version

Summary of AtREG516 (All List)

OrganismArabidopsis thaliana  
IDAtREG516  
SequenceAACCCGGT  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count153  

Entry Sequences (153 entries)

LocusGene modelSequenceDescription
AT1G06010AT1G06010.1AACCCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G06220AT1G06220.1AACCCGGTTTACEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. 
AT1G06220.2AACCCGGTTTACEncodes a protein with similarity to splicing factor Snu114. Snu114 is thought to be involved in activation of the splicosome. Loss of GFA1 function results in reduced female fertility. Approximately 50% of ovules abort due to defects in the female gametophyte. In mutant gametophytes antipodal cells express egg cell markers suggesting a defect in specification of cell fate.GFA1 is also required to restrict the expression of LIS. 
AT1G06730AT1G06730.1AACCCGGTTCGGTpfkB-type carbohydrate kinase family protein; FUNCTIONS IN: kinase activity; INVOLVED IN: D-ribose catabolic process; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Carbohydrate/purine kinase (InterPro:IPR011611); BEST Arabidopsis thaliana protein match is: pfkB-type carbohydrate kinase family protein (TAIR:AT3G59480.1); Has 8525 Blast hits to 8520 proteins in 1199 species: Archae - 160; Bacteria - 6264; Metazoa - 85; Fungi - 26; Plants - 192; Viruses - 0; Other Eukaryotes - 1798 (source: NCBI BLink). 
AT1G08470AT1G08470.1ACCGGGTTstrictosidine synthase family protein; FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: strictosidine synthase family protein (TAIR:AT5G22020.1); Has 898 Blast hits to 891 proteins in 185 species: Archae - 1; Bacteria - 239; Metazoa - 198; Fungi - 13; Plants - 301; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). 
AT1G08480AT1G08480.1AACCCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion, plasma membrane, plastid, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G08840AT1G08840.1ACCGGGTTembryo defective 2411 (emb2411); FUNCTIONS IN: ATP-dependent DNA helicase activity, DNA binding, ATP binding; INVOLVED IN: embryonic development ending in seed dormancy, DNA replication; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA replication factor Dna2 (InterPro:IPR014808); BEST Arabidopsis thaliana protein match is: DNA-binding protein, putative (TAIR:AT2G03270.1); Has 4081 Blast hits to 3639 proteins in 571 species: Archae - 158; Bacteria - 979; Metazoa - 1088; Fungi - 747; Plants - 269; Viruses - 30; Other Eukaryotes - 810 (source: NCBI BLink). 
AT1G08845AT1G08845.1AACCCGGTstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: endomembrane system, ribosome, intracellular; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: structural constituent of ribosome (TAIR:AT3G22450.1). 
AT1G12440AT1G12440.1AACCCGGTTCAzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). 
AT1G12440.2AACCCGGTTCAzinc finger (AN1-like) family protein; FUNCTIONS IN: DNA binding, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Zinc finger, AN1-type (InterPro:IPR000058), Zinc finger, A20-type (InterPro:IPR002653); BEST Arabidopsis thaliana protein match is: zinc finger (AN1-like) family protein (TAIR:AT4G12040.2); Has 773 Blast hits to 766 proteins in 109 species: Archae - 0; Bacteria - 0; Metazoa - 388; Fungi - 2; Plants - 269; Viruses - 6; Other Eukaryotes - 108 (source: NCBI BLink). 
AT1G12620AT1G12620.1AACCCGGTTTTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: shoot apex, leaf whorl, flower, seed; EXPRESSED DURING: petal differentiation and expansion stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G12300.1); Has 27983 Blast hits to 6205 proteins in 194 species: Archae - 4; Bacteria - 17; Metazoa - 1072; Fungi - 778; Plants - 24632; Viruses - 0; Other Eukaryotes - 1480 (source: NCBI BLink). 
AT1G14130AT1G14130.1ACCGGGTT2-oxoglutarate-dependent dioxygenase, putative; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: 2-oxoglutarate-dependent dioxygenase, putative (TAIR:AT1G14120.1); Has 4610 Blast hits to 4563 proteins in 547 species: Archae - 0; Bacteria - 464; Metazoa - 97; Fungi - 366; Plants - 2925; Viruses - 0; Other Eukaryotes - 758 (source: NCBI BLink). 
AT1G15880AT1G15880.1AACCCGGTGolgi SNARE 11 protein (GOS11) 
AT1G16850AT1G16850.1AACCCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to salt stress; LOCATED IN: endomembrane system; EXPRESSED IN: leaf whorl, leaf apex, male gametophyte, flower, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, petal differentiation and expansion stage, LP.08 eight leaves visible; Has 9 Blast hits to 9 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G17360AT1G17360.1AACCCGGTTTACFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 8834 Blast hits to 6495 proteins in 406 species: Archae - 8; Bacteria - 626; Metazoa - 3389; Fungi - 793; Plants - 257; Viruses - 52; Other Eukaryotes - 3709 (source: NCBI BLink). 
