version

Summary of AtREG393 (All List)

OrganismArabidopsis thaliana  
IDAtREG393  
SequenceTCGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE MotifGGGCC  one of "Sequences Over-Represented in Light-Induced Promoters (SORLIPs) in Arabidopsis; Computationally identified phyA-induced motifs; See also S000482, S000484, S000485, S000486 (all SORLIPs), and also S000487, S000488, S000489, S000490 (all SORLREPs);  
TGGGCY  "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)  
Total Entry Count306  

Entry Sequences (306 entries)

LocusGene modelSequenceDescription
AT1G02690AT1G02690.1GTTGGGCCGATATTGGGCTAAPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G02690.2GTTGGGCCGATATTGGGCTAAPutative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. 
AT1G03310AT1G03310.1TTATTGGGCCTATGGGCTCGGCCCAGAEncodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. 
AT1G03310.2TTATTGGGCCTATGGGCTCGGCCCAGAEncodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. 
AT1G04270AT1G04270.1AGTTGGGCCGAEncodes cytosolic ribosomal protein S15. 
AT1G04270.2AGTTGGGCCGAEncodes cytosolic ribosomal protein S15. 
AT1G04870AT1G04870.1AAATGGGCCGAAEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. 
AT1G04870.2AAATGGGCCGAAEncodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. 
AT1G04930AT1G04930.1AATACCCTCAGGCCCAGATCGGCCCAAAAhydroxyproline-rich glycoprotein family protein; LOCATED IN: chloroplast; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT2G32840.1); Has 1563 Blast hits to 1268 proteins in 183 species: Archae - 0; Bacteria - 127; Metazoa - 510; Fungi - 165; Plants - 332; Viruses - 182; Other Eukaryotes - 247 (source: NCBI BLink). 
AT1G04940AT1G04940.1TTTTGGGCCGATCTGGGCCTGAGGGTATTTic20 is believed to function as a component of the protein-conducting channel at the inner envelope membrane. Genes AT1G04940 and AT1G04945 were switched for the TAIR7 genome release to give consistency with MIPs annotation. 
AT1G05190AT1G05190.1TAATGGGCCGAAembryo defective 2394 (emb2394); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: chloroplast stroma, chloroplast, large ribosomal subunit, membrane, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-1 (InterPro:IPR002358); BEST Arabidopsis thaliana protein match is: ribosomal protein L6 family protein (TAIR:AT2G18400.1); Has 5749 Blast hits to 5749 proteins in 1580 species: Archae - 150; Bacteria - 2981; Metazoa - 10; Fungi - 116; Plants - 74; Viruses - 0; Other Eukaryotes - 2418 (source: NCBI BLink). 
AT1G06220AT1G06220.1AATTGGGCCGATEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. 
AT1G06220.2AATTGGGCCGATEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. 
AT1G07000AT1G07000.1ATCGGCCCATAAA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. 
AT1G07070AT1G07070.1TTCGGCCCATAT60S ribosomal protein L35a (RPL35aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L35Ae (InterPro:IPR001780), Ribosomal protein L35Ae, conserved site (InterPro:IPR018266); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35a (RPL35aC) (TAIR:AT1G74270.1); Has 541 Blast hits to 541 proteins in 186 species: Archae - 21; Bacteria - 0; Metazoa - 228; Fungi - 97; Plants - 93; Viruses - 0; Other Eukaryotes - 102 (source: NCBI BLink). 
AT1G07140AT1G07140.1ATCGGCCCATAEncodes a putative Ran-binding protein (siRanBP). 
AT1G08125AT1G08125.1ATTTGGGCCGAAExpressed protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G73320.1); Has 986 Blast hits to 984 proteins in 169 species: Archae - 0; Bacteria - 58; Metazoa - 387; Fungi - 270; Plants - 163; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT1G08490AT1G08490.1AAAAGGCCTAATTCGGCCCATATChloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. 
AT1G08640AT1G08640.1ATTGGGCCGATunknown protein; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT1G09140AT1G09140.1ATATGGGCCGATEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. 
AT1G09140.2ATATGGGCCGATEncodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. 
AT1G09150AT1G09150.1ATCGGCCCATATpseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: PUA-like (InterPro:IPR015947), PUA (InterPro:IPR002478), Translation machinery-associated RNA binding protein, predicted (InterPro:IPR016437), Uncharacterized domain 2 (InterPro:IPR004521); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor SUI1 family protein (TAIR:AT1G71350.1); Has 649 Blast hits to 647 proteins in 208 species: Archae - 99; Bacteria - 0; Metazoa - 263; Fungi - 102; Plants - 42; Viruses - 0; Other Eukaryotes - 143 (source: NCBI BLink). 
AT1G09800AT1G09800.1TGTGGGCCATCGGCCCACAtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT3G06950.1); Has 6844 Blast hits to 5672 proteins in 1445 species: Archae - 71; Bacteria - 3683; Metazoa - 118; Fungi - 0; Plants - 55; Viruses - 0; Other Eukaryotes - 2917 (source: NCBI BLink). 
AT1G09815AT1G09815.1CAATGGGCCGATPOLYMERASE DELTA 4 (POLD4); FUNCTIONS IN: DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase delta, subunit 4 (InterPro:IPR007218); Has 137 Blast hits to 137 proteins in 62 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 58; Plants - 33; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G10030AT1G10030.1TCGGCCCATCAArabidopsis homolog of yeast ergosterol28 (ERG28); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Erg28-like (InterPro:IPR005352); Has 155 Blast hits to 155 proteins in 68 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 64; Plants - 23; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT1G12810AT1G12810.1ATCGGCCCAAATCCAATAAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages. 
AT1G12810.2ATCGGCCCAAATCCAATAAGproline-rich family protein; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages. 
AT1G13060AT1G13060.1ATCGGCCCATTAAEncodes 20S proteasome beta subunit PBE1 (PBE1). 
AT1G13690AT1G13690.1TTATTGGGCCGACCCGAtE1 - stimulates the ATPase activity of DnaK/DnaJ 
AT1G14250AT1G14250.1ATCGGCCCACAnucleoside phosphatase family protein / GDA1/CD39 family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Nucleoside phosphatase GDA1/CD39 (InterPro:IPR000407); BEST Arabidopsis thaliana protein match is: nucleoside phosphatase family protein / GDA1/CD39 family protein (TAIR:AT1G14240.4); Has 1087 Blast hits to 1083 proteins in 168 species: Archae - 0; Bacteria - 20; Metazoa - 530; Fungi - 212; Plants - 197; Viruses - 0; Other Eukaryotes - 128 (source: NCBI BLink). 
AT1G14990AT1G14990.1TTATTGGGCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G15000AT1G15000.1TTCGGCCCAATAAserine carboxypeptidase-like 50 (scpl50); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: scpl48 (serine carboxypeptidase-like 48); serine-type carboxypeptidase (TAIR:AT3G45010.1); Has 2538 Blast hits to 2426 proteins in 320 species: Archae - 0; Bacteria - 215; Metazoa - 624; Fungi - 565; Plants - 842; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink). 
AT1G15420AT1G15420.1TAAGTCGGCCCAACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function NUC189, C-terminal (InterPro:IPR012979); Has 698 Blast hits to 572 proteins in 149 species: Archae - 0; Bacteria - 42; Metazoa - 236; Fungi - 117; Plants - 61; Viruses - 27; Other Eukaryotes - 215 (source: NCBI BLink). 
AT1G15720AT1G15720.1TTATGGGCCGATArabidopsis thaliana myb family transcription factor (At1g15720) 
AT1G16445AT1G16445.1CTATTGGGCCGAAmethylase-related; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Putative rRNA methylase (InterPro:IPR010719); Has 531 Blast hits to 531 proteins in 250 species: Archae - 2; Bacteria - 482; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G19920AT1G19920.1TGATGGGCCGAAencodes a chloroplast form of ATP sulfurylase 
AT1G21190AT1G21190.1ATATTGGGCCGATsmall nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G76860.1); Has 924 Blast hits to 924 proteins in 209 species: Archae - 244; Bacteria - 0; Metazoa - 275; Fungi - 141; Plants - 102; Viruses - 0; Other Eukaryotes - 162 (source: NCBI BLink). 
AT1G21200AT1G21200.1ATCGGCCCAATATtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G76870.1); Has 251 Blast hits to 233 proteins in 48 species: Archae - 2; Bacteria - 24; Metazoa - 66; Fungi - 2; Plants - 75; Viruses - 9; Other Eukaryotes - 73 (source: NCBI BLink). 
AT1G21350AT1G21350.1TTCGGCCCATCAantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). 
AT1G21350.2TTCGGCCCATCAantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). 
