version

Summary of AtREG392 (All List)

OrganismArabidopsis thaliana  
IDAtREG392  
SequenceGGGCCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE MotifGGGCC  one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);  
TGGGCY  "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)  
Total Entry Count255  

Entry Sequences (255 entries)

LocusGene modelSequenceDescription
AT1G01510AT1G01510.1TTTTGGGCCCTEncodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. 
AT1G04130AT1G04130.1ATTTGGGCCCATAAtetratricopeptide repeat (TPR)-containing protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: serine/threonine protein phosphatase-related (TAIR:AT1G56440.1); Has 3930 Blast hits to 3426 proteins in 259 species: Archae - 8; Bacteria - 133; Metazoa - 1878; Fungi - 572; Plants - 573; Viruses - 0; Other Eukaryotes - 766 (source: NCBI BLink). 
AT1G05940AT1G05940.1TGTTGGGCCCAATGEncodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. 
AT1G07820AT1G07820.1GGGCCCAATAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). 
AT1G07820.2GGGCCCAATAhistone H4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleus, nucleosome; CONTAINS InterPro DOMAIN/s: Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125), Histone H4 (InterPro:IPR001951); BEST Arabidopsis thaliana protein match is: histone H4 (TAIR:AT5G59970.1); Has 2713 Blast hits to 2713 proteins in 359 species: Archae - 0; Bacteria - 0; Metazoa - 1566; Fungi - 279; Plants - 355; Viruses - 6; Other Eukaryotes - 507 (source: NCBI BLink). 
AT1G07830AT1G07830.1TATTGGGCCCTAribosomal protein L29 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome, mitochondrial ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L47, mitochondrial (InterPro:IPR010729), Ribosomal protein L29 (InterPro:IPR001854); Has 236 Blast hits to 236 proteins in 132 species: Archae - 0; Bacteria - 0; Metazoa - 93; Fungi - 80; Plants - 22; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). 
AT1G07840AT1G07840.1CTTATTGGGCCCTAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT1G07840.2CTTATTGGGCCCTAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT1G07840.3CTTATTGGGCCCTAleucine zipper factor-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Sas10/Utp3/C1D (InterPro:IPR007146); BEST Arabidopsis thaliana protein match is: EMB2777 (EMBRYO DEFECTIVE 2777) (TAIR:AT2G43650.1); Has 529 Blast hits to 527 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 239; Fungi - 93; Plants - 45; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT1G13090AT1G13090.1CATTGGGCCCATAAputative cytochrome P450 
AT1G14380AT1G14380.1TAATTGGGCCCAGAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). 
AT1G14380.2TAATTGGGCCCAGAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). 
AT1G14380.3TAATTGGGCCCAGAIQ67 DOMAIN PROTEIN 28 (IQD28); FUNCTIONS IN: calmodulin binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: IQ calmodulin-binding region (InterPro:IPR000048); BEST Arabidopsis thaliana protein match is: IQD29 (IQ-domain 29); calmodulin binding (TAIR:AT2G02790.1); Has 5726 Blast hits to 4293 proteins in 313 species: Archae - 0; Bacteria - 281; Metazoa - 2433; Fungi - 436; Plants - 559; Viruses - 34; Other Eukaryotes - 1983 (source: NCBI BLink). 
AT1G15270AT1G15270.1TTTAACGGGCCCAAAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation machinery associated TMA7 (InterPro:IPR015157); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16040.1); Has 263 Blast hits to 263 proteins in 90 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 48; Plants - 41; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT1G15280AT1G15280.1TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). 
AT1G15280.2TTTTGGGCCCGTTAAAglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80000.2); Has 3928 Blast hits to 2073 proteins in 245 species: Archae - 0; Bacteria - 154; Metazoa - 1298; Fungi - 267; Plants - 178; Viruses - 66; Other Eukaryotes - 1965 (source: NCBI BLink). 
AT1G16570AT1G16570.1GGGCCCAATTAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink). 
AT1G16570.2GGGCCCAATTAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); Has 512 Blast hits to 501 proteins in 213 species: Archae - 24; Bacteria - 143; Metazoa - 133; Fungi - 92; Plants - 27; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink). 
AT1G16590AT1G16590.1TAATTGGGCCCputative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). 
AT1G16790AT1G16790.1TGGGCCCAAGCCCAACAribosomal protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 4 Blast hits to 4 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G16810AT1G16810.1ATATTGGGCCCTATTGGGCTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT1G16810.2ATATTGGGCCCTATTGGGCTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1754, eukaryotic (InterPro:IPR013865); Has 275 Blast hits to 274 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 132; Fungi - 62; Plants - 34; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT1G20460AT1G20460.1GGGCCCAATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76185.1); Has 19 Blast hits to 19 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G23400AT1G23400.1TTATGGGCCTGGCCTTAGGGCCCAATTPromotes the splicing of chloroplast group II introns. 
AT1G24040AT1G24040.1TATATGGGCCATAAGGGCCCAATAAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G24040.2TATATGGGCCATAAGGGCCCAATAAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G24050AT1G24050.1TTATTGGGCCCTTATGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT1G26230AT1G26230.1TGTTGGGCCCGAACCAchaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24360 Blast hits to 24320 proteins in 5137 species: Archae - 390; Bacteria - 14007; Metazoa - 1488; Fungi - 952; Plants - 459; Viruses - 2; Other Eukaryotes - 7062 (source: NCBI BLink). 
AT1G26300AT1G26300.1TTATTGGGCCCTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G26300.2TTATTGGGCCCTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 146 Blast hits to 143 proteins in 27 species: Archae - 2; Bacteria - 4; Metazoa - 9; Fungi - 4; Plants - 98; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G26940AT1G26940.1CATTGGGCCCAATApeptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 7846 Blast hits to 7844 proteins in 1250 species: Archae - 78; Bacteria - 3271; Metazoa - 1001; Fungi - 616; Plants - 300; Viruses - 0; Other Eukaryotes - 2580 (source: NCBI BLink). 
AT1G27310AT1G27310.1TAACGGGCCCAACTEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. 
AT1G28090AT1G28090.1GGGCCCAATAApolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). 
AT1G28090.2GGGCCCAATAApolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). 
AT1G28090.3GGGCCCAATAApolynucleotide adenylyltransferase family protein; FUNCTIONS IN: RNA binding, nucleotidyltransferase activity; INVOLVED IN: RNA processing; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotide adenylyltransferase region (InterPro:IPR002646); BEST Arabidopsis thaliana protein match is: polynucleotide adenylyltransferase family protein (TAIR:AT5G23690.1); Has 6227 Blast hits to 6223 proteins in 1431 species: Archae - 2; Bacteria - 3614; Metazoa - 116; Fungi - 173; Plants - 58; Viruses - 8; Other Eukaryotes - 2256 (source: NCBI BLink). 
AT1G28190AT1G28190.1GTTTGGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12340.1); Has 113 Blast hits to 106 proteins in 30 species: Archae - 0; Bacteria - 2; Metazoa - 25; Fungi - 5; Plants - 61; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT1G29880AT1G29880.1CTTGGGCCCAAAglycyl-tRNA synthetase / glycine--tRNA ligase; FUNCTIONS IN: glycine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: response to cadmium ion, glycyl-tRNA aminoacylation; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), WHEP-TRS (InterPro:IPR000738), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Glycyl-tRNA synthetase, alpha2 dimer (InterPro:IPR002315), Anticodon-binding (InterPro:IPR004154), Glycyl-tRNA synthetase, alpha2 dimer, C-terminal (InterPro:IPR018160), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: tRNA synthetase class II (G, H, P and S) family protein (TAIR:AT1G29870.1); Has 4267 Blast hits to 3231 proteins in 634 species: Archae - 169; Bacteria - 1528; Metazoa - 158; Fungi - 116; Plants - 33; Viruses - 0; Other Eukaryotes - 2263 (source: NCBI BLink). 
