version

Summary of AtREG572 (All List)

OrganismArabidopsis thaliana  
IDAtREG572  
SequenceAGATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count163  

Entry Sequences (163 entries)

LocusGene modelSequenceDescription
AT1G03630AT1G03630.1TTAAAGCCCATCTCAAGGCCCAATAAEncodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. 
AT1G03630.2TTAAAGCCCATCTCAAGGCCCAATAAEncodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. 
AT1G04290AT1G04290.1AGATGGGCthioesterase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, acyl-CoA thioesterase activity; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioesterase superfamily (InterPro:IPR006683), Phenylacetic acid degradation-related protein (InterPro:IPR003736); BEST Arabidopsis thaliana protein match is: thioesterase family protein (TAIR:AT2G29590.1); Has 654 Blast hits to 653 proteins in 190 species: Archae - 15; Bacteria - 172; Metazoa - 161; Fungi - 107; Plants - 138; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT1G06560AT1G06560.1AGATGGGCTTATNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink). 
AT1G06560.1ATGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink). 
AT1G06560.1CAAGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink). 
AT1G06560.1CAAGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink). 
AT1G06560.1CAAGGCCCATCTNOL1/NOP2/sun family protein; FUNCTIONS IN: RNA binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p (InterPro:IPR001678), PUA-like (InterPro:IPR015947), Bacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p, conserved site (InterPro:IPR018314), PUA (InterPro:IPR002478); BEST Arabidopsis thaliana protein match is: nucleolar protein, putative (TAIR:AT4G26600.1); Has 7921 Blast hits to 5034 proteins in 1248 species: Archae - 364; Bacteria - 5099; Metazoa - 733; Fungi - 277; Plants - 171; Viruses - 0; Other Eukaryotes - 1277 (source: NCBI BLink). 
AT1G07700AT1G07700.1CATGGGCCCATCTthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink). 
AT1G07700.2CATGGGCCCATCTthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink). 
AT1G07700.3CATGGGCCCATCTthioredoxin family protein; INVOLVED IN: cell redox homeostasis; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335), Thioredoxin, core (InterPro:IPR015467), Thioredoxin-like (InterPro:IPR017936), Thioredoxin domain (InterPro:IPR013766), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: ATTRX4; oxidoreductase, acting on sulfur group of donors, disulfide as acceptor (TAIR:AT1G19730.1); Has 1443 Blast hits to 1443 proteins in 284 species: Archae - 5; Bacteria - 129; Metazoa - 456; Fungi - 206; Plants - 380; Viruses - 3; Other Eukaryotes - 264 (source: NCBI BLink). 
AT1G19920AT1G19920.1AGGGCCCATCTencodes a chloroplast form of ATP sulfurylase 
AT1G24510AT1G24510.1AGATGGGCTTTAAT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink). 
AT1G24510.2AGATGGGCTTTAAT-complex protein 1 epsilon subunit, putative / TCP-1-epsilon, putative / chaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: protein folding, cellular protein metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, epsilon subunit (InterPro:IPR012718), Chaperonin Cpn60 (InterPro:IPR001844), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT3G18190.1); Has 13238 Blast hits to 13142 proteins in 2425 species: Archae - 394; Bacteria - 5650; Metazoa - 1832; Fungi - 993; Plants - 479; Viruses - 0; Other Eukaryotes - 3890 (source: NCBI BLink). 
AT1G24520AT1G24520.1TTAAAGCCCATCTMale fertility gene acting on tapetum and microspore 
AT1G24575AT1G24575.1GCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 5 Blast hits to 5 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G25280AT1G25280.2AGATGGGCTAAMember of TLP family 
AT1G25280.3AGATGGGCTAAMember of TLP family 
AT1G36990AT1G36990.1TTATGGGCCCATCTunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G08510.1); Has 4597 Blast hits to 1552 proteins in 255 species: Archae - 0; Bacteria - 986; Metazoa - 1160; Fungi - 777; Plants - 63; Viruses - 27; Other Eukaryotes - 1584 (source: NCBI BLink). 
AT1G52343AT1G52343.1AAAGCCCATCTunknown protein. 
AT1G55530AT1G55530.1AAAAGGCCCATCTzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT5G56340.1); Has 7739 Blast hits to 7642 proteins in 225 species: Archae - 0; Bacteria - 8; Metazoa - 2938; Fungi - 729; Plants - 2721; Viruses - 30; Other Eukaryotes - 1313 (source: NCBI BLink). 
AT1G69620AT1G69620.1AGATGGGCCTTTGGGCCAAputative 60S ribosomal protein L34 
AT1G69680AT1G69680.1AGATGGGCCTGGGCTTTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (InterPro:IPR016124), Ran-interacting Mog1 protein (InterPro:IPR007681), Mog1/PsbP, alpha/beta/alpha sandwich (InterPro:IPR016123); Has 202 Blast hits to 202 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 55; Fungi - 83; Plants - 25; Viruses - 0; Other Eukaryotes - 39 (source: NCBI BLink). 
