version

Summary of AtREG434 (All List)

OrganismArabidopsis thaliana  
IDAtREG434  
SequenceGCCCAGTA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count102  

Entry Sequences (102 entries)

LocusGene modelSequenceDescription
AT1G05140AT1G05140.1TACTGGGCTTGmembrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT2G32480.1); Has 6877 Blast hits to 5459 proteins in 1201 species: Archae - 28; Bacteria - 3634; Metazoa - 12; Fungi - 4; Plants - 40; Viruses - 0; Other Eukaryotes - 3159 (source: NCBI BLink). 
AT1G08430AT1G08430.1GCCCAACTTACTGGGCEncodes a Al-activated malate efflux transporter. Is essential for aluminum tolerance but does not represent the major Al tolerance QTL. Staurosporine and calyculin A both block all changes in AtALMT1 gene expression (as a result malate release is totally inhibited). 
AT1G10417AT1G10417.1TACTGGGCCCATATAEncodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. 
AT1G12830AT1G12830.1TAAATGGGCTAATACTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 39113 Blast hits to 20367 proteins in 821 species: Archae - 97; Bacteria - 5453; Metazoa - 15540; Fungi - 5514; Plants - 1861; Viruses - 608; Other Eukaryotes - 10040 (source: NCBI BLink). 
AT1G12840AT1G12840.1TTGGCCCAGTATTAGCCCATTTAEncodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. 
AT1G13180AT1G13180.1TCAGCCCAGTAMutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype. 
AT1G15020AT1G15020.1ATAAAGCCCAGTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. 
AT1G15020.2ATAAAGCCCAGTAEncodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. 
AT1G15330AT1G15330.1TACTGGGCCGTTCBS domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein (TAIR:AT1G80090.1); Has 364 Blast hits to 364 proteins in 90 species: Archae - 2; Bacteria - 4; Metazoa - 214; Fungi - 57; Plants - 56; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). 
AT1G16740AT1G16740.1TAAAGGCCCAGTAribosomal protein L20 family protein; FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L20, bacterial-type (InterPro:IPR005812), Ribosomal protein L20 (InterPro:IPR005813); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:ATCG00660.1); Has 5711 Blast hits to 5711 proteins in 1648 species: Archae - 0; Bacteria - 2947; Metazoa - 105; Fungi - 0; Plants - 471; Viruses - 0; Other Eukaryotes - 2188 (source: NCBI BLink). 
AT1G17880AT1G17880.1GCCCAGTAnascent polypeptide-associated complex (NAC) domain-containing protein / BTF3b-like transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: response to salt stress; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nascent polypeptide-associated complex NAC (InterPro:IPR002715); BEST Arabidopsis thaliana protein match is: nascent polypeptide-associated complex (NAC) domain-containing protein (TAIR:AT1G73230.1); Has 620 Blast hits to 620 proteins in 181 species: Archae - 0; Bacteria - 0; Metazoa - 334; Fungi - 124; Plants - 89; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). 
AT1G27540AT1G27540.1TACTGGGCCTGGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G27540.2TACTGGGCCTGGF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF295 (InterPro:IPR005174); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G27580.1); Has 148 Blast hits to 145 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G28375AT1G28375.1TACTGGGCCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, petal, sepal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 6 Blast hits to 6 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G33250AT1G33250.1TACTGGGCCCATATTAGGCCCfringe-related protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF604 (InterPro:IPR006740), Fringe-like (InterPro:IPR003378); BEST Arabidopsis thaliana protein match is: fringe-related protein (TAIR:AT4G23490.1); Has 492 Blast hits to 488 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 233; Fungi - 119; Plants - 128; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G34190AT1G34190.1GCCCAGTAArabidopsis NAC domain containing protein 17 (anac017); FUNCTIONS IN: transcription factor activity; INVOLVED IN: multicellular organismal development, regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: anac016 (Arabidopsis NAC domain containing protein 16); transcription factor (TAIR:AT1G34180.1); Has 1572 Blast hits to 1562 proteins in 56 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 1564; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G61430AT1G61430.1TACTGGGCCTTATGGGCTTATS-locus protein kinase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: protein amino acid phosphorylation, recognition of pollen; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Curculin-like (mannose-binding) lectin (InterPro:IPR001480), PAN-like, type 2 (InterPro:IPR013227), Apple-like (InterPro:IPR003609), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase-like (InterPro:IPR011009), Protein kinase, core (InterPro:IPR000719), S-locus glycoprotein (InterPro:IPR000858); BEST Arabidopsis thaliana protein match is: S-locus protein kinase, putative (TAIR:AT1G61440.1); Has 87173 Blast hits to 85910 proteins in 3093 species: Archae - 55; Bacteria - 7595; Metazoa - 38320; Fungi - 6601; Plants - 19577; Viruses - 379; Other Eukaryotes - 14646 (source: NCBI BLink). 
