:AT4G19000.1); Has 907 Blast hits to 871 proteins in 182 species: Archae - 4; Bacteria - 14; Metazoa - 417; Fungi - 195; Plants - 42; Viruses - 8; Other Eukaryotes - 227 (source: NCBI BLink). 
AT1G35720AT1G35720.1GCCACGTCGEncodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. 
AT1G47970AT1G47970.1ACGCCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; Has 85194 Blast hits to 34173 proteins in 1291 species: Archae - 566; Bacteria - 13003; Metazoa - 26927; Fungi - 13823; Plants - 4747; Viruses - 1476; Other Eukaryotes - 24652 (source: NCBI BLink). 
AT1G48410AT1G48410.1TCGCCACGTCGEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. 
AT1G48410.2TCGCCACGTCGEncodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. 
AT1G48620AT1G48620.1AAAACGCCACGTCATCThis gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. 
AT1G52510AT1G52510.2ACGCCACGTCGhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epoxide hydrolase-like (InterPro:IPR000639), Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT4G12830.1); Has 3440 Blast hits to 3440 proteins in 614 species: Archae - 16; Bacteria - 2126; Metazoa - 96; Fungi - 67; Plants - 194; Viruses - 0; Other Eukaryotes - 941 (source: NCBI BLink). 
AT1G52590AT1G52590.1ATGACGTGGCATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative thiol-disulphide oxidoreductase DCC (InterPro:IPR007263); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 622 Blast hits to 622 proteins in 201 species: Archae - 0; Bacteria - 363; Metazoa - 0; Fungi - 0; Plants - 36; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT1G52600AT1G52600.1ATGCCACGTCATsignal peptidase, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis, signal peptide processing; LOCATED IN: endoplasmic reticulum, plasma membrane, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S24, S26A and S26B, C-terminal (InterPro:IPR011056), Peptidase S26B, eukaryotic signal peptidase (InterPro:IPR001733), Peptidase S24, S26A, S26B and S26C (InterPro:IPR015927); BEST Arabidopsis thaliana protein match is: signal peptidase, putative (TAIR:AT3G15710.1); Has 592 Blast hits to 592 proteins in 237 species: Archae - 51; Bacteria - 117; Metazoa - 192; Fungi - 97; Plants - 49; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). 
AT1G53400AT1G53400.1GTGACGTGGCAAunknown protein; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45740.1); Has 229 Blast hits to 229 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 40; Plants - 47; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT1G53670AT1G53670.1CGACGTGGCAGmethionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). 
AT1G53670.2CGACGTGGCAGmethionine sulfoxide reductase B 1 (MSRB1); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: response to oxidative stress, N-terminal protein myristoylation; LOCATED IN: chloroplast stroma, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04830.1); Has 5981 Blast hits to 5978 proteins in 1232 species: Archae - 55; Bacteria - 2690; Metazoa - 223; Fungi - 85; Plants - 107; Viruses - 1; Other Eukaryotes - 2820 (source: NCBI BLink). 
AT1G54780AT1G54780.1TAAAACGCCACGTCGthylakoid lumen 18.3 kDa protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF477 (InterPro:IPR007621); Has 159 Blast hits to 159 proteins in 71 species: Archae - 0; Bacteria - 103; Metazoa - 2; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT1G56220AT1G56220.1TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G56220.2TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G56220.3TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G56220.4TCGCCACGTCACdormancy/auxin associated family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Dormancyauxin associated (InterPro:IPR008406); BEST Arabidopsis thaliana protein match is: dormancy/auxin associated protein-related (TAIR:AT1G54070.1); Has 130 Blast hits to 129 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 129; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G56330AT1G56330.1ACGCCACGTCACEncodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. 
AT1G56340AT1G56340.1AGCCACGTCATEncodes calreticulin CRT1. 
AT1G56340.2AGCCACGTCATEncodes calreticulin CRT1. 
AT1G62180AT1G62180.1TCGCCACGTCATCencodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. 
AT1G63290AT1G63290.1GTGCCACGTCATCribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT3G01850.2); Has 6133 Blast hits to 6130 proteins in 1420 species: Archae - 32; Bacteria - 2852; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2918 (source: NCBI BLink). 
AT1G63900AT1G63900.1GCCACGTCATCzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: ZCF61; protein binding / zinc ion binding (TAIR:AT1G59560.1); Has 2665 Blast hits to 2573 proteins in 206 species: Archae - 0; Bacteria - 8; Metazoa - 1654; Fungi - 30; Plants - 409; Viruses - 201; Other Eukaryotes - 363 (source: NCBI BLink). 
AT1G68010AT1G68010.1GCCACGTCAGCEncodes hydroxypyruvate reductase. 
AT1G72510AT1G72510.1CTGACGTGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G72510.2CTGACGTGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1677, plant (InterPro:IPR012876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G09970.1); Has 130 Blast hits to 129 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G72650AT1G72650.1CTGACGTGGCAATArabidopsis thaliana myb family transcription factor (At1g72650) 
AT1G72650.2CTGACGTGGCAATArabidopsis thaliana myb family transcription factor (At1g72650) 
AT1G74730AT1G74730.1CTGACGTGGCAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1118 (InterPro:IPR009500); Has 41 Blast hits to 41 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G76020AT1G76020.1CTGCCACGTCACINVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G20225.1); Has 118 Blast hits to 116 proteins in 37 species: Archae - 0; Bacteria - 51; Metazoa - 12; Fungi - 4; Plants - 28; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT1G76030AT1G76030.1GTGACGTGGCAGEncodes the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. 
AT1G76100AT1G76100.1ATGCCACGTCACOne of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. 
AT1G77810AT1G77810.1ATGACGTGGCATgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT1G77810.2ATGACGTGGCATgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, beta-1,3-galactosyltransferase activity; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: Golgi apparatus; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: DD46; galactosyltransferase/ transferase, transferring hexosyl groups (TAIR:AT1G22015.1); Has 1001 Blast hits to 996 proteins in 75 species: Archae - 0; Bacteria - 2; Metazoa - 709; Fungi - 0; Plants - 279; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT1G79340AT1G79340.1ATGCCACGTCAGmetacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink). 
AT1G80580AT1G80580.1ATTGCCACGTCAAAACGCencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. 
AT2G01590AT2G01590.1GCTGACGTGGCLikely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located in the membrane fraction of chloroplast. Mutant has impaired NAD(P)H dehydrogenase activity. 
AT2G06025AT2G06025.1TCGCCACGTCACGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT4G28030.1); Has 565 Blast hits to 565 proteins in 223 species: Archae - 42; Bacteria - 278; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 54 (source: NCBI BLink). 
AT2G15695AT2G15695.1ATGACGTGGCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF829, eukaryotic (InterPro:IPR008547); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G44250.1); Has 84 Blast hits to 84 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 30; Fungi - 0; Plants - 45; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G17870AT2G17870.1GCTGACGTGGCGAcold-shock DNA-binding family protein; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Cold shock protein (InterPro:IPR011129), Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084), Cold-shock protein, DNA-binding (InterPro:IPR002059); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 53154 Blast hits to 27277 proteins in 1824 species: Archae - 36; Bacteria - 18684; Metazoa - 10644; Fungi - 2506; Plants - 4908; Viruses - 6728; Other Eukaryotes - 9648 (source: NCBI BLink). 