AT1G21350.3TTCGGCCCATCAantioxidant/ oxidoreductase; FUNCTIONS IN: oxidoreductase activity, antioxidant activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen (InterPro:IPR000866), Thioredoxin-like (InterPro:IPR017936), Thioredoxin-like fold (InterPro:IPR012336); Has 2431 Blast hits to 2431 proteins in 245 species: Archae - 18; Bacteria - 506; Metazoa - 4; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 1877 (source: NCBI BLink). 
AT1G21790AT1G21790.1AAATGGGCCGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); Has 127 Blast hits to 127 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT1G22520AT1G22520.1ATAAGGCCCATTAATCGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). 
AT1G22520.2ATAAGGCCCATTAATCGGCCCAATATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF543 (InterPro:IPR007512); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G72170.1). 
AT1G23205AT1G23205.1TCAGGCCCAGATCGGCCCATTAAinvertase/pectin methylesterase inhibitor family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase inhibitor activity, pectinesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase inhibitor (InterPro:IPR006501); BEST Arabidopsis thaliana protein match is: invertase/pectin methylesterase inhibitor family protein (TAIR:AT1G70720.1); Has 417 Blast hits to 412 proteins in 34 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 417; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G23360AT1G23360.1CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). 
AT1G23360.2CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). 
AT1G23360.3CTTATTGGGCCTAAAATCGGCCCAATATUbiE/COQ5 methyltransferase family protein; FUNCTIONS IN: methyltransferase activity; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UbiE/COQ5 methyltransferase (InterPro:IPR004033); BEST Arabidopsis thaliana protein match is: UbiE/COQ5 methyltransferase family protein (TAIR:AT5G57300.2); Has 10223 Blast hits to 10221 proteins in 1487 species: Archae - 351; Bacteria - 5788; Metazoa - 264; Fungi - 303; Plants - 236; Viruses - 0; Other Eukaryotes - 3281 (source: NCBI BLink). 
AT1G25260AT1G25260.1ATCGGCCCAGAacidic ribosomal protein P0-related; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L10 (InterPro:IPR001790); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P0 (RPP0C) (TAIR:AT3G11250.1); Has 809 Blast hits to 807 proteins in 249 species: Archae - 78; Bacteria - 0; Metazoa - 294; Fungi - 172; Plants - 102; Viruses - 0; Other Eukaryotes - 163 (source: NCBI BLink). 
AT1G26230AT1G26230.1TCGGCCCAACAchaperonin, putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: cellular protein metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperonin Cpn60 (InterPro:IPR001844); BEST Arabidopsis thaliana protein match is: CPN60B (CHAPERONIN 60 BETA); ATP binding / protein binding (TAIR:AT1G55490.2); Has 24360 Blast hits to 24320 proteins in 5137 species: Archae - 390; Bacteria - 14007; Metazoa - 1488; Fungi - 952; Plants - 459; Viruses - 2; Other Eukaryotes - 7062 (source: NCBI BLink). 
AT1G26530AT1G26530.1TATATGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT1G32470AT1G32470.1TGTGGGCCGAAglycine cleavage system H protein, mitochondrial, putative; FUNCTIONS IN: glycine dehydrogenase (decarboxylating) activity; INVOLVED IN: glycine catabolic process; LOCATED IN: mitochondrion, glycine cleavage complex, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxo acid dehydrogenase, lipoyl-binding site (InterPro:IPR003016), Single hybrid motif (InterPro:IPR011053), Glycine cleavage H-protein (InterPro:IPR002930), Glycine cleavage H-protein, subgroup (InterPro:IPR017453); BEST Arabidopsis thaliana protein match is: GDCH; glycine dehydrogenase (decarboxylating) (TAIR:AT2G35370.1); Has 4756 Blast hits to 4756 proteins in 1228 species: Archae - 82; Bacteria - 2411; Metazoa - 143; Fungi - 84; Plants - 158; Viruses - 0; Other Eukaryotes - 1878 (source: NCBI BLink). 
AT1G32580AT1G32580.1TTCGGCCCATTAAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: plastid developmental protein DAG, putative (TAIR:AT2G35240.1); Has 151 Blast hits to 138 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 151; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G33520AT1G33520.1TCGGCCCATATAHas single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; 
AT1G43170AT1G43170.1TCGGCCCATATEncodes a cytoplasmic ribosomal protein. 
AT1G43170.2TCGGCCCATATEncodes a cytoplasmic ribosomal protein. 
AT1G43170.3TCGGCCCATATEncodes a cytoplasmic ribosomal protein. 
AT1G43170.4TCGGCCCATATEncodes a cytoplasmic ribosomal protein. 
AT1G48420AT1G48420.1GAATGGGCCGAGGCCCATAAEncodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. Unlike homologous bacterial enzymes, it does not have 1-aminocyclopropane-1-carboxylate deaminase activity. 
AT1G48650AT1G48650.1TTCGGCCCAAGhelicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1). 
AT1G48650.2TTCGGCCCAAGhelicase domain-containing protein; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), Double-stranded RNA binding (InterPro:IPR001159), Region of unknown function DUF1605 (InterPro:IPR011709), Double-stranded RNA-binding-like (InterPro:IPR014720), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP binding / ATP-dependent helicase/ RNA binding / double-stranded RNA binding / helicase/ nucleic acid binding (TAIR:AT2G01130.1). 
AT1G49140AT1G49140.1TCTGGGCCGANADH-ubiquinone oxidoreductase-related; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase-related (TAIR:AT3G18410.2); Has 96 Blast hits to 96 proteins in 44 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 54; Plants - 36; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G49410AT1G49410.1TCGGCCCACAtranslocase of the outer mitochondrial membrane 6 (TOM6); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 20 Blast hits to 20 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G51060AT1G51060.1GTTTGGGCCGAAEncodes HTA10, a histone H2A protein. 
AT1G54120AT1G54120.1TTCGGCCCAGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G14060.1); Has 12 Blast hits to 12 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 12; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G56190AT1G56190.1CATTGGGCCGAphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G56190.2CATTGGGCCGAphosphoglycerate kinase, putative; FUNCTIONS IN: phosphoglycerate kinase activity; INVOLVED IN: response to cadmium ion, glycolysis; LOCATED IN: thylakoid, mitochondrion, chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phosphoglycerate kinase, N-terminal (InterPro:IPR015824), Phosphoglycerate kinase (InterPro:IPR001576), Phosphoglycerate kinase, C-terminal (InterPro:IPR015901), Phosphoglycerate kinase, conserved site (InterPro:IPR015911); BEST Arabidopsis thaliana protein match is: PGK1 (PHOSPHOGLYCERATE KINASE 1); phosphoglycerate kinase (TAIR:AT3G12780.1); Has 8089 Blast hits to 8068 proteins in 1791 species: Archae - 166; Bacteria - 2876; Metazoa - 368; Fungi - 140; Plants - 376; Viruses - 0; Other Eukaryotes - 4163 (source: NCBI BLink). 
AT1G56460AT1G56460.1TAATGGGCCGATPAPA-1-like family protein / zinc finger (HIT type) family protein; FUNCTIONS IN: protein binding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Zinc finger, HIT-type (InterPro:IPR007529), PAPA-1-like conserved region (InterPro:IPR006880); BEST Arabidopsis thaliana protein match is: PAPA-1-like family protein / zinc finger (HIT type) family protein (TAIR:AT2G47350.1); Has 6344 Blast hits to 4558 proteins in 417 species: Archae - 6; Bacteria - 427; Metazoa - 2467; Fungi - 794; Plants - 231; Viruses - 26; Other Eukaryotes - 2393 (source: NCBI BLink). 
AT1G61450AT1G61450.1ATTGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G61415.1); Has 7 Blast hits to 7 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G61990AT1G61990.1TATATGGGCCGAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT1G61960.1); Has 369 Blast hits to 350 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 366; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G64490AT1G64490.1TCGGCCCATTCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42060.1); Has 43 Blast hits to 42 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G64490.1TCGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G42060.1); Has 43 Blast hits to 42 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G70900AT1G70900.1TTCGGCCCATGunknown protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23110.3); Has 29 Blast hits to 29 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G74970AT1G74970.1TTAATGGGCTCTAATGGGCCGATribosomal protein S9, nuclear encoded component of the chloroplast ribosome 
AT1G76300AT1G76300.1CTAATGGGCCGATsnRNP core protein SmD3 (SmD3); FUNCTIONS IN: molecular_function unknown; LOCATED IN: nuclear body, nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein, putative / snRNP, putative / Sm protein, putative (TAIR:AT1G20580.1); Has 890 Blast hits to 890 proteins in 170 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 227; Plants - 127; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink). 
AT1G77270AT1G77270.1TTCGGCCCATTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07730.1); Has 365 Blast hits to 331 proteins in 76 species: Archae - 0; Bacteria - 25; Metazoa - 174; Fungi - 10; Plants - 59; Viruses - 0; Other Eukaryotes - 97 (source: NCBI BLink). 
AT1G77490AT1G77490.1TCGGCCCATAAEncodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. 