AT1G69690AT1G69690.1TAAGCCCATCTTCP family transcription factor, putative; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor, TCP (InterPro:IPR005333), Transcription factor TCP subgroup (InterPro:IPR017887); BEST Arabidopsis thaliana protein match is: AtTCP14 (TEOSINTE BRANCHED1, CYCLOIDEA and PCF (TCP) 14); transcription factor (TAIR:AT3G47620.1); Has 658 Blast hits to 655 proteins in 114 species: Archae - 0; Bacteria - 6; Metazoa - 116; Fungi - 16; Plants - 496; Viruses - 0; Other Eukaryotes - 24 (source: NCBI BLink). 
AT1G69770AT1G69770.1AGATGGGCCTCAEncodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing. 
AT1G69920AT1G69920.1TGAGCCCATCTEncodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). 
AT1G70600AT1G70600.1GGGCCTAAAGGCCCATCTstructural constituent of ribosome; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: guard cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L15 (InterPro:IPR001196); BEST Arabidopsis thaliana protein match is: RPL27AB; structural constituent of ribosome (TAIR:AT1G23290.1); Has 825 Blast hits to 825 proteins in 317 species: Archae - 121; Bacteria - 11; Metazoa - 289; Fungi - 107; Plants - 96; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). 
AT1G70610AT1G70610.1AGATGGGCCTTTAGGCCCmember of TAP subfamily 
AT1G71860AT1G71860.1GCCCATCTEncodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. 
AT1G71860.1TGAGCCCATCTEncodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. 
AT1G71860.2GCCCATCTEncodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. 
AT1G71860.2TGAGCCCATCTEncodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. 
AT1G71860.3GCCCATCTEncodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. 
AT1G71860.3TGAGCCCATCTEncodes a protein with tyrosine phosphatase activity that is downregulated in response to cold and upregulated in response to salt stress. 
AT1G75180AT1G75180.1GCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G75180.2GCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G75180.3GCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G19400.2); Has 70 Blast hits to 70 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 70; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G79710AT1G79710.1CTAATGGGCCACAAAAAGCCCATCTintegral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196), Biopterin transport-related protein BT1 (InterPro:IPR004324); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT5G25050.1); Has 694 Blast hits to 685 proteins in 112 species: Archae - 4; Bacteria - 113; Metazoa - 0; Fungi - 0; Plants - 141; Viruses - 0; Other Eukaryotes - 436 (source: NCBI BLink). 
AT1G79870AT1G79870.1TTATGGGCCCAAAAATAGGCCCATCToxidoreductase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region (InterPro:IPR006139), D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (InterPro:IPR006140), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: oxidoreductase family protein (TAIR:AT1G12550.1); Has 19936 Blast hits to 19933 proteins in 1515 species: Archae - 283; Bacteria - 9447; Metazoa - 662; Fungi - 752; Plants - 323; Viruses - 5; Other Eukaryotes - 8464 (source: NCBI BLink). 
AT2G04690AT2G04690.1GCCCATCTcellular repressor of E1A-stimulated genes (CREG) family; FUNCTIONS IN: FMN binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 336 Blast hits to 336 proteins in 88 species: Archae - 0; Bacteria - 72; Metazoa - 145; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT2G04690.2GCCCATCTcellular repressor of E1A-stimulated genes (CREG) family; FUNCTIONS IN: FMN binding; INVOLVED IN: biological_process unknown; LOCATED IN: vacuole; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular repressor of E1A-stimulated genes (CREG) (InterPro:IPR014631), FMN-binding split barrel (InterPro:IPR012349), FMN-binding split barrel, related (InterPro:IPR009002); Has 336 Blast hits to 336 proteins in 88 species: Archae - 0; Bacteria - 72; Metazoa - 145; Fungi - 2; Plants - 50; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT2G16365AT2G16365.1AAAAGCCCATCTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G16365.2AAAAGCCCATCTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G16365.3AAAAGCCCATCTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G16365.4AAAAGCCCATCTF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT2G16300.1); Has 77 Blast hits to 74 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 73; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT2G18680AT2G18680.1AGATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G18690.1); Has 116 Blast hits to 114 proteins in 17 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 104; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G27100AT2G27100.1AGATGGGCCTCTIdentified as a leaf form mutant by Redei having serrated leaves. Further analysis of the single loss of function allele indicated pleiotropic effects extending to many aspects of shoot development such as taller meristems, alterations in phase transition, phyllotaxy and branching. Encodes a single zinc finger containing protein that is expressed in meristems and organ primordia. 