AT2G20260AT2G20260.1TTGCCACGTCATCEncodes subunit E of photosystem I. 
AT2G21060AT2G21060.1GTGACGTGGCGGglycine-rich protein (AtGRP2b) 
AT2G21970AT2G21970.1AGCCACGTCGstress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein 
AT2G22010AT2G22010.1ACGTCATCAGCCACGTCATCEncodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. 
AT2G23120AT2G23120.1AAGCCACGTCGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant protein 18 (InterPro:IPR018930); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23110.1); Has 25 Blast hits to 25 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G24020AT2G24020.1GTGACGTGGCGunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0133 (InterPro:IPR004401); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30620.1); Has 1553 Blast hits to 1553 proteins in 610 species: Archae - 0; Bacteria - 1223; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 301 (source: NCBI BLink). 
AT2G25430AT2G25430.1TCGCCACGTCATCepsin N-terminal homology (ENTH) domain-containing protein; FUNCTIONS IN: phospholipid binding, clathrin binding, binding, phosphatidylinositol binding; INVOLVED IN: clathrin coat assembly; LOCATED IN: nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Epsin-like, N-terminal (InterPro:IPR013809), ANTH (InterPro:IPR011417), ENTH/VHS (InterPro:IPR008942), Clathrin adaptor, phosphoinositide-binding, GAT-like (InterPro:IPR014712); BEST Arabidopsis thaliana protein match is: epsin N-terminal homology (ENTH) domain-containing protein / clathrin assembly protein-related (TAIR:AT4G32285.2); Has 1419 Blast hits to 1078 proteins in 187 species: Archae - 4; Bacteria - 130; Metazoa - 620; Fungi - 114; Plants - 393; Viruses - 2; Other Eukaryotes - 156 (source: NCBI BLink). 
AT2G28940AT2G28940.1TCGCCACGTCATCprotein kinase family protein; FUNCTIONS IN: protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G39110.1); Has 81015 Blast hits to 80048 proteins in 2308 species: Archae - 40; Bacteria - 6913; Metazoa - 35685; Fungi - 6155; Plants - 18356; Viruses - 328; Other Eukaryotes - 13538 (source: NCBI BLink). 
AT2G29530AT2G29530.1GATGACGTGGCGTEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. 
AT2G29530.2GATGACGTGGCGTEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. 
AT2G29530.3GATGACGTGGCGTEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. 
AT2G29540AT2G29540.1ACGCCACGTCATCRNA polymerase I(A) and III(C) 14 kDa subunit 
AT2G29540.2ACGCCACGTCATCRNA polymerase I(A) and III(C) 14 kDa subunit 
AT2G29540.3ACGCCACGTCATCRNA polymerase I(A) and III(C) 14 kDa subunit 
AT2G33180AT2G33180.1TTGCCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G34250AT2G34250.1GACGTGGCAGprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G34250.2GACGTGGCAGprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G37250AT2G37250.1ATGCCACGTCAGencodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth 
AT2G40490AT2G40490.1ATGACGTGGCAGHEME2; FUNCTIONS IN: uroporphyrinogen decarboxylase activity; INVOLVED IN: porphyrin biosynthetic process; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uroporphyrinogen decarboxylase HemE (InterPro:IPR006361), Uroporphyrinogen decarboxylase (URO-D) (InterPro:IPR000257); BEST Arabidopsis thaliana protein match is: HEME1; uroporphyrinogen decarboxylase (TAIR:AT3G14930.2); Has 5539 Blast hits to 5539 proteins in 1187 species: Archae - 101; Bacteria - 2315; Metazoa - 206; Fungi - 87; Plants - 67; Viruses - 0; Other Eukaryotes - 2763 (source: NCBI BLink). 
AT2G40770AT2G40770.1AAGCCACGTCGATP binding / DNA binding / helicase/ nucleic acid binding / protein binding / zinc ion binding; FUNCTIONS IN: in 6 functions; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, PHD-type (InterPro:IPR001965), SNF2-related (InterPro:IPR000330), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: RAD5; ATP binding / ATP-dependent helicase/ DNA binding / helicase/ hydrolase, acting on acid anhydrides, in phosphorus-containing anhydrides / nucleic acid binding / protein binding / zinc ion binding (TAIR:AT5G22750.1); Has 13590 Blast hits to 8685 proteins in 812 species: Archae - 59; Bacteria - 2742; Metazoa - 4195; Fungi - 3438; Plants - 951; Viruses - 102; Other Eukaryotes - 2103 (source: NCBI BLink). 
AT2G41790AT2G41790.1AAATGACGTGGCTpeptidase M16 family protein / insulinase family protein; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: peptidase M16 family protein / insulinase family protein (TAIR:AT3G57470.2); Has 5997 Blast hits to 5925 proteins in 1223 species: Archae - 5; Bacteria - 3363; Metazoa - 558; Fungi - 370; Plants - 146; Viruses - 3; Other Eukaryotes - 1552 (source: NCBI BLink). 
AT2G42750AT2G42750.1TTGCCACGTCAGCDNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), 4Fe-4S ferredoxin, iron-sulpur binding domain (InterPro:IPR017896), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (TAIR:AT5G23240.1); Has 11990 Blast hits to 11989 proteins in 1806 species: Archae - 113; Bacteria - 4757; Metazoa - 2272; Fungi - 965; Plants - 810; Viruses - 15; Other Eukaryotes - 3058 (source: NCBI BLink). 
AT2G43400AT2G43400.1TTGCCACGTCATCEncodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. 
AT2G45010AT2G45010.1AAAACGACGACGTGGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51400.1); Has 322 Blast hits to 321 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 15; Plants - 299; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G45010.2AAAACGACGACGTGGCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function Cys-rich (InterPro:IPR006461); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51400.1); Has 322 Blast hits to 321 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 15; Plants - 299; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G45820AT2G45820.1GTGACGTGGCATDNA-binding protein, putative; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Remorin, C-terminal region (InterPro:IPR005516), Remorin, N-terminal region (InterPro:IPR005518); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / remorin family protein (TAIR:AT3G61260.1); Has 2170 Blast hits to 1469 proteins in 249 species: Archae - 2; Bacteria - 278; Metazoa - 371; Fungi - 179; Plants - 300; Viruses - 4; Other Eukaryotes - 1036 (source: NCBI BLink). 
AT2G46790AT2G46790.1AAGCCACGTCAGCPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. 
AT2G46790.2AAGCCACGTCAGCPseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. 
AT2G46820AT2G46820.1CCGCCACGTCAGCEncodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. 
AT2G46820.2CCGCCACGTCAGCEncodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. 
AT2G47470AT2G47470.1ACGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. 
AT2G47470.2ACGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. 
AT2G47470.3ACGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. 
AT2G47470.4ACGCCACGTCATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. 