AT1G78800AT1G78800.1TCTGGGCCGAAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: SUS5; UDP-glycosyltransferase/ sucrose synthase (TAIR:AT5G37180.1); Has 9928 Blast hits to 9895 proteins in 1204 species: Archae - 399; Bacteria - 5805; Metazoa - 243; Fungi - 183; Plants - 319; Viruses - 0; Other Eukaryotes - 2979 (source: NCBI BLink). 
AT1G78870AT1G78870.1ATCGGCCCAACUBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B. 
AT1G78870.2ATCGGCCCAACUBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B. 
AT1G78870.3ATCGGCCCAACUBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B. 
AT1G78920AT1G78920.1TATATGGGCCGAAvacuolar-type H+-translocating inorganic pyrophosphatase 
AT1G78920.2TATATGGGCCGAAvacuolar-type H+-translocating inorganic pyrophosphatase 
AT1G79280AT1G79280.1TTCGGCCCAACTEncodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. 
AT1G79340AT1G79340.1AGTTGGGCCGAAATTAGGCCmetacaspase 4 (AtMC4); FUNCTIONS IN: cysteine-type peptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600); BEST Arabidopsis thaliana protein match is: ATMC5 (ARABIDOPSIS THALIANA METACASPASE 5); cysteine-type endopeptidase (TAIR:AT1G79330.1); Has 835 Blast hits to 815 proteins in 210 species: Archae - 5; Bacteria - 241; Metazoa - 2; Fungi - 193; Plants - 189; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink). 
AT1G79650AT1G79650.1TGGGCCGAAputative DNA repair protein RAD23 
AT1G79650.2TGGGCCGAAputative DNA repair protein RAD23 
AT1G79650.3TGGGCCGAAputative DNA repair protein RAD23 
AT1G80550AT1G80550.1ATCGGCCCAAATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G15010.1); Has 13165 Blast hits to 4764 proteins in 142 species: Archae - 4; Bacteria - 8; Metazoa - 159; Fungi - 112; Plants - 12399; Viruses - 0; Other Eukaryotes - 483 (source: NCBI BLink). 
AT2G02910AT2G02910.1TGTGGGCCGATGGCCCACAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 191 Blast hits to 191 proteins in 22 species: Archae - 6; Bacteria - 21; Metazoa - 0; Fungi - 0; Plants - 106; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT2G14660AT2G14660.1ATCGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0310 (InterPro:IPR002740); Has 2334 Blast hits to 2333 proteins in 479 species: Archae - 5; Bacteria - 781; Metazoa - 60; Fungi - 50; Plants - 22; Viruses - 0; Other Eukaryotes - 1416 (source: NCBI BLink). 
AT2G14660.1TTCGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0310 (InterPro:IPR002740); Has 2334 Blast hits to 2333 proteins in 479 species: Archae - 5; Bacteria - 781; Metazoa - 60; Fungi - 50; Plants - 22; Viruses - 0; Other Eukaryotes - 1416 (source: NCBI BLink). 
AT2G17670AT2G17670.1TTTGGGCCGATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). 
AT2G17670.2TTTGGGCCGATpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: MEE40 (maternal effect embryo arrest 40) (TAIR:AT3G53700.1); Has 19381 Blast hits to 5780 proteins in 170 species: Archae - 5; Bacteria - 14; Metazoa - 420; Fungi - 382; Plants - 17857; Viruses - 0; Other Eukaryotes - 703 (source: NCBI BLink). 
AT2G20410AT2G20410.1TGGGCCGATactivating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT2G20410.1TGTGGGCCATCGGCCCACAactivating signal cointegrator-related; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ASCH domain (InterPro:IPR007374); Has 193 Blast hits to 192 proteins in 83 species: Archae - 2; Bacteria - 44; Metazoa - 93; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT2G21150AT2G21150.1AAAAGCCCAATTATTGGGCCGATXAP5 family protein involved in light regulation of the circadian clock and photomorphogenesis. Nuclear localized. 
AT2G21410AT2G21410.1ATATGGGCCGATVacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. 
AT2G23780AT2G23780.1ATCGGCCCAATAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G19310.1); Has 2997 Blast hits to 2989 proteins in 206 species: Archae - 0; Bacteria - 0; Metazoa - 1936; Fungi - 317; Plants - 374; Viruses - 17; Other Eukaryotes - 353 (source: NCBI BLink). 
AT2G24765AT2G24765.1CAATGGGCCGAGTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner 
AT2G24765.2CAATGGGCCGAGTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner 
AT2G27285AT2G27285.1TCGGCCCATCAunknown protein; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2040, coiled-coil (InterPro:IPR018612); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G27280.1); Has 35706 Blast hits to 21282 proteins in 1150 species: Archae - 208; Bacteria - 3585; Metazoa - 16311; Fungi - 2551; Plants - 911; Viruses - 174; Other Eukaryotes - 11966 (source: NCBI BLink). 
AT2G28230AT2G28230.1TTTTGGGCCTTCGGCCCATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: TATA-binding related factor (InterPro:IPR013921); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G09070.1); Has 43 Blast hits to 43 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 22; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G29580AT2G29580.1TTCGGCCCAAzinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, zinc ion binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: F mature embryo stage, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Zinc finger, CCCH-type (InterPro:IPR000571), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT1G07360.1); Has 10655 Blast hits to 8392 proteins in 419 species: Archae - 8; Bacteria - 299; Metazoa - 5085; Fungi - 2309; Plants - 1897; Viruses - 119; Other Eukaryotes - 938 (source: NCBI BLink). 
AT2G33040AT2G33040.1AGATGGGCCGAAATP synthase gamma chain, mitochondrial (ATPC); FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, gamma subunit (InterPro:IPR000131); BEST Arabidopsis thaliana protein match is: ATPC1; enzyme regulator (TAIR:AT4G04640.1); Has 6854 Blast hits to 6853 proteins in 1574 species: Archae - 5; Bacteria - 3135; Metazoa - 212; Fungi - 103; Plants - 101; Viruses - 0; Other Eukaryotes - 3298 (source: NCBI BLink). 
AT2G34250AT2G34250.1ATCGGCCCAATprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G34250.2ATCGGCCCAATprotein transport protein sec61, putative; FUNCTIONS IN: P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: response to salt stress, protein secretion; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SecY protein (InterPro:IPR002208); BEST Arabidopsis thaliana protein match is: P-P-bond-hydrolysis-driven protein transmembrane transporter (TAIR:AT1G29310.1); Has 2776 Blast hits to 2770 proteins in 1213 species: Archae - 193; Bacteria - 1633; Metazoa - 225; Fungi - 153; Plants - 68; Viruses - 0; Other Eukaryotes - 504 (source: NCBI BLink). 
AT2G34520AT2G34520.1TAGTGGGCCGATnuclear-encoded mitochondrial ribosomal protein S14 
AT2G34590AT2G34590.1TAATTGGGCCGAtransketolase family protein; FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity, transketolase activity; INVOLVED IN: pollen tube development; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transketolase, C-terminal (InterPro:IPR005476), Transketolase C-terminal-like (InterPro:IPR015941), Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (InterPro:IPR009014), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: PDH-E1 BETA (PYRUVATE DEHYDROGENASE E1 BETA); pyruvate dehydrogenase (acetyl-transferring) (TAIR:AT1G30120.1); Has 9465 Blast hits to 9457 proteins in 1366 species: Archae - 92; Bacteria - 4722; Metazoa - 387; Fungi - 143; Plants - 155; Viruses - 0; Other Eukaryotes - 3966 (source: NCBI BLink). 
AT2G35320AT2G35320.1ATAATGGGCCTTTAATTGGGCCGAhomologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent. 
AT2G36130AT2G36130.1TAATTGGGCCGAApeptidyl-prolyl cis-trans isomerase, putative / cyclophilin, putative / rotamase, putative; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: CYP71 (CYCLOPHILIN71); chromatin binding / histone binding / peptidyl-prolyl cis-trans isomerase (TAIR:AT3G44600.1); Has 12476 Blast hits to 12426 proteins in 1530 species: Archae - 82; Bacteria - 4056; Metazoa - 2344; Fungi - 974; Plants - 734; Viruses - 0; Other Eukaryotes - 4286 (source: NCBI BLink). 
AT2G36160AT2G36160.1TGGGCCGAA40S ribosomal protein S14 (RPS14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane, chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971), Ribosomal S11, conserved site (InterPro:IPR018102); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S14 (RPS14B) (TAIR:AT3G11510.1); Has 6247 Blast hits to 6247 proteins in 1750 species: Archae - 169; Bacteria - 2829; Metazoa - 487; Fungi - 108; Plants - 517; Viruses - 0; Other Eukaryotes - 2137 (source: NCBI BLink). 
