Organism | Arabidopsis thaliana | |
ID | AtREG492 | |
Sequence | AAGCGCGT | |
Annotation | ||
PPDB Motif | ACGCGC | CGCG box, stress response? |
PLACE Motif | ||
Total Entry Count | 128 |
Locus | Gene model | Sequence | Description |
AT1G03730 | AT1G03730.1 | AAGCGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G03600.1); Has 27 Blast hits to 27 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G03730.1 | ACACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G03600.1); Has 27 Blast hits to 27 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT1G10940 | AT1G10940.1 | AAGCGCGT | Encodes a plant protein kinase similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Kinase activity of its homolog in tobacco is induced by hyperosmotic condition within 1 minute.  |
AT1G12380 | AT1G12380.1 | AAGCGCGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62870.1); Has 97 Blast hits to 97 proteins in 28 species: Archae - 0; Bacteria - 4; Metazoa - 25; Fungi - 8; Plants - 48; Viruses - 6; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT1G17140 | AT1G17140.1 | ACACGCGCTT | tropomyosin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78430.1); Has 43510 Blast hits to 22998 proteins in 1377 species: Archae - 572; Bacteria - 4160; Metazoa - 22917; Fungi - 3693; Plants - 1661; Viruses - 138; Other Eukaryotes - 10369 (source: NCBI BLink).  |
AT1G17140.2 | ACACGCGCTT | tropomyosin-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G78430.1); Has 43510 Blast hits to 22998 proteins in 1377 species: Archae - 572; Bacteria - 4160; Metazoa - 22917; Fungi - 3693; Plants - 1661; Viruses - 138; Other Eukaryotes - 10369 (source: NCBI BLink).  | |
AT1G17790 | AT1G17790.1 | AAGCGCGTGA | DNA-binding bromodomain-containing protein; FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: GTE3 (GLOBAL TRANSCRIPTION FACTOR GROUP E 3); DNA binding / histone binding (TAIR:AT1G73150.1); Has 10421 Blast hits to 6039 proteins in 444 species: Archae - 16; Bacteria - 924; Metazoa - 4753; Fungi - 937; Plants - 711; Viruses - 164; Other Eukaryotes - 2916 (source: NCBI BLink).  |
AT1G18300 | AT1G18300.1 | AAGCGCGTG | Arabidopsis thaliana Nudix hydrolase homolog 4 (atnudt4); FUNCTIONS IN: hydrolase activity; LOCATED IN: cytosol; EXPRESSED IN: stem, root, leaf; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt21 (Arabidopsis thaliana Nudix hydrolase homolog 21); hydrolase (TAIR:AT1G73540.1); Has 801 Blast hits to 799 proteins in 226 species: Archae - 1; Bacteria - 254; Metazoa - 216; Fungi - 81; Plants - 132; Viruses - 0; Other Eukaryotes - 117 (source: NCBI BLink).  |
AT1G20620 | AT1G20620.4 | AAGCGCGT | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen.  |
AT1G23710 | AT1G23710.1 | TCAGCCCATCACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink).  |
AT1G29840 | AT1G29840.1 | ACGCGCTT | esterase/lipase/thioesterase family protein; FUNCTIONS IN: catalytic activity; BEST Arabidopsis thaliana protein match is: esterase/lipase/thioesterase family protein (TAIR:AT3G47560.1); Has 2153 Blast hits to 2152 proteins in 431 species: Archae - 25; Bacteria - 868; Metazoa - 5; Fungi - 50; Plants - 119; Viruses - 2; Other Eukaryotes - 1084 (source: NCBI BLink).  |
AT1G31930 | AT1G31930.1 | ATTGCCACGCGCTT | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses.  |
AT1G31930.2 | ATTGCCACGCGCTT | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses.  | |
AT1G32920 | AT1G32920.1 | AAGCGCGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32928.1); Has 14 Blast hits to 14 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G32928 | AT1G32928.1 | ACACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32920.1); Has 14 Blast hits to 14 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G34000 | AT1G34000.1 | ACACGCGCTT | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions.  |
AT1G51660 | AT1G51660.1 | TCACGCGCTT | Encodes a mitogen-activated map kinase kinase (there are nine in Arabidopsis) involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK5. In plants with both MKK5 and MKK6 levels reduced by RNAi plants, floral organs do not abscise suggestion a role for both proteins in mediating floral organ abscission.  |