AT2G47710AT2G47710.1AGCCACGTCATCuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to stress; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49050.1); Has 1402 Blast hits to 1369 proteins in 323 species: Archae - 50; Bacteria - 850; Metazoa - 46; Fungi - 22; Plants - 381; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT3G01090AT3G01090.1ATGCCACGTCencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase 
AT3G01090.2ATGCCACGTCencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase 
AT3G01090.3ATGCCACGTCencodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase 
AT3G01570AT3G01570.1GTGCCACGTCACglycine-rich protein / oleosin; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: lipid storage; LOCATED IN: monolayer-surrounded lipid storage body, integral to membrane, membrane; CONTAINS InterPro DOMAIN/s: Oleosin (InterPro:IPR000136); BEST Arabidopsis thaliana protein match is: OLEO2 (OLEOSIN 2) (TAIR:AT5G40420.1); Has 384 Blast hits to 384 proteins in 47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 384; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01850AT3G01850.1ATGCCACGTCATCribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). 
AT3G01850.2ATGCCACGTCATCribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative; FUNCTIONS IN: ribulose-phosphate 3-epimerase activity, catalytic activity; INVOLVED IN: carbohydrate metabolic process, metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Ribulose-phosphate 3-epimerase (InterPro:IPR000056), Ribulose-phosphate binding barrel (InterPro:IPR011060); BEST Arabidopsis thaliana protein match is: ribulose-phosphate 3-epimerase, cytosolic, putative / pentose-5-phosphate 3-epimerase, putative (TAIR:AT1G63290.1); Has 6149 Blast hits to 6146 proteins in 1420 species: Archae - 32; Bacteria - 2858; Metazoa - 158; Fungi - 90; Plants - 83; Viruses - 0; Other Eukaryotes - 2928 (source: NCBI BLink). 
AT3G01990AT3G01990.1GTGCCACGTCATCMember of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. 
AT3G04460AT3G04460.1GATGACGTGGCTRING finger protein involved in peroxisome biogenesis. 
AT3G07090AT3G07090.1GACGTGGCAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF862, eukaryotic (InterPro:IPR008580); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25170.1); Has 596 Blast hits to 596 proteins in 139 species: Archae - 0; Bacteria - 0; Metazoa - 201; Fungi - 84; Plants - 173; Viruses - 0; Other Eukaryotes - 138 (source: NCBI BLink). 
AT3G07360AT3G07360.1ATGACGTGGCAAEncodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. 
AT3G07360.2ATGACGTGGCAAEncodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. 
AT3G07360.3ATGACGTGGCAAEncodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. 
AT3G07460AT3G07460.1GACGTGGCTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07470.1); Has 287 Blast hits to 287 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 286; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G07460.2GACGTGGCTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07470.1); Has 287 Blast hits to 287 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 286; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G07470AT3G07470.1CGACGTGGCTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07460.1); Has 339 Blast hits to 339 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 338; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G07680AT3G07680.1ATGACGTGGCAATemp24/gp25L/p24 family protein; FUNCTIONS IN: protein transmembrane transporter activity; INVOLVED IN: intracellular protein transport, transport; LOCATED IN: endomembrane system, integral to membrane, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GOLD (InterPro:IPR009038), emp24/gp25L/p24 (InterPro:IPR000348); BEST Arabidopsis thaliana protein match is: emp24/gp25L/p24 protein-related (TAIR:AT3G22845.1); Has 672 Blast hits to 672 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 376; Fungi - 151; Plants - 95; Viruses - 0; Other Eukaryotes - 50 (source: NCBI BLink). 
AT3G08780AT3G08780.1ACGCCACGTCGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G08780.2ACGCCACGTCGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; Has 94 Blast hits to 94 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 72; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G09690AT3G09690.1CCGCCACGTCAGhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G09690.2CCGCCACGTCAGhydrolase, alpha/beta fold family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Alpha/beta hydrolase fold-1 (InterPro:IPR000073); BEST Arabidopsis thaliana protein match is: hydrolase, alpha/beta fold family protein (TAIR:AT5G02970.1); Has 647 Blast hits to 641 proteins in 160 species: Archae - 2; Bacteria - 318; Metazoa - 4; Fungi - 38; Plants - 201; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G11397AT3G11397.1CTGCCACGTCATCPRENYLATED RAB ACCEPTOR 1.A3 (PRA1.A3); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum, membrane; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA1.A2 (PRENYLATED RAB ACCEPTOR 1.A2) (TAIR:AT5G05987.1); Has 234 Blast hits to 234 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 155; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G11900AT3G11900.1GTGCCACGTCACencodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. 
AT3G13445AT3G13445.1GCTGACGTGGCTBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex 
AT3G13445.2GCTGACGTGGCTBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex 
AT3G13450AT3G13450.1CTGACGTGGCTbranched chain alpha-keto acid dehydrogenase E1 beta 
AT3G13670AT3G13670.1CTGACGTGGCATprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT2G25760.1); Has 12090 Blast hits to 12038 proteins in 826 species: Archae - 10; Bacteria - 3127; Metazoa - 4213; Fungi - 955; Plants - 1425; Viruses - 207; Other Eukaryotes - 2153 (source: NCBI BLink). 
AT3G13700AT3G13700.1GACGTGGCAGRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G13700.2GACGTGGCAGRNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G13710AT3G13710.1GACGTGGCAGPRENYLATED RAB ACCEPTOR 1.F4 (PRA1.F4); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: vesicle-mediated transport; LOCATED IN: endoplasmic reticulum; CONTAINS InterPro DOMAIN/s: Prenylated rab acceptor PRA1 (InterPro:IPR004895); BEST Arabidopsis thaliana protein match is: PRA8 (TAIR:AT3G13720.1); Has 294 Blast hits to 294 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 71; Fungi - 30; Plants - 172; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT3G14067AT3G14067.1GACGTGGCATsubtilase family protein; FUNCTIONS IN: identical protein binding, serine-type endopeptidase activity; INVOLVED IN: proteolysis, negative regulation of catalytic activity; LOCATED IN: apoplast, plasma membrane, vacuole, plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Proteinase inhibitor, propeptide (InterPro:IPR009020), Peptidase S8 and S53, subtilisin, kexin, sedolisin (InterPro:IPR000209), Peptidase S8, subtilisin-related (InterPro:IPR015500), Proteinase inhibitor I9, subtilisin propeptide (InterPro:IPR010259); BEST Arabidopsis thaliana protein match is: ARA12; serine-type endopeptidase (TAIR:AT5G67360.1); Has 4847 Blast hits to 4214 proteins in 722 species: Archae - 147; Bacteria - 2629; Metazoa - 66; Fungi - 489; Plants - 902; Viruses - 0; Other Eukaryotes - 614 (source: NCBI BLink). 
AT3G14070AT3G14070.1ATGCCACGTCInvolved in cation (K, Na and Mn) homeostasis and transport 
AT3G14130AT3G14130.1ACGCCACGTC(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14150.2); Has 9793 Blast hits to 9779 proteins in 1166 species: Archae - 155; Bacteria - 3369; Metazoa - 366; Fungi - 469; Plants - 174; Viruses - 0; Other Eukaryotes - 5260 (source: NCBI BLink). 
AT3G15090AT3G15090.1CTGCCACGTCoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, zinc ion binding, catalytic activity; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 20659 Blast hits to 20565 proteins in 1484 species: Archae - 253; Bacteria - 11042; Metazoa - 1064; Fungi - 2188; Plants - 463; Viruses - 0; Other Eukaryotes - 5649 (source: NCBI BLink). 