AT2G36160.1TTCGGCCCAAAT40S ribosomal protein S14 (RPS14A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, plasma membrane, chloroplast, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S11 (InterPro:IPR001971), Ribosomal S11, conserved site (InterPro:IPR018102); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S14 (RPS14B) (TAIR:AT3G11510.1); Has 6247 Blast hits to 6247 proteins in 1750 species: Archae - 169; Bacteria - 2829; Metazoa - 487; Fungi - 108; Plants - 517; Viruses - 0; Other Eukaryotes - 2137 (source: NCBI BLink). 
AT2G36305AT2G36305.1TTCGGCCCAGTAEncodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. 
AT2G40290AT2G40290.1AGTTGGGCCGAAeukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). 
AT2G40290.2AGTTGGGCCGAAeukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). 
AT2G40290.3AGTTGGGCCGAAeukaryotic translation initiation factor 2 subunit 1, putative / eIF-2A, putative / eIF-2-alpha, putative; FUNCTIONS IN: RNA binding, translation initiation factor activity; INVOLVED IN: translation; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), S1, RNA binding (InterPro:IPR003029), Eukaryotic translation initiation factor 2, alpha subunit (InterPro:IPR011488); BEST Arabidopsis thaliana protein match is: EIF2 ALPHA; RNA binding / translation initiation factor (TAIR:AT5G05470.1); Has 3250 Blast hits to 2835 proteins in 1032 species: Archae - 145; Bacteria - 2021; Metazoa - 147; Fungi - 90; Plants - 52; Viruses - 31; Other Eukaryotes - 764 (source: NCBI BLink). 
AT2G42160AT2G42160.1TATATGGGCCGAACCAAAAGCCCATATzinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). 
AT2G42790AT2G42790.1TTCGGCCCATTCEncodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. 
AT2G42890AT2G42890.1GTTGGGCCGAAA member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices. 
AT2G42890.2GTTGGGCCGAAA member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices. 
AT2G42890.3GTTGGGCCGAAA member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML2 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. AML2 is expressed during early embryo development (heart and torpedo stage) and predominantly in vegetative organs; no significant accumulation was detected in floral apices. 
AT2G45000AT2G45000.1TTATTGGGCTGGGCCGAEMBRYO DEFECTIVE 2766 (EMB2766); FUNCTIONS IN: structural constituent of nuclear pore; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, nuclear pore; CONTAINS InterPro DOMAIN/s: Nucleoporin, Nsp1-like, C-terminal (InterPro:IPR007758); Has 196388 Blast hits to 74057 proteins in 2349 species: Archae - 657; Bacteria - 41194; Metazoa - 62656; Fungi - 37422; Plants - 6443; Viruses - 2462; Other Eukaryotes - 45554 (source: NCBI BLink). 
AT2G45530AT2G45530.1TCGGCCCAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G37950.1); Has 621 Blast hits to 621 proteins in 69 species: Archae - 0; Bacteria - 0; Metazoa - 262; Fungi - 5; Plants - 312; Viruses - 3; Other Eukaryotes - 39 (source: NCBI BLink). 
AT2G46540AT2G46540.1ATAATGGGCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G47170AT2G47170.1TAAATGGGCCGAATTGGGCTGAGene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT2G47250AT2G47250.1TCGGCCCACARNA helicase, putative; FUNCTIONS IN: in 7 functions; LOCATED IN: membrane, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), ATPase, AAA+ type, core (InterPro:IPR003593), Region of unknown function DUF1605 (InterPro:IPR011709), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: RNA helicase, putative (TAIR:AT3G62310.1); Has 7386 Blast hits to 6689 proteins in 1000 species: Archae - 0; Bacteria - 1927; Metazoa - 2123; Fungi - 842; Plants - 395; Viruses - 601; Other Eukaryotes - 1498 (source: NCBI BLink). 
AT2G47580AT2G47580.1ATCGGCCCACTAencodes spliceosomal protein U1A 
AT2G47790AT2G47790.1TAAATGGGCCGAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 8923 Blast hits to 5742 proteins in 332 species: Archae - 8; Bacteria - 1962; Metazoa - 3030; Fungi - 2021; Plants - 501; Viruses - 0; Other Eukaryotes - 1401 (source: NCBI BLink). 
AT2G47840AT2G47840.1TAAGTCGGCCCAATTAtic20 protein-related; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G55710.1); Has 272 Blast hits to 272 proteins in 73 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 0; Plants - 50; Viruses - 0; Other Eukaryotes - 115 (source: NCBI BLink). 
AT3G01560AT3G01560.1TTCGGCCCATTTAproline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Protein of unknown function DUF1421 (InterPro:IPR010820), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT5G14540.1); Has 76923 Blast hits to 40691 proteins in 1566 species: Archae - 110; Bacteria - 8440; Metazoa - 31149; Fungi - 13515; Plants - 10280; Viruses - 1804; Other Eukaryotes - 11625 (source: NCBI BLink). 
AT3G03150AT3G03150.1TCGGCCCAAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03160AT3G03160.1TTTTGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03210AT3G03210.1TGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03210.1TGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 23 Blast hits to 23 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04040AT3G04040.1ATATTGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04160AT3G04160.1ATATGGGCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; Has 1599 Blast hits to 1235 proteins in 157 species: Archae - 0; Bacteria - 45; Metazoa - 652; Fungi - 193; Plants - 164; Viruses - 0; Other Eukaryotes - 545 (source: NCBI BLink). 
AT3G04400AT3G04400.1TTCGGCCCATAAembryo defective 2171 (emb2171); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: embryonic development ending in seed dormancy, translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L14b/L23e (InterPro:IPR000218); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L23 (RPL23B) (TAIR:AT2G33370.1); Has 6297 Blast hits to 6297 proteins in 1833 species: Archae - 236; Bacteria - 2977; Metazoa - 280; Fungi - 176; Plants - 586; Viruses - 0; Other Eukaryotes - 2042 (source: NCBI BLink). 
AT3G04560AT3G04560.1ATTTGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 16 growth stages; Has 174 Blast hits to 172 proteins in 62 species: Archae - 0; Bacteria - 13; Metazoa - 84; Fungi - 25; Plants - 27; Viruses - 2; Other Eukaryotes - 23 (source: NCBI BLink). 
AT3G05280AT3G05280.1TAGTGGGCCGATintegral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 381 Blast hits to 380 proteins in 122 species: Archae - 0; Bacteria - 0; Metazoa - 195; Fungi - 69; Plants - 47; Viruses - 0; Other Eukaryotes - 70 (source: NCBI BLink). 
AT3G06540AT3G06540.1AGATGGGCCATGTTGGGCCGATGDP dissociation inhibitor family protein / Rab GTPase activator family protein; FUNCTIONS IN: RAB GDP-dissociation inhibitor activity; INVOLVED IN: intracellular protein transport, regulation of GTPase activity, protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rab GTPase activator (InterPro:IPR002005), Rab protein geranylgeranyltransferase component A, eukaryota (InterPro:IPR016664), Yeast Mrs6p protein (InterPro:IPR000632), GDP dissociation inhibitor (InterPro:IPR018203); BEST Arabidopsis thaliana protein match is: ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation inhibitor (TAIR:AT2G44100.2); Has 948 Blast hits to 858 proteins in 184 species: Archae - 0; Bacteria - 2; Metazoa - 512; Fungi - 195; Plants - 103; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). 
AT3G07300AT3G07300.1TTCGGCCCAAAAeukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink). 
AT3G07300.2TTCGGCCCAAAAeukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink). 
AT3G07300.3TTCGGCCCAAAAeukaryotic translation initiation factor 2B family protein / eIF-2B family protein; FUNCTIONS IN: GTP binding, translation initiation factor activity; INVOLVED IN: translational initiation, cellular metabolic process; LOCATED IN: eukaryotic translation initiation factor 2B complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor 2B related (InterPro:IPR000649); BEST Arabidopsis thaliana protein match is: GTP binding / translation initiation factor (TAIR:AT2G44070.1); Has 3102 Blast hits to 3086 proteins in 618 species: Archae - 219; Bacteria - 968; Metazoa - 478; Fungi - 332; Plants - 115; Viruses - 0; Other Eukaryotes - 990 (source: NCBI BLink). 
AT3G08640AT3G08640.1CGCACGTGGGAAATGGGCCGATalphavirus core protein family; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, chloroplast, plastid, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G08630.1); Has 10912 Blast hits to 4701 proteins in 450 species: Archae - 4; Bacteria - 2405; Metazoa - 4145; Fungi - 556; Plants - 2369; Viruses - 93; Other Eukaryotes - 1340 (source: NCBI BLink). 
AT3G11120AT3G11120.1ATCGGCCCAATAT60S ribosomal protein L41 (RPL41E); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G11200AT3G11200.1ATTTGGGCCGATAL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT3G11200.2ATTTGGGCCGATAL2 encodes a member of the Alfin-Like family of nuclear-localized PhD domain containing homeodomain proteins. Binds to H3K4 di or trimethylated DNA. 