AT1G22180AT1G22180.1AAAACCGGGTTSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G08690.2); Has 1880 Blast hits to 1880 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 814; Fungi - 399; Plants - 444; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT1G22180.2AAAACCGGGTTSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G08690.2); Has 1880 Blast hits to 1880 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 814; Fungi - 399; Plants - 444; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT1G22180.3AAAACCGGGTTSEC14 cytosolic factor family protein / phosphoglyceride transfer family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251), Cellular retinaldehyde-binding/triple function, N-terminal (InterPro:IPR008273), Phosphatidylinositol transfer protein-like, N-terminal (InterPro:IPR011074); BEST Arabidopsis thaliana protein match is: SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein (TAIR:AT4G08690.2); Has 1880 Blast hits to 1880 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 814; Fungi - 399; Plants - 444; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT1G26640AT1G26640.1AACCCGGTTTGaspartate/glutamate/uridylate kinase family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: amino acid biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aspartate/glutamate/uridylate kinase (InterPro:IPR001048); Has 393 Blast hits to 393 proteins in 151 species: Archae - 114; Bacteria - 162; Metazoa - 4; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). 
AT1G26650AT1G26650.1CAAACCGGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G69430.1); Has 108 Blast hits to 107 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 108; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G28281AT1G28281.1AAAACCGGGTTunknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). 
AT1G28281.1TTAACCGGGTTunknown protein; LOCATED IN: endomembrane system; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). 
AT1G33490AT1G33490.1AACCCGGTTCGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10140.1); Has 42 Blast hits to 42 proteins in 15 species: Archae - 0; Bacteria - 18; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G33500AT1G33500.1CCGAACCGGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell, embryo, flower; EXPRESSED DURING: petal differentiation and expansion stage, D bilateral stage; BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT3G22790.1); Has 3639 Blast hits to 2952 proteins in 364 species: Archae - 50; Bacteria - 374; Metazoa - 1667; Fungi - 244; Plants - 133; Viruses - 6; Other Eukaryotes - 1165 (source: NCBI BLink). 
AT1G49670AT1G49670.1AACCGGGTTmolecular function has not been defined. Was shown involved in oxidative stress tolerance. 
AT1G50500AT1G50500.1ATAAACCGGGTTencodes a member of VPS53 family protein involved in the retrograde trafficking of vesicles to the late Golgi. Mutants in this gene are more sensitive to heat and osmotic stress. 
AT1G54100AT1G54100.1AACCCGGTTTGAldehyde dehydrogenase 
AT1G54100.2AACCCGGTTTGAldehyde dehydrogenase 
AT1G56440AT1G56440.1AACCCGGTTserine/threonine protein phosphatase-related; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Tetratricopeptide TPR-1 (InterPro:IPR001440), Tetratricopeptide-like helical (InterPro:IPR011990), Tetratricopeptide region (InterPro:IPR013026); BEST Arabidopsis thaliana protein match is: atToc64-III (Arabidopsis thaliana translocon at the outer membrane of chloroplasts 64-III); binding / carbon-nitrogen ligase, with glutamine as amido-N-donor (TAIR:AT3G17970.1); Has 9463 Blast hits to 7185 proteins in 478 species: Archae - 219; Bacteria - 1810; Metazoa - 3127; Fungi - 835; Plants - 1006; Viruses - 0; Other Eukaryotes - 2466 (source: NCBI BLink). 
AT1G56450AT1G56450.1AACCGGGTT20S proteasome beta subunit PBG1 (PBG1) mRNA, complete cds 
AT1G61900AT1G61900.1AACCCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G61900.2AACCCGGTTTAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: anchored to plasma membrane, plasma membrane, anchored to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G30700.1); Has 30 Blast hits to 30 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G63520AT1G63520.1AGGGCCCAACCGGGTTCGAACCGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: inflorescence meristem, hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G11450.1); Has 63 Blast hits to 63 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 63; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G63690AT1G63690.1AACCCGGTprotease-associated (PA) domain-containing protein; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: aspartic-type endopeptidase/ peptidase (TAIR:AT1G01650.1); Has 1356 Blast hits to 1341 proteins in 210 species: Archae - 0; Bacteria - 123; Metazoa - 670; Fungi - 109; Plants - 251; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). 
AT1G63690.2AACCCGGTprotease-associated (PA) domain-containing protein; FUNCTIONS IN: peptidase activity, aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protease-associated PA (InterPro:IPR003137), Peptidase A22, presenilin signal peptide (InterPro:IPR006639), Peptidase A22B, signal peptide peptidase (InterPro:IPR007369); BEST Arabidopsis thaliana protein match is: aspartic-type endopeptidase/ peptidase (TAIR:AT1G01650.1); Has 1356 Blast hits to 1341 proteins in 210 species: Archae - 0; Bacteria - 123; Metazoa - 670; Fungi - 109; Plants - 251; Viruses - 0; Other Eukaryotes - 203 (source: NCBI BLink). 
AT1G70710AT1G70710.1AACCCGGTendo-1,4-beta-glucanase. Involved in cell elongation. 
AT1G75670AT1G75670.1CGAACCGGGTTATTGGGDNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT1G75670.2CGAACCGGGTTATTGGGDNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT2G06925AT2G06925.1AACCCGGTTAAGEncodes a secretory phospholipase A2 enzyme, which specifically hydrolyzes the sn-2 position of phospholipids. The enzyme has a preference towards linoleoyl acyl chain over palmitoyl acyl chain. It also has a slight preference for phosphatidylcholine over phosphatidylethanolamine. 