AT1G53840 | AT1G53840.1 | AAGCGCGT | encodes a pectin methylesterase  |
AT1G69740 | AT1G69740.1 | AAGCGCGTGAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.  |
AT1G69740.2 | AAGCGCGTGAA | Encodes a putative 5-aminolevulinate dehydratase involved in chlorophyll biosynthesis.  | |
AT1G69770 | AT1G69770.1 | ACGCGCTT | Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing.  |
AT1G70090 | AT1G70090.1 | AAGCGCGTGT | Encodes a protein with putative galacturonosyltransferase activity.  |
AT1G70090.1 | TTCACGCGCTT | Encodes a protein with putative galacturonosyltransferase activity.  | |
AT1G70090.2 | AAGCGCGTGT | Encodes a protein with putative galacturonosyltransferase activity.  | |
AT1G70090.2 | TTCACGCGCTT | Encodes a protein with putative galacturonosyltransferase activity.  | |
AT1G71070 | AT1G71070.1 | AAGCGCGTGAA | glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups, acetylglucosaminyltransferase activity; INVOLVED IN: carbohydrate biosynthetic process; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 14 (InterPro:IPR003406); BEST Arabidopsis thaliana protein match is: glycosyltransferase family 14 protein / core-2/I-branching enzyme family protein (TAIR:AT5G39990.1); Has 699 Blast hits to 696 proteins in 86 species: Archae - 0; Bacteria - 16; Metazoa - 469; Fungi - 0; Plants - 190; Viruses - 14; Other Eukaryotes - 10 (source: NCBI BLink).  |
AT1G73540 | AT1G73540.1 | AAGCGCGTGA | Arabidopsis thaliana Nudix hydrolase homolog 21 (atnudt21); FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); BEST Arabidopsis thaliana protein match is: atnudt4 (Arabidopsis thaliana Nudix hydrolase homolog 4); hydrolase (TAIR:AT1G18300.1); Has 819 Blast hits to 817 proteins in 227 species: Archae - 3; Bacteria - 284; Metazoa - 212; Fungi - 79; Plants - 132; Viruses - 0; Other Eukaryotes - 109 (source: NCBI BLink).  |
AT1G78040 | AT1G78040.1 | TCACGCGCTT | pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT1G78040.2 | TCACGCGCTT | pollen Ole e 1 allergen and extensin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: in 10 processes; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pollen Ole e 1 allergen and extensin (InterPro:IPR006041), TonB box, conserved site (InterPro:IPR010916); BEST Arabidopsis thaliana protein match is: SAH7 (TAIR:AT4G08685.1); Has 188 Blast hits to 188 proteins in 32 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 188; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G01490 | AT2G01490.1 | AAGCGCGTGA | phytanoyl-CoA dioxygenase (PhyH) family protein; FUNCTIONS IN: phytanoyl-CoA dioxygenase activity; INVOLVED IN: N-terminal protein myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Phytanoyl-CoA dioxygenase (InterPro:IPR008775); Has 2632 Blast hits to 2624 proteins in 223 species: Archae - 0; Bacteria - 300; Metazoa - 320; Fungi - 67; Plants - 32; Viruses - 0; Other Eukaryotes - 1913 (source: NCBI BLink).  |
AT2G01910 | AT2G01910.1 | ACGCGCTT | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria.  |
AT2G01910.2 | ACGCGCTT | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria.  | |
AT2G03240 | AT2G03240.1 | TCACGCGCTT | LOCATED IN: integral to membrane; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331), EXS, C-terminal (InterPro:IPR004342); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G14040.1); Has 764 Blast hits to 738 proteins in 146 species: Archae - 0; Bacteria - 0; Metazoa - 262; Fungi - 250; Plants - 154; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink).  |
AT2G17480 | AT2G17480.1 | TCACGCGCTT | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO8 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO9, and AtMLO10. The gene is expressed during seedling growth, in cotyledons and hypocotyl, and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).  |
AT2G23810 | AT2G23810.1 | AAGCGCGTG | Member of TETRASPANIN family  |