AT1G31420AT1G31420.1TAATGGGCCTTAAAAATGGGCCCAATGEncodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. 
AT1G32530AT1G32530.1TATATGGGCCCAAATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). 
AT1G45976AT1G45976.1AGGGCCCAATAGs-ribonuclease binding protein 1 (SBP1); FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), S-ribonuclease binding protein, SBP1, pollen (InterPro:IPR017066); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT1G10650.2); Has 850 Blast hits to 850 proteins in 129 species: Archae - 0; Bacteria - 2; Metazoa - 475; Fungi - 4; Plants - 238; Viruses - 48; Other Eukaryotes - 83 (source: NCBI BLink). 
AT1G54310AT1G54310.1AAATGGGCCCAATAARNA binding; FUNCTIONS IN: RNA binding; LOCATED IN: plasma membrane; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: PUA (InterPro:IPR002478); Has 3651 Blast hits to 3638 proteins in 946 species: Archae - 69; Bacteria - 3053; Metazoa - 33; Fungi - 6; Plants - 28; Viruses - 0; Other Eukaryotes - 462 (source: NCBI BLink). 
AT1G60890AT1G60890.1GGGCCCAAAAphosphatidylinositol-4-phosphate 5-kinase family protein; FUNCTIONS IN: 1-phosphatidylinositol-4-phosphate 5-kinase activity, phosphatidylinositol phosphate kinase activity, ATP binding; INVOLVED IN: phosphatidylinositol metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (InterPro:IPR016034), Phosphatidylinositol-4-phosphate 5-kinase, plant (InterPro:IPR017163), MORN motif (InterPro:IPR003409), Phosphatidylinositol-4-phosphate 5-kinase, core (InterPro:IPR002498); BEST Arabidopsis thaliana protein match is: phosphatidylinositol-4-phosphate 5-kinase family protein (TAIR:AT1G10900.1); Has 22998 Blast hits to 6300 proteins in 384 species: Archae - 0; Bacteria - 2356; Metazoa - 3944; Fungi - 305; Plants - 691; Viruses - 0; Other Eukaryotes - 15702 (source: NCBI BLink). 
AT1G62830AT1G62830.1CATTGGGCCCAGEncodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering time loci FLC and FWA. Located in nucleus. Negatively regulates root elongation. Involved in repression of LRP1 via histone deacetylation. 
AT1G63520AT1G63520.1AGGGCCCAACCGGGTTCGAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11450.1); Has 63 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G64880AT1G64880.1AATTGGGCCCATGribosomal protein S5 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: ribosome, Golgi apparatus, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Double-stranded RNA-binding-like (InterPro:IPR014720), Ribosomal protein S5, C-terminal (InterPro:IPR005324), Ribosomal protein S5 (InterPro:IPR000851), Ribosomal protein S5 domain 2-type fold (InterPro:IPR014721), Ribosomal protein S5, N-terminal (InterPro:IPR013810); BEST Arabidopsis thaliana protein match is: ribosomal protein S5 family protein (TAIR:AT2G33800.1); Has 10105 Blast hits to 8747 proteins in 1649 species: Archae - 225; Bacteria - 3046; Metazoa - 1648; Fungi - 368; Plants - 134; Viruses - 59; Other Eukaryotes - 4625 (source: NCBI BLink). 
AT1G65820AT1G65820.1ATTGGGCCCAATGmicrosomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129). 
AT1G65820.2ATTGGGCCCAATGmicrosomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129). 
AT1G65820.3ATTGGGCCCAATGmicrosomal glutathione s-transferase, putative; FUNCTIONS IN: glutathione transferase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Membrane-associated, eicosanoid and glutathione metabolism (MAPEG) (InterPro:IPR001129). 
AT1G66930AT1G66930.1CTTGGGCCCTAserine/threonine protein kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT1G67000.1); Has 85221 Blast hits to 83970 proteins in 3159 species: Archae - 75; Bacteria - 7164; Metazoa - 37987; Fungi - 6777; Plants - 18536; Viruses - 358; Other Eukaryotes - 14324 (source: NCBI BLink). 
AT1G72320AT1G72320.1TAATTGGGCCCTAArabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT1G72320.2TAATTGGGCCCTAArabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT1G72320.3TAATTGGGCCCTAArabidopsis Pumilio 23 (APUM23); FUNCTIONS IN: RNA binding, binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pumilio RNA-binding region (InterPro:IPR001313), Armadillo-like helical (InterPro:IPR011989), Armadillo-type fold (InterPro:IPR016024); Has 273 Blast hits to 273 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 96; Plants - 37; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT1G72330AT1G72330.1TAGGGCCCAATTAEncodes for alanine aminotransferase ALAAT2. 
AT1G72330.2TAGGGCCCAATTAEncodes for alanine aminotransferase ALAAT2. 
AT1G73430AT1G73430.1TCTGGGCCCAATGGCCTTTTsec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT1G73430.2TCTGGGCCCAATGGCCTTTTsec34-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: intracellular protein transport; LOCATED IN: chloroplast, membrane, cis-Golgi network; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sec34-like protein (InterPro:IPR007265); Has 256 Blast hits to 248 proteins in 121 species: Archae - 0; Bacteria - 4; Metazoa - 107; Fungi - 89; Plants - 19; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT1G73840AT1G73840.1TAATTGGGCCCResembles the CstF64 family of RNA processing factors that are conserved between yeast and mammals. In mammals, CstF64 is a component of the CstF complex which is required for mRNA 3'end formation along with other factors. 
AT1G76200AT1G76200.1AGGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 59 Blast hits to 59 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 29; Plants - 27; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT1G76300AT1G76300.1CTAATGGGCCCAATAAsnRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). 
AT1G77480AT1G77480.1ATATTGGGCCCTnucellin protein, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: nucellin protein, putative (TAIR:AT1G44130.1); Has 1042 Blast hits to 1037 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 17; Plants - 945; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT1G77480.2ATATTGGGCCCTnucellin protein, putative; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461), Peptidase aspartic, active site (InterPro:IPR001969); BEST Arabidopsis thaliana protein match is: nucellin protein, putative (TAIR:AT1G44130.1); Has 1042 Blast hits to 1037 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 17; Plants - 945; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT1G77490AT1G77490.1AGGGCCCAATATEncodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. 
AT1G78680AT1G78680.1AATTGGGCCCTThe Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. 
AT1G79710AT1G79710.1CAATGGGCCCAAATintegral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink). 
AT1G79830AT1G79830.1GGGCCCAATATThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). 
AT1G79830.2GGGCCCAATATThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). 
AT1G79870AT1G79870.1TTATGGGCCCAAAAATAGGCCCATCToxidoreductase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19936 Blast hits to 19933 proteins in 1515 species: Archae - 283; Bacteria - 9447; Metazoa - 662; Fungi - 752; Plants - 323; Viruses - 5; Other Eukaryotes - 8464 (source: NCBI BLink). 