AT2G16640AT2G16640.1ACCGGGTTMULTIMERIC TRANSLOCON COMPLEX IN THE OUTER ENVELOPE MEMBRANE 132 (TOC132); FUNCTIONS IN: transmembrane receptor activity; INVOLVED IN: protein targeting to chloroplast; LOCATED IN: chloroplast outer membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chloroplast protein import component Toc86/159 (InterPro:IPR005690), AIG1 (InterPro:IPR006703); BEST Arabidopsis thaliana protein match is: ATTOC120; GTP binding (TAIR:AT3G16620.1); Has 6352 Blast hits to 4186 proteins in 415 species: Archae - 14; Bacteria - 449; Metazoa - 2396; Fungi - 635; Plants - 342; Viruses - 83; Other Eukaryotes - 2433 (source: NCBI BLink). 
AT2G17200AT2G17200.1CGAACCGGGTTubiquitin family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein modification process; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Heat shock chaperonin-binding (InterPro:IPR006636), Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (InterPro:IPR015940), Ubiquitin-associated/translation elongation factor EF1B, N-terminal (InterPro:IPR000449), Ubiquilin (InterPro:IPR015496), Ubiquitin (InterPro:IPR000626), UBA-like (InterPro:IPR009060); BEST Arabidopsis thaliana protein match is: ubiquitin family protein (TAIR:AT2G17190.1); Has 11842 Blast hits to 6071 proteins in 720 species: Archae - 6; Bacteria - 2895; Metazoa - 3957; Fungi - 1228; Plants - 1619; Viruses - 162; Other Eukaryotes - 1975 (source: NCBI BLink). 
AT2G17880AT2G17880.1AACCCGGTTCGDNAJ heat shock protein, putative; FUNCTIONS IN: heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein (J11) (TAIR:AT4G36040.1); Has 13518 Blast hits to 13518 proteins in 1859 species: Archae - 87; Bacteria - 4830; Metazoa - 2737; Fungi - 1089; Plants - 967; Viruses - 5; Other Eukaryotes - 3803 (source: NCBI BLink). 
AT2G22660AT2G22660.1AACCCGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1399 (InterPro:IPR009836); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G37900.1); Has 14843 Blast hits to 4550 proteins in 469 species: Archae - 40; Bacteria - 5555; Metazoa - 4422; Fungi - 897; Plants - 1977; Viruses - 191; Other Eukaryotes - 1761 (source: NCBI BLink). 
AT2G22660.2AACCCGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1399 (InterPro:IPR009836); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT4G37900.1); Has 14843 Blast hits to 4550 proteins in 469 species: Archae - 40; Bacteria - 5555; Metazoa - 4422; Fungi - 897; Plants - 1977; Viruses - 191; Other Eukaryotes - 1761 (source: NCBI BLink). 
AT2G22990AT2G22990.2AACCGGGTTsinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. 
AT2G22990.6AACCGGGTTsinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. 
AT2G25850AT2G25850.1ACCGGGTTnucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). 
AT2G25850.2ACCGGGTTnucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). 
AT2G25850.3ACCGGGTTnucleotidyltransferase family protein; FUNCTIONS IN: protein binding, nucleotidyltransferase activity; INVOLVED IN: RNA polyadenylation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Poly(A) polymerase (InterPro:IPR014492), Poly(A) polymerase, central region (InterPro:IPR007012), Nucleotidyltransferase, class I, C-terminal-like (InterPro:IPR011068), Nucleotidyltransferase (InterPro:IPR002934), Poly(A) polymerase, RNA-binding region (InterPro:IPR007010); BEST Arabidopsis thaliana protein match is: nPAP (NUCLEAR POLY(A) POLYMERASE); nucleotidyltransferase/ protein binding (TAIR:AT4G32850.10); Has 588 Blast hits to 588 proteins in 160 species: Archae - 0; Bacteria - 9; Metazoa - 233; Fungi - 135; Plants - 107; Viruses - 0; Other Eukaryotes - 104 (source: NCBI BLink). 
AT2G25870AT2G25870.1AACCCGGThaloacid dehalogenase-like hydrolase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cof protein (InterPro:IPR000150), HAD-superfamily hydrolase, subfamily IIB (InterPro:IPR006379), HAD superfamily hydrolase-like, type 3 (InterPro:IPR013200), Uncharacterised protein family UPF0054 (InterPro:IPR002036); Has 11617 Blast hits to 11603 proteins in 1525 species: Archae - 144; Bacteria - 9370; Metazoa - 28; Fungi - 12; Plants - 43; Viruses - 0; Other Eukaryotes - 2020 (source: NCBI BLink). 
AT2G26460AT2G26460.1AACCCGGTRED family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RED-like, N-terminal (InterPro:IPR012916), RED-like, C-terminal (InterPro:IPR012492); Has 352 Blast hits to 259 proteins in 108 species: Archae - 0; Bacteria - 2; Metazoa - 220; Fungi - 53; Plants - 31; Viruses - 3; Other Eukaryotes - 43 (source: NCBI BLink). 