AT3G15360AT3G15360.1ATGACGTGGCGAencodes a prokaryotic thioredoxin 
AT3G19100AT3G19100.1GACGTGGCAAcalcium-dependent protein kinase, putative / CDPK, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: calcium-dependent protein kinase, putative / CDPK, putative (TAIR:AT1G49580.1); Has 88782 Blast hits to 87368 proteins in 2426 species: Archae - 71; Bacteria - 8151; Metazoa - 38639; Fungi - 8417; Plants - 15332; Viruses - 469; Other Eukaryotes - 17703 (source: NCBI BLink). 
AT3G22880AT3G22880.1ATGACGTGGCATExpression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene. 
AT3G22968AT3G22968.1CGACGTGGCATUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF59 represents a conserved upstream opening reading frame relative to major ORF AT3G22970.1 
AT3G22970AT3G22970.1CGACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G22970.2CGACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14620.1); Has 210 Blast hits to 209 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 208; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G23080AT3G23080.1AAGCCACGTCATCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14500.1); Has 247 Blast hits to 246 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 162; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G23080.2AAGCCACGTCATCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14500.1); Has 247 Blast hits to 246 proteins in 61 species: Archae - 0; Bacteria - 0; Metazoa - 162; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT3G23700AT3G23700.1ATGCCACGTCACS1 RNA-binding domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: response to cold; LOCATED IN: chloroplast stroma, nucleus, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029); BEST Arabidopsis thaliana protein match is: RPS1 (RIBOSOMAL PROTEIN S1); RNA binding / structural constituent of ribosome (TAIR:AT5G30510.1); Has 19049 Blast hits to 12627 proteins in 1560 species: Archae - 136; Bacteria - 11493; Metazoa - 155; Fungi - 150; Plants - 198; Viruses - 0; Other Eukaryotes - 6917 (source: NCBI BLink). 
AT3G24520AT3G24520.1AAGCCACGTCAmember of Heat Stress Transcription Factor (Hsf) family 
AT3G26560AT3G26560.1GACGACGTGGCATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). 
AT3G46780AT3G46780.1ATGACGTGGCATPLASTID TRANSCRIPTIONALLY ACTIVE 16 (PTAC16); FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: in 6 components; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: binding / catalytic/ coenzyme binding (TAIR:AT3G18890.1); Has 939 Blast hits to 790 proteins in 244 species: Archae - 1; Bacteria - 344; Metazoa - 68; Fungi - 66; Plants - 99; Viruses - 22; Other Eukaryotes - 339 (source: NCBI BLink). 
AT3G50690AT3G50690.1ACGCCACGTCATCleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 79321 Blast hits to 33428 proteins in 1262 species: Archae - 436; Bacteria - 8197; Metazoa - 29512; Fungi - 13019; Plants - 4257; Viruses - 1007; Other Eukaryotes - 22893 (source: NCBI BLink). 
AT3G51240AT3G51240.1GACGTGGCTTEncodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and chalcone isomerases. Regulates flavonoid biosynthesis. 
AT3G51250AT3G51250.1ACGCCACGTCATCsenescence/dehydration-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Senescence-associated (InterPro:IPR009686); BEST Arabidopsis thaliana protein match is: ERD7 (EARLY-RESPONSIVE TO DEHYDRATION 7) (TAIR:AT2G17840.1); Has 204 Blast hits to 204 proteins in 60 species: Archae - 0; Bacteria - 2; Metazoa - 79; Fungi - 29; Plants - 83; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT3G53668AT3G53668.1GCCACGTCUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF51 represents a conserved upstream opening reading frame relative to major ORF AT3G53670.1 
AT3G53670AT3G53670.1GCCACGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G37480.1); Has 146 Blast hits to 143 proteins in 22 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 11; Plants - 128; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G54500AT3G54500.1CTGACGTGGCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G54500.2CTGACGTGGCAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: dentin sialophosphoprotein-related (TAIR:AT5G64170.2); Has 108 Blast hits to 102 proteins in 33 species: Archae - 0; Bacteria - 4; Metazoa - 36; Fungi - 7; Plants - 52; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G55660AT3G55660.1CTGACGTGGCAGEncodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. 
AT3G56140AT3G56140.1AAATGACGTGGCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF399 (InterPro:IPR007314); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40400.2); Has 354 Blast hits to 354 proteins in 86 species: Archae - 0; Bacteria - 111; Metazoa - 36; Fungi - 6; Plants - 172; Viruses - 6; Other Eukaryotes - 23 (source: NCBI BLink). 
AT3G56270AT3G56270.1AAGCCACGTCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF827, plant (InterPro:IPR008545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G40480.1); Has 136 Blast hits to 136 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT3G63520AT3G63520.1CGACGTGGCAGCGTTTEncodes a protein with 9-<i>cis</i>-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including &#946;-carotene, lutein, zeaxanthin, and all-<i>trans</i>-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-<i>cis</i>-double or allenic bonds. 
AT4G00990AT4G00990.1GCCACGTCACtranscription factor jumonji (jmjC) domain-containing protein; FUNCTIONS IN: protein binding, transcription factor activity, zinc ion binding; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor jumonji/aspartyl beta-hydroxylase (InterPro:IPR003347), Zinc finger, RING-type (InterPro:IPR001841), Transcription factor jumonji (InterPro:IPR013129); BEST Arabidopsis thaliana protein match is: transcription factor jumonji (jmjC) domain-containing protein (TAIR:AT1G62310.1); Has 700 Blast hits to 466 proteins in 80 species: Archae - 0; Bacteria - 8; Metazoa - 459; Fungi - 31; Plants - 147; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT4G01800AT4G01800.1ATGACGTGGCAApreprotein translocase secA subunit, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: intracellular protein transport, protein targeting, protein import; LOCATED IN: chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: SecA Wing and Scaffold (InterPro:IPR011116), SecA preprotein cross-linking region (InterPro:IPR011130), SecA DEAD-like (InterPro:IPR011115), SecA motor DEAD (InterPro:IPR014018), SecA protein (InterPro:IPR000185); BEST Arabidopsis thaliana protein match is: ATP binding / protein binding (TAIR:AT1G21650.1); Has 15109 Blast hits to 10309 proteins in 1586 species: Archae - 2; Bacteria - 6696; Metazoa - 44; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 8307 (source: NCBI BLink). 
AT4G02940AT4G02940.1AGCCACGTCAGCoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G48080.1); Has 143 Blast hits to 141 proteins in 42 species: Archae - 0; Bacteria - 8; Metazoa - 22; Fungi - 12; Plants - 70; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). 
AT4G03100AT4G03100.1ACGCCACGTCArac GTPase activating protein, putative; FUNCTIONS IN: Rac GTPase activator activity; INVOLVED IN: signal transduction; LOCATED IN: intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: PAK-box/P21-Rho-binding (InterPro:IPR000095), Rho GTPase activation protein (InterPro:IPR008936), RhoGAP (InterPro:IPR000198); BEST Arabidopsis thaliana protein match is: rac GTPase activating protein, putative (TAIR:AT2G46710.1); Has 3126 Blast hits to 3120 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 2422; Fungi - 299; Plants - 105; Viruses - 0; Other Eukaryotes - 300 (source: NCBI BLink). 
AT4G03150AT4G03150.1AGCCACGTCACGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 60 Blast hits to 60 proteins in 30 species: Archae - 0; Bacteria - 46; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G03510AT4G03510.1TCGCCACGTCATRMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. 