AT1G80080AT1G80080.1TAGGGCCCAACAEncodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. 
AT1G80550AT1G80550.1GGGCTTTGGGCCCATAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink). 
AT2G01270AT2G01270.1AGCCCAATTGGGCCCAAATEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. 
AT2G01870AT2G01870.1AAATGGGCCCAATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 7 Blast hits to 7 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G03430AT2G03430.1AAAAGGCCCATAAACGGGCCCAATATankyrin repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G19150.1); Has 104929 Blast hits to 30234 proteins in 997 species: Archae - 84; Bacteria - 8435; Metazoa - 52441; Fungi - 8607; Plants - 4055; Viruses - 2006; Other Eukaryotes - 29301 (source: NCBI BLink). 
AT2G16500AT2G16500.1TAGGGCCCAAGCCCAAAAencodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. 
AT2G20530AT2G20530.1TTTTGGGCCCAAAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). 
AT2G20530.2TTTTGGGCCCAAAPROHIBITIN 6 (ATPHB6); INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, respiratory chain complex I, membrane; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Prohibitin (InterPro:IPR000163), Band 7 protein (InterPro:IPR001107); BEST Arabidopsis thaliana protein match is: ATPHB1 (PROHIBITIN 1) (TAIR:AT4G28510.1); Has 2400 Blast hits to 2398 proteins in 654 species: Archae - 119; Bacteria - 948; Metazoa - 392; Fungi - 189; Plants - 171; Viruses - 10; Other Eukaryotes - 571 (source: NCBI BLink). 
AT2G22610AT2G22610.1GGGCCCAATATkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT1G72250.1); Has 61125 Blast hits to 37324 proteins in 1305 species: Archae - 470; Bacteria - 4361; Metazoa - 29529; Fungi - 3969; Plants - 2072; Viruses - 206; Other Eukaryotes - 20518 (source: NCBI BLink). 
AT2G23130AT2G23130.1ATATTGGGCCCAATGAGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers. 
AT2G23130.2ATATTGGGCCCAATGAGP17 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP18 and AGP19, other lysine-rich AGPs. 84% of its proline residues are hydroxylated to hydroproline and its heavy glycosylation accounts for appr. 69% of the molecular weight. The main glycosyl residues are arabinose (30.1%) and galactose (55.1%). Glycosyl linkages are consistent with type II arabinogalactans. AGP17 is predicted to have a glycosylphosphatidylinositol (GPI)anchor and is localized to the plasma membrane and Hechtian strands. It is expressed in young/old leaves, shoots, suspension cultures and flowers. 
AT2G24060AT2G24060.1TAATTGGGCCCTtranslation initiation factor 3 (IF-3) family protein; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 3 (InterPro:IPR001288); BEST Arabidopsis thaliana protein match is: translation initiation factor 3 (IF-3) family protein (TAIR:AT4G30690.1); Has 17514 Blast hits to 8661 proteins in 1545 species: Archae - 56; Bacteria - 6187; Metazoa - 2053; Fungi - 689; Plants - 758; Viruses - 336; Other Eukaryotes - 7435 (source: NCBI BLink). 
AT2G29510AT2G29510.1CTATTGGGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59020.1); Has 3816 Blast hits to 613 proteins in 107 species: Archae - 0; Bacteria - 39; Metazoa - 471; Fungi - 67; Plants - 91; Viruses - 10; Other Eukaryotes - 3138 (source: NCBI BLink). 
AT2G32480AT2G32480.1ATTTGGGCCCTAmembrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). 
AT2G32480.2ATTTGGGCCCTAmembrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT1G05140.1); Has 6832 Blast hits to 5448 proteins in 1198 species: Archae - 29; Bacteria - 3558; Metazoa - 3; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 3202 (source: NCBI BLink). 
AT2G35520AT2G35520.1CTTGGGCCCAAAGGCCCDEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT2G35520.2CTTGGGCCCAAAGGCCCDEFENDER AGAINST CELL DEATH 2 (DAD2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: anti-apoptosis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Defender against death DAD protein (InterPro:IPR003038); BEST Arabidopsis thaliana protein match is: ATDAD1 (DEFENDER AGAINST APOPTOTIC DEATH 1) (TAIR:AT1G32210.1); Has 338 Blast hits to 338 proteins in 150 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 77; Plants - 74; Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink). 
AT2G39805AT2G39805.1TCTGGGCCCAAGintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). 
AT2G39805.1TCTGGGCCCAAGintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). 
AT2G39805.2TCTGGGCCCAAGintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). 
AT2G39805.2TCTGGGCCCAAGintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). 
AT2G43720AT2G43720.1TAAATGGGCCCAATTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF842, eukaryotic (InterPro:IPR008560); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31725.1); Has 203 Blast hits to 203 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 158; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT2G44180AT2G44180.1ATATTGGGCCCAATAAGEncodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci. 
AT2G44310AT2G44310.1TCTGACGGGCCCAATATcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT1G54530.1); Has 158 Blast hits to 153 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT2G44970AT2G44970.1TAATTGGGCCCAGTAGTGGCCCATATlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G44970.2TAATTGGGCCCAGTAGTGGCCCATATlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G46540AT2G46540.1ATTTGGGCCCAGTAACCCGACCCGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01520AT3G01520.1ATTTGGGCCCTuniversal stress protein (USP) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, response to stress; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UspA (InterPro:IPR006016), Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Universal stress protein A (InterPro:IPR006015); BEST Arabidopsis thaliana protein match is: universal stress protein (USP) family protein (TAIR:AT5G14680.1); Has 1147 Blast hits to 1145 proteins in 292 species: Archae - 54; Bacteria - 658; Metazoa - 30; Fungi - 22; Plants - 354; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT3G01540AT3G01540.1GTGGCCCAAAAGGGCCCAAAARNA HELICASE DRH1 
AT3G01540.2GTGGCCCAAAAGGGCCCAAAARNA HELICASE DRH1 
AT3G01540.3GTGGCCCAAAAGGGCCCAAAARNA HELICASE DRH1 
AT3G01540.4GTGGCCCAAAAGGGCCCAAAARNA HELICASE DRH1 
AT3G01740AT3G01740.1GGGCCCAACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L37, mitochondrial (InterPro:IPR013870); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G14290.1); Has 117 Blast hits to 117 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 56; Fungi - 22; Plants - 27; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT3G02065AT3G02065.1GGGCCCAATTGDEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.2GGGCCCAATTGDEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.3GGGCCCAATTGDEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02555AT3G02555.1CAATGGGCCCAATGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G16110.1); Has 62 Blast hits to 62 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 62; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G02560AT3G02560.1CATTGGGCCCATTG40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). 
AT3G02560.2CATTGGGCCCATTG40S ribosomal protein S7 (RPS7B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7C) (TAIR:AT5G16130.1); Has 555 Blast hits to 555 proteins in 220 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 93; Plants - 111; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). 
AT3G03520AT3G03520.1GGGCCCAAGphosphoesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole, membrane; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoesterase (InterPro:IPR007312); BEST Arabidopsis thaliana protein match is: NPC4 (NONSPECIFIC PHOSPHOLIPASE C4); hydrolase, acting on ester bonds / phospholipase C (TAIR:AT3G03530.1); Has 1450 Blast hits to 1383 proteins in 241 species: Archae - 10; Bacteria - 1206; Metazoa - 0; Fungi - 97; Plants - 91; Viruses - 0; Other Eukaryotes - 46 (source: NCBI BLink). 