AT2G25250 | AT2G25250.1 | AAGCGCGTGA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32020.1); Has 14 Blast hits to 14 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G25690 | AT2G25690.1 | TCACGCGCTT | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT5G11460.1); Has 277 Blast hits to 277 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 277; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT2G25690.2 | TCACGCGCTT | senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT5G11460.1); Has 277 Blast hits to 277 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 277; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT2G28890 | AT2G28890.1 | ACGCGCTT | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves.  |
AT2G32950 | AT2G32950.1 | AAGCGCGT | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light.  |
AT2G33510 | AT2G33510.1 | CACGCGCTT | protein binding; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: WW/Rsp5/WWP (InterPro:IPR001202); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28070.1); Has 6341 Blast hits to 1213 proteins in 158 species: Archae - 0; Bacteria - 40; Metazoa - 4967; Fungi - 231; Plants - 231; Viruses - 92; Other Eukaryotes - 780 (source: NCBI BLink).  |
AT2G39805 | AT2G39805.1 | AAGCGCGTG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  |
AT2G39805.2 | AAGCGCGTG | integral membrane Yip1 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Yip1 domain (InterPro:IPR006977); BEST Arabidopsis thaliana protein match is: integral membrane Yip1 family protein (TAIR:AT5G27490.1); Has 320 Blast hits to 319 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 150; Fungi - 61; Plants - 49; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink).  | |
AT2G40270 | AT2G40270.1 | ACGCGCTT | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G56050.2); Has 26726 Blast hits to 26497 proteins in 928 species: Archae - 2; Bacteria - 1013; Metazoa - 9654; Fungi - 683; Plants - 12592; Viruses - 117; Other Eukaryotes - 2665 (source: NCBI BLink).  |
AT2G40270.2 | ACGCGCTT | protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT3G56050.2); Has 26726 Blast hits to 26497 proteins in 928 species: Archae - 2; Bacteria - 1013; Metazoa - 9654; Fungi - 683; Plants - 12592; Viruses - 117; Other Eukaryotes - 2665 (source: NCBI BLink).  | |
AT2G43330 | AT2G43330.1 | TCACGCGCTT | Encodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium.  |
AT2G44370 | AT2G44370.1 | AAGCGCGT | DC1 domain-containing protein; EXPRESSED IN: hypocotyl, root; CONTAINS InterPro DOMAIN/s: DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT2G17740.1); Has 1603 Blast hits to 573 proteins in 27 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi - 5; Plants - 1571; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  |
AT3G01770 | AT3G01770.1 | AAGCGCGTGCCGT | Arabidopsis thaliana BROMODOMAIN AND EXTRATERMINAL DOMAIN PROTEIN 10 (ATBET10); FUNCTIONS IN: DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Bromodomain (InterPro:IPR001487); BEST Arabidopsis thaliana protein match is: ATBET9 (Arabidopsis thaliana Bromodomain and Extraterminal Domain protein 9); DNA binding (TAIR:AT5G14270.1); Has 10636 Blast hits to 8190 proteins in 445 species: Archae - 19; Bacteria - 529; Metazoa - 5538; Fungi - 1309; Plants - 426; Viruses - 19; Other Eukaryotes - 2796 (source: NCBI BLink).  |
AT3G01780 | AT3G01780.1 | ACGGCACGCGCTT | Encodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position.  |
AT3G01810 | AT3G01810.1 | AAGCGCGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2); Has 1293 Blast hits to 384 proteins in 97 species: Archae - 2; Bacteria - 96; Metazoa - 212; Fungi - 99; Plants - 59; Viruses - 0; Other Eukaryotes - 825 (source: NCBI BLink).  |
AT3G01810.2 | AAGCGCGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: nucleolar protein gar2-related (TAIR:AT2G42320.2); Has 1293 Blast hits to 384 proteins in 97 species: Archae - 2; Bacteria - 96; Metazoa - 212; Fungi - 99; Plants - 59; Viruses - 0; Other Eukaryotes - 825 (source: NCBI BLink).  | |
AT3G04930 | AT3G04930.1 | AAGCGCGTGT | transcription regulator; FUNCTIONS IN: transcription regulator activity; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF573 (InterPro:IPR007592); BEST Arabidopsis thaliana protein match is: transcription regulator (TAIR:AT5G28040.1); Has 231 Blast hits to 227 proteins in 38 species: Archae - 1; Bacteria - 18; Metazoa - 23; Fungi - 4; Plants - 160; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink).  |