AT1G62200AT1G62200.1TACTGGGCCATproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region, conserved site (InterPro:IPR018456), TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: PTR2 (PEPTIDE TRANSPORTER 2); dipeptide transporter/ high affinity oligopeptide transporter/ nitrate transmembrane transporter/ peptide transporter/ transporter/ tripeptide transporter (TAIR:AT2G02040.1); Has 4799 Blast hits to 4477 proteins in 805 species: Archae - 0; Bacteria - 2076; Metazoa - 699; Fungi - 312; Plants - 1141; Viruses - 0; Other Eukaryotes - 571 (source: NCBI BLink). 
AT1G79650AT1G79650.1GGGCCTTACTGGGCTATTputative DNA repair protein RAD23 
AT1G79650.2GGGCCTTACTGGGCTATTputative DNA repair protein RAD23 
AT1G79650.3GGGCCTTACTGGGCTATTputative DNA repair protein RAD23 
AT1G79660AT1G79660.1AATAGCCCAGTAAGGCCCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16170.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G16440AT2G16440.1TAAAAGCCCAGTADNA replication licensing factor, putative; FUNCTIONS IN: nucleoside-triphosphatase activity, DNA-dependent ATPase activity, DNA binding, nucleotide binding, ATP binding; INVOLVED IN: DNA replication initiation, DNA replication; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), ATPase, AAA+ type, core (InterPro:IPR003593), DNA-dependent ATPase MCM (InterPro:IPR001208), DNA-dependent ATPase MCM, conserved site (InterPro:IPR018525), MCM protein 4 (InterPro:IPR008047); BEST Arabidopsis thaliana protein match is: minichromosome maintenance family protein / MCM family protein (TAIR:AT5G44635.1); Has 3751 Blast hits to 3594 proteins in 440 species: Archae - 240; Bacteria - 334; Metazoa - 1218; Fungi - 641; Plants - 353; Viruses - 5; Other Eukaryotes - 960 (source: NCBI BLink). 
AT2G16530AT2G16530.1TACTGGGCTTG3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, 3-oxo-5-alpha-steroid 4-dehydrogenase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104); BEST Arabidopsis thaliana protein match is: 3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein (TAIR:AT1G72590.1); Has 802 Blast hits to 802 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 320; Fungi - 111; Plants - 85; Viruses - 0; Other Eukaryotes - 266 (source: NCBI BLink). 
AT2G16530.2TACTGGGCTTG3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein; FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, 3-oxo-5-alpha-steroid 4-dehydrogenase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: callus; CONTAINS InterPro DOMAIN/s: 3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (InterPro:IPR001104); BEST Arabidopsis thaliana protein match is: 3-oxo-5-alpha-steroid 4-dehydrogenase family protein / steroid 5-alpha-reductase family protein (TAIR:AT1G72590.1); Has 802 Blast hits to 802 proteins in 149 species: Archae - 0; Bacteria - 20; Metazoa - 320; Fungi - 111; Plants - 85; Viruses - 0; Other Eukaryotes - 266 (source: NCBI BLink). 
AT2G18040AT2G18040.1TACTGGGCphosphorylation-specific peptidyl prolyl cis/trans isomerase (PPIase) with specificity for phosphoserine-proline bonds 
AT2G21250AT2G21250.1TACTGGGCCTAATmannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). 
AT2G21250.2TACTGGGCCTAATmannose 6-phosphate reductase (NADPH-dependent), putative; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: cultured cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: mannose 6-phosphate reductase (NADPH-dependent), putative (TAIR:AT2G21260.1); Has 13388 Blast hits to 13358 proteins in 1330 species: Archae - 187; Bacteria - 7678; Metazoa - 1798; Fungi - 1191; Plants - 907; Viruses - 0; Other Eukaryotes - 1627 (source: NCBI BLink). 