AT2G27530AT2G27530.1AGATGGGCTTTTTEncodes ribosomal protein L10aP. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. 
AT2G27530.2AGATGGGCTTTTTEncodes ribosomal protein L10aP. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. 
AT2G29300AT2G29300.1AGATGGGCTTCtropinone reductase, putative / tropine dehydrogenase, putative; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: NAD(P)-binding (InterPro:IPR016040), Glucose/ribitol dehydrogenase (InterPro:IPR002347), Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198); BEST Arabidopsis thaliana protein match is: tropinone reductase, putative / tropine dehydrogenase, putative (TAIR:AT2G29320.1); Has 77732 Blast hits to 77581 proteins in 2156 species: Archae - 464; Bacteria - 43191; Metazoa - 4073; Fungi - 3687; Plants - 1470; Viruses - 5; Other Eukaryotes - 24842 (source: NCBI BLink). 
AT2G29510AT2G29510.1ACTGGGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59020.1); Has 3816 Blast hits to 613 proteins in 107 species: Archae - 0; Bacteria - 39; Metazoa - 471; Fungi - 67; Plants - 91; Viruses - 10; Other Eukaryotes - 3138 (source: NCBI BLink). 
AT2G29510.1CTATTGGGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59020.1); Has 3816 Blast hits to 613 proteins in 107 species: Archae - 0; Bacteria - 39; Metazoa - 471; Fungi - 67; Plants - 91; Viruses - 10; Other Eukaryotes - 3138 (source: NCBI BLink). 
AT2G33040AT2G33040.1AGATGGGCCGAAATP synthase gamma chain, mitochondrial (ATPC); FUNCTIONS IN: hydrogen ion transporting ATP synthase activity, rotational mechanism, proton-transporting ATPase activity, rotational mechanism; INVOLVED IN: proton transport, ATP synthesis coupled proton transport; LOCATED IN: in 7 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F1 complex, gamma subunit (InterPro:IPR000131); BEST Arabidopsis thaliana protein match is: ATPC1; enzyme regulator (TAIR:AT4G04640.1); Has 6854 Blast hits to 6853 proteins in 1574 species: Archae - 5; Bacteria - 3135; Metazoa - 212; Fungi - 103; Plants - 101; Viruses - 0; Other Eukaryotes - 3298 (source: NCBI BLink). 
AT2G37030AT2G37030.1GCCCATCTauxin-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to auxin stimulus; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Auxin responsive SAUR protein (InterPro:IPR003676); BEST Arabidopsis thaliana protein match is: auxin-responsive family protein (TAIR:AT3G53250.1); Has 569 Blast hits to 566 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 568; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT2G37230AT2G37230.1CTAGGCCCATCTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G02060.1); Has 17936 Blast hits to 5762 proteins in 186 species: Archae - 4; Bacteria - 20; Metazoa - 375; Fungi - 355; Plants - 16510; Viruses - 0; Other Eukaryotes - 672 (source: NCBI BLink). 
AT2G37640AT2G37640.1AGATGGGCmember of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. 
AT2G41670AT2G41670.1GAAGCCCATCTTAAGCCCAAATGTP-binding family protein; FUNCTIONS IN: GTP binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: GTP binding (TAIR:AT4G10650.1); Has 2332 Blast hits to 2332 proteins in 753 species: Archae - 70; Bacteria - 1127; Metazoa - 335; Fungi - 275; Plants - 106; Viruses - 0; Other Eukaryotes - 419 (source: NCBI BLink). 
AT2G43350AT2G43350.1AGATGGGCTTTAAGlutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. 
AT2G46180AT2G46180.1TAAAGGCCCATCTThis gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein. 
AT3G01340AT3G01340.1ATGGCCCATCTprotein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink). 
AT3G01340.2ATGGCCCATCTprotein transport protein SEC13 family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: intracellular protein transport, membrane budding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT2G30050.1); Has 16199 Blast hits to 10279 proteins in 408 species: Archae - 22; Bacteria - 3034; Metazoa - 6785; Fungi - 3044; Plants - 1251; Viruses - 0; Other Eukaryotes - 2063 (source: NCBI BLink). 
AT3G01345AT3G01345.1AGATGGGCCATExpressed protein; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: membrane; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G28919.1); Has 12 Blast hits to 12 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G01410AT3G01410.1GAAGCCCATCTRNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). 
AT3G01410.2GAAGCCCATCTRNase H domain-containing protein; FUNCTIONS IN: ribonuclease H activity, nuclease activity, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337), Ribonuclease H (InterPro:IPR002156); BEST Arabidopsis thaliana protein match is: RNase H domain-containing protein (TAIR:AT1G24090.1); Has 2378 Blast hits to 2378 proteins in 271 species: Archae - 46; Bacteria - 450; Metazoa - 12; Fungi - 0; Plants - 1407; Viruses - 0; Other Eukaryotes - 463 (source: NCBI BLink). 