AT3G07195 | AT3G07195.1 | AAGCGCGTGGCTT | proline-rich family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: defense protein-related (TAIR:AT5G48657.2); Has 4353 Blast hits to 3535 proteins in 378 species: Archae - 6; Bacteria - 1484; Metazoa - 1568; Fungi - 266; Plants - 491; Viruses - 21; Other Eukaryotes - 517 (source: NCBI BLink).  |
AT3G10270 | AT3G10270.1 | AAGCGCGT | Protein targeting to mitochondria is influenced by UTR sequences.  |
AT3G12320 | AT3G12320.1 | TCACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G06980.1); Has 49 Blast hits to 49 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 47; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT3G15530 | AT3G15530.1 | AAGCGCGTGAA | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT5G54400.1); Has 1872 Blast hits to 1872 proteins in 644 species: Archae - 84; Bacteria - 1456; Metazoa - 9; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  |
AT3G15530.2 | AAGCGCGTGAA | methyltransferase; FUNCTIONS IN: methyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Methyltransferase type 11 (InterPro:IPR013216); BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT5G54400.1); Has 1872 Blast hits to 1872 proteins in 644 species: Archae - 84; Bacteria - 1456; Metazoa - 9; Fungi - 98; Plants - 47; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink).  | |
AT3G21660 | AT3G21660.1 | AAGCGCGTTTTG | UBX domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: UBX (InterPro:IPR001012), SEP (InterPro:IPR012989); BEST Arabidopsis thaliana protein match is: PUX5 (Arabidopsis thaliana serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma); protein binding (TAIR:AT4G15410.1); Has 901 Blast hits to 569 proteins in 154 species: Archae - 0; Bacteria - 31; Metazoa - 481; Fungi - 168; Plants - 100; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink).  |
AT3G23920 | AT3G23920.1 | AAGCGCGT | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.  |
AT3G26030 | AT3G26030.1 | TTCACGCGCTT | protein phosphatase 2A regulatory subunit isoform B' delta  |
AT3G30300 | AT3G30300.1 | AAGCGCGT | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: EDA30 (embryo sac development arrest 30) (TAIR:AT3G03810.1); Has 512 Blast hits to 417 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 512; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G49720 | AT3G49720.1 | ACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G49720.2 | ACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, Golgi apparatus, plasma membrane, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65810.1); Has 32 Blast hits to 32 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G49870 | AT3G49870.1 | TCACGCGCTT | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases.  |
AT3G54000 | AT3G54000.1 | AAGCGCGTGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT3G54000.2 | AAGCGCGTGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G54000.3 | AAGCGCGTGAA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP022260 (InterPro:IPR016802); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59050.1); Has 43 Blast hits to 43 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  | |
AT3G61300 | AT3G61300.1 | AAGCGCGT | C2 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: tryptophan biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: C2 membrane targeting protein (InterPro:IPR018029), C2 calcium/lipid-binding region, CaLB (InterPro:IPR008973), Phosphoribosyltransferase C-terminal, plant (InterPro:IPR013583), C2 calcium-dependent membrane targeting (InterPro:IPR000008); BEST Arabidopsis thaliana protein match is: C2 domain-containing protein (TAIR:AT4G11610.1); Has 4843 Blast hits to 3631 proteins in 212 species: Archae - 0; Bacteria - 0; Metazoa - 3192; Fungi - 336; Plants - 918; Viruses - 8; Other Eukaryotes - 389 (source: NCBI BLink).  |