AT3G06420AT3G06420.1TGATGGGCCCAAAAautophagy 8h (ATG8H); FUNCTIONS IN: microtubule binding; INVOLVED IN: autophagy; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Light chain 3 (LC3) (InterPro:IPR004241); BEST Arabidopsis thaliana protein match is: APG8H (AUTOPHAGY 8H); APG8 activating enzyme/ APG8-specific protease/ Atg8 ligase/ microtubule binding (TAIR:AT3G15580.1); Has 1119 Blast hits to 1117 proteins in 200 species: Archae - 0; Bacteria - 0; Metazoa - 577; Fungi - 124; Plants - 171; Viruses - 3; Other Eukaryotes - 244 (source: NCBI BLink). 
AT3G07590AT3G07590.1TTTTGGGCCCAATATsmall nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein D1, putative / snRNP core protein D1, putative / Sm protein D1, putative (TAIR:AT4G02840.1); Has 828 Blast hits to 827 proteins in 166 species: Archae - 0; Bacteria - 2; Metazoa - 337; Fungi - 221; Plants - 121; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink). 
AT3G07630AT3G07630.1TAGGGCTTTTATTGGGCCCAGTEncodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. 
AT3G07630.2TAGGGCTTTTATTGGGCCCAGTEncodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. 
AT3G07690AT3G07690.1AGTTGGGCCCANAD or NADH binding / binding / catalytic/ coenzyme binding / glycerol-3-phosphate dehydrogenase (NAD+)/ oxidoreductase/ oxidoreductase, acting on CH-OH group of donors / oxidoreductase, acting on the CH-OH group of donors, NAD or NADP as acceptor; FUNCTIONS IN: in 8 functions; INVOLVED IN: glycerol-3-phosphate catabolic process, glycerol-3-phosphate metabolic process, carbohydrate metabolic process, metabolic process; LOCATED IN: glycerol-3-phosphate dehydrogenase complex, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), NAD(P)-binding (InterPro:IPR016040), NAD-dependent glycerol-3-phosphate dehydrogenase, C-terminal (InterPro:IPR006109), NAD-dependent glycerol-3-phosphate dehydrogenase, N-terminal (InterPro:IPR011128), NAD-dependent glycerol-3-phosphate dehydrogenase (InterPro:IPR006168); BEST Arabidopsis thaliana protein match is: GPDHC1; NAD or NADH binding / glycerol-3-phosphate dehydrogenase (NAD+) (TAIR:AT2G41540.3); Has 2182 Blast hits to 2182 proteins in 581 species: Archae - 10; Bacteria - 1021; Metazoa - 281; Fungi - 47; Plants - 70; Viruses - 0; Other Eukaryotes - 753 (source: NCBI BLink). 
AT3G09250AT3G09250.1CTTGGGCCCTADNA binding / nuclease; FUNCTIONS IN: DNA binding, nuclease activity; INVOLVED IN: nucleotide-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UvrB/UvrC protein (InterPro:IPR001943); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G10925.2); Has 169 Blast hits to 169 proteins in 54 species: Archae - 0; Bacteria - 92; Metazoa - 0; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 37 (source: NCBI BLink). 
AT3G09630AT3G09630.1ATATTGGGCCCT60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT3G09630.2ATATTGGGCCCT60S ribosomal protein L4/L1 (RPL4A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 9 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4D) (TAIR:AT5G02870.1); Has 862 Blast hits to 861 proteins in 294 species: Archae - 213; Bacteria - 13; Metazoa - 235; Fungi - 102; Plants - 77; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT3G11200AT3G11200.1AGGGCCCAACTAL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT3G11200.2AGGGCCCAACTAL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT3G12280AT3G12280.1TGGGCCCAATEncodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. 
AT3G12290AT3G12290.1ATTGGGCCCAtetrahydrofolate dehydrogenase/cyclohydrolase, putative; FUNCTIONS IN: binding, catalytic activity; INVOLVED IN: folic acid and derivative biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Tetrahydrofolate dehydrogenase/cyclohydrolase (InterPro:IPR000672), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: tetrahydrofolate dehydrogenase/cyclohydrolase, putative (TAIR:AT4G00620.1); Has 7113 Blast hits to 7108 proteins in 1554 species: Archae - 77; Bacteria - 3117; Metazoa - 345; Fungi - 200; Plants - 87; Viruses - 0; Other Eukaryotes - 3287 (source: NCBI BLink). 
AT3G12600AT3G12600.1GAATGGGCCCAATAAGArabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G12600.2GAATGGGCCCAATAAGArabidopsis thaliana Nudix hydrolase homolog 16 (atnudt16); FUNCTIONS IN: hydrolase activity; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt12 (Arabidopsis thaliana Nudix hydrolase homolog 12); hydrolase (TAIR:AT1G12880.1); Has 764 Blast hits to 762 proteins in 210 species: Archae - 0; Bacteria - 257; Metazoa - 210; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 84 (source: NCBI BLink). 
AT3G13300AT3G13300.1TAGGGCCCAATAAEncodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. 
AT3G13300.2TAGGGCCCAATAAEncodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. 
AT3G13930AT3G13930.1TAGGGCCCAATATdihydrolipoamide S-acetyltransferase, putative; FUNCTIONS IN: dihydrolipoyllysine-residue acetyltransferase activity, protein binding, acyltransferase activity; INVOLVED IN: pyruvate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Dihydrolipoamide acetyltransferase, long form (InterPro:IPR006257), E3 binding (InterPro:IPR004167), 2-oxoacid dehydrogenase acyltransferase, catalytic domain (InterPro:IPR001078), Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: dihydrolipoamide S-acetyltransferase, putative (TAIR:AT1G54220.2); Has 15128 Blast hits to 14242 proteins in 1320 species: Archae - 43; Bacteria - 6315; Metazoa - 646; Fungi - 315; Plants - 198; Viruses - 0; Other Eukaryotes - 7611 (source: NCBI BLink). 
AT3G15420AT3G15420.1TAATGGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80745.1); Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G15430AT3G15430.1TTTTGGGCCCATTAregulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). 
AT3G15430.2TTTTGGGCCCATTAregulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: Ran GTPase binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: regulator of chromosome condensation (RCC1) family protein (TAIR:AT3G26100.2); Has 13355 Blast hits to 4140 proteins in 287 species: Archae - 48; Bacteria - 1354; Metazoa - 5756; Fungi - 735; Plants - 1385; Viruses - 4; Other Eukaryotes - 4073 (source: NCBI BLink). 
AT3G18790AT3G18790.1CTTGGGCCCTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isy1-like splicing (InterPro:IPR009360); Has 1075 Blast hits to 879 proteins in 176 species: Archae - 8; Bacteria - 11; Metazoa - 379; Fungi - 177; Plants - 27; Viruses - 9; Other Eukaryotes - 464 (source: NCBI BLink). 
AT3G20280AT3G20280.1ATATGGGCCCAACTPHD finger family protein; FUNCTIONS IN: protein binding, DNA binding, zinc ion binding; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, PHD-type (InterPro:IPR001965), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT1G50620.1); Has 9770 Blast hits to 5029 proteins in 476 species: Archae - 22; Bacteria - 1974; Metazoa - 3487; Fungi - 1858; Plants - 150; Viruses - 195; Other Eukaryotes - 2084 (source: NCBI BLink). 