AT2G26240AT2G26240.1CCGGCCCAGTAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0136, Transmembrane (InterPro:IPR005349); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43520.1); Has 306 Blast hits to 306 proteins in 93 species: Archae - 0; Bacteria - 30; Metazoa - 172; Fungi - 29; Plants - 67; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G32060AT2G32060.1ATGGCCCAGTAAAGCCCATTAA40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT2G32060.2ATGGCCCAGTAAAGCCCATTAA40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT2G32060.3ATGGCCCAGTAAAGCCCATTAA40S ribosomal protein S12 (RPS12C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S12e (InterPro:IPR000530), Ribosomal protein L7Ae/L30e/S12e/Gadd45 (InterPro:IPR004038); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S12 (RPS12A) (TAIR:AT1G15930.2); Has 682 Blast hits to 682 proteins in 239 species: Archae - 118; Bacteria - 0; Metazoa - 255; Fungi - 114; Plants - 63; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT2G36305AT2G36305.1TTCGGCCCAGTAEncodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. 
AT2G41945AT2G41945.1AAAGCCCATAAGGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1). 
AT2G41945.2AAAGCCCATAAGGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1). 
AT2G41945.3AAAGCCCATAAGGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1). 
AT2G43340AT2G43340.1CCGGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1685 (InterPro:IPR012881); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31560.2); Has 128 Blast hits to 128 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 126; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G43640AT2G43640.1TACTGGGCCTAATAAGGCCCATTATsignal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 27; Plants - 26; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT2G43640.2TACTGGGCCTAATAAGGCCCATTATsignal recognition particle 14 kDa family protein / SRP14 family protein; FUNCTIONS IN: 7S RNA binding, protein binding, endoplasmic reticulum signal peptide binding, RNA binding; INVOLVED IN: negative regulation of translational elongation, protein targeting, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP14 subunit (InterPro:IPR003210), Signal recognition particle, SRP9/SRP14 subunit (InterPro:IPR009018); Has 170 Blast hits to 170 proteins in 73 species: Archae - 0; Bacteria - 0; Metazoa - 100; Fungi - 27; Plants - 26; Viruses - 0; Other Eukaryotes - 17 (source: NCBI BLink). 
AT2G44970AT2G44970.1TAATTGGGCCCAGTAGTGGCCCATATlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G44970.2TAATTGGGCCCAGTAGTGGCCCATATlipase-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 120 Blast hits to 120 proteins in 35 species: Archae - 0; Bacteria - 47; Metazoa - 0; Fungi - 4; Plants - 61; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G46505AT2G46505.1AAAAGCCCAGTATAAAGCCCAACTEncodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. 
AT2G46540AT2G46540.1ATTTGGGCCCAGTAACCCGACCCGACCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; Has 26 Blast hits to 26 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G47960AT2G47960.1TGAGGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF974 (InterPro:IPR010378); Has 215 Blast hits to 214 proteins in 92 species: Archae - 0; Bacteria - 0; Metazoa - 131; Fungi - 46; Plants - 18; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT3G01780AT3G01780.1TACTGGGCEncodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position. 
AT3G02065AT3G02065.1TATGGCCCAGTAAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.2TATGGCCCAGTAAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02065.3TATGGCCCAGTAAAAAGCCCATTTADEAD/DEAH box helicase family protein; FUNCTIONS IN: helicase activity, ATP-dependent helicase activity, nucleic acid binding, ATP binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH box type, N-terminal (InterPro:IPR011545), RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014), DEAD-like helicase, N-terminal (InterPro:IPR014001), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Zinc finger, HIT-type (InterPro:IPR007529), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: DEAD box RNA helicase, putative (TAIR:AT2G42520.1); Has 27637 Blast hits to 27044 proteins in 1723 species: Archae - 415; Bacteria - 11105; Metazoa - 5215; Fungi - 3275; Plants - 1400; Viruses - 12; Other Eukaryotes - 6215 (source: NCBI BLink). 
AT3G02520AT3G02520.1TACTGGGCCTTATEncodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). 
AT3G02820AT3G02820.1TACTGGGCTTTAAGGCCzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: cell cycle, replication fork protection, response to DNA damage stimulus; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Replication fork protection component Swi3 (InterPro:IPR012923), Zinc finger, CCHC-type (InterPro:IPR001878); Has 310 Blast hits to 310 proteins in 102 species: Archae - 0; Bacteria - 4; Metazoa - 145; Fungi - 74; Plants - 50; Viruses - 2; Other Eukaryotes - 35 (source: NCBI BLink). 