AT2G30530AT2G30530.1AACCCGGTTTAAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G01970.1); Has 5828 Blast hits to 755 proteins in 128 species: Archae - 0; Bacteria - 29; Metazoa - 881; Fungi - 129; Plants - 81; Viruses - 12; Other Eukaryotes - 4696 (source: NCBI BLink). 
AT2G32235AT2G32235.1AACCCGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 27 Blast hits to 27 proteins in 11 species: Archae - 0; Bacteria - 4; Metazoa - 10; Fungi - 9; Plants - 3; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G32630AT2G32630.1CTAAACCGGGTTpentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: sperm cell; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 24903 Blast hits to 6117 proteins in 190 species: Archae - 4; Bacteria - 30; Metazoa - 789; Fungi - 688; Plants - 22202; Viruses - 0; Other Eukaryotes - 1190 (source: NCBI BLink). 
AT2G42120AT2G42120.1TTAACCGGGTTDNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). 
AT2G42120.2TTAACCGGGTTDNA POLYMERASE DELTA SMALL SUBUNIT (POLD2); FUNCTIONS IN: DNA binding, DNA-directed DNA polymerase activity; INVOLVED IN: DNA replication; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: DNA polymerase alpha/epsilon, subunit B (InterPro:IPR007185); Has 462 Blast hits to 457 proteins in 184 species: Archae - 74; Bacteria - 0; Metazoa - 131; Fungi - 95; Plants - 26; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). 
AT2G42130AT2G42130.1AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.2AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.3AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.4AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G42130.5AACCCGGTTAAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58010.1); Has 98 Blast hits to 98 proteins in 26 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 97; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G46560AT2G46560.1AACCCGGTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); Has 1588 Blast hits to 1099 proteins in 199 species: Archae - 0; Bacteria - 444; Metazoa - 395; Fungi - 420; Plants - 69; Viruses - 0; Other Eukaryotes - 260 (source: NCBI BLink). 
AT2G48100AT2G48100.1AACCCGGTTTTexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT2G48100.2AACCCGGTTTTexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT2G48100.3AACCCGGTTTTexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT2G48100.4AACCCGGTTTTexonuclease family protein; FUNCTIONS IN: exonuclease activity, zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Exonuclease (InterPro:IPR006055), Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Zinc finger, C2H2-type (InterPro:IPR007087), Exonuclease, RNase T and DNA polymerase III (InterPro:IPR013520); BEST Arabidopsis thaliana protein match is: exonuclease family protein (TAIR:AT5G40310.1); Has 1165 Blast hits to 1165 proteins in 166 species: Archae - 0; Bacteria - 10; Metazoa - 634; Fungi - 294; Plants - 142; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT3G03580AT3G03580.1TCGGTTTAAACCGGGTTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: DOT4 (DEFECTIVELY ORGANIZED TRIBUTARIES 4) (TAIR:AT4G18750.1); Has 19378 Blast hits to 5309 proteins in 162 species: Archae - 0; Bacteria - 2; Metazoa - 56; Fungi - 84; Plants - 18779; Viruses - 0; Other Eukaryotes - 457 (source: NCBI BLink). 
AT3G03810AT3G03810.1CTAAACCGGGTTembryo sac development arrest 30 (EDA30); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: N-terminal protein myristoylation, polar nucleus fusion, pollen tube development; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF246, plant (InterPro:IPR004348); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G30300.1); Has 433 Blast hits to 418 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 433; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03890AT3G03890.1CCAAACCGGGTTFMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). 
AT3G03890.2CCAAACCGGGTTFMN binding; FUNCTIONS IN: FMN binding; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: FMN-binding split barrel (InterPro:IPR012349), Pyridoxamine 5'-phosphate oxidase-related, FMN-binding core (InterPro:IPR011576), FMN-binding split barrel, related (InterPro:IPR009002), Haem iron utilisation protein, pyridoxamine 5'-phosphate region (InterPro:IPR014599); BEST Arabidopsis thaliana protein match is: FMN binding (TAIR:AT3G21140.1); Has 606 Blast hits to 606 proteins in 221 species: Archae - 0; Bacteria - 374; Metazoa - 11; Fungi - 0; Plants - 82; Viruses - 0; Other Eukaryotes - 139 (source: NCBI BLink). 
AT3G03920AT3G03920.1AACCCGGTGar1 RNA-binding region family protein; FUNCTIONS IN: RNA binding, rRNA binding; INVOLVED IN: rRNA processing; LOCATED IN: chloroplast thylakoid membrane, nucleolus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Gar1 protein RNA-binding region (InterPro:IPR007504); BEST Arabidopsis thaliana protein match is: Gar1 RNA-binding region family protein (TAIR:AT5G18180.1); Has 26246 Blast hits to 8264 proteins in 726 species: Archae - 15; Bacteria - 4613; Metazoa - 10704; Fungi - 2027; Plants - 5901; Viruses - 362; Other Eukaryotes - 2624 (source: NCBI BLink). 
AT3G04040AT3G04040.1ACCGGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18250.1); Has 32 Blast hits to 32 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G05630AT3G05630.1AACCCGGTEncodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. 