AT4G03510.2TCGCCACGTCATRMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. 
AT4G04640AT4G04640.1ACGCCACGTCAOne of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. 
AT4G08180AT4G08180.1TCGCCACGTCAGCOSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink). 
AT4G08180.2TCGCCACGTCAGCOSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink). 
AT4G08180.3TCGCCACGTCAGCOSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1C (ORP1C); FUNCTIONS IN: phosphoinositide binding, oxysterol binding; INVOLVED IN: steroid metabolic process, signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pleckstrin homology-type (InterPro:IPR011993), Oxysterol-binding protein (InterPro:IPR000648), Pleckstrin homology (InterPro:IPR001849); BEST Arabidopsis thaliana protein match is: ORP1D (OSBP(OXYSTEROL BINDING PROTEIN)-RELATED PROTEIN 1D); oxysterol binding (TAIR:AT1G13170.1); Has 2131 Blast hits to 1984 proteins in 165 species: Archae - 0; Bacteria - 4; Metazoa - 1234; Fungi - 475; Plants - 169; Viruses - 0; Other Eukaryotes - 249 (source: NCBI BLink). 
AT4G08390AT4G08390.3TGACGTGGCTEncodes a chloroplastic stromal ascorbate peroxidase sAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. 
AT4G09630AT4G09630.1ACGCCACGTCATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 2910 Blast hits to 2214 proteins in 235 species: Archae - 17; Bacteria - 119; Metazoa - 666; Fungi - 192; Plants - 194; Viruses - 70; Other Eukaryotes - 1652 (source: NCBI BLink). 
AT4G09750AT4G09750.1AAAAAGCCACGTCATCshort-chain dehydrogenase/reductase (SDR) family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: short-chain dehydrogenase/reductase (SDR) family protein (TAIR:AT4G24050.1); Has 49720 Blast hits to 49652 proteins in 1938 species: Archae - 292; Bacteria - 27546; Metazoa - 4870; Fungi - 3259; Plants - 1240; Viruses - 0; Other Eukaryotes - 12513 (source: NCBI BLink). 
AT4G10360AT4G10360.1AGCCACGTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 453 Blast hits to 451 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 225; Fungi - 97; Plants - 91; Viruses - 3; Other Eukaryotes - 37 (source: NCBI BLink). 
AT4G10360.2AGCCACGTCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 453 Blast hits to 451 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 225; Fungi - 97; Plants - 91; Viruses - 3; Other Eukaryotes - 37 (source: NCBI BLink). 
AT4G11570AT4G11570.1GACGTGGCAAhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink). 
AT4G11570.2GACGTGGCAAhaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Haloacid dehalogenase-like hydrolase (InterPro:IPR005834); BEST Arabidopsis thaliana protein match is: haloacid dehalogenase-like hydrolase family protein (TAIR:AT3G10970.1); Has 5376 Blast hits to 5376 proteins in 1041 species: Archae - 50; Bacteria - 4358; Metazoa - 59; Fungi - 19; Plants - 177; Viruses - 0; Other Eukaryotes - 713 (source: NCBI BLink). 
AT4G13010AT4G13010.1GTGACGTGGCAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink). 
AT4G13010.1GTGACGTGGCAAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink). 
AT4G13400AT4G13400.1CGACGTGGCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G63290.1); Has 253 Blast hits to 253 proteins in 88 species: Archae - 0; Bacteria - 66; Metazoa - 16; Fungi - 72; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT4G14500AT4G14500.1CGCCACGTCATCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT4G14500.2CGCCACGTCATCFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipid-binding START (InterPro:IPR002913); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G23080.1); Has 257 Blast hits to 256 proteins in 63 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 0; Plants - 83; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT4G14620AT4G14620.1AAATGACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF506, plant (InterPro:IPR006502); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G22970.1); Has 217 Blast hits to 217 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 212; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G14622AT4G14622.1AAATGACGTGGCATUpstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF60 represents a conserved upstream opening reading frame relative to major ORF AT4G14620.1 
AT4G15560AT4G15560.1TGACGTGGCCCAACEncodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis 
AT4G16330AT4G16330.1GTGCCACGTCAGCoxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT2G38240.1); Has 5424 Blast hits to 5410 proteins in 662 species: Archae - 0; Bacteria - 677; Metazoa - 111; Fungi - 490; Plants - 3015; Viruses - 0; Other Eukaryotes - 1131 (source: NCBI BLink). 
AT4G18640AT4G18640.1GTGACGTGGCTTRequired for root hair elongation during tip growth. 
AT4G19130AT4G19130.1TTGCCACGTCTTCCACGTDNA binding / nucleic acid binding / zinc ion binding; FUNCTIONS IN: DNA binding, zinc ion binding, nucleic acid binding; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: sperm cell, flower; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), Nucleic acid binding, OB-fold, tRNA/helicase-type (InterPro:IPR004365), Replication factor-A, C-terminal (InterPro:IPR013955), Replication factor-a protein 1 Rpa1 (InterPro:IPR004591), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Zinc finger, CCHC-type (InterPro:IPR001878), Replication factor-A protein 1, N-terminal (InterPro:IPR007199); BEST Arabidopsis thaliana protein match is: replication protein, putative (TAIR:AT5G45400.1); Has 609 Blast hits to 584 proteins in 169 species: Archae - 16; Bacteria - 0; Metazoa - 189; Fungi - 98; Plants - 176; Viruses - 0; Other Eukaryotes - 130 (source: NCBI BLink). 
AT4G19140AT4G19140.1ACGTGGAAGACGTGGCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G21320AT4G21320.1ATGACGTGGCATEncodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. 
AT4G21320.1ATGACGTGGCTEncodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. 
AT4G22756AT4G22756.1ATGCCACGTCACEncodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha- methyl oxidase. 
AT4G25620AT4G25620.1GATGACGTGGCAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink). 
AT4G26450AT4G26450.1GCTGACGTGGCGTTTTunknown protein; Has 2630 Blast hits to 1931 proteins in 274 species: Archae - 42; Bacteria - 240; Metazoa - 1048; Fungi - 174; Plants - 110; Viruses - 15; Other Eukaryotes - 1001 (source: NCBI BLink). 
AT4G26630AT4G26630.1CTGACGTGGCATEXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). 
AT4G26630.2CTGACGTGGCATEXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DEK, C-terminal (InterPro:IPR014876); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55660.1); Has 253164 Blast hits to 95130 proteins in 2571 species: Archae - 852; Bacteria - 27744; Metazoa - 108483; Fungi - 29060; Plants - 10256; Viruses - 1718; Other Eukaryotes - 75051 (source: NCBI BLink). 
AT4G26970AT4G26970.1CTGACGTGGCCTTGGGCCATaconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); BEST Arabidopsis thaliana protein match is: aconitate hydratase, cytoplasmic, putative / citrate hydro-lyase/aconitase, putative (TAIR:AT2G05710.1); Has 15496 Blast hits to 15351 proteins in 1535 species: Archae - 312; Bacteria - 6112; Metazoa - 484; Fungi - 449; Plants - 132; Viruses - 0; Other Eukaryotes - 8007 (source: NCBI BLink). 
AT4G27410AT4G27410.1GACGTGGCAGEncodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. 