AT3G08530AT3G08530.1GCCCAGTAclathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast, membrane; EXPRESSED IN: guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G11130.1); Has 1212 Blast hits to 1102 proteins in 356 species: Archae - 0; Bacteria - 29; Metazoa - 727; Fungi - 112; Plants - 61; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink). 
AT3G10300AT3G10300.1TACTGGGCCTCcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G10300.1TACTGGGCCTCAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G10300.2TACTGGGCCTCcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G10300.2TACTGGGCCTCAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G10300.3TACTGGGCCTCcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G10300.3TACTGGGCCTCAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G10300.4TACTGGGCCTCcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G10300.4TACTGGGCCTCAcalcium-binding EF hand family protein; FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), Calcium-binding EF-hand (InterPro:IPR002048), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calcium-binding EF hand family protein (TAIR:AT5G04170.1); Has 33639 Blast hits to 18340 proteins in 837 species: Archae - 0; Bacteria - 2811; Metazoa - 19727; Fungi - 3988; Plants - 3787; Viruses - 272; Other Eukaryotes - 3054 (source: NCBI BLink). 
AT3G14400AT3G14400.1AGATGGGCCTAAAAAGCCCAGTAEncodes a ubiquitin-specific protease. 
AT3G18480AT3G18480.1TACTGGGCCTATThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565–689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation. 
AT3G24820AT3G24820.1ATAAGGCCCAGTAGCCCAGTABSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69030.1); Has 97 Blast hits to 97 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G24830AT3G24830.1TACTGGGCTACTGGGCCTTAT60S ribosomal protein L13A (RPL13aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aA) (TAIR:AT3G07110.1); Has 1473 Blast hits to 1473 proteins in 438 species: Archae - 212; Bacteria - 283; Metazoa - 292; Fungi - 127; Plants - 164; Viruses - 0; Other Eukaryotes - 395 (source: NCBI BLink). 
AT3G51260AT3G51260.1CTTGGGCCCAGTA20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. 
AT3G51260.2CTTGGGCCCAGTA20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. 
AT3G56340AT3G56340.1TACTGGGCTTG40S ribosomal protein S26 (RPS26C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S26e (InterPro:IPR000892); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S26 (RPS26A) (TAIR:AT2G40510.1); Has 605 Blast hits to 605 proteins in 200 species: Archae - 32; Bacteria - 0; Metazoa - 279; Fungi - 107; Plants - 80; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT4G01870AT4G01870.1AAAGCCCAGTAtolB protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cyclopentenone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40-like Beta Propeller (InterPro:IPR011659), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G21680.1); Has 4671 Blast hits to 3161 proteins in 698 species: Archae - 22; Bacteria - 2093; Metazoa - 16; Fungi - 28; Plants - 63; Viruses - 0; Other Eukaryotes - 2449 (source: NCBI BLink). 
AT4G08500AT4G08500.1TAAGCCCAATTAAAAAGCCCAGTAMember of MAP Kinase Kinase gene family. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates AtMEK1. 
AT4G11600AT4G11600.1TTTAGGCCCAGTAEncodes glutathione peroxidase. 
AT4G14145AT4G14145.1TACTGGGCTGGGCCCATTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 16 Blast hits to 16 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G14455AT4G14455.1TAAAGCCCAGTAAGCCCAATTEncodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in <i>sft1-1</i> yeast cells; however, it cannot support the deletion of the yeast BET1 gene (<i>bet1&#916;</i>). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi. 
AT4G14690AT4G14690.1TACTGGGCCTATEncodes an early light-induced protein. ELIPs are thought not to be directly involved in the synthesis and assembly of specific photosynthetic complexes, but rather affect the biogenesis of all chlorophyll-binding complexes. A study (PMID 17553115) has shown that the chlorophyll synthesis pathway was downregulated as a result of constitutive ELIP2 expression, leading to decreased chlorophyll availability for the assembly of pigment-binding proteins for photosynthesis. 
AT4G16770AT4G16770.1TTATGGGCCTAAAGCCCAGTAiron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: flavonoid biosynthetic process; LOCATED IN: peroxisome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isopenicillin N synthase (InterPro:IPR002283), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT4G16765.2); Has 6031 Blast hits to 6015 proteins in 680 species: Archae - 0; Bacteria - 734; Metazoa - 132; Fungi - 691; Plants - 2939; Viruses - 0; Other Eukaryotes - 1535 (source: NCBI BLink). 