AT3G09210AT3G09210.1ATAAACCGGGTTPLASTID TRANSCRIPTIONALLY ACTIVE13 (PTAC13); FUNCTIONS IN: transcription elongation regulator activity; INVOLVED IN: positive regulation of RNA elongation from RNA polymerase II promoter; LOCATED IN: plastid chromosome, nucleoid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Transcription antitermination protein, NusG, N-terminal (InterPro:IPR006645), Translation protein SH3-like, subgroup (InterPro:IPR014722), KOW (InterPro:IPR005824); Has 2507 Blast hits to 2507 proteins in 692 species: Archae - 0; Bacteria - 1288; Metazoa - 0; Fungi - 2; Plants - 16; Viruses - 0; Other Eukaryotes - 1201 (source: NCBI BLink). 
AT3G11945AT3G11945.1TTAACCGGGTTEncodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. 
AT3G11945.2TTAACCGGGTTEncodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. 
AT3G13070AT3G13070.1CAAACCGGGTTCBS domain-containing protein / transporter associated domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF21 (InterPro:IPR002550), Transporter-associated region (InterPro:IPR005170), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: CBS domain-containing protein / transporter associated domain-containing protein (TAIR:AT1G55930.1); Has 10211 Blast hits to 10209 proteins in 1421 species: Archae - 94; Bacteria - 6198; Metazoa - 215; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 3506 (source: NCBI BLink). 
AT3G15580AT3G15580.1TGAACCGGGTTEncodes APG8, a component of autophagy conjugation pathway. Delivered to the lumens of vacuole under nitrogen-starvation condition. 
AT3G19640AT3G19640.1AACCCGGTTTGmagnesium transporter CorA-like family protein (MRS2-3); FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mg2+ transporter protein, CorA-like (InterPro:IPR002523); BEST Arabidopsis thaliana protein match is: magnesium transporter CorA-like family protein (MRS2-1) (TAIR:AT1G16010.2); Has 603 Blast hits to 521 proteins in 126 species: Archae - 0; Bacteria - 31; Metazoa - 102; Fungi - 198; Plants - 203; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT3G19770AT3G19770.1AAAACCGGGTTGuanine nucleotide exchange factor VPS9a. Can ctivate all Rab5 members to GTP-bound forms in vitro. Required for embryogenesis. Regulates the localization of ARA7 and ARA6. Involved in postembryonic root development. 
AT3G19770.2AAAACCGGGTTGuanine nucleotide exchange factor VPS9a. Can ctivate all Rab5 members to GTP-bound forms in vitro. Required for embryogenesis. Regulates the localization of ARA7 and ARA6. Involved in postembryonic root development. 
AT3G20870AT3G20870.1AACCCGGTTmetal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G08650.2); Has 2198 Blast hits to 2183 proteins in 642 species: Archae - 78; Bacteria - 1120; Metazoa - 489; Fungi - 73; Plants - 72; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). 
AT3G20870.1ACCGGGTTAAACCGACCCGAmetal transporter family protein; FUNCTIONS IN: metal ion transmembrane transporter activity; INVOLVED IN: metal ion transport; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc/iron permease (InterPro:IPR003689); BEST Arabidopsis thaliana protein match is: metal transporter family protein (TAIR:AT3G08650.2); Has 2198 Blast hits to 2183 proteins in 642 species: Archae - 78; Bacteria - 1120; Metazoa - 489; Fungi - 73; Plants - 72; Viruses - 0; Other Eukaryotes - 366 (source: NCBI BLink). 
AT3G22220AT3G22220.1AACCCGGThAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: DNA binding / protein dimerization (TAIR:AT4G15020.2); Has 496 Blast hits to 443 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 490; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G22220.2AACCCGGThAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity, DNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Zinc finger, BED-type predicted (InterPro:IPR003656), Protein of unknown function DUF659 (InterPro:IPR007021), Protein of unknown function DUF1544 (InterPro:IPR011523); BEST Arabidopsis thaliana protein match is: DNA binding / protein dimerization (TAIR:AT4G15020.2); Has 496 Blast hits to 443 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 490; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT3G22480AT3G22480.1AACCCGGTTCAAPREFOLDIN 2 (PDF2); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin beta-like (InterPro:IPR002777), Prefoldin (InterPro:IPR009053); Has 303 Blast hits to 303 proteins in 148 species: Archae - 11; Bacteria - 0; Metazoa - 113; Fungi - 80; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT3G22480.2AACCCGGTTCAAPREFOLDIN 2 (PDF2); FUNCTIONS IN: unfolded protein binding; INVOLVED IN: protein folding; LOCATED IN: prefoldin complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin beta-like (InterPro:IPR002777), Prefoldin (InterPro:IPR009053); Has 303 Blast hits to 303 proteins in 148 species: Archae - 11; Bacteria - 0; Metazoa - 113; Fungi - 80; Plants - 37; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT3G24150AT3G24150.1AACCCGGTTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G32295.1); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 0; Plants - 10; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G24160AT3G24160.1ATAACCGGGTTEncodes a putative Type 1 membrane protein (PMP). 
AT3G24200AT3G24200.1AAAACCGGGTTFAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). 