AT3G22460AT3G22460.1GGGCCCAAAAEncodes a member of a family of genes with O-acetylserine(thiol)lyase activity. 
AT3G24515AT3G24515.1TTTTGGGCCCATAAubiquitin-conjugating enzyme 37 (UBC37); FUNCTIONS IN: ubiquitin-protein ligase activity, small conjugating protein ligase activity; INVOLVED IN: regulation of protein metabolic process, post-translational protein modification; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-conjugating enzyme/RWD-like (InterPro:IPR016135), Ubiquitin-conjugating enzyme, E2 (InterPro:IPR000608); BEST Arabidopsis thaliana protein match is: UBC11 (UBIQUITIN-CONJUGATING ENZYME 11); ubiquitin-protein ligase (TAIR:AT3G08690.1); Has 7488 Blast hits to 7480 proteins in 304 species: Archae - 0; Bacteria - 0; Metazoa - 3738; Fungi - 1409; Plants - 1069; Viruses - 22; Other Eukaryotes - 1250 (source: NCBI BLink). 
AT3G24860AT3G24860.1TGTTGGGCCCAAAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: transcription factor activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: transcription factor (TAIR:AT2G44730.1); Has 700 Blast hits to 557 proteins in 131 species: Archae - 0; Bacteria - 29; Metazoa - 100; Fungi - 40; Plants - 346; Viruses - 61; Other Eukaryotes - 124 (source: NCBI BLink). 
AT3G26410AT3G26410.1TAAATGGGCTTTATTGGGCCCATGmethyltransferase/ nucleic acid binding; FUNCTIONS IN: methyltransferase activity, nucleic acid binding; INVOLVED IN: methylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Putative RNA methylase (InterPro:IPR000241), tRNA guanosine-2'-O-methyltransferase, TRM11 (InterPro:IPR016691), N-6 adenine-specific DNA methylase, conserved site (InterPro:IPR002052); Has 434 Blast hits to 428 proteins in 205 species: Archae - 104; Bacteria - 4; Metazoa - 143; Fungi - 86; Plants - 19; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G26420AT3G26420.1CATGGGCCCAATAAAGCCCATTTAZinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. 
AT3G43230AT3G43230.1CAAGGCCCATTGGGCCCTzinc finger (FYVE type) family protein; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: phosphoinositide binding / zinc ion binding (TAIR:AT1G29800.2); Has 3031 Blast hits to 2947 proteins in 232 species: Archae - 0; Bacteria - 157; Metazoa - 1828; Fungi - 464; Plants - 196; Viruses - 3; Other Eukaryotes - 383 (source: NCBI BLink). 
AT3G45030AT3G45030.1GTTGGGCCCAACAAGCCCATATA40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT3G46580AT3G46580.1CTTAATGGGCCCAAAAGCCCAAAAProtein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. 
AT3G50930AT3G50930.1ATTTGGGCCCTCYTOCHROME BC1 SYNTHESIS (BCS1); FUNCTIONS IN: nucleoside-triphosphatase activity, ATPase activity, nucleotide binding, ATP binding; LOCATED IN: mitochondrion, plastid; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593), ATPase, AAA-type, conserved site (InterPro:IPR003960); BEST Arabidopsis thaliana protein match is: AAA-type ATPase family protein (TAIR:AT3G50940.1); Has 14639 Blast hits to 13488 proteins in 1548 species: Archae - 792; Bacteria - 3998; Metazoa - 3028; Fungi - 1834; Plants - 1282; Viruses - 24; Other Eukaryotes - 3681 (source: NCBI BLink). 
AT3G51260AT3G51260.1CTTGGGCCCAGTA20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. 
AT3G51260.2CTTGGGCCCAGTA20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. 
AT3G52040AT3G52040.1AATTGGGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G52050AT3G52050.1TTATTGGGCCCAATT5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.2TTATTGGGCCCAATT5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.3TTATTGGGCCCAATT5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.4TTATTGGGCCCAATT5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.5TTATTGGGCCCAATT5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G55620AT3G55620.1TAGGGCCCAAACembryo defective 1624 (emb1624); FUNCTIONS IN: ribosome binding, translation initiation factor activity; INVOLVED IN: embryonic development ending in seed dormancy, translational initiation; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation initiation factor IF6 (InterPro:IPR002769); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 6, putative / eIF-6, putative (TAIR:AT2G39820.1); Has 595 Blast hits to 595 proteins in 239 species: Archae - 161; Bacteria - 0; Metazoa - 147; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). 
AT3G62790AT3G62790.1AGTTGGGCCCATGNADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT2G47690.1); Has 85 Blast hits to 85 proteins in 41 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 43; Plants - 36; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT3G63460AT3G63460.1TTATTGGGCCCAATTGWD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). 
AT3G63460.2TTATTGGGCCCAATTGWD-40 repeat family protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT1G18830.1); Has 29990 Blast hits to 20402 proteins in 935 species: Archae - 42; Bacteria - 3651; Metazoa - 11973; Fungi - 5426; Plants - 3318; Viruses - 524; Other Eukaryotes - 5056 (source: NCBI BLink). 
AT4G00530AT4G00530.1AGATGGGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G01560AT4G01560.1AGATGGGCCCAAGmaternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT4G01570AT4G01570.1CTTGGGCCCATCTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink). 
AT4G01860AT4G01860.1TATTGGGCCCTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). 
AT4G01860.2TATTGGGCCCTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). 
AT4G02720AT4G02720.1AGGGCCCAATAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF926 (InterPro:IPR009269); Has 94634 Blast hits to 43088 proteins in 1394 species: Archae - 72; Bacteria - 10621; Metazoa - 45152; Fungi - 10187; Plants - 3989; Viruses - 718; Other Eukaryotes - 23895 (source: NCBI BLink). 
AT4G03490AT4G03490.1AGGGCCCAAAAprotein binding; FUNCTIONS IN: protein binding; CONTAINS InterPro DOMAIN/s: Ankyrin (InterPro:IPR002110); BEST Arabidopsis thaliana protein match is: ankyrin repeat family protein (TAIR:AT4G03500.1); Has 19395 Blast hits to 9360 proteins in 384 species: Archae - 23; Bacteria - 1025; Metazoa - 12359; Fungi - 1194; Plants - 1122; Viruses - 91; Other Eukaryotes - 3581 (source: NCBI BLink). 
AT4G08310AT4G08310.1TAGGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G44780.2); Has 49375 Blast hits to 29075 proteins in 1129 species: Archae - 121; Bacteria - 2824; Metazoa - 24551; Fungi - 5614; Plants - 1764; Viruses - 442; Other Eukaryotes - 14059 (source: NCBI BLink). 
AT4G14200AT4G14200.1ATATTGGGCCCunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 8 growth stages; Has 1311 Blast hits to 831 proteins in 209 species: Archae - 4; Bacteria - 342; Metazoa - 470; Fungi - 179; Plants - 56; Viruses - 0; Other Eukaryotes - 260 (source: NCBI BLink). 
AT4G14230AT4G14230.1TAGGGCCCAAGGCCCAAACCBS domain-containing protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G14240.1); Has 6669 Blast hits to 6527 proteins in 1353 species: Archae - 64; Bacteria - 4331; Metazoa - 264; Fungi - 186; Plants - 121; Viruses - 0; Other Eukaryotes - 1703 (source: NCBI BLink). 