AT3G62270 | AT3G62270.1 | ACGCGCTT | anion exchange family protein; FUNCTIONS IN: anion exchanger activity; INVOLVED IN: anion transport; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bicarbonate transporter, eukaryotic (InterPro:IPR003020), Bicarbonate transporter, C-terminal (InterPro:IPR011531); BEST Arabidopsis thaliana protein match is: BOR1 (REQUIRES HIGH BORON 1); anion exchanger/ boron transporter (TAIR:AT2G47160.1); Has 2011 Blast hits to 1074 proteins in 144 species: Archae - 0; Bacteria - 12; Metazoa - 1646; Fungi - 204; Plants - 99; Viruses - 2; Other Eukaryotes - 48 (source: NCBI BLink).  |
AT4G01090 | AT4G01090.1 | TTCACGCGCTT | extra-large G-protein-related; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: extra-large G-protein-related (TAIR:AT1G01440.1); Has 1293 Blast hits to 1199 proteins in 189 species: Archae - 0; Bacteria - 45; Metazoa - 453; Fungi - 263; Plants - 305; Viruses - 2; Other Eukaryotes - 225 (source: NCBI BLink).  |
AT4G02350 | AT4G02350.1 | AAGCGCGT | exocyst complex subunit Sec15-like family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: pollen germination, pollen tube growth; LOCATED IN: plasma membrane, membrane, exocyst; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Exocyst complex subunit Sec15-like (InterPro:IPR007225), Vps51/Vps67 (InterPro:IPR014812); BEST Arabidopsis thaliana protein match is: exocyst complex subunit Sec15-like family protein (TAIR:AT3G56640.1); Has 306 Blast hits to 302 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 90; Plants - 46; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink).  |
AT4G03600 | AT4G03600.1 | AAGCGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G03730.1); Has 27 Blast hits to 27 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G04210 | AT4G04210.1 | CACGCGCTT | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4)  |
AT4G04860 | AT4G04860.1 | CACGCGCTT | DERLIN-2.2 (DER2.2); INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.1 (DERLIN-2.1) (TAIR:AT4G21810.1); Has 634 Blast hits to 633 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 294; Fungi - 119; Plants - 84; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).  |
AT4G09630 | AT4G09630.1 | AAGCGCGTGA | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF616 (InterPro:IPR006852); BEST Arabidopsis thaliana protein match is: EMB2756 (EMBRYO DEFECTIVE 2756) (TAIR:AT1G34550.1); Has 2910 Blast hits to 2214 proteins in 235 species: Archae - 17; Bacteria - 119; Metazoa - 666; Fungi - 192; Plants - 194; Viruses - 70; Other Eukaryotes - 1652 (source: NCBI BLink).  |
AT4G12650 | AT4G12650.1 | AAGCGCGT | LOCATED IN: integral to membrane, Golgi apparatus, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35160.1); Has 983 Blast hits to 980 proteins in 161 species: Archae - 0; Bacteria - 0; Metazoa - 434; Fungi - 144; Plants - 228; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  |
AT4G17615 | AT4G17615.1 | ACACGCGCTT | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation.  |
AT4G21810 | AT4G21810.1 | ACACGCGCTT | DERLIN-2.1 (DER2.1); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: proteolysis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Der1-like (InterPro:IPR007599); BEST Arabidopsis thaliana protein match is: DER2.2 (DERLIN-2.2) (TAIR:AT4G04860.1); Has 644 Blast hits to 643 proteins in 163 species: Archae - 0; Bacteria - 0; Metazoa - 293; Fungi - 119; Plants - 95; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).  |
AT4G25620 | AT4G25620.1 | AAGCGCGTGGGTCCAAACCG | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT5G52430.1); Has 844 Blast hits to 627 proteins in 148 species: Archae - 0; Bacteria - 72; Metazoa - 151; Fungi - 122; Plants - 173; Viruses - 60; Other Eukaryotes - 266 (source: NCBI BLink).  |
AT4G27654 | AT4G27654.1 | ACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 9 growth stages; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G29780 | AT4G29780.1 | TTCACGCGCTT | unknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12010.1); Has 674 Blast hits to 672 proteins in 58 species: Archae - 0; Bacteria - 0; Metazoa - 420; Fungi - 37; Plants - 217; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G30350 | AT4G30350.1 | CACGCGCTT | heat shock protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: heat shock protein-related (TAIR:AT5G57710.1); Has 9629 Blast hits to 8914 proteins in 1507 species: Archae - 15; Bacteria - 6840; Metazoa - 9; Fungi - 184; Plants - 322; Viruses - 0; Other Eukaryotes - 2259 (source: NCBI BLink).  |