AT3G02220AT3G02220.1AGATGGGCTTTTAunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 159 Blast hits to 159 proteins in 72 species: Archae - 1; Bacteria - 2; Metazoa - 93; Fungi - 4; Plants - 25; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT3G03130AT3G03130.1ATAGGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17160.1); Has 6511 Blast hits to 3260 proteins in 393 species: Archae - 10; Bacteria - 2333; Metazoa - 1613; Fungi - 601; Plants - 171; Viruses - 56; Other Eukaryotes - 1727 (source: NCBI BLink). 
AT3G03341AT3G03341.1TTAAGGCCCATCTunknown protein; Has 48 Blast hits to 48 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 10; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G05590AT3G05590.1CAAGGCCCATCTEncodes cytoplasmic ribosomal protein L18. 
AT3G05730AT3G05730.1AGATGGGCCTTTAAAGGCEncodes a defensin-like (DEFL) family protein. 
AT3G06500AT3G06500.1CCGGCCCATCTbeta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative; FUNCTIONS IN: catalytic activity, beta-fructofuranosidase activity; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plant neutral invertase (InterPro:IPR006937), Six-hairpin glycosidase-like (InterPro:IPR008928); BEST Arabidopsis thaliana protein match is: beta-fructofuranosidase, putative / invertase, putative / saccharase, putative / beta-fructosidase, putative (TAIR:AT1G56560.1); Has 513 Blast hits to 512 proteins in 77 species: Archae - 0; Bacteria - 104; Metazoa - 0; Fungi - 0; Plants - 173; Viruses - 0; Other Eukaryotes - 236 (source: NCBI BLink). 
AT3G06540AT3G06540.1AGATGGGCCATGTTGGGCCGATGDP dissociation inhibitor family protein / Rab GTPase activator family protein; FUNCTIONS IN: RAB GDP-dissociation inhibitor activity; INVOLVED IN: intracellular protein transport, regulation of GTPase activity, protein transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rab GTPase activator (InterPro:IPR002005), Rab protein geranylgeranyltransferase component A, eukaryota (InterPro:IPR016664), Yeast Mrs6p protein (InterPro:IPR000632), GDP dissociation inhibitor (InterPro:IPR018203); BEST Arabidopsis thaliana protein match is: ATGDI1 (ARABIDOPSIS THALIANA GUANOSINE NUCLEOTIDE DIPHOSPHATE DISSOCIATION INHIBITOR 1); RAB GDP-dissociation inhibitor (TAIR:AT2G44100.2); Has 948 Blast hits to 858 proteins in 184 species: Archae - 0; Bacteria - 2; Metazoa - 512; Fungi - 195; Plants - 103; Viruses - 0; Other Eukaryotes - 136 (source: NCBI BLink). 
AT3G06790AT3G06790.1AATAGCCCATCTplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06790.2AATAGCCCATCTplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G07110AT3G07110.1AGATGGGCCTGA60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). 
AT3G07110.2AGATGGGCCTGA60S ribosomal protein L13A (RPL13aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, nucleolus, large ribosomal subunit, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L13 (InterPro:IPR005822), Ribosomal protein L13, eukaryotic/archaeal (InterPro:IPR005755); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L13A (RPL13aD) (TAIR:AT5G48760.2); Has 1890 Blast hits to 1890 proteins in 584 species: Archae - 212; Bacteria - 573; Metazoa - 292; Fungi - 125; Plants - 164; Viruses - 0; Other Eukaryotes - 524 (source: NCBI BLink). 
AT3G07150AT3G07150.1ACAGGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G07480AT3G07480.1GAAGCCCATCTelectron carrier/ iron-sulfur cluster binding; FUNCTIONS IN: electron carrier activity, iron-sulfur cluster binding; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ferredoxin (InterPro:IPR001041), Beta-grasp fold, ferredoxin-type (InterPro:IPR012675); Has 1153 Blast hits to 1153 proteins in 168 species: Archae - 0; Bacteria - 236; Metazoa - 115; Fungi - 5; Plants - 23; Viruses - 0; Other Eukaryotes - 774 (source: NCBI BLink). 
AT3G07568AT3G07568.1AAAGGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 6 Blast hits to 6 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 6; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G11010AT3G11010.1AGATGGGCReceptor Like Protein 34 (AtRLP34); FUNCTIONS IN: protein binding, kinase activity; INVOLVED IN: signal transduction, defense response; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210); BEST Arabidopsis thaliana protein match is: AtRLP53 (Receptor Like Protein 53); kinase/ protein binding (TAIR:AT5G27060.1); Has 91497 Blast hits to 22730 proteins in 876 species: Archae - 60; Bacteria - 6628; Metazoa - 30049; Fungi - 1113; Plants - 46480; Viruses - 34; Other Eukaryotes - 7133 (source: NCBI BLink). 