AT3G24200.2AAAACCGGGTTFAD binding / monooxygenase/ oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; FUNCTIONS IN: oxidoreductase activity, FAD binding, monooxygenase activity, oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen; INVOLVED IN: ubiquinone biosynthetic process, metabolic process; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 (InterPro:IPR010971), Aromatic-ring hydroxylase-like (InterPro:IPR003042), Monooxygenase, FAD-binding (InterPro:IPR002938), Ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6, conserved site (InterPro:IPR018168); Has 6357 Blast hits to 6353 proteins in 914 species: Archae - 2; Bacteria - 3648; Metazoa - 130; Fungi - 342; Plants - 48; Viruses - 0; Other Eukaryotes - 2187 (source: NCBI BLink). 
AT3G24315AT3G24315.1ATAACCGGGTTAtSec20; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Sec20 (InterPro:IPR005606); Has 205 Blast hits to 205 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 106; Fungi - 64; Plants - 27; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT3G27160AT3G27160.1TTAAACCGGGTTGHS1 encodes plastid ribosomal protein S21 
AT3G47610AT3G47610.1AACCCGGTtranscription regulator/ zinc ion binding; FUNCTIONS IN: transcription regulator activity, zinc ion binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2HC5-type (InterPro:IPR009349); Has 247 Blast hits to 233 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 104; Fungi - 80; Plants - 16; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT3G48750AT3G48750.1AACCCGGTATAA-type cyclin-dependent kinase. Together with its specific inhibitor, the Kip-related protein, KRP2 they regulate the mitosis-to-endocycle transition during leaf development. Dominant negative mutations abolish cell division. Loss of function phenotype has reduced fertility with failure to transmit via pollen. Pollen development is arrested at the second mitotic division. Expression is regulated by environmental and chemical signals. Part of the promoter is responsible for expression in trichomes. Functions as a positive regulator of cell proliferation during development of the male gametophyte, embryo and endosperm. Phosphorylation of threonine 161 is required for activation of its associated kinase. 
AT3G52400AT3G52400.1AACCCGGTTsyntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway 
AT3G56800AT3G56800.1AACCCGGTencodes a calmodulin 
AT3G57330AT3G57330.1GTAAACCGGGTTautoinhibited Ca2+-ATPase 11 (ACA11); FUNCTIONS IN: calmodulin binding, calcium-transporting ATPase activity; INVOLVED IN: cation transport, calcium ion transport, metabolic process, ATP biosynthetic process; LOCATED IN: chloroplast, plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, P-type, ATPase-associated region (InterPro:IPR008250), ATPase, P-type, calcium-transporting, PMCA-type (InterPro:IPR006408), ATPase, P-type, H+ transporting proton pump (InterPro:IPR000695), ATPase, P-type cation-transporter, N-terminal (InterPro:IPR004014), Haloacid dehalogenase-like hydrolase (InterPro:IPR005834), ATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter (InterPro:IPR001757), ATPase, P-type cation-transporter, C-terminal (InterPro:IPR006068), ATPase, P-type phosphorylation site (InterPro:IPR018303); BEST Arabidopsis thaliana protein match is: ACA4 (AUTO-INHIBITED CA(2+)-ATPASE, ISOFORM 4); calcium-transporting ATPase/ calmodulin binding (TAIR:AT2G41560.1); Has 25242 Blast hits to 19809 proteins in 1858 species: Archae - 502; Bacteria - 15238; Metazoa - 3407; Fungi - 1728; Plants - 1099; Viruses - 3; Other Eukaryotes - 3265 (source: NCBI BLink). 
AT3G58880AT3G58880.1ACCGGGTTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G59000.1); Has 1422 Blast hits to 1382 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 2; Fungi - 0; Plants - 1418; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G63150AT3G63150.1TCACGTGTCGGGTCAACCCGGTTEncodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response. 
AT4G01370AT4G01370.1AACCCGGTTTAAEncodes a nuclear and cytoplasmically localized MAP kinase involved in mediating responses to pathogens. Its substrates include MKS1. 
AT4G02890AT4G02890.1AACCCGGTTTTPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G02890.2AACCCGGTTTTPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G02890.3AACCCGGTTTTPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G02890.4AACCCGGTTTTPolyubiquitin gene containing 4 ubiquitin repeats. 
AT4G05410AT4G05410.1AACCCGGTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding, nucleic acid binding; INVOLVED IN: mitochondrial fission; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, anaphase-promoting complex, CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: EMB2271 (EMBRYO DEFECTIVE 2271); nucleotide binding (TAIR:AT4G21130.1); Has 36165 Blast hits to 19140 proteins in 585 species: Archae - 40; Bacteria - 4252; Metazoa - 16125; Fungi - 6813; Plants - 3147; Viruses - 96; Other Eukaryotes - 5692 (source: NCBI BLink). 
AT4G09680AT4G09680.1AACCCGGTCGGGTCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G09680.2AACCCGGTCGGGTCAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 20 Blast hits to 13 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G15545AT4G15545.1ACCGGGTTunknown protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G16520.1); Has 557 Blast hits to 539 proteins in 129 species: Archae - 0; Bacteria - 87; Metazoa - 242; Fungi - 51; Plants - 82; Viruses - 2; Other Eukaryotes - 93 (source: NCBI BLink). 