AT3G11730AT3G11730.1TCGGCCCATTTAEncodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. 
AT3G12140AT3G12140.1TATATGGGCCGAAemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G12140.2TATATGGGCCGAAemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G12140.3TATATGGGCCGAAemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G12300AT3G12300.1GGCTTTATTAGTGGGCCGAGGCCCAAGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF667 (InterPro:IPR007714); Has 280 Blast hits to 278 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 188; Fungi - 2; Plants - 29; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT3G12650AT3G12650.1ATTGGGCCGAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 14 Blast hits to 14 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G13290AT3G13290.1TATGGGCCGATVARICOSE-RELATED (VCR); FUNCTIONS IN: nucleotide binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: VCS (VARICOSE); nucleotide binding / protein homodimerization (TAIR:AT3G13300.1); Has 812 Blast hits to 636 proteins in 176 species: Archae - 4; Bacteria - 160; Metazoa - 282; Fungi - 137; Plants - 80; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). 
AT3G16190AT3G16190.1TGTTGGGCCGAAisochorismatase hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); Has 3706 Blast hits to 3703 proteins in 851 species: Archae - 95; Bacteria - 2998; Metazoa - 0; Fungi - 127; Plants - 43; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink). 
AT3G17626AT3G17626.1TGGGCCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: ribosomal protein L18 family protein (TAIR:AT1G48350.1); Has 336 Blast hits to 336 proteins in 121 species: Archae - 0; Bacteria - 241; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 58 (source: NCBI BLink). 
AT3G18940AT3G18940.1ATCGGCCCAAATclast3-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP010044 (InterPro:IPR016562); Has 170 Blast hits to 170 proteins in 73 species: Archae - 1; Bacteria - 0; Metazoa - 98; Fungi - 37; Plants - 26; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G20050AT3G20050.1TTCGGCCCAATATEncodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1). 
AT3G21790AT3G21790.1ATCGGCCCAACAUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B8 (UDP-GLUCOSYL TRANSFERASE 71B8); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 4'-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT3G21800.1); Has 4493 Blast hits to 4475 proteins in 265 species: Archae - 0; Bacteria - 82; Metazoa - 1698; Fungi - 10; Plants - 2668; Viruses - 11; Other Eukaryotes - 24 (source: NCBI BLink). 
AT3G22230AT3G22230.1TTAATGGGCCGAA60S ribosomal protein L27 (RPL27B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L27e, conserved site (InterPro:IPR018262), Ribosomal protein L27e (InterPro:IPR001141); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L27 (RPL27C) (TAIR:AT4G15000.1); Has 603 Blast hits to 603 proteins in 228 species: Archae - 0; Bacteria - 0; Metazoa - 292; Fungi - 102; Plants - 95; Viruses - 0; Other Eukaryotes - 114 (source: NCBI BLink). 
AT3G26560AT3G26560.1ATCGGCCCAAATATP-dependent RNA helicase, putative; FUNCTIONS IN: in 6 functions; LOCATED IN: cytosol, mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Region of unknown function DUF1605 (InterPro:IPR011709), S1, RNA binding (InterPro:IPR003029), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ESP3 (ENHANCED SILENCING PHENOTYPE 3); ATP binding / ATP-dependent RNA helicase/ ATP-dependent helicase/ helicase/ nucleic acid binding (TAIR:AT1G32490.1); Has 44749 Blast hits to 27526 proteins in 1894 species: Archae - 128; Bacteria - 7760; Metazoa - 17585; Fungi - 4781; Plants - 2372; Viruses - 1049; Other Eukaryotes - 11074 (source: NCBI BLink). 
AT3G27520AT3G27520.1ATCGGCCCATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 14 Blast hits to 14 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G43270AT3G43270.1TTTTGGGCCGAApectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: plant-type cell wall; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase inhibitor (InterPro:IPR006501), Pectinesterase, catalytic (InterPro:IPR000070), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: enzyme inhibitor/ pectinesterase (TAIR:AT4G33220.1); Has 1380 Blast hits to 1337 proteins in 184 species: Archae - 0; Bacteria - 247; Metazoa - 1; Fungi - 134; Plants - 998; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47250AT3G47250.1TGGGCCGAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF247, plant (InterPro:IPR004158); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G47200.2); Has 496 Blast hits to 450 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 496; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47250.2TGGGCCGAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF247, plant (InterPro:IPR004158); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G47200.2); Has 496 Blast hits to 450 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 496; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47250.3TGGGCCGAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF247, plant (InterPro:IPR004158); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G47200.2); Has 496 Blast hits to 450 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 496; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47610AT3G47610.1ATATTGGGCCGAtranscription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT3G49010AT3G49010.1TTCGGCCCACCGGCCCAATAAEncodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). 
AT3G49010.2TTCGGCCCACCGGCCCAATAAEncodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). 
AT3G49010.3TTCGGCCCACCGGCCCAATAAEncodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). 
AT3G49010.4TTCGGCCCACCGGCCCAATAAEncodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). 
AT3G49010.5TTCGGCCCACCGGCCCAATAAEncodes 60S ribosomal protein L13. Homolog of human breast basic conserved 1 (BBC1). 
AT3G50808AT3G50808.1CTTAATGGGCCGAunknown protein. 
AT3G51800AT3G51800.1TTCGGCCCATAputative nuclear DNA-binding protein G2p (AtG2) mRNA, 
AT3G51800.2TTCGGCCCATAputative nuclear DNA-binding protein G2p (AtG2) mRNA, 
AT3G56820AT3G56820.1TGTGGGCCATCGGCCCACAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 21 Blast hits to 21 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT3G60880AT3G60880.1TGTGGGCCGAAEncodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast. 
AT3G60880.2TGTGGGCCGAAEncodes a dihydropicolinate synthase involved in lysine biosynthesis. The enzyme is allosterically inhibited by lysine. It is predicted to localize to the cholorplast. 
AT3G63250AT3G63250.1ATTGGGCCGATEncodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. 
AT3G63250.2ATTGGGCCGATEncodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. 
AT4G00020AT4G00020.1TTCGGCCCAAATOrtholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. 
AT4G00020.2TTCGGCCCAAATOrtholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development. 
AT4G01940AT4G01940.1ATCGGCCCATTTEncodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. 
AT4G02550AT4G02550.1TCGGCCCATTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02550.2TCGGCCCATTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02550.3TCGGCCCATTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G02210.1); Has 205 Blast hits to 176 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 9; Plants - 196; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G02820AT4G02820.1ATTGGGCCGApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02150.1); Has 6981 Blast hits to 3279 proteins in 125 species: Archae - 0; Bacteria - 14; Metazoa - 76; Fungi - 59; Plants - 6627; Viruses - 0; Other Eukaryotes - 205 (source: NCBI BLink). 
AT4G08280AT4G08280.1TATATGGGCCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin 2 (InterPro:IPR008554), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); Has 214 Blast hits to 214 proteins in 65 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT4G12620AT4G12620.1ATAAGCCCAATATTCGGCCCAAAOrigin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime. 
AT4G12620.1ATCGGCCCAAAAOrigin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime. 
AT4G12640AT4G12640.1TTTGGGCCGAATATTGGGCTTATRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 6679 Blast hits to 5578 proteins in 311 species: Archae - 8; Bacteria - 143; Metazoa - 3956; Fungi - 1074; Plants - 834; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink). 
AT4G12640.1TTTTGGGCCGATRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Spen paralogue and orthologue C-terminal (InterPro:IPR012921), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: FPA; RNA binding (TAIR:AT2G43410.4); Has 6679 Blast hits to 5578 proteins in 311 species: Archae - 8; Bacteria - 143; Metazoa - 3956; Fungi - 1074; Plants - 834; Viruses - 0; Other Eukaryotes - 664 (source: NCBI BLink). 
AT4G13530AT4G13530.1TCGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10080.1); Has 38 Blast hits to 38 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G13530.2TCGGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10080.1); Has 38 Blast hits to 38 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G14455AT4G14455.1ATATGGGCCGAAEncodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in <i>sft1-1</i> yeast cells; however, it cannot support the deletion of the yeast BET1 gene (<i>bet1&#916;</i>). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi. 
AT4G15240AT4G15240.1TTAATGGGCCGAfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biological_process unknown; LOCATED IN: Golgi apparatus; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT1G05280.1); Has 368 Blast hits to 364 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 123; Fungi - 109; Plants - 125; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT4G15260AT4G15260.1TCGGCCCAATTAUDP-glucoronosyl/UDP-glucosyl transferase family protein; FUNCTIONS IN: UDP-glycosyltransferase activity, transferase activity, transferring glycosyl groups; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT71B5 (UDP-GLUCOSYL TRANSFERASE 71B5); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ transferase, transferring glycosyl groups (TAIR:AT4G15280.1); Has 4447 Blast hits to 4433 proteins in 286 species: Archae - 0; Bacteria - 156; Metazoa - 1629; Fungi - 12; Plants - 2597; Viruses - 18; Other Eukaryotes - 35 (source: NCBI BLink). 