AT3G14172AT3G14172.1TTGGCCCATCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: COP1-interacting protein-related (TAIR:AT1G72410.1); Has 2665 Blast hits to 1956 proteins in 215 species: Archae - 2; Bacteria - 189; Metazoa - 878; Fungi - 141; Plants - 132; Viruses - 5; Other Eukaryotes - 1318 (source: NCBI BLink). 
AT3G14180AT3G14180.1AGATGGGCTTTTtranscription factor; FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: ASIL1 (ARABIDOPSIS 6B-INTERACTING PROTEIN 1-LIKE 1); sequence-specific DNA binding / transcription factor (TAIR:AT1G54060.1); Has 259 Blast hits to 224 proteins in 23 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 4; Plants - 220; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT3G14330AT3G14330.1AGATGGGCpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 13083 Blast hits to 5154 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 59; Fungi - 57; Plants - 12750; Viruses - 0; Other Eukaryotes - 217 (source: NCBI BLink). 
AT3G14400AT3G14400.1AGATGGGCCTAAAAAGCCCAGTAEncodes a ubiquitin-specific protease. 
AT3G15260AT3G15260.1AACGGCCCATCTprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink). 
AT3G15260.2AACGGCCCATCTprotein phosphatase 2C, putative / PP2C, putative; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT4G28400.1); Has 4540 Blast hits to 4534 proteins in 402 species: Archae - 3; Bacteria - 375; Metazoa - 1354; Fungi - 535; Plants - 1305; Viruses - 11; Other Eukaryotes - 957 (source: NCBI BLink). 
AT3G15352AT3G15352.1AGATGGGCEncodes protein similar to yeast COX17, a copper-binding protein that mediates the delivery of Cu to the mitochondria for the assembly of a functional cytochrome oxidase complex. 
AT3G16190AT3G16190.1AGATGGGCCGTisochorismatase hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Isochorismatase hydrolase (InterPro:IPR000868); Has 3706 Blast hits to 3703 proteins in 851 species: Archae - 95; Bacteria - 2998; Metazoa - 0; Fungi - 127; Plants - 43; Viruses - 0; Other Eukaryotes - 443 (source: NCBI BLink). 
AT3G17470AT3G17470.1AGATGGGCRelA/SpoT domain-containing protein / calcium-binding EF-hand family protein; FUNCTIONS IN: GTP diphosphokinase activity, calcium ion binding; INVOLVED IN: guanosine tetraphosphate metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248), RelA/SpoT (InterPro:IPR007685); BEST Arabidopsis thaliana protein match is: RSH3 (RELA/SPOT HOMOLOG 3); GTP diphosphokinase (TAIR:AT1G54130.1); Has 9156 Blast hits to 9111 proteins in 1936 species: Archae - 2; Bacteria - 3932; Metazoa - 1073; Fungi - 862; Plants - 449; Viruses - 0; Other Eukaryotes - 2838 (source: NCBI BLink). 
AT3G17668AT3G17668.1AGATGGGCCTTAGGCCCENHANCER OF ATNSI ACTIVITY (ENA); FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Heat shock protein DnaJ, cysteine-rich region (InterPro:IPR001305); Has 103 Blast hits to 95 proteins in 30 species: Archae - 2; Bacteria - 13; Metazoa - 34; Fungi - 2; Plants - 26; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT3G18210AT3G18210.1AGATGGGCTAoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink). 
AT3G18210.2AGATGGGCTAoxidoreductase, 2OG-Fe(II) oxygenase family protein; FUNCTIONS IN: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors, oxidoreductase activity, iron ion binding; INVOLVED IN: protein metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prolyl 4-hydroxylase, alpha subunit (InterPro:IPR006620), 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: iron ion binding / oxidoreductase/ oxidoreductase, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (TAIR:AT1G22950.1); Has 311 Blast hits to 310 proteins in 60 species: Archae - 0; Bacteria - 16; Metazoa - 224; Fungi - 0; Plants - 36; Viruses - 3; Other Eukaryotes - 32 (source: NCBI BLink). 
AT3G18215AT3G18215.1TAGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF599 (InterPro:IPR006747); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G24600.1); Has 180 Blast hits to 180 proteins in 49 species: Archae - 0; Bacteria - 72; Metazoa - 0; Fungi - 0; Plants - 96; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT3G19590AT3G19590.1AACGGCCCATCTWD-40 repeat family protein / mitotic checkpoint protein, putative; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein / mitotic checkpoint protein, putative (TAIR:AT1G49910.1); Has 5445 Blast hits to 4008 proteins in 309 species: Archae - 14; Bacteria - 1198; Metazoa - 1895; Fungi - 1134; Plants - 290; Viruses - 0; Other Eukaryotes - 914 (source: NCBI BLink). 