AT4G27410.2GACGTGGCAGEncodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. 
AT4G27410.3GACGTGGCAGEncodes a NAC transcription factor induced in response to dessication. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. 
AT4G27440AT4G27440.1TAAACGACGACGTGGCAGlight-dependent NADPH:protochlorophyllide oxidoreductase B 
AT4G27440.2TAAACGACGACGTGGCAGlight-dependent NADPH:protochlorophyllide oxidoreductase B 
AT4G29330AT4G29330.1CGACGTGGCAADERLIN-1 (DER1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 666 Blast hits to 665 proteins in 170 species: Archae - 0; Bacteria - 12; Metazoa - 290; Fungi - 127; Plants - 84; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). 
AT4G29390AT4G29390.1GCTGACGTGGCT40S ribosomal protein S30 (RPS30B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30C) (TAIR:AT5G56670.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink). 
AT4G29400AT4G29400.1AGCCACGTCAGCunknown protein; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08400.2); Has 259 Blast hits to 259 proteins in 63 species: Archae - 0; Bacteria - 100; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 126 (source: NCBI BLink). 
AT4G29830AT4G29830.1GACGTGGCGGThe protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. 
AT4G29905AT4G29905.1TTGCCACGTCATCunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 41 Blast hits to 41 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G31010AT4G31010.1GACGTGGCRNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G31010.2GACGTGGCRNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; CONTAINS InterPro DOMAIN/s: RNA-binding, CRM domain (InterPro:IPR001890); BEST Arabidopsis thaliana protein match is: RNA binding (TAIR:AT5G54890.1); Has 165 Blast hits to 146 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 165; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G31330AT4G31330.1ATGCCACGTCATCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10580.1); Has 252 Blast hits to 252 proteins in 85 species: Archae - 0; Bacteria - 139; Metazoa - 0; Fungi - 0; Plants - 94; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT4G31340AT4G31340.1ACGCCACGTCATmyosin heavy chain-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: DNA repair ATPase-related (TAIR:AT2G24420.2); Has 34880 Blast hits to 19753 proteins in 1289 species: Archae - 456; Bacteria - 3905; Metazoa - 16892; Fungi - 2497; Plants - 1119; Viruses - 175; Other Eukaryotes - 9836 (source: NCBI BLink). 
AT4G31340.2ACGCCACGTCATmyosin heavy chain-related; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: DNA repair ATPase-related (TAIR:AT2G24420.2); Has 34880 Blast hits to 19753 proteins in 1289 species: Archae - 456; Bacteria - 3905; Metazoa - 16892; Fungi - 2497; Plants - 1119; Viruses - 175; Other Eukaryotes - 9836 (source: NCBI BLink). 
AT4G32330AT4G32330.1ATGACGTGGCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink). 
AT4G32330.2ATGACGTGGCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink). 
AT4G32330.3ATGACGTGGCACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Targeting for Xklp2 (InterPro:IPR009675); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25480.1); Has 4728 Blast hits to 3313 proteins in 331 species: Archae - 4; Bacteria - 347; Metazoa - 2216; Fungi - 461; Plants - 233; Viruses - 22; Other Eukaryotes - 1445 (source: NCBI BLink). 
AT4G32410AT4G32410.1TTGCCACGTCACEncodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. 
AT4G38680AT4G38680.1GTGACGTGGCAGEncodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. 
AT4G39730AT4G39730.1AGCCACGTCAlipid-associated family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, plasma membrane, chloroplast, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976); BEST Arabidopsis thaliana protein match is: lipid-associated family protein (TAIR:AT2G22170.1); Has 164 Blast hits to 150 proteins in 34 species: Archae - 0; Bacteria - 1; Metazoa - 73; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT5G01420AT5G01420.1GACGTGGCACglutaredoxin family protein; FUNCTIONS IN: electron carrier activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin family protein (TAIR:AT5G03870.1); Has 300 Blast hits to 300 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 90; Fungi - 0; Plants - 195; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT5G02090AT5G02090.1ACGCCACGTCACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 14 Blast hits to 14 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G02270AT5G02270.1CGCCACGTCGmember of NAP subfamily 
AT5G02280AT5G02280.1CGACGTGGCGsynbindin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport, ER to Golgi vesicle-mediated transport; LOCATED IN: cis-Golgi network; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sybindin-like protein (InterPro:IPR007233), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: synbindin, putative (TAIR:AT1G51160.2); Has 419 Blast hits to 413 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 194; Fungi - 100; Plants - 56; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT5G03940AT5G03940.1TACTGGGCCACGTCATCmutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit 
AT5G06600AT5G06600.1AGCCACGTCEncodes a ubiquitin-specific protease. 
AT5G06600.2AGCCACGTCEncodes a ubiquitin-specific protease. 
AT5G06600.3AGCCACGTCEncodes a ubiquitin-specific protease. 
AT5G07090AT5G07090.1ACGCCACGTCAGC40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). 
AT5G07090.2ACGCCACGTCAGC40S ribosomal protein S4 (RPS4B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), RNA-binding S4 (InterPro:IPR002942), KOW (InterPro:IPR005824), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4D) (TAIR:AT5G58420.1); Has 942 Blast hits to 942 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 224 (source: NCBI BLink). 
AT5G08640AT5G08640.1TCGCCACGTCEncodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. 
AT5G10980AT5G10980.1AGCCACGTCATChistone H3; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 17 growth stages; CONTAINS InterPro DOMAIN/s: Histone H3 (InterPro:IPR000164), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H3.2 (TAIR:AT4G40040.2); Has 10278 Blast hits to 10275 proteins in 5329 species: Archae - 0; Bacteria - 0; Metazoa - 7397; Fungi - 1307; Plants - 999; Viruses - 0; Other Eukaryotes - 575 (source: NCBI BLink). 
AT5G11700AT5G11700.1ATGACGTGGCGTglycine-rich protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G32920.1). 
AT5G11700.2ATGACGTGGCGTglycine-rich protein; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G32920.1). 
AT5G12940AT5G12940.1GACGACGTGGCAAleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein (TAIR:AT3G20820.1); Has 47045 Blast hits to 16978 proteins in 730 species: Archae - 15; Bacteria - 2431; Metazoa - 14572; Fungi - 447; Plants - 26641; Viruses - 0; Other Eukaryotes - 2939 (source: NCBI BLink). 
AT5G13650AT5G13650.1GACGTGGCTTelongation factor family protein; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein TypA (InterPro:IPR006298), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor family protein (TAIR:AT2G31060.2); Has 52040 Blast hits to 46861 proteins in 4222 species: Archae - 904; Bacteria - 26711; Metazoa - 3006; Fungi - 1714; Plants - 1188; Viruses - 0; Other Eukaryotes - 18517 (source: NCBI BLink). 
AT5G13650.2GACGTGGCTTelongation factor family protein; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EFG/EF2, C-terminal (InterPro:IPR000640), GTP-binding protein TypA (InterPro:IPR006298), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Elongation factor G, III and V (InterPro:IPR009022), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: elongation factor family protein (TAIR:AT2G31060.2); Has 52040 Blast hits to 46861 proteins in 4222 species: Archae - 904; Bacteria - 26711; Metazoa - 3006; Fungi - 1714; Plants - 1188; Viruses - 0; Other Eukaryotes - 18517 (source: NCBI BLink). 