AT4G17060AT4G17060.1TCGGCCCAATEncodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. 
AT4G18040AT4G18040.1TTCGGCCCAAAAeIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein. 
AT4G20300AT4G20300.1TAGTGGGCCTGATAATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT4G20300.2TAGTGGGCCTGATAATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1639 (InterPro:IPR012438); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55340.2); Has 456 Blast hits to 442 proteins in 73 species: Archae - 0; Bacteria - 7; Metazoa - 184; Fungi - 40; Plants - 150; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT4G20330AT4G20330.1TTATTGGGCCGAAtranscription initiation factor-related; FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIE complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor TFIIE, beta subunit (InterPro:IPR016656), Transcription factor TFIIE beta subunit-like, DNA-binding (InterPro:IPR017935); BEST Arabidopsis thaliana protein match is: transcription initiation factor-related (TAIR:AT4G21010.1); Has 212 Blast hits to 212 proteins in 96 species: Archae - 0; Bacteria - 0; Metazoa - 99; Fungi - 68; Plants - 35; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G20870AT4G20870.1TGGGCCGAAencodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. 
AT4G21280AT4G21280.1TTCGGCCCAAATEncodes the PsbQ subunit of the oxygen evolving complex of photosystem II. 
AT4G21280.2TTCGGCCCAAATEncodes the PsbQ subunit of the oxygen evolving complex of photosystem II. 
AT4G23660AT4G23660.1TTCGGCCCAAATEncodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50). 
AT4G23660.2TTCGGCCCAAATEncodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50). 
AT4G27000AT4G27000.1ATAATGGGCCGAATRBP45C; FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45A (RNA-binding protein 45A); RNA binding (TAIR:AT5G54900.1); Has 24066 Blast hits to 14859 proteins in 588 species: Archae - 10; Bacteria - 1237; Metazoa - 14401; Fungi - 2729; Plants - 3582; Viruses - 5; Other Eukaryotes - 2102 (source: NCBI BLink). 
AT4G28360AT4G28360.1TAACGGGCTCGGCCCAAATribosomal protein L22 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: mitochondrion, ribosome; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22/L17 (InterPro:IPR001063), Ribosomal protein L22, bacterial-type (InterPro:IPR005727); BEST Arabidopsis thaliana protein match is: ribosomal protein L22 family protein (TAIR:AT1G52370.3); Has 5503 Blast hits to 5503 proteins in 1687 species: Archae - 0; Bacteria - 3089; Metazoa - 109; Fungi - 48; Plants - 431; Viruses - 0; Other Eukaryotes - 1826 (source: NCBI BLink). 
AT4G28540AT4G28540.1GTTTGGGCCGATCASEIN KINASE I-LIKE 6 (CKL6); FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasmodesma; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: ADK1 (dual specificity kinase 1); kinase/ protein serine/threonine/tyrosine kinase (TAIR:AT1G03930.1); Has 46100 Blast hits to 45721 proteins in 1424 species: Archae - 12; Bacteria - 5612; Metazoa - 19980; Fungi - 4668; Plants - 5911; Viruses - 338; Other Eukaryotes - 9579 (source: NCBI BLink). 
AT4G29070AT4G29070.1TCGGCCCATTTTGAGCCCAATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G29070.2TCGGCCCATTTTGAGCCCAATAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phospholipase A2 (InterPro:IPR016090); Has 22 Blast hits to 22 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30390AT4G30390.1TTCGGCCCATCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 13 Blast hits to 13 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 13; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G31270AT4G31270.1GTTTGGGCCGAAtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 8 growth stages; BEST Arabidopsis thaliana protein match is: gt-2-related (TAIR:AT2G33550.1); Has 142 Blast hits to 141 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 12; Fungi - 1; Plants - 121; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT4G31985AT4G31985.1CATGGGCCTTGGGCCGAA60S ribosomal protein L39 (RPL39C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39B) (TAIR:AT3G02190.1); Has 591 Blast hits to 591 proteins in 225 species: Archae - 151; Bacteria - 0; Metazoa - 212; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). 
AT4G34700AT4G34700.1TTAATGGGCCGATcomplex 1 family protein / LVR family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, plasma membrane, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Complex 1 LYR protein (InterPro:IPR008011); Has 169 Blast hits to 169 proteins in 76 species: Archae - 0; Bacteria - 0; Metazoa - 85; Fungi - 51; Plants - 24; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT4G34870AT4G34870.1TCGGCCCAbelongs to cyclophilin family 
AT4G38120AT4G38120.1ATTGGGCCGAAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 151 Blast hits to 124 proteins in 50 species: Archae - 0; Bacteria - 2; Metazoa - 104; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT4G38120.2ATTGGGCCGAAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 151 Blast hits to 124 proteins in 50 species: Archae - 0; Bacteria - 2; Metazoa - 104; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT4G39710AT4G39710.1TGTGGGCCGATimmunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: FK506-binding protein 1 (FKBP13) (TAIR:AT5G45680.1); Has 6176 Blast hits to 5824 proteins in 1083 species: Archae - 68; Bacteria - 2849; Metazoa - 1385; Fungi - 335; Plants - 363; Viruses - 0; Other Eukaryotes - 1176 (source: NCBI BLink). 
AT4G39880AT4G39880.1TTCGGCCCATTAAGGCCCATTAAribosomal protein L23 family protein; FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L23/L15e, core (InterPro:IPR012678), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal protein L25/L23 (InterPro:IPR013025); Has 2011 Blast hits to 2011 proteins in 690 species: Archae - 0; Bacteria - 1392; Metazoa - 5; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 592 (source: NCBI BLink). 
AT5G01400AT5G01400.1AATAGGCCCACATCGGCCCATTATEncodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. 
AT5G03290AT5G03290.1TAATTGGGCCGATisocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NAD+) activity, ATP binding; INVOLVED IN: tricarboxylic acid cycle, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NAD-dependent, mitochondrial (InterPro:IPR004434); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NAD+ isocitrate dehydrogenase, putative (TAIR:AT3G09810.1); Has 12731 Blast hits to 12647 proteins in 1639 species: Archae - 252; Bacteria - 5773; Metazoa - 779; Fungi - 723; Plants - 237; Viruses - 0; Other Eukaryotes - 4967 (source: NCBI BLink). 
AT5G03560AT5G03560.1TATATGGGCCGAAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G03560.2TATATGGGCCGAAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G03690AT5G03690.1TATGGGCCGATfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: pentose-phosphate shunt; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4408 Blast hits to 4403 proteins in 738 species: Archae - 0; Bacteria - 420; Metazoa - 1258; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2389 (source: NCBI BLink). 
AT5G03690.2TATGGGCCGATfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: pentose-phosphate shunt; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4408 Blast hits to 4403 proteins in 738 species: Archae - 0; Bacteria - 420; Metazoa - 1258; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2389 (source: NCBI BLink). 
AT5G04050AT5G04050.1TCGGCCCAFUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: intron maturase, type II family protein (TAIR:AT1G74350.1). 
AT5G04050.2TCGGCCCAFUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: intron maturase, type II family protein (TAIR:AT1G74350.1). 
AT5G05450AT5G05450.1AAATGGGCCGAADEAD/DEAH box helicase, putative (RH18); FUNCTIONS IN: helicase activity, nucleic acid binding, ATP-dependent helicase activity, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, ATP-dependent, DEAD-box, conserved site (InterPro:IPR000629), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD/DEAH box helicase, putative (TAIR:AT1G71370.1); Has 26025 Blast hits to 25450 proteins in 1685 species: Archae - 410; Bacteria - 10515; Metazoa - 4736; Fungi - 3110; Plants - 1301; Viruses - 7; Other Eukaryotes - 5946 (source: NCBI BLink). 
AT5G05670AT5G05670.1TTAATGGGCTTTTATTCGGCCCATTAAsignal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). 
AT5G05670.2TTAATGGGCTTTTATTCGGCCCATTAAsignal recognition particle binding; FUNCTIONS IN: signal recognition particle binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: signal recognition particle binding (TAIR:AT2G18770.1); Has 911 Blast hits to 911 proteins in 185 species: Archae - 2; Bacteria - 40; Metazoa - 443; Fungi - 156; Plants - 102; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). 
AT5G05680AT5G05680.1TTAATGGGCCGAATAAAAGCCCATTAAnuclear pore complex protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 7 growth stages; Has 361 Blast hits to 348 proteins in 84 species: Archae - 2; Bacteria - 20; Metazoa - 218; Fungi - 31; Plants - 27; Viruses - 0; Other Eukaryotes - 63 (source: NCBI BLink). 