AT4G15410AT4G15410.1TTTGGGCCCATTAAArabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma (PUX5); FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), UBX (InterPro:IPR001012), SEP (InterPro:IPR012989), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: PUX4; protein binding (TAIR:AT4G04210.1); Has 2169 Blast hits to 897 proteins in 184 species: Archae - 0; Bacteria - 87; Metazoa - 456; Fungi - 202; Plants - 88; Viruses - 16; Other Eukaryotes - 1320 (source: NCBI BLink). 
AT4G16770AT4G16770.1GGGCCCAAAiron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G16765.2); Has 6031 Blast hits to 6015 proteins in 680 species: Archae - 0; Bacteria - 734; Metazoa - 132; Fungi - 691; Plants - 2939; Viruses - 0; Other Eukaryotes - 1535 (source: NCBI BLink). 
AT4G17560AT4G17560.1TGGGCCCAAATribosomal protein L19 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, chloroplast stroma, chloroplast, membrane, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L19 (InterPro:IPR001857), Ribosomal protein L19, conserved site (InterPro:IPR018257); BEST Arabidopsis thaliana protein match is: ribosomal protein L19 family protein (TAIR:AT5G47190.1); Has 5332 Blast hits to 5332 proteins in 1492 species: Archae - 0; Bacteria - 2922; Metazoa - 96; Fungi - 46; Plants - 97; Viruses - 0; Other Eukaryotes - 2171 (source: NCBI BLink). 
AT4G17650AT4G17650.1ATAAAGCCCATTGGGCCCAACAaromatic-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Streptomyces cyclase/dehydrase (InterPro:IPR005031); Has 1885 Blast hits to 1881 proteins in 667 species: Archae - 0; Bacteria - 1017; Metazoa - 157; Fungi - 73; Plants - 26; Viruses - 1; Other Eukaryotes - 611 (source: NCBI BLink). 
AT4G20440AT4G20440.1GTTTGGGCCCATAAsmall nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). 
AT4G20440.2GTTTGGGCCCATAAsmall nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). 
AT4G20440.3GTTTGGGCCCATAAsmall nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). 
AT4G20440.4GTTTGGGCCCATAAsmall nuclear ribonucleoprotein associated protein B (smB); INVOLVED IN: nuclear mRNA splicing, via spliceosome; LOCATED IN: nucleoplasm, small nucleolar ribonucleoprotein complex, nucleus, Cajal body; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Small ribonucleoprotein associated, SmB/SmN (InterPro:IPR017131), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein associated protein B, putative / snRNP-B, putative / Sm protein B, putative (TAIR:AT5G44500.2); Has 59641 Blast hits to 27303 proteins in 1040 species: Archae - 59; Bacteria - 6325; Metazoa - 32922; Fungi - 6111; Plants - 7180; Viruses - 1300; Other Eukaryotes - 5744 (source: NCBI BLink). 
AT4G21860AT4G21860.1ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAATmethionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink). 
AT4G21860.2ATATTGGGCTAAAGGGCCCAAACGTAAGGCCCAAATmethionine sulfoxide reductase B 2 (MSRB2); FUNCTIONS IN: peptide-methionine-(S)-S-oxide reductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Methionine sulphoxide reductase B (InterPro:IPR002579), Mss4-like (InterPro:IPR011057); BEST Arabidopsis thaliana protein match is: methionine sulfoxide reductase domain-containing protein / SeIR domain-containing protein (TAIR:AT4G04800.1); Has 5933 Blast hits to 5932 proteins in 1231 species: Archae - 53; Bacteria - 2689; Metazoa - 222; Fungi - 85; Plants - 108; Viruses - 1; Other Eukaryotes - 2775 (source: NCBI BLink). 
AT4G27370AT4G27370.1CTTATTGGGCCCATAmember of Myosin-like proteins 
AT4G27380AT4G27380.1TATGGGCCCAATAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 26 Blast hits to 24 proteins in 11 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT4G28030AT4G28030.1TATGGGCTCATATTGGGCCCAAATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). 
AT4G28030.2TATGGGCTCATATTGGGCCCAAATGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); BEST Arabidopsis thaliana protein match is: GCN5-related N-acetyltransferase (GNAT) family protein (TAIR:AT2G06025.1); Has 235 Blast hits to 234 proteins in 78 species: Archae - 4; Bacteria - 115; Metazoa - 0; Fungi - 0; Plants - 89; Viruses - 0; Other Eukaryotes - 27 (source: NCBI BLink). 
AT4G28390AT4G28390.1AATTGGGCCCAGAEncodes a mitochondrial ADP/ATP carrier protein. Shown in heterologous systems to be located in the plasma membrane. Has comparable affinity for ADP and ATP (in E.coli). 
AT4G28880AT4G28880.1AGGGCCCAAAACasein Kinase I-like 3 (ckl3); FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ckl4 (Casein Kinase I-like 4); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase (TAIR:AT4G28860.1); Has 47686 Blast hits to 47386 proteins in 1403 species: Archae - 19; Bacteria - 6033; Metazoa - 20862; Fungi - 4890; Plants - 5655; Viruses - 307; Other Eukaryotes - 9920 (source: NCBI BLink). 
AT4G28910AT4G28910.1AATTGGGCCCATGLOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G28910.2AATTGGGCCCATGLOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G28910.3AATTGGGCCCATGLOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1675 (InterPro:IPR012463); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G07250.1); Has 223 Blast hits to 204 proteins in 56 species: Archae - 2; Bacteria - 11; Metazoa - 48; Fungi - 32; Plants - 89; Viruses - 3; Other Eukaryotes - 38 (source: NCBI BLink). 
AT4G29840AT4G29840.1TTAATGGGCCCAAAAthreonine synthase 
AT4G30750AT4G30750.1CTTGGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30730.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30760AT4G30760.1TTTTGGGCCCAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30760.2TTTTGGGCCCAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF537 (InterPro:IPR007491); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62050.1); Has 78 Blast hits to 76 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G34720AT4G34720.1CATTGGGCCCvacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1) 
AT4G35580AT4G35580.1TTTGGGCTTTAAGGCCTTTTTGGGCCCTANAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G35580.2TTTGGGCTTTAAGGCCTTTTTGGGCCCTANAC transcription factor-like 9 (NTL9); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: no apical meristem (NAM) family protein (TAIR:AT1G33060.2); Has 1627 Blast hits to 1625 proteins in 54 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1627; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G38170AT4G38170.1AGGGCCCAAAAFAR1-related sequence 9 (FRS9); FUNCTIONS IN: zinc ion binding; INVOLVED IN: response to red or far red light; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PMZ-type (InterPro:IPR006564), MULE transposase, conserved domain (InterPro:IPR018289), Zinc finger, SWIM-type (InterPro:IPR007527); BEST Arabidopsis thaliana protein match is: FRS5 (FAR1-related sequence 5); zinc ion binding (TAIR:AT4G38180.1); Has 575 Blast hits to 561 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 2; Plants - 571; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G02240AT5G02240.1GGCTGGGCCCAAAAProtein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. 
AT5G02370AT5G02370.1TAAATGGGCCCAAAAAAGGCCkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, sequence-specific DNA binding, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Helix-hairpin-helix DNA-binding motif, class 1 (InterPro:IPR003583), Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATP binding / microtubule motor (TAIR:AT5G23910.1); Has 7488 Blast hits to 7156 proteins in 245 species: Archae - 0; Bacteria - 21; Metazoa - 3823; Fungi - 875; Plants - 885; Viruses - 0; Other Eukaryotes - 1884 (source: NCBI BLink). 