AT3G20470AT3G20470.1AGATGGGCencodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers. 
AT3G23390AT3G23390.1AGATGGGCCCATTG60S ribosomal protein L36a/L44 (RPL36aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aB) (TAIR:AT4G14320.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT3G45030AT3G45030.1GCCCATCT40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT3G46310AT3G46310.1TTTAGGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G46300.1); Has 19 Blast hits to 19 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G49800AT3G49800.1AGATGGGCBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G49800.1AGATGGGCTABSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT5G65910.1); Has 131 Blast hits to 121 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 15; Fungi - 1; Plants - 111; Viruses - 2; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G50360AT3G50360.1ATTAGGCCCATCTCENTRIN2 (ATCEN2); FUNCTIONS IN: calcium ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: caltractin, putative / centrin, putative (TAIR:AT4G37010.2); Has 25773 Blast hits to 16030 proteins in 1342 species: Archae - 0; Bacteria - 125; Metazoa - 11739; Fungi - 5407; Plants - 4427; Viruses - 2; Other Eukaryotes - 4073 (source: NCBI BLink). 
AT3G56020AT3G56020.1AGATGGGCCTTAAAGGCCCAATAT60S ribosomal protein L41 (RPL41G); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G56030AT3G56030.1ATATTGGGCCTTTAAGGCCCATCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT2G40240.1); Has 6707 Blast hits to 2251 proteins in 74 species: Archae - 0; Bacteria - 0; Metazoa - 57; Fungi - 13; Plants - 6562; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT3G59280AT3G59280.1AGATGGGCCTGAmutant exhibited resistance to growth on media containing thaxtomin due to a difference in the rate of uptake of the toxin.We proposed that TXR1 is a component of, or regulator of, a dispensable transport mechanism. 
AT3G60250AT3G60250.1GTGGCCCATCTRegulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis 
AT3G60250.2GTGGCCCATCTRegulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis 
AT3G61790AT3G61790.1TTAGGCCCATCTseven in absentia (SINA) family protein; FUNCTIONS IN: ubiquitin-protein ligase activity, protein binding, zinc ion binding; INVOLVED IN: multicellular organismal development, ubiquitin-dependent protein catabolic process, protein ubiquitination; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type, conserved site (InterPro:IPR017907), TRAF-like (InterPro:IPR008974), Seven in absentia protein, TRAF-like domain (InterPro:IPR018121), Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, SIAH-type (InterPro:IPR013010), Seven In Absentia Homolog-type (InterPro:IPR013323), Seven in absentia protein (InterPro:IPR004162), TRAF-type (InterPro:IPR013322); BEST Arabidopsis thaliana protein match is: seven in absentia (SINA) family protein (TAIR:AT4G27880.1); Has 1422 Blast hits to 1414 proteins in 637 species: Archae - 0; Bacteria - 0; Metazoa - 1099; Fungi - 9; Plants - 250; Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink). 
AT4G00530AT4G00530.1AGATGGGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; Has 9 Blast hits to 9 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 9; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G00860AT4G00860.1AGATGGGCCAATputative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. 
AT4G01150AT4G01150.1AGATGGGCCTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G01150.1AGATGGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G01150.2AGATGGGCCTAAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G01150.2AGATGGGCTTTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G01560AT4G01560.1AGATGGGCCCAAGmaternal effect embryo arrest 49 (MEE49); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Brix domain (InterPro:IPR007109); BEST Arabidopsis thaliana protein match is: IMP4 (TAIR:AT1G63780.1); Has 636 Blast hits to 628 proteins in 164 species: Archae - 2; Bacteria - 0; Metazoa - 218; Fungi - 225; Plants - 59; Viruses - 0; Other Eukaryotes - 132 (source: NCBI BLink). 
AT4G01570AT4G01570.1CTTGGGCCCATCTpentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT1G62910.1); Has 25223 Blast hits to 5430 proteins in 165 species: Archae - 8; Bacteria - 10; Metazoa - 231; Fungi - 283; Plants - 23698; Viruses - 0; Other Eukaryotes - 993 (source: NCBI BLink). 
AT4G13395AT4G13395.1AGATGGGCROTUNDIFOLIA LIKE 12 (RTFL12); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: shoot development; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: DVL (InterPro:IPR012552); BEST Arabidopsis thaliana protein match is: ROT4 (ROTUNDIFOLIA4) (TAIR:AT2G36985.1); Has 77 Blast hits to 77 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 77; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G13520AT4G13520.1AGATGGGCCACEncodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid. 