AT5G05800AT5G05800.1TCGGCCCAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11290.1); Has 434 Blast hits to 262 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 26; Plants - 408; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G05800.2TCGGCCCAGCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G11290.1); Has 434 Blast hits to 262 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 26; Plants - 408; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G08540AT5G08540.1TAAATGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G10350AT5G10350.1GGGCCTATGATGGGCCGAApolyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). 
AT5G10350.2GGGCCTATGATGGGCCGAApolyadenylate-binding protein family protein / PABP family protein; FUNCTIONS IN: protein binding, RNA binding, poly(A) binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: polyadenylate-binding protein family protein / PABP family protein (TAIR:AT5G65260.1); Has 5173 Blast hits to 4727 proteins in 414 species: Archae - 4; Bacteria - 591; Metazoa - 2173; Fungi - 904; Plants - 878; Viruses - 0; Other Eukaryotes - 623 (source: NCBI BLink). 
AT5G10730AT5G10730.1TTCGGCCCAATTbinding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: dehydrogenase-related (TAIR:AT5G15910.1); Has 2817 Blast hits to 2817 proteins in 746 species: Archae - 59; Bacteria - 1671; Metazoa - 115; Fungi - 146; Plants - 119; Viruses - 0; Other Eukaryotes - 707 (source: NCBI BLink). 
AT5G13010AT5G13010.1ATCGGCCCATATembryo defective 3011 (EMB3011); FUNCTIONS IN: RNA helicase activity, helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Region of unknown function DUF1605 (InterPro:IPR011709), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: ATP-dependent RNA helicase, putative (TAIR:AT3G26560.1); Has 7285 Blast hits to 6618 proteins in 979 species: Archae - 6; Bacteria - 1991; Metazoa - 2135; Fungi - 867; Plants - 393; Viruses - 401; Other Eukaryotes - 1492 (source: NCBI BLink). 
AT5G15260AT5G15260.1CTTGGGCCGAstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G01170.1); Has 39 Blast hits to 39 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G18790AT5G18790.1TTAATGGGCCGAAribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT3G06320.1); Has 1786 Blast hits to 1786 proteins in 750 species: Archae - 0; Bacteria - 1570; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). 
AT5G18800AT5G18800.1TTCGGCCCATTAANADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G18800.2TTCGGCCCATTAANADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT3G06310.1); Has 235 Blast hits to 235 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 73; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G19120AT5G19120.1TCGGCCCAaspartic-type endopeptidase; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: extracellular dermal glycoprotein, putative / EDGP, putative (TAIR:AT1G03220.1); Has 701 Blast hits to 699 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 699; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G20160AT5G20160.1CATGGGCCGAAribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). 
AT5G20160.2CATGGGCCGAAribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). 
AT5G20160.3CATGGGCCGAAribosomal protein L7Ae/L30e/S12e/Gadd45 family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: ribosome biogenesis; LOCATED IN: nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: High mobility group-like nuclear protein (InterPro:IPR002415), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038), Ribosomal protein L7Ae conserved site (InterPro:IPR004037); BEST Arabidopsis thaliana protein match is: ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein (TAIR:AT4G22380.1); Has 1076 Blast hits to 1076 proteins in 269 species: Archae - 226; Bacteria - 0; Metazoa - 321; Fungi - 181; Plants - 101; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink). 
AT5G20520AT5G20520.1TTCGGCCCAGTEncodes a Bem46-like protein. WAV2 negatively regulates root bending when roots alter their growth direction. It's not involved in sensing environmental stimuli (e.g. gravity, light, water, touch). 
AT5G22140AT5G22140.1TCGGCCCAAACpyridine nucleotide-disulphide oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); BEST Arabidopsis thaliana protein match is: pyridine nucleotide-disulphide oxidoreductase family protein (TAIR:AT3G44190.1); Has 8697 Blast hits to 8694 proteins in 1406 species: Archae - 266; Bacteria - 6387; Metazoa - 242; Fungi - 449; Plants - 207; Viruses - 0; Other Eukaryotes - 1146 (source: NCBI BLink). 
AT5G22140.2TCGGCCCAAACpyridine nucleotide-disulphide oxidoreductase family protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding; LOCATED IN: plasma membrane; CONTAINS InterPro DOMAIN/s: FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Pyridine nucleotide-disulphide oxidoreductase, NAD-binding region (InterPro:IPR001327); BEST Arabidopsis thaliana protein match is: pyridine nucleotide-disulphide oxidoreductase family protein (TAIR:AT3G44190.1); Has 8697 Blast hits to 8694 proteins in 1406 species: Archae - 266; Bacteria - 6387; Metazoa - 242; Fungi - 449; Plants - 207; Viruses - 0; Other Eukaryotes - 1146 (source: NCBI BLink). 
AT5G22500AT5G22500.1TGATGGGCCGAFATTY ACID REDUCTASE 1 (FAR1); FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, fatty acyl-CoA reductase (alcohol-forming) activity; INVOLVED IN: microsporogenesis, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Male sterility (InterPro:IPR004262), NAD(P)-binding (InterPro:IPR016040), Male sterility, NAD-binding (InterPro:IPR013120); BEST Arabidopsis thaliana protein match is: FAR4 (FATTY ACID REDUCTASE 4); binding / catalytic/ oxidoreductase, acting on the CH-CH group of donors (TAIR:AT3G44540.1); Has 1821 Blast hits to 1792 proteins in 332 species: Archae - 0; Bacteria - 455; Metazoa - 873; Fungi - 189; Plants - 136; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). 
AT5G22640AT5G22640.1TTCGGCCCATATAembryo defective 1211 (emb1211); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MORN motif (InterPro:IPR003409); Has 20090 Blast hits to 11448 proteins in 643 species: Archae - 30; Bacteria - 1497; Metazoa - 7184; Fungi - 2271; Plants - 998; Viruses - 319; Other Eukaryotes - 7791 (source: NCBI BLink). 
AT5G23080AT5G23080.1CTAATGGGCCGAAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. 
AT5G23080.2CTAATGGGCCGAAInteracts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1. 
AT5G23090AT5G23090.1TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G23090.2TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G23090.3TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G23090.4TTCGGCCCATTAGNUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G24650AT5G24650.1TTATGGGCCGAAmitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: chloroplast, plasma membrane, vacuole, mitochondrial inner membrane presequence translocase complex, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sterile alpha motif SAM (InterPro:IPR001660), Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT3G49560.1); Has 132 Blast hits to 130 proteins in 43 species: Archae - 0; Bacteria - 0; Metazoa - 10; Fungi - 63; Plants - 54; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT5G25610AT5G25610.1ATCGGCCCAAATresponsive to dehydration 22 (RD22) mediated by ABA 
AT5G26760AT5G26760.2TCGGCCCAATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF408 (InterPro:IPR007308); Has 247 Blast hits to 205 proteins in 87 species: Archae - 0; Bacteria - 73; Metazoa - 105; Fungi - 29; Plants - 21; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G27770AT5G27770.1TCGGCCCATTAG60S ribosomal protein L22 (RPL22C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L22e (InterPro:IPR002671); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L22-2 (RPL22B) (TAIR:AT3G05560.3); Has 492 Blast hits to 492 proteins in 173 species: Archae - 0; Bacteria - 0; Metazoa - 251; Fungi - 89; Plants - 73; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). 
AT5G28060AT5G28060.1TTCGGCCCATCA40S ribosomal protein S24 (RPS24B); FUNCTIONS IN: structural constituent of ribosome, nucleotide binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S24e (InterPro:IPR001976), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), Ribosomal S24e conserved site (InterPro:IPR018098); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S24 (RPS24A) (TAIR:AT3G04920.1); Has 644 Blast hits to 644 proteins in 256 species: Archae - 59; Bacteria - 0; Metazoa - 306; Fungi - 104; Plants - 74; Viruses - 0; Other Eukaryotes - 101 (source: NCBI BLink). 
AT5G35430AT5G35430.1TACGGCCCAACTCGGCCCAACbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); Has 179 Blast hits to 170 proteins in 58 species: Archae - 0; Bacteria - 4; Metazoa - 132; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT5G37050AT5G37050.1TTAAAGGCCCAATGGGCCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: SNX2a (SORTING NEXIN 2a); phosphoinositide binding (TAIR:AT5G58440.1); Has 23 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G38830AT5G38830.1GTTGGGCCGAtRNA synthetase class I (C) family protein; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, cysteinyl-tRNA aminoacylation; LOCATED IN: cytoplasm; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT3G56300.1); Has 8148 Blast hits to 7899 proteins in 1622 species: Archae - 141; Bacteria - 3284; Metazoa - 371; Fungi - 182; Plants - 67; Viruses - 3; Other Eukaryotes - 4100 (source: NCBI BLink). 
AT5G41520AT5G41520.1ATCGGCCCAATTA40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). 