AT5G02450AT5G02450.1GTTTGGGCCCAACA60S ribosomal protein L36 (RPL36C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L36e (InterPro:IPR000509); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36 (RPL36B) (TAIR:AT3G53740.4); Has 585 Blast hits to 585 proteins in 196 species: Archae - 0; Bacteria - 0; Metazoa - 295; Fungi - 95; Plants - 95; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink). 
AT5G03160AT5G03160.1TTTTGGGCCCATCAJ domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. 
AT5G04280AT5G04280.1CTTGGGCCCATAglycine-rich RNA-binding protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Zinc finger, CCHC-type (InterPro:IPR001878); BEST Arabidopsis thaliana protein match is: glycine-rich RNA-binding protein, putative (TAIR:AT1G60650.2); Has 24420 Blast hits to 18586 proteins in 789 species: Archae - 10; Bacteria - 1605; Metazoa - 14101; Fungi - 2458; Plants - 3834; Viruses - 39; Other Eukaryotes - 2373 (source: NCBI BLink). 
AT5G04710AT5G04710.1CATGGGCCCAAAGCCCATAaspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink). 
AT5G04840AT5G04840.1AGGGCCCAAAAbZIP protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription, DNA-dependent; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827); BEST Arabidopsis thaliana protein match is: bZIP transcription factor family protein (TAIR:AT2G42380.2); Has 249 Blast hits to 247 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 249; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G05320AT5G05320.1CATTGGGCCCATGmonooxygenase, putative (MO3); FUNCTIONS IN: monooxygenase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938); BEST Arabidopsis thaliana protein match is: monooxygenase, putative (MO2) (TAIR:AT4G38540.1); Has 3563 Blast hits to 3548 proteins in 650 species: Archae - 42; Bacteria - 1804; Metazoa - 7; Fungi - 839; Plants - 277; Viruses - 0; Other Eukaryotes - 594 (source: NCBI BLink). 
AT5G06340AT5G06340.1AAATGGGCCCAATAARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 27 (ATNUDX27); FUNCTIONS IN: bis(5'-adenosyl)-pentaphosphatase activity, bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: ATNUDX26 (ARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 26); bis(5'-adenosyl)-pentaphosphatase/ bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) (TAIR:AT3G10620.1); Has 3191 Blast hits to 3191 proteins in 724 species: Archae - 2; Bacteria - 1483; Metazoa - 9; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1660 (source: NCBI BLink). 
AT5G06660AT5G06660.1CATTGGGCCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF841, eukaryotic (InterPro:IPR008559); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12030.1); Has 193 Blast hits to 193 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). 
AT5G07340AT5G07340.1TAATTGGGCCCAGcalnexin, putative; FUNCTIONS IN: unfolded protein binding, calcium ion binding; INVOLVED IN: protein folding; LOCATED IN: endoplasmic reticulum, plasma membrane, chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Calreticulin/calnexin, P (InterPro:IPR009033), Calreticulin/calnexin (InterPro:IPR001580), Calreticulin/calnexin, conserved site (InterPro:IPR018124), Concanavalin A-like lectin/glucanase (InterPro:IPR008985), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320); BEST Arabidopsis thaliana protein match is: calnexin 1 (CNX1) (TAIR:AT5G61790.1); Has 1287 Blast hits to 1216 proteins in 289 species: Archae - 0; Bacteria - 58; Metazoa - 600; Fungi - 146; Plants - 196; Viruses - 11; Other Eukaryotes - 276 (source: NCBI BLink). 
AT5G09770AT5G09770.1TATATGGGCCCAAAGCCCAAACribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G09880AT5G09880.1CTATTGGGCCCATCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Splicing factor, CC1-like (InterPro:IPR006509), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA recognition motif (RRM)-containing protein (TAIR:AT2G16940.1); Has 75114 Blast hits to 36610 proteins in 1254 species: Archae - 65; Bacteria - 4369; Metazoa - 40620; Fungi - 8054; Plants - 5837; Viruses - 419; Other Eukaryotes - 15750 (source: NCBI BLink). 
AT5G10870AT5G10870.1AGTTGGGCCCAAATEncodes chorismate mutase AtCM2. 
AT5G14030AT5G14030.1CAATTGGGCCCATCATTGACTTTtranslocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT5G14030.2CAATTGGGCCCATCATTGACTTTtranslocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT5G14030.3CAATTGGGCCCATCATTGACTTTtranslocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT5G14030.4CAATTGGGCCCATCATTGACTTTtranslocon-associated protein beta (TRAPB) family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translocon-associated beta (InterPro:IPR008856); Has 154 Blast hits to 154 proteins in 64 species: Archae - 0; Bacteria - 0; Metazoa - 124; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT5G14610AT5G14610.1CATGGGCCCAAATATP binding / ATP-dependent helicase/ helicase/ nucleic acid binding / protein binding; FUNCTIONS IN: protein binding, helicase activity, nucleic acid binding, ATP binding, ATP-dependent helicase activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), WW/Rsp5/WWP (InterPro:IPR001202), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DRH1 (DEAD BOX RNA HELICASE 1); ATP-dependent RNA helicase/ ATPase (TAIR:AT3G01540.4); Has 52477 Blast hits to 39251 proteins in 1971 species: Archae - 612; Bacteria - 22224; Metazoa - 10881; Fungi - 4675; Plants - 4189; Viruses - 260; Other Eukaryotes - 9636 (source: NCBI BLink). 
AT5G15200AT5G15200.1TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G15200.2TCAAAACGGGCCCAATATAAAGCC40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink). 
AT5G15550AT5G15550.1TTTGGGCCCAAAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink). 
AT5G15550.2TTTGGGCCCAAAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink). 
AT5G15860AT5G15860.1TTTGGGCCCAEncodes a protein with prenylcysteine methylesterase activity. 
AT5G15860.2TTTGGGCCCAEncodes a protein with prenylcysteine methylesterase activity. 
AT5G16220AT5G16220.1CATGGGCCCAAATocticosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G16250AT5G16250.1CATTGGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G02640.1); Has 56 Blast hits to 56 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 56; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G16260AT5G16260.1TGGGCCCAATGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink). 
AT5G16940AT5G16940.1ATATTGGGCCCAATAAcarbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink). 
AT5G16940.2ATATTGGGCCCAATAAcarbon-sulfur lyase; FUNCTIONS IN: carbon-sulfur lyase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione-dependent formaldehyde-activating, GFA (InterPro:IPR006913); Has 1933 Blast hits to 1931 proteins in 352 species: Archae - 0; Bacteria - 664; Metazoa - 60; Fungi - 38; Plants - 18; Viruses - 0; Other Eukaryotes - 1153 (source: NCBI BLink). 
AT5G16950AT5G16950.1TTATTGGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 16 Blast hits to 16 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G19290AT5G19290.1GGGCCCAAAAesterase/lipase/thioesterase family protein; FUNCTIONS IN: catalytic activity; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT5G14980.1); Has 1459 Blast hits to 1457 proteins in 500 species: Archae - 13; Bacteria - 834; Metazoa - 101; Fungi - 51; Plants - 236; Viruses - 33; Other Eukaryotes - 191 (source: NCBI BLink). 