AT4G14320AT4G14320.1AGATGGGCCTGA60S ribosomal protein L36a/L44 (RPL36aB); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aA) (TAIR:AT3G23390.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT4G14330AT4G14330.1TCAGGCCCATCTphragmoplast-associated kinesin-related protein 2 (PAKRP2); FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: phragmoplast; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: ATK1 (ARABIDOPSIS THALIANA KINESIN 1); microtubule motor/ minus-end-directed microtubule motor (TAIR:AT4G21270.1); Has 19997 Blast hits to 14982 proteins in 632 species: Archae - 102; Bacteria - 784; Metazoa - 9932; Fungi - 1679; Plants - 1066; Viruses - 71; Other Eukaryotes - 6363 (source: NCBI BLink). 
AT4G15415AT4G15415.1GCCCATCTB' regulatory subunit of PP2A (AtB'gamma) 
AT4G15415.2GCCCATCTB' regulatory subunit of PP2A (AtB'gamma) 
AT4G22910AT4G22910.1TTTAGGCCCATCTFIZZY-RELATED 2 (FZR2); FUNCTIONS IN: signal transducer activity; INVOLVED IN: trichome branching, signal transduction, DNA endoreduplication, cell growth; LOCATED IN: chloroplast, heterotrimeric G-protein complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: CCS52A2; signal transducer (TAIR:AT4G11920.1); Has 32185 Blast hits to 17091 proteins in 521 species: Archae - 40; Bacteria - 4571; Metazoa - 14163; Fungi - 6386; Plants - 2781; Viruses - 0; Other Eukaryotes - 4244 (source: NCBI BLink). 
AT4G24210AT4G24210.1AGATGGGCTTGGGCTTTTTF-box protein that is involved in GA signaling. Regulates seed germination. Component of E3 ubiquitin complex. Interacts with DELLA proteins. 
AT4G25050AT4G25050.1AGATGGGCCCGTTencodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. 
AT4G25110AT4G25110.1ATGGCCCATCTGGGCCCTmetacaspase 2 (AtMC2); FUNCTIONS IN: cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600), Zinc finger, LSD1-type (InterPro:IPR005735); BEST Arabidopsis thaliana protein match is: AMC1 (METACASPASE 1); cysteine-type endopeptidase (TAIR:AT1G02170.1); Has 7004 Blast hits to 3377 proteins in 428 species: Archae - 6; Bacteria - 590; Metazoa - 997; Fungi - 825; Plants - 2862; Viruses - 584; Other Eukaryotes - 1140 (source: NCBI BLink). 
AT4G25110.2ATGGCCCATCTGGGCCCTmetacaspase 2 (AtMC2); FUNCTIONS IN: cysteine-type endopeptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase C14, caspase catalytic (InterPro:IPR011600), Zinc finger, LSD1-type (InterPro:IPR005735); BEST Arabidopsis thaliana protein match is: AMC1 (METACASPASE 1); cysteine-type endopeptidase (TAIR:AT1G02170.1); Has 7004 Blast hits to 3377 proteins in 428 species: Archae - 6; Bacteria - 590; Metazoa - 997; Fungi - 825; Plants - 2862; Viruses - 584; Other Eukaryotes - 1140 (source: NCBI BLink). 
AT4G25810AT4G25810.1GCCCATCTxyloglucan endotransglycosylase-related protein (XTR6) 
AT4G30993AT4G30993.1AGATGGGCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 17 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G30993.2AGATGGGCTTGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 17 Blast hits to 16 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G32470AT4G32470.1AGATGGGCCACTTAAGGCCCAAATubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G32470.2AGATGGGCCACTTAAGGCCCAAATubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, plasma membrane, plastid, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT5G25450.1); Has 264 Blast hits to 264 proteins in 88 species: Archae - 0; Bacteria - 0; Metazoa - 167; Fungi - 41; Plants - 51; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G34090AT4G34090.1CTAAGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G34090.2CTAAGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G23370.1); Has 40 Blast hits to 38 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT4G34100AT4G34100.1AGATGGGCTTAGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). 
AT4G34100.2AGATGGGCTTAGprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 1572 Blast hits to 1390 proteins in 165 species: Archae - 0; Bacteria - 0; Metazoa - 796; Fungi - 185; Plants - 291; Viruses - 39; Other Eukaryotes - 261 (source: NCBI BLink). 
AT4G34620AT4G34620.1TGGCCCAACATGGCCCATCTEncodes ribosomal protein S16, has embryo-defective lethal mutant phenotype 
AT4G35730AT4G35730.1CAAAGCCCATCTAAGCCCATTATunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF292, eukaryotic (InterPro:IPR005061); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G34220.2); Has 510 Blast hits to 497 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 187; Fungi - 123; Plants - 153; Viruses - 0; Other Eukaryotes - 47 (source: NCBI BLink). 