AT5G41520.2ATCGGCCCAATTA40S ribosomal protein S10 (RPS10B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 4999 Blast hits to 3072 proteins in 404 species: Archae - 0; Bacteria - 734; Metazoa - 2249; Fungi - 471; Plants - 866; Viruses - 49; Other Eukaryotes - 630 (source: NCBI BLink). 
AT5G42060AT5G42060.1ATCGGCCCATTTAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G64490.1); Has 37 Blast hits to 36 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G47320AT5G47320.1ATCGGCCCAGTNuclear encoded mitochondrial ribosome subunit. 
AT5G47580AT5G47580.1TAATTGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G17250.1); Has 17 Blast hits to 16 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G47630AT5G47630.1TTCGGCCCAGTAEncodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. 
AT5G47630.2TTCGGCCCAGTAEncodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. 
AT5G47880AT5G47880.1TTCGGCCCATTAAGEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. 
AT5G47880.2TTCGGCCCATTAAGEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. 
AT5G48760AT5G48760.1TTCGGCCCATCA60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink). 
AT5G48760.2TTCGGCCCATCA60S ribosomal protein L13A (RPL13aD); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aC) (TAIR:AT4G13170.1); Has 1705 Blast hits to 1705 proteins in 521 species: Archae - 212; Bacteria - 464; Metazoa - 292; Fungi - 124; Plants - 165; Viruses - 0; Other Eukaryotes - 448 (source: NCBI BLink). 
AT5G49930AT5G49930.1TCGGCCCAACAembryo defective 1441 (emb1441); FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Fibronectin-binding A, N-terminal (InterPro:IPR008616), Zinc finger, CCHC-type (InterPro:IPR001878), Protein of unknown function DUF814 (InterPro:IPR008532); Has 2906 Blast hits to 2454 proteins in 381 species: Archae - 144; Bacteria - 336; Metazoa - 995; Fungi - 294; Plants - 92; Viruses - 7; Other Eukaryotes - 1038 (source: NCBI BLink). 
AT5G50810AT5G50810.1TCGGCCCAGAEncodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. 
AT5G51700AT5G51700.1ATTTGGGCCGAGGCCCGTTEncodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. 
AT5G52470AT5G52470.1ATCGGCCCATTATencodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. 
AT5G52470.2ATCGGCCCATTATencodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.1f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. 
AT5G52820AT5G52820.1TTCGGCCCATTAATTAAAGGCWD-40 repeat family protein / notchless protein, putative; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680), G-protein, beta subunit (InterPro:IPR001632); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 92804 Blast hits to 28593 proteins in 717 species: Archae - 60; Bacteria - 7422; Metazoa - 44321; Fungi - 18160; Plants - 9806; Viruses - 6; Other Eukaryotes - 13029 (source: NCBI BLink). 
AT5G52840AT5G52840.1TTCGGCCCATANADH-ubiquinone oxidoreductase-related; FUNCTIONS IN: oxidoreductase activity, acting on NADH or NADPH; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, chloroplast, respiratory chain complex I, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: ETC complex I subunit (InterPro:IPR006806); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G28005.1); Has 272 Blast hits to 272 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 153; Fungi - 69; Plants - 31; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G56120AT5G56120.1TTCGGCCCATTAAAGGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G12870.1); Has 51 Blast hits to 51 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G56280AT5G56280.1TCGGCCCATAone of two genes encoding subunit 6 of COP9 signalosome complex. Protein contains a MPR1p and PAD1p N-terminal (MPN) domain at the N-terminal region and belongs to the Mov34 superfamily. Mutant and antisense expression result in a number of developmental defects and in ubiquitin/proteasome-mediated protein degradation. 
AT5G57860AT5G57860.1TTCGGCCCATAAGCCCAATATubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G57860.2TTCGGCCCATAAGCCCAATATubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G57860.3TTCGGCCCATAAGCCCAATATubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G57860.4TTCGGCCCATAAGCCCAATATubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); Has 64 Blast hits to 64 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 18; Fungi - 0; Plants - 24; Viruses - 14; Other Eukaryotes - 8 (source: NCBI BLink). 
AT5G58950AT5G58950.1TTAATGGGCCGAAprotein kinase family protein; FUNCTIONS IN: protein serine/threonine/tyrosine kinase activity, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G46930.1); Has 97287 Blast hits to 95864 proteins in 3755 species: Archae - 57; Bacteria - 8154; Metazoa - 43395; Fungi - 8207; Plants - 19435; Viruses - 506; Other Eukaryotes - 17533 (source: NCBI BLink). 
AT5G59910AT5G59910.1CATGGGCCGATHTB4; FUNCTIONS IN: DNA binding; INVOLVED IN: nucleosome assembly; LOCATED IN: nucleolus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Histone H2B (InterPro:IPR000558), Histone-fold (InterPro:IPR009072), Histone core (InterPro:IPR007125); BEST Arabidopsis thaliana protein match is: histone H2B, putative (TAIR:AT2G28720.1); Has 3079 Blast hits to 2919 proteins in 300 species: Archae - 0; Bacteria - 69; Metazoa - 1920; Fungi - 175; Plants - 374; Viruses - 0; Other Eukaryotes - 541 (source: NCBI BLink). 
AT5G60820AT5G60820.1TTCGGCCCATTAGzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G08139.1); Has 6800 Blast hits to 6591 proteins in 264 species: Archae - 0; Bacteria - 123; Metazoa - 2390; Fungi - 543; Plants - 2247; Viruses - 74; Other Eukaryotes - 1423 (source: NCBI BLink). 
AT5G60980AT5G60980.1CTTGGGCCGAACCGAACnuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G25150.1); Has 32736 Blast hits to 13928 proteins in 925 species: Archae - 9; Bacteria - 11373; Metazoa - 9852; Fungi - 2838; Plants - 4351; Viruses - 467; Other Eukaryotes - 3846 (source: NCBI BLink). 
AT5G60980.2CTTGGGCCGAACCGAACnuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: transport, nucleocytoplasmic transport; LOCATED IN: intracellular; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nuclear transport factor 2 (InterPro:IPR002075), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nuclear transport factor 2, Eukaryote (InterPro:IPR018222), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nuclear transport factor 2 (NTF2) family protein / RNA recognition motif (RRM)-containing protein (TAIR:AT3G25150.1); Has 32736 Blast hits to 13928 proteins in 925 species: Archae - 9; Bacteria - 11373; Metazoa - 9852; Fungi - 2838; Plants - 4351; Viruses - 467; Other Eukaryotes - 3846 (source: NCBI BLink). 
AT5G63190AT5G63190.1CAATGGGCCGAAMA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). 
AT5G63190.2CAATGGGCCGAAMA3 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Initiation factor eIF-4 gamma, MA3 (InterPro:IPR003891); BEST Arabidopsis thaliana protein match is: MA3 domain-containing protein (TAIR:AT4G24800.2); Has 1496 Blast hits to 591 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 1077; Fungi - 6; Plants - 322; Viruses - 0; Other Eukaryotes - 91 (source: NCBI BLink). 
AT5G63840AT5G63840.1GTTTGGGCCGAAradial swelling mutant shown to be specifically impaired in cellulose production. Encodes the alpha-subunit of a glucosidase II enzyme. 
AT5G65400AT5G65400.1ATATGGGCCGATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF341 (InterPro:IPR005645); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24380.1); Has 479 Blast hits to 479 proteins in 121 species: Archae - 0; Bacteria - 2; Metazoa - 88; Fungi - 285; Plants - 66; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT5G65750AT5G65750.1TTTTGGGCCGATAAGCCCAATAT2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor, oxoglutarate dehydrogenase (succinyl-transferring) activity, thiamin pyrophosphate binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: 2-oxoglutarate dehydrogenase, E1 component (InterPro:IPR011603), Dehydrogenase, E1 component (InterPro:IPR001017), Transketolase, central region (InterPro:IPR005475); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate dehydrogenase E1 component, putative / oxoglutarate decarboxylase, putative / alpha-ketoglutaric dehydrogenase, putative (TAIR:AT3G55410.1); Has 8716 Blast hits to 8694 proteins in 1114 species: Archae - 2; Bacteria - 2389; Metazoa - 550; Fungi - 187; Plants - 68; Viruses - 0; Other Eukaryotes - 5520 (source: NCBI BLink). 
AT5G66010AT5G66010.1TTTGGGCCGATRNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G20890.1); Has 2870 Blast hits to 1043 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 2605; Fungi - 10; Plants - 100; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT5G66680AT5G66680.1TTCGGCCCATTTEncodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. 
AT5G67270AT5G67270.1GTTTGGGCCGAencodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. 
AT5G67320AT5G67320.1GTTGGGCCGAAEncodes a WD-40 protein involved in histone deacetylation in response to abiotic stress.Identified in a screen for mutations with altered expression of stress induced genes. Functions as a repressor of cold tolerance induced genes. Loss of function mutants are hypersensitive to freezing. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.