AT4G22240AT4G22240.1CAAGCCCAGTAAACCGTplastid-lipid associated protein PAP, putative; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, thylakoid lumen, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: fruit, guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); BEST Arabidopsis thaliana protein match is: FIB (FIBRILLIN); structural molecule (TAIR:AT4G04020.1); Has 296 Blast hits to 296 proteins in 63 species: Archae - 0; Bacteria - 66; Metazoa - 0; Fungi - 0; Plants - 219; Viruses - 0; Other Eukaryotes - 11 (source: NCBI BLink). 
AT4G31570AT4G31570.1ATTGGGCTTTTAAGGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: seed; EXPRESSED DURING: E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24460.1); Has 149725 Blast hits to 50120 proteins in 2064 species: Archae - 2358; Bacteria - 20690; Metazoa - 73457; Fungi - 11975; Plants - 5885; Viruses - 756; Other Eukaryotes - 34604 (source: NCBI BLink). 
AT4G33030AT4G33030.1ATTTGGGCCAACCGGCCCAGTAinvolved in sulfolipid biosynthesis 
AT4G34140AT4G34140.1TACTGGGCCTAAACCGTnucleic acid binding; FUNCTIONS IN: nucleic acid binding; LOCATED IN: intracellular; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: D111/G-patch (InterPro:IPR000467); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding / zinc ion binding (TAIR:AT3G54230.1); Has 432 Blast hits to 428 proteins in 79 species: Archae - 0; Bacteria - 2; Metazoa - 338; Fungi - 40; Plants - 36; Viruses - 3; Other Eukaryotes - 13 (source: NCBI BLink). 
AT4G38660AT4G38660.1GCCCAGTAthaumatin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24180.1); Has 1098 Blast hits to 1079 proteins in 151 species: Archae - 0; Bacteria - 26; Metazoa - 54; Fungi - 57; Plants - 945; Viruses - 4; Other Eukaryotes - 12 (source: NCBI BLink). 
AT4G38660.2GCCCAGTAthaumatin, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to other organism; LOCATED IN: anchored to membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thaumatin, pathogenesis-related (InterPro:IPR001938); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G24180.1); Has 1098 Blast hits to 1079 proteins in 151 species: Archae - 0; Bacteria - 26; Metazoa - 54; Fungi - 57; Plants - 945; Viruses - 4; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G03940AT5G03940.1TACTGGGCCACGTCATCmutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit 
AT5G08415AT5G08415.1TACTGGGCTTClipoic acid synthase family protein; FUNCTIONS IN: lipoic acid synthase activity, iron-sulfur cluster binding, lipoate synthase activity, catalytic activity; INVOLVED IN: lipoic acid biosynthetic process, lipoate biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Lipoate synthase (InterPro:IPR003698), Elongator protein 3/MiaB/NifB (InterPro:IPR006638), Radical SAM (InterPro:IPR007197); BEST Arabidopsis thaliana protein match is: LIP1 (LIPOIC ACID SYNTHASE 1); lipoic acid synthase (TAIR:AT2G20860.1); Has 5746 Blast hits to 5746 proteins in 1192 species: Archae - 36; Bacteria - 2422; Metazoa - 113; Fungi - 91; Plants - 53; Viruses - 0; Other Eukaryotes - 3031 (source: NCBI BLink). 
AT5G08420AT5G08420.1GAAGCCCAGTARNA binding; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: K Homology (InterPro:IPR004087); Has 2056 Blast hits to 1575 proteins in 229 species: Archae - 85; Bacteria - 30; Metazoa - 600; Fungi - 242; Plants - 75; Viruses - 0; Other Eukaryotes - 1024 (source: NCBI BLink). 
AT5G10100AT5G10100.1CCCATTATTAGGCCCAGTAGGTCCCACtrehalose-6-phosphate phosphatase, putative; FUNCTIONS IN: catalytic activity, trehalose-phosphatase activity; INVOLVED IN: trehalose biosynthetic process, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: embryo, root; EXPRESSED DURING: C globular stage; CONTAINS InterPro DOMAIN/s: HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), Trehalose-phosphatase (InterPro:IPR003337); BEST Arabidopsis thaliana protein match is: trehalose-6-phosphate phosphatase, putative (TAIR:AT5G65140.1); Has 1468 Blast hits to 1466 proteins in 515 species: Archae - 29; Bacteria - 765; Metazoa - 195; Fungi - 100; Plants - 258; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). 