AT5G15500AT5G15500.1CTGCCACGTCACankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). 
AT5G15500.2CTGCCACGTCACankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G10720.1); Has 15291 Blast hits to 8061 proteins in 322 species: Archae - 13; Bacteria - 757; Metazoa - 8515; Fungi - 631; Plants - 930; Viruses - 51; Other Eukaryotes - 4394 (source: NCBI BLink). 
AT5G16630AT5G16630.1GTGACGTGGCGARAD4; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: nucleotide-excision repair; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transglutaminase-like (InterPro:IPR002931), DNA repair protein Rad4, DNA-binding domain 1 (InterPro:IPR018326), DNA repair protein Rad4, DNA-binding domain 3 (InterPro:IPR018328), DNA repair protein Rad4, DNA-binding domain 2 (InterPro:IPR018327), DNA repair protein Rad4, transglutaminase-like domain (InterPro:IPR018325), DNA repair protein Rad4 (InterPro:IPR004583); Has 484 Blast hits to 413 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 196; Fungi - 169; Plants - 44; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT5G16630.2GTGACGTGGCGARAD4; FUNCTIONS IN: damaged DNA binding; INVOLVED IN: nucleotide-excision repair; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transglutaminase-like (InterPro:IPR002931), DNA repair protein Rad4, DNA-binding domain 1 (InterPro:IPR018326), DNA repair protein Rad4, DNA-binding domain 3 (InterPro:IPR018328), DNA repair protein Rad4, DNA-binding domain 2 (InterPro:IPR018327), DNA repair protein Rad4, transglutaminase-like domain (InterPro:IPR018325), DNA repair protein Rad4 (InterPro:IPR004583); Has 484 Blast hits to 413 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 196; Fungi - 169; Plants - 44; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT5G18440AT5G18440.1CGCCACGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G18440.2CGCCACGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 1233 Blast hits to 1114 proteins in 157 species: Archae - 0; Bacteria - 93; Metazoa - 319; Fungi - 137; Plants - 52; Viruses - 6; Other Eukaryotes - 626 (source: NCBI BLink). 
AT5G18850AT5G18850.1GATGACGTGGCGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G19860AT5G19860.1GACGTGGCAATunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55265.1); Has 347 Blast hits to 347 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 346; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G19930AT5G19930.1GTGCCACGTCATintegral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink). 
AT5G19940AT5G19940.1ATGACGTGGCACplastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G19940.2ATGACGTGGCACplastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G21105AT5G21105.2GACGTGGCTL-ascorbate oxidase/ copper ion binding / oxidoreductase; FUNCTIONS IN: oxidoreductase activity, L-ascorbate oxidase activity, copper ion binding; INVOLVED IN: oxidation reduction; LOCATED IN: cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type 2 (InterPro:IPR011706), Multicopper oxidase, type 3 (InterPro:IPR011707), Multicopper oxidase, copper-binding site (InterPro:IPR002355), L-ascorbate oxidase, plants (InterPro:IPR017760), Multicopper oxidase, type 1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein match is: L-ascorbate oxidase, putative (TAIR:AT5G21100.1); Has 6896 Blast hits to 6267 proteins in 1013 species: Archae - 39; Bacteria - 2676; Metazoa - 535; Fungi - 2466; Plants - 798; Viruses - 0; Other Eukaryotes - 382 (source: NCBI BLink). 
AT5G22290AT5G22290.1GTGACGTGGCATArabidopsis NAC domain containing protein 89 (anac089); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac060 (Arabidopsis NAC domain containing protein 60); transcription factor (TAIR:AT3G44290.1); Has 1506 Blast hits to 1504 proteins in 51 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1506; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G23200AT5G23200.1GACGTGGCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G23280AT5G23280.1ATGACGTGGCAATCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G08330.1); Has 679 Blast hits to 678 proteins in 154 species: Archae - 0; Bacteria - 0; Metazoa - 26; Fungi - 0; Plants - 639; Viruses - 0; Other Eukaryotes - 14 (source: NCBI BLink). 
AT5G23420AT5G23420.1ACGCCACGTCAEncodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. 
AT5G23890AT5G23890.1GCTGACGTGGCATLOCATED IN: mitochondrion, chloroplast thylakoid membrane, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: S-layer homology region (InterPro:IPR001119); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G52410.2); Has 47782 Blast hits to 27307 proteins in 1672 species: Archae - 444; Bacteria - 6951; Metazoa - 22630; Fungi - 3561; Plants - 1682; Viruses - 252; Other Eukaryotes - 12262 (source: NCBI BLink). 
AT5G24810AT5G24810.1GATGACGTGGCCCATTGABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink). 
AT5G24970AT5G24970.1GACGTGGCGAABC1 family protein; FUNCTIONS IN: protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Protein kinase, core (InterPro:IPR000719), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ABC1 family protein (TAIR:AT1G79600.1); Has 7448 Blast hits to 7430 proteins in 1103 species: Archae - 69; Bacteria - 2644; Metazoa - 345; Fungi - 303; Plants - 352; Viruses - 14; Other Eukaryotes - 3721 (source: NCBI BLink). 
AT5G24980AT5G24980.1TCGCCACGTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10745.1); Has 23 Blast hits to 23 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G44110AT5G44110.1GTGACGTGGCAGEncodes a member of the NAP subfamily of ABC transporters. 
AT5G44110.2GTGACGTGGCAGEncodes a member of the NAP subfamily of ABC transporters. 
AT5G44110.3GTGACGTGGCAGEncodes a member of the NAP subfamily of ABC transporters. 
AT5G47180AT5G47180.1CTGCCACGTCATCvesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT5G47180.2CTGCCACGTCATCvesicle-associated membrane family protein / VAMP family protein; FUNCTIONS IN: structural molecule activity; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: PapD-like (InterPro:IPR008962), Major sperm protein (InterPro:IPR000535), Vesicle-associated membrane protein (InterPro:IPR016763); BEST Arabidopsis thaliana protein match is: VAP (VESICLE ASSOCIATED PROTEIN); protein binding (TAIR:AT3G60600.1); Has 746 Blast hits to 741 proteins in 147 species: Archae - 0; Bacteria - 0; Metazoa - 359; Fungi - 101; Plants - 222; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT5G47200AT5G47200.1GCCACGTCAGCATRAB1A; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1C; GTP binding (TAIR:AT4G17530.1); Has 23714 Blast hits to 23664 proteins in 649 species: Archae - 17; Bacteria - 107; Metazoa - 13262; Fungi - 2840; Plants - 2236; Viruses - 19; Other Eukaryotes - 5233 (source: NCBI BLink). 
AT5G47590AT5G47590.1GTGCCACGTCACheat shock protein-related; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Small heat shock protein, predicted, plant (InterPro:IPR016952), Peptidase A1 (InterPro:IPR001461), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT4G16550.1); Has 51 Blast hits to 42 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G47810AT5G47810.1TTGCCACGTCPHOSPHOFRUCTOKINASE 2 (PFK2); FUNCTIONS IN: 6-phosphofructokinase activity; INVOLVED IN: glycolysis; LOCATED IN: cytosol, 6-phosphofructokinase complex; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Pyrophosphate-dependent phosphofructokinase TP0108 (InterPro:IPR012004), Phosphofructokinase (InterPro:IPR000023); BEST Arabidopsis thaliana protein match is: PFK3 (PHOSPHOFRUCTOKINASE 3); 6-phosphofructokinase (TAIR:AT4G26270.1); Has 4565 Blast hits to 4222 proteins in 1114 species: Archae - 20; Bacteria - 2500; Metazoa - 504; Fungi - 230; Plants - 224; Viruses - 2; Other Eukaryotes - 1085 (source: NCBI BLink). 