AT4G31580 | AT4G31580.1 | ACGCGCTT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K.  |
AT4G31580.2 | ACGCGCTT | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K.  | |
AT4G32020 | AT4G32020.1 | AAGCGCGTGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G25250.1); Has 34 Blast hits to 34 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 5; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT4G33080 | AT4G33080.1 | AAGCGCGTGA | protein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G19400.1); Has 78886 Blast hits to 77157 proteins in 1855 species: Archae - 56; Bacteria - 7391; Metazoa - 32768; Fungi - 7799; Plants - 14685; Viruses - 369; Other Eukaryotes - 15818 (source: NCBI BLink).  |
AT4G33080.2 | AAGCGCGTGA | protein kinase, putative; FUNCTIONS IN: kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase, C-terminal (InterPro:IPR017892), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), AGC-kinase, C-terminal (InterPro:IPR000961), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: protein kinase, putative (TAIR:AT2G19400.1); Has 78886 Blast hits to 77157 proteins in 1855 species: Archae - 56; Bacteria - 7391; Metazoa - 32768; Fungi - 7799; Plants - 14685; Viruses - 369; Other Eukaryotes - 15818 (source: NCBI BLink).  | |
AT4G34390 | AT4G34390.1 | TTCACGCGCTT | extra-large GTP-binding protein 2 (XLG2); FUNCTIONS IN: guanyl nucleotide binding, signal transducer activity; INVOLVED IN: in 7 processes; LOCATED IN: nucleus; EXPRESSED IN: 28 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Guanine nucleotide binding protein (G-protein), alpha subunit (InterPro:IPR001019), G protein alpha subunit, helical insertion (InterPro:IPR011025); BEST Arabidopsis thaliana protein match is: XLG1 (EXTRA-LARGE G-PROTEIN 1); guanyl nucleotide binding / signal transducer (TAIR:AT2G23460.1); Has 2643 Blast hits to 2642 proteins in 328 species: Archae - 0; Bacteria - 2; Metazoa - 1875; Fungi - 392; Plants - 229; Viruses - 0; Other Eukaryotes - 145 (source: NCBI BLink).  |
AT4G39100 | AT4G39100.1 | ACACGCGCTT | Putative transcription factor containing a PHD finger and BAH motif, required for normal development  |
AT4G39550 | AT4G39550.1 | ACACGCGCTT | kelch repeat-containing F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G49000.2); Has 2334 Blast hits to 1835 proteins in 108 species: Archae - 6; Bacteria - 90; Metazoa - 1470; Fungi - 6; Plants - 681; Viruses - 3; Other Eukaryotes - 78 (source: NCBI BLink).  |
AT4G39890 | AT4G39890.1 | ACGCGCTT | Arabidopsis Rab GTPase homolog H1c (AtRABH1c); FUNCTIONS IN: protein binding, GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab6-related (InterPro:IPR015600); BEST Arabidopsis thaliana protein match is: ATRABH1D (ARABIDOPSIS RAB GTPASE HOMOLOG H1D); GTP binding (TAIR:AT2G22290.1); Has 23210 Blast hits to 23184 proteins in 633 species: Archae - 15; Bacteria - 105; Metazoa - 12984; Fungi - 2714; Plants - 2201; Viruses - 19; Other Eukaryotes - 5172 (source: NCBI BLink).  |
AT5G02490 | AT5G02490.1 | ACACGCGCTT | heat shock cognate 70 kDa protein 2 (HSC70-2) (HSP70-2); FUNCTIONS IN: ATP binding; INVOLVED IN: protein folding, response to cadmium ion, response to heat, response to bacterium; LOCATED IN: cytosol, cell wall, plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Heat shock protein 70, conserved site (InterPro:IPR018181), Heat shock protein Hsp70 (InterPro:IPR001023), Heat shock protein 70 (InterPro:IPR013126); BEST Arabidopsis thaliana protein match is: HSC70-1 (HEAT SHOCK COGNATE PROTEIN 70-1); ATP binding (TAIR:AT5G02500.1); Has 24929 Blast hits to 24652 proteins in 3112 species: Archae - 103; Bacteria - 9641; Metazoa - 3128; Fungi - 1215; Plants - 726; Viruses - 241; Other Eukaryotes - 9875 (source: NCBI BLink).  |