AT4G19400AT4G19400.1TTAAACCGGGTTactin binding; FUNCTIONS IN: actin binding; INVOLVED IN: cytoskeleton organization; LOCATED IN: actin cytoskeleton; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Profilin/allergen (InterPro:IPR002097); Has 17 Blast hits to 16 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G20840AT4G20840.1ACCGGGTTFAD-binding domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, FAD binding, catalytic activity; LOCATED IN: apoplast, plasma membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: FAD-binding, type 2 (InterPro:IPR016166), Berberine/berberine-like (InterPro:IPR012951), FAD linked oxidase, N-terminal (InterPro:IPR006094); BEST Arabidopsis thaliana protein match is: FAD-binding domain-containing protein (TAIR:AT4G20830.2); Has 2748 Blast hits to 2654 proteins in 455 species: Archae - 10; Bacteria - 1082; Metazoa - 3; Fungi - 1106; Plants - 397; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink). 
AT4G23930AT4G23930.1AACCCGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G23930.2AACCCGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Harpin-induced 1 (InterPro:IPR010847); BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT1G64450.1); Has 183 Blast hits to 177 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 183; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G24490AT4G24490.1AAAACCGGGTTprotein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). 
AT4G24490.1AACCCGGTTTACprotein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). 
AT4G24490.2AAAACCGGGTTprotein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). 
AT4G24490.2AACCCGGTTTACprotein prenyltransferase; FUNCTIONS IN: protein prenyltransferase activity; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein prenyltransferase (InterPro:IPR008940), Protein prenyltransferase, alpha subunit (InterPro:IPR002088); BEST Arabidopsis thaliana protein match is: geranylgeranyl transferase alpha subunit-related / RAB geranylgeranyltransferase alpha subunit-related (TAIR:AT5G41820.1); Has 2932 Blast hits to 2359 proteins in 263 species: Archae - 17; Bacteria - 285; Metazoa - 1694; Fungi - 296; Plants - 206; Viruses - 2; Other Eukaryotes - 432 (source: NCBI BLink). 
AT4G24500AT4G24500.1AACCCGGTTTThydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). 
AT4G24500.1GTAAACCGGGTThydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). 
AT4G24500.2AACCCGGTTTThydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). 
AT4G24500.2GTAAACCGGGTThydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; Has 285 Blast hits to 283 proteins in 80 species: Archae - 0; Bacteria - 10; Metazoa - 159; Fungi - 48; Plants - 40; Viruses - 3; Other Eukaryotes - 25 (source: NCBI BLink). 
AT4G25390AT4G25390.1AACCCGGTTCCGGTTTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink). 
AT4G25390.2AACCCGGTTCCGGTTTprotein kinase family protein; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G51770.1); Has 62019 Blast hits to 52421 proteins in 1538 species: Archae - 19; Bacteria - 4146; Metazoa - 22140; Fungi - 3414; Plants - 25096; Viruses - 163; Other Eukaryotes - 7041 (source: NCBI BLink). 
AT4G27000AT4G27000.1CTTAACCGGGTTATRBP45C; FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45A (RNA-binding protein 45A); RNA binding (TAIR:AT5G54900.1); Has 24066 Blast hits to 14859 proteins in 588 species: Archae - 10; Bacteria - 1237; Metazoa - 14401; Fungi - 2729; Plants - 3582; Viruses - 5; Other Eukaryotes - 2102 (source: NCBI BLink). 
AT4G27500AT4G27500.1ACCGGGTTinteracts with H+-ATPase, and regulates its activity 
AT4G33530AT4G33530.1AACCCGGTTTTpotassium transporter 
AT4G33540AT4G33540.1AAAACCGGGTTmetallo-beta-lactamase family protein; FUNCTIONS IN: hydrolase activity, catalytic activity; INVOLVED IN: response to arsenic, metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-lactamase-like (InterPro:IPR001279); Has 1070 Blast hits to 1070 proteins in 241 species: Archae - 64; Bacteria - 439; Metazoa - 27; Fungi - 6; Plants - 47; Viruses - 0; Other Eukaryotes - 487 (source: NCBI BLink). 
AT5G01510AT5G01510.1ATAAACCGAATTTAACCGGGTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF647 (InterPro:IPR006968); BEST Arabidopsis thaliana protein match is: RUS1 (ROOT UVB SENSITIVE 1) (TAIR:AT3G45890.1); Has 266 Blast hits to 266 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 95; Fungi - 39; Plants - 94; Viruses - 0; Other Eukaryotes - 36 (source: NCBI BLink). 
AT5G02870AT5G02870.1AACCCGGTTAA60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT5G02870.2AACCCGGTTAA60S ribosomal protein L4/L1 (RPL4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L4/L1e (InterPro:IPR002136), Ribosomal protein L4/L1e, eukaryotic/archaeal, conserved site (InterPro:IPR013000); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L4/L1 (RPL4A) (TAIR:AT3G09630.1); Has 859 Blast hits to 858 proteins in 292 species: Archae - 213; Bacteria - 8; Metazoa - 235; Fungi - 103; Plants - 78; Viruses - 0; Other Eukaryotes - 222 (source: NCBI BLink). 