AT5G50375AT5G50375.1CTGCCACGTCAGCConverts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 
AT5G52300AT5G52300.1GACGTGGCAGencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G52300.2GACGTGGCAGencodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and dessication. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. 
AT5G52430AT5G52430.1GATGACGTGGCAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G25620.1); Has 849 Blast hits to 464 proteins in 107 species: Archae - 2; Bacteria - 43; Metazoa - 236; Fungi - 114; Plants - 84; Viruses - 9; Other Eukaryotes - 361 (source: NCBI BLink). 
AT5G52960AT5G52960.1ATTGCCACGTCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT5G52960.1GTGACGTGGCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 56 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 72 (source: NCBI BLink). 
AT5G52990AT5G52990.1CGACGTGGCAATvesicle-associated membrane protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: transport; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G27840.1); Has 89 Blast hits to 89 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G53310AT5G53310.1AAGCCACGTCmyosin heavy chain-related; FUNCTIONS IN: motor activity; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Myosin tail 2 (InterPro:IPR010926); Has 312 Blast hits to 312 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 197; Fungi - 37; Plants - 16; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT5G53490AT5G53490.1ATGCCACGTCATthylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. 
AT5G53490.2ATGCCACGTCATthylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. 
AT5G54080AT5G54080.1ATGCCACGTCATChomogentisate 1,2-dioxygenase 
AT5G54080.2ATGCCACGTCATChomogentisate 1,2-dioxygenase 
AT5G54770AT5G54770.1CTGACGTGGCEncodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. 
AT5G55000AT5G55000.1ATGACGTGGCTFH protein interacting protein FIP2 
AT5G55000.2ATGACGTGGCTFH protein interacting protein FIP2 
AT5G58710AT5G58710.1TGACGTGGCTTEncodes cyclophilin ROC7. 
AT5G58720AT5G58720.1TGACGTGGCGAPRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G58720.2TGACGTGGCGAPRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G58720.3TGACGTGGCGAPRLI-interacting factor, putative; FUNCTIONS IN: damaged DNA binding, ATP binding; INVOLVED IN: mismatch repair; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Smr protein/MutS2 C-terminal (InterPro:IPR002625), Region of unknown function DUF1771 (InterPro:IPR013899); BEST Arabidopsis thaliana protein match is: SDE5 (silencing defective 5) (TAIR:AT3G15390.1); Has 242 Blast hits to 240 proteins in 93 species: Archae - 0; Bacteria - 2; Metazoa - 58; Fungi - 102; Plants - 61; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G58760AT5G58760.1TCGCCACGTCdamaged DNA-binding 2 (DDB2); FUNCTIONS IN: nucleotide binding, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G80710.1); Has 3318 Blast hits to 3006 proteins in 249 species: Archae - 18; Bacteria - 310; Metazoa - 1331; Fungi - 862; Plants - 258; Viruses - 0; Other Eukaryotes - 539 (source: NCBI BLink). 
AT5G58800AT5G58800.1ATTGCCACGTCATquinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). 
AT5G58800.2ATTGCCACGTCATquinone reductase family protein; FUNCTIONS IN: oxidoreductase activity, FMN binding; INVOLVED IN: negative regulation of transcription; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Flavoprotein WrbA (InterPro:IPR010089), Flavodoxin/nitric oxide synthase (InterPro:IPR008254); BEST Arabidopsis thaliana protein match is: quinone reductase family protein (TAIR:AT4G27270.1); Has 2079 Blast hits to 2079 proteins in 653 species: Archae - 32; Bacteria - 1498; Metazoa - 2; Fungi - 180; Plants - 117; Viruses - 1; Other Eukaryotes - 249 (source: NCBI BLink). 
AT5G59570AT5G59570.1ATGACGTGGCTmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Myb-type HTH DNA-binding domain (InterPro:IPR017930), Myb-like DNA-binding region, SHAQKYF class (InterPro:IPR006447), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: PCL1 (PHYTOCLOCK 1); DNA binding / transcription factor (TAIR:AT3G46640.2); Has 892 Blast hits to 892 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 875; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT5G59750AT5G59750.1TATAGGCCACGTCAGCriboflavin biosynthesis protein, putative; FUNCTIONS IN: 3,4-dihydroxy-2-butanone-4-phosphate synthase activity, GTP cyclohydrolase II activity; INVOLVED IN: riboflavin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GTP cyclohydrolase II (InterPro:IPR000926), DHBP synthase RibB (InterPro:IPR000422), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945); BEST Arabidopsis thaliana protein match is: ATGCH; 3,4-dihydroxy-2-butanone-4-phosphate synthase/ GTP cyclohydrolase II (TAIR:AT5G64300.1); Has 8351 Blast hits to 8350 proteins in 1311 species: Archae - 133; Bacteria - 4029; Metazoa - 0; Fungi - 273; Plants - 55; Viruses - 0; Other Eukaryotes - 3861 (source: NCBI BLink). 
AT5G61380AT5G61380.1GATGACGTGGCCTTTTPseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. 
AT5G61790AT5G61790.1ATGACGTGGCcalnexin 1 (CNX1); FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin, putative (TAIR:AT5G07340.1); Has 1344 Blast hits to 1252 proteins in 297 species: Archae - 2; Bacteria - 61; Metazoa - 623; Fungi - 137; Plants - 191; Viruses - 36; Other Eukaryotes - 294 (source: NCBI BLink). 
AT5G61940AT5G61940.1AGCCACGTCGubiquitin carboxyl-terminal hydrolase-related; FUNCTIONS IN: ubiquitin thiolesterase activity, zinc ion binding; INVOLVED IN: ubiquitin-dependent protein catabolic process; LOCATED IN: intracellular; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF627 (InterPro:IPR006866), Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (InterPro:IPR001394), Zinc finger, C2H2-type (InterPro:IPR007087), Protein of unknown function DUF629 (InterPro:IPR006865); BEST Arabidopsis thaliana protein match is: ubiquitin carboxyl-terminal hydrolase-related (TAIR:AT5G61950.1); Has 375 Blast hits to 347 proteins in 83 species: Archae - 0; Bacteria - 15; Metazoa - 68; Fungi - 36; Plants - 109; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). 
AT5G65700AT5G65700.1CTGACGTGGCACEncodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. 
AT5G66510AT5G66510.1GTGACGTGGCGAEncodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. 
AT5G66510.2GTGACGTGGCGAEncodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. 
AT5G66520AT5G66520.1TCGCCACGTCACpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G06540.1); Has 14737 Blast hits to 5344 proteins in 184 species: Archae - 1; Bacteria - 4; Metazoa - 109; Fungi - 73; Plants - 14158; Viruses - 0; Other Eukaryotes - 392 (source: NCBI BLink). 
AT5G67330AT5G67330.1CTGACGTGGCGTEncodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.