AT5G03140 | AT5G03140.1 | ACACGCGCTT | lectin protein kinase family protein; FUNCTIONS IN: carbohydrate binding, kinase activity; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Legume lectin, beta domain (InterPro:IPR001220), Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase-related (InterPro:IPR017442), Concanavalin A-like lectin/glucanase, subgroup (InterPro:IPR013320), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Concanavalin A-like lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis thaliana protein match is: lectin protein kinase family protein (TAIR:AT3G53380.1); Has 86443 Blast hits to 85431 proteins in 3024 species: Archae - 50; Bacteria - 7703; Metazoa - 37587; Fungi - 6804; Plants - 19480; Viruses - 384; Other Eukaryotes - 14435 (source: NCBI BLink).  |
AT5G04590 | AT5G04590.1 | GCGTTTTACGCGCTT | A.thaliana gene encoding sulfite reductase.  |
AT5G08150 | AT5G08150.1 | ACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1101 Blast hits to 891 proteins in 136 species: Archae - 2; Bacteria - 37; Metazoa - 322; Fungi - 143; Plants - 81; Viruses - 8; Other Eukaryotes - 508 (source: NCBI BLink).  |
AT5G08330 | AT5G08330.1 | AAGCGCGTGA | TCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: TCP family transcription factor, putative (TAIR:AT5G23280.1); Has 741 Blast hits to 732 proteins in 146 species: Archae - 0; Bacteria - 2; Metazoa - 30; Fungi - 0; Plants - 703; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  |
AT5G08760 | AT5G08760.1 | AAGCGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G12140 | AT5G12140.1 | AAAACGCGCTT | Encodes a cystatin.  |
AT5G13700 | AT5G13700.1 | AAGCGCGT | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants).  |
AT5G15730 | AT5G15730.1 | ACGCGCTT | serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G54590.2); Has 85200 Blast hits to 84239 proteins in 3312 species: Archae - 48; Bacteria - 7076; Metazoa - 38106; Fungi - 6592; Plants - 18568; Viruses - 406; Other Eukaryotes - 14404 (source: NCBI BLink).  |
AT5G15730.2 | ACGCGCTT | serine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G54590.2); Has 85200 Blast hits to 84239 proteins in 3312 species: Archae - 48; Bacteria - 7076; Metazoa - 38106; Fungi - 6592; Plants - 18568; Viruses - 406; Other Eukaryotes - 14404 (source: NCBI BLink).  | |
AT5G19480 | AT5G19480.1 | AAGCGCGTGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12230.1); Has 16108 Blast hits to 7312 proteins in 337 species: Archae - 6; Bacteria - 291; Metazoa - 8114; Fungi - 1489; Plants - 1051; Viruses - 36; Other Eukaryotes - 5121 (source: NCBI BLink).  |
AT5G19480.2 | AAGCGCGTGAA | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12230.1); Has 16108 Blast hits to 7312 proteins in 337 species: Archae - 6; Bacteria - 291; Metazoa - 8114; Fungi - 1489; Plants - 1051; Viruses - 36; Other Eukaryotes - 5121 (source: NCBI BLink).  | |
AT5G23080 | AT5G23080.1 | AAGCGCGTGAA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.  |
AT5G23080.2 | AAGCGCGTGAA | Interacts with TATA-box binding protein 2. Contains domains with strong similarity to G-patch and SWAP domains, characteristic of RNA binding and processing proteins. Colocalizes with the splicing regulator SRp34 to subnuclear particles. Role in RNA binding or processing. Mutants display developmental defects, including reduced plant height, polycotyly, and reduced vascularization. Strong genetic interaction between TGH and AMP1.  | |
AT5G40150 | AT5G40150.1 | AAGCGCGTTTT | peroxidase, putative; FUNCTIONS IN: electron carrier activity, peroxidase activity, heme binding; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Haem peroxidase (InterPro:IPR010255), Plant peroxidase (InterPro:IPR000823), Haem peroxidase, plant/fungal/bacterial (InterPro:IPR002016); BEST Arabidopsis thaliana protein match is: peroxidase, putative (TAIR:AT3G28200.1); Has 3213 Blast hits to 3199 proteins in 258 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 351; Plants - 2806; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink).  |
AT5G40155 | AT5G40155.1 | ACGCGCTT | Encodes a defensin-like (DEFL) family protein.  |