AT5G03970AT5G03970.1AACCCGGTTCAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G03970.2AACCCGGTTCAAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G07610.1); Has 196 Blast hits to 196 proteins in 25 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 194; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G06760AT5G06760.1AAAACCGGGTTlate embryogenesis abundant group 1 domain-containing protein / LEA group 1 domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, embryonic development; LOCATED IN: cellular_component unknown; EXPRESSED IN: 8 plant structures; EXPRESSED DURING: dry seed stage, 4 anthesis, LP.04 four leaves visible, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Late embryogenesis abundant (LEA) group 1 (InterPro:IPR005513); Has 477 Blast hits to 328 proteins in 98 species: Archae - 0; Bacteria - 70; Metazoa - 102; Fungi - 37; Plants - 214; Viruses - 1; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G07890AT5G07890.1ACCGGGTTmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). 
AT5G07890.2ACCGGGTTmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). 
AT5G07890.3ACCGGGTTmyosin heavy chain-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G61200.1); Has 35432 Blast hits to 20384 proteins in 990 species: Archae - 403; Bacteria - 2576; Metazoa - 19466; Fungi - 2002; Plants - 1090; Viruses - 99; Other Eukaryotes - 9796 (source: NCBI BLink). 
AT5G07900AT5G07900.1AACCCGGTmitochondrial transcription termination factor family protein / mTERF family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor family protein / mTERF family protein (TAIR:AT1G21150.1); Has 434 Blast hits to 369 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 40; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G10330AT5G10330.1AACCGGGTTEncodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. 
AT5G10330.2AACCGGGTTEncodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. 
AT5G10330.3AACCGGGTTEncodes histidinol-phosphate aminotransferase that catalyzes the eighth step in histidine biosynthesis. Loss of function mutations are embryo lethal. 
AT5G15120AT5G15120.1AACCGGGTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1637 (InterPro:IPR012864); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G39890.1); Has 239 Blast hits to 239 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 84; Fungi - 0; Plants - 130; Viruses - 0; Other Eukaryotes - 25 (source: NCBI BLink). 
AT5G15920AT5G15920.1GTAAACCGGGTTstructural maintenance of chromosomes (SMC) family protein (MSS2); FUNCTIONS IN: ATP binding; INVOLVED IN: chromosome segregation; LOCATED IN: chromosome, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RecF/RecN/SMC protein, N-terminal (InterPro:IPR003395); BEST Arabidopsis thaliana protein match is: MIM (hypersensitive to MMS, irradiation and MMC); ATP binding (TAIR:AT5G61460.1); Has 53696 Blast hits to 28151 proteins in 1680 species: Archae - 715; Bacteria - 7485; Metazoa - 25639; Fungi - 3625; Plants - 1389; Viruses - 117; Other Eukaryotes - 14726 (source: NCBI BLink). 
AT5G16220AT5G16220.1AACCCGGTocticosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G16220.1ACCGGGTTocticosapeptide/Phox/Bem1p (PB1) domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Octicosapeptide/Phox/Bem1p (InterPro:IPR000270); BEST Arabidopsis thaliana protein match is: octicosapeptide/Phox/Bem1p (PB1) domain-containing protein (TAIR:AT2G01190.1); Has 247 Blast hits to 246 proteins in 31 species: Archae - 0; Bacteria - 0; Metazoa - 48; Fungi - 12; Plants - 175; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G16640AT5G16640.1AACCGGGTTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: F mature embryo stage, 4 leaf senescence stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62680.1); Has 27324 Blast hits to 6063 proteins in 188 species: Archae - 4; Bacteria - 18; Metazoa - 819; Fungi - 570; Plants - 24583; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink). 
AT5G18400AT5G18400.1AACCCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.2AACCCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G18400.3AACCCGGTTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF689 (InterPro:IPR007785); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G18362.1); Has 310 Blast hits to 309 proteins in 151 species: Archae - 0; Bacteria - 0; Metazoa - 121; Fungi - 101; Plants - 35; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G38660AT5G38660.1ACCGGGTTmutant has Altered acclimation responses; 
AT5G48030AT5G48030.1AACCCGGTencodes a mitochondrially targeted DNAJ protein involved in female gametophyte development. 
AT5G55940AT5G55940.1TGACCCGAACCCGGTTTAGembryo defective 2731 (emb2731); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0172 (InterPro:IPR005366); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G51620.3); Has 220 Blast hits to 219 proteins in 84 species: Archae - 0; Bacteria - 0; Metazoa - 140; Fungi - 10; Plants - 30; Viruses - 0; Other Eukaryotes - 40 (source: NCBI BLink). 
AT5G60860AT5G60860.1AACCCGGTArabidopsis Rab GTPase homolog A1f (AtRABA1f); FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1g (Arabidopsis Rab GTPase homolog A1g); GTP binding (TAIR:AT3G15060.1); Has 21819 Blast hits to 21779 proteins in 607 species: Archae - 23; Bacteria - 103; Metazoa - 12072; Fungi - 2821; Plants - 1861; Viruses - 19; Other Eukaryotes - 4920 (source: NCBI BLink). 
AT5G66760AT5G66760.1AACCCGGTTTAGOne of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.