AT5G10110AT5G10110.1CAAGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65120.1); Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G12290AT5G12290.1TACTGGGCCCATTAAAAGCCCAATAAGEncodes a mitochondrial outer membrane protein, involved in galactoglycerolipid biosynthesis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. 
AT5G14590AT5G14590.1TACTGGGCCTTATGTTGGGCCTACisocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative; FUNCTIONS IN: isocitrate dehydrogenase (NADP+) activity, oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor; INVOLVED IN: isocitrate metabolic process, metabolic process; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isocitrate/isopropylmalate dehydrogenase (InterPro:IPR001804), Isocitrate dehydrogenase NADP-dependent, eukaryotic (InterPro:IPR004790); BEST Arabidopsis thaliana protein match is: isocitrate dehydrogenase, putative / NADP+ isocitrate dehydrogenase, putative (TAIR:AT1G65930.1); Has 4142 Blast hits to 4125 proteins in 584 species: Archae - 19; Bacteria - 563; Metazoa - 433; Fungi - 160; Plants - 265; Viruses - 0; Other Eukaryotes - 2702 (source: NCBI BLink). 
AT5G14600AT5G14600.1GTAGGCCCAACATAAGGCCCAGTAtRNA (adenine-N1-)-methyltransferase; FUNCTIONS IN: tRNA (adenine-N1-)-methyltransferase activity; INVOLVED IN: tRNA methylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: tRNA methyltransferase complex GCD14 subunit (InterPro:IPR014816); Has 1145 Blast hits to 1142 proteins in 382 species: Archae - 132; Bacteria - 313; Metazoa - 135; Fungi - 115; Plants - 30; Viruses - 0; Other Eukaryotes - 420 (source: NCBI BLink). 
AT5G19180AT5G19180.1TTTTGGGCCTAGCCCAGTAEncodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein. 
AT5G20500AT5G20500.1GAAGCCCAGTAglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT1G77370.1); Has 4164 Blast hits to 4161 proteins in 811 species: Archae - 10; Bacteria - 1751; Metazoa - 378; Fungi - 232; Plants - 403; Viruses - 108; Other Eukaryotes - 1282 (source: NCBI BLink). 
AT5G22440AT5G22440.1TGTGGGCCTAAATACTGGGCTTTAA60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). 
AT5G22440.2TGTGGGCCTAAATACTGGGCTTTAA60S ribosomal protein L10A (RPL10aC); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation, RNA processing; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L1 (InterPro:IPR002143), Ribosomal protein L1, 2-layer alpha/beta-sandwich (InterPro:IPR016094); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L10A (RPL10aA) (TAIR:AT1G08360.1); Has 3069 Blast hits to 3069 proteins in 947 species: Archae - 186; Bacteria - 1384; Metazoa - 354; Fungi - 122; Plants - 241; Viruses - 0; Other Eukaryotes - 782 (source: NCBI BLink). 
AT5G44568AT5G44568.1CTAGGCCCAGTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 11 Blast hits to 11 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G47630AT5G47630.1TTCGGCCCAGTAEncodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. 
AT5G47630.2TTCGGCCCAGTAEncodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. 
AT5G47880AT5G47880.1TACTGGGCTTAGGCCCATTAAEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. 
AT5G47880.2TACTGGGCTTAGGCCCATTAAEncodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. 
AT5G56700AT5G56700.1TGGCCCAGTAF-box protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G60610.1); Has 668 Blast hits to 656 proteins in 7 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 666; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G66190AT5G66190.1GCCCAGTAEncodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. 
AT5G66190.2GCCCAGTAEncodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. 
AT5G67490AT5G67490.1TACTGGGCCAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1674 (InterPro:IPR012875); Has 340 Blast hits to 340 proteins in 113 species: Archae - 0; Bacteria - 97; Metazoa - 109; Fungi - 4; Plants - 24; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). 
AT5G67490.1TACTGGGCTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1674 (InterPro:IPR012875); Has 340 Blast hits to 340 proteins in 113 species: Archae - 0; Bacteria - 97; Metazoa - 109; Fungi - 4; Plants - 24; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). 
AT5G67500AT5G67500.1TTGGCCCAGTAEncodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.