AT5G42950 | AT5G42950.1 | AAGCGCGTG | GYF domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: GYF (InterPro:IPR003169); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24300.1); Has 5230 Blast hits to 3533 proteins in 314 species: Archae - 2; Bacteria - 506; Metazoa - 2065; Fungi - 608; Plants - 278; Viruses - 13; Other Eukaryotes - 1758 (source: NCBI BLink).  |
AT5G44568 | AT5G44568.1 | AAAGTCAAAGCGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; Has 11 Blast hits to 11 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G46170 | AT5G46170.1 | ACACGCGCTT | F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: heat acclimation; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT4G18380.1); Has 87 Blast hits to 86 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 87; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G48657 | AT5G48657.1 | AAGCGCGTCGTT | defense protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G07195.1); Has 49 Blast hits to 47 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  |
AT5G48657.2 | AAGCGCGTCGTT | defense protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G07195.1); Has 49 Blast hits to 47 proteins in 10 species: Archae - 0; Bacteria - 2; Metazoa - 6; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink).  | |
AT5G50440 | AT5G50440.1 | AAGCGCGT | member of Membrin Gene Family  |
AT5G51790 | AT5G51790.1 | AAGCGCGT | basix helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: DNA binding / transcription factor (TAIR:AT4G25410.1); Has 157 Blast hits to 156 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 156; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  |
AT5G52200 | AT5G52200.1 | TTCACGCGCTT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 509 Blast hits to 471 proteins in 137 species: Archae - 0; Bacteria - 0; Metazoa - 232; Fungi - 109; Plants - 74; Viruses - 6; Other Eukaryotes - 88 (source: NCBI BLink).  |
AT5G52430 | AT5G52430.1 | AAGCGCGTGT | hydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: hydroxyproline-rich glycoprotein family protein (TAIR:AT4G25620.1); Has 849 Blast hits to 464 proteins in 107 species: Archae - 2; Bacteria - 43; Metazoa - 236; Fungi - 114; Plants - 84; Viruses - 9; Other Eukaryotes - 361 (source: NCBI BLink).  |
AT5G53570 | AT5G53570.1 | AAGCGCGTGT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1).  |
AT5G53570.1 | CACGCGCTT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1).  | |
AT5G53570.2 | AAGCGCGTGT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1).  | |
AT5G53570.2 | CACGCGCTT | RabGAP/TBC domain-containing protein; FUNCTIONS IN: RAB GTPase activator activity; INVOLVED IN: regulation of Rab GTPase activity; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RabGAP/TBC (InterPro:IPR000195); BEST Arabidopsis thaliana protein match is: RAB GTPase activator (TAIR:AT3G49350.1).  | |
AT5G62130 | AT5G62130.1 | TCACGCGCTT | Per1-like protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Per1-like (InterPro:IPR007217); BEST Arabidopsis thaliana protein match is: Per1-like family protein (TAIR:AT1G16560.3); Has 243 Blast hits to 235 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 102; Fungi - 97; Plants - 42; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  |
AT5G64120 | AT5G64120.1 | CACGCGCTT | encodes a cell wall bound peroxidase that is induced by hypo-osmolarity  |
AT5G67110 | AT5G67110.1 | CACGCGCTT | encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce.  |
AT5G67110.2 | CACGCGCTT | encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce.  | |
AT5G67110.3 | CACGCGCTT | encodes a myc/bHLH transcription factor-like protein. Gene product is involved in fruit dehiscence. Mutant siliques fail to dehisce.  | |
AT5G67250 | AT5G67250.1 | AAGCGCGTG | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes.  |
AT5G67300 | AT5G67300.1 | CACGCGCTT | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli.  |
AT5G67370 | AT5G67370.1 | AAGCGCGT | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1230 (InterPro:IPR009631); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11840.1); Has 264 Blast hits to 264 proteins in 69 species: Archae - 0; Bacteria - 98; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  |