AT5G19875AT5G19875.1AGGGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31940.1); Has 63 Blast hits to 63 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G21070AT5G21070.1CATTGGGCCCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 53 Blast hits to 53 proteins in 17 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT5G23200AT5G23200.1AAATGGGCCCAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G08270.1); Has 52 Blast hits to 52 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G23740AT5G23740.1TTGGCCCAAAAGGGCCCAACAEncodes a putative ribosomal protein S11 (RPS11-beta). 
AT5G24810AT5G24810.1TTGGGCTTATTGGGCCCATAAABC1 family protein; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ABC-1 (InterPro:IPR004147), Beta-lactamase-type transpeptidase fold (InterPro:IPR012338), Beta-lactamase-related (InterPro:IPR001466), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATATH13; transporter (TAIR:AT5G64940.2); Has 11583 Blast hits to 11540 proteins in 1287 species: Archae - 93; Bacteria - 6015; Metazoa - 395; Fungi - 388; Plants - 356; Viruses - 16; Other Eukaryotes - 4320 (source: NCBI BLink). 
AT5G26610AT5G26610.1TTTTGGGCCCAATD111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink). 
AT5G26610.2TTTTGGGCCCAATD111/G-patch domain-containing protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), D111/G-patch (InterPro:IPR000467), Zinc finger, C2H2-type (InterPro:IPR007087); BEST Arabidopsis thaliana protein match is: D111/G-patch domain-containing protein (TAIR:AT2G42330.2); Has 2158 Blast hits to 1959 proteins in 193 species: Archae - 1; Bacteria - 43; Metazoa - 1258; Fungi - 212; Plants - 135; Viruses - 16; Other Eukaryotes - 493 (source: NCBI BLink). 
AT5G28370AT5G28370.1AAATGGGCCCAACTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G28460.1); Has 22506 Blast hits to 6026 proteins in 190 species: Archae - 7; Bacteria - 27; Metazoa - 841; Fungi - 534; Plants - 20012; Viruses - 0; Other Eukaryotes - 1085 (source: NCBI BLink). 
AT5G28540AT5G28540.1ACTGGGCCCAACAEncodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. 
AT5G38480AT5G38480.1GTTGGGCCCAGTGGCCCATTTAgeneral regulatory factor, a 14-3-3 gene 
AT5G38480.2GTTGGGCCCAGTGGCCCATTTAgeneral regulatory factor, a 14-3-3 gene 
AT5G39510AT5G39510.1GTTTGGGCCCTAEncodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. 
AT5G41600AT5G41600.1TAAATGGGCCCAATGVIRB2-INTERACTING PROTEIN 3 (BTI3); INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Reticulon (InterPro:IPR003388); BEST Arabidopsis thaliana protein match is: reticulon family protein (RTNLB3) (TAIR:AT1G64090.1); Has 939 Blast hits to 939 proteins in 86 species: Archae - 0; Bacteria - 0; Metazoa - 648; Fungi - 2; Plants - 271; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT5G41940AT5G41940.1TGGGCCCAATTRabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1); Has 3483 Blast hits to 2868 proteins in 186 species: Archae - 2; Bacteria - 83; Metazoa - 1894; Fungi - 490; Plants - 337; Viruses - 5; Other Eukaryotes - 672 (source: NCBI BLink). 
AT5G45390AT5G45390.1AATAGGCCAGGGCCCAATAAACCGTOne of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). 
AT5G47010AT5G47010.1TAATTGGGCCCAATATRequired for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. 
AT5G47320AT5G47320.1CATTGGGCCCATTATNuclear encoded mitochondrial ribosome subunit. 
AT5G47435AT5G47435.1CTTATTGGGCCCATTTencodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. 
AT5G47435.2CTTATTGGGCCCATTTencodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. 
AT5G47840AT5G47840.1GTTTGGGCCCTAdenosine monophosphate kinase (AMK2); FUNCTIONS IN: nucleobase, nucleoside, nucleotide kinase activity, nucleotide kinase activity, ATP binding, adenylate kinase activity, phosphotransferase activity, phosphate group as acceptor; INVOLVED IN: nucleobase, nucleoside, nucleotide and nucleic acid metabolic process, anaerobic respiration, nucleotide metabolic process; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Adenylate kinase, zinc-finger lid region (InterPro:IPR007862), Adenylate kinase, subfamily (InterPro:IPR006259), Adenylate kinase (InterPro:IPR000850); BEST Arabidopsis thaliana protein match is: adenylate kinase family protein (TAIR:AT5G35170.2); Has 8772 Blast hits to 8627 proteins in 1854 species: Archae - 64; Bacteria - 4464; Metazoa - 1141; Fungi - 289; Plants - 247; Viruses - 0; Other Eukaryotes - 2567 (source: NCBI BLink). 
AT5G48730AT5G48730.1TTTTGGGCCCAAAApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G53170.1); Has 13431 Blast hits to 4993 proteins in 158 species: Archae - 3; Bacteria - 10; Metazoa - 241; Fungi - 171; Plants - 12464; Viruses - 0; Other Eukaryotes - 542 (source: NCBI BLink). 
AT5G50080AT5G50080.1ATTTGGGCCCAAATencodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. 
AT5G52070AT5G52070.1ATTTGGGCCCagenet domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tudor-like, plant (InterPro:IPR014002), Agenet (InterPro:IPR008395); BEST Arabidopsis thaliana protein match is: agenet domain-containing protein (TAIR:AT5G42670.1); Has 28 Blast hits to 28 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G55140AT5G55140.1TAATTGGGCCCAGATAAAGCCCAAATribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink). 
AT5G56030AT5G56030.1AGTTGGGCCCAAAAa member of heat shock protein 90 (HSP90) gene family. Expressed in all tissues and abundant in root apical meristem, pollen and tapetum. Expression is NOT heat-induced but induced by IAA and NaCl. 
AT5G57815AT5G57815.1TTTTGGGCCCATTAAAGCCCAATAAAATGGGCTAcytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink). 
AT5G58710AT5G58710.1GGGCCCAATTAEncodes cyclophilin ROC7. 
AT5G58960AT5G58960.2AGGGCCCAAAAMutant plants display impaired light-regulation of the hypocotyl randomization response. 
AT5G58960.3AGGGCCCAAAAMutant plants display impaired light-regulation of the hypocotyl randomization response. 
AT5G62300AT5G62300.1GTTTGGGCCCAACA40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT5G62300.2GTTTGGGCCCAACA40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT5G62700AT5G62700.1ATGGGCCCAAAencodes tubulin beta-2/beta-3 chain 
AT5G63910AT5G63910.1ATAAGGGCCCAAGencodes for a farnesylcysteine lyase (EC 1.8.3.5 - prenylcysteine oxidase) involved in a salvage pathway of farnesyl diphosphate. 
AT5G66240AT5G66240.1ATTTGGGCCCATATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink). 
AT5G66240.2ATTTGGGCCCATATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT5G14530.1); Has 16339 Blast hits to 9309 proteins in 380 species: Archae - 34; Bacteria - 3341; Metazoa - 6649; Fungi - 3004; Plants - 1107; Viruses - 0; Other Eukaryotes - 2204 (source: NCBI BLink). 
AT5G66290AT5G66290.1TGGGCCCAATAAAATGGGCTTTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; Has 18 Blast hits to 18 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.