AT4G35750AT4G35750.1GCCCATCTRho-GTPase-activating protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cellular retinaldehyde-binding/triple function, C-terminal (InterPro:IPR001251); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G10210.1); Has 313 Blast hits to 313 proteins in 57 species: Archae - 0; Bacteria - 0; Metazoa - 237; Fungi - 0; Plants - 68; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT4G38210AT4G38210.1AGATGGGCCTGGexpansin -like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. 
AT5G01350AT5G01350.1AGATGGGCCTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 22 Blast hits to 22 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G01881AT5G01881.1AAAAGCCCATCTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 1 Blast hits to 1 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G10060AT5G10060.1AAAGCCCATCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF618 (InterPro:IPR006903), Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), ENTH/VHS (InterPro:IPR008942); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G65180.1); Has 4531 Blast hits to 4161 proteins in 412 species: Archae - 14; Bacteria - 404; Metazoa - 1999; Fungi - 666; Plants - 262; Viruses - 36; Other Eukaryotes - 1150 (source: NCBI BLink). 
AT5G15550AT5G15550.1CCGGCCCATCTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink). 
AT5G15550.2CCGGCCCATCTtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleolus, CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), NLE (InterPro:IPR012972), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT4G02730.1); Has 24919 Blast hits to 14751 proteins in 514 species: Archae - 36; Bacteria - 3358; Metazoa - 10677; Fungi - 5278; Plants - 2324; Viruses - 0; Other Eukaryotes - 3246 (source: NCBI BLink). 
AT5G15800AT5G15800.1AGATGGGCTAEncodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. 
AT5G15800.2AGATGGGCTAEncodes a MADS box transcription factor involved flower and ovule development. Functionally redundant with SEP2 and SEP3. 
AT5G20500AT5G20500.1AGATGGGCCGGGTTAAACCGTglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT1G77370.1); Has 4164 Blast hits to 4161 proteins in 811 species: Archae - 10; Bacteria - 1751; Metazoa - 378; Fungi - 232; Plants - 403; Viruses - 108; Other Eukaryotes - 1282 (source: NCBI BLink). 
AT5G20520AT5G20520.1AGATGGGCTTTAEncodes a Bem46-like protein. WAV2 negatively regulates root bending when roots alter their growth direction. It's not involved in sensing environmental stimuli (e.g. gravity, light, water, touch). 
AT5G23420AT5G23420.1TAAAGCCCATCTEncodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. 
AT5G46800AT5G46800.1ACGGCCCATCTSeedling lethal mutation; Mitochondrial Carnitine Acyl Carrier-Like Protein 
AT5G48580AT5G48580.1AGATGGGCTTTTAimmunophilin (FKBP15-2) 
AT5G53580AT5G53580.1GCCCATCTaldo/keto reductase family protein; FUNCTIONS IN: oxidoreductase activity, aldo-keto reductase activity; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395), Aldo/keto reductase, conserved site (InterPro:IPR018170); BEST Arabidopsis thaliana protein match is: aldo/keto reductase family protein (TAIR:AT1G06690.1); Has 17681 Blast hits to 17668 proteins in 1454 species: Archae - 262; Bacteria - 9536; Metazoa - 1802; Fungi - 1372; Plants - 771; Viruses - 0; Other Eukaryotes - 3938 (source: NCBI BLink). 
AT5G55510AT5G55510.1GCCCATCTP-P-bond-hydrolysis-driven protein transmembrane transporter/ protein transporter; FUNCTIONS IN: protein transporter activity, P-P-bond-hydrolysis-driven protein transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrial inner membrane presequence translocase complex, chloroplast envelope; CONTAINS InterPro DOMAIN/s: Mitochondrial import inner membrane translocase, subunit Tim17/22 (InterPro:IPR003397); BEST Arabidopsis thaliana protein match is: mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein (TAIR:AT4G26670.1); Has 385 Blast hits to 385 proteins in 93 species: Archae - 0; Bacteria - 0; Metazoa - 152; Fungi - 135; Plants - 78; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT5G57030AT5G57030.1TACGGCCCATCTLutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase 
AT5G57290AT5G57290.1TCAGGCCCATCT60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G57290.2TCAGGCCCATCT60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G57290.3TCAGGCCCATCT60S acidic ribosomal protein P3 (RPP3B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation; LOCATED IN: cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P3 (RPP3A) (TAIR:AT4G25890.1); Has 940 Blast hits to 920 proteins in 179 species: Archae - 2; Bacteria - 26; Metazoa - 415; Fungi - 134; Plants - 243; Viruses - 4; Other Eukaryotes - 116 (source: NCBI BLink). 
AT5G60030AT5G60030.1TTTTGGGCTTTGTTGGCCCATCTunknown protein; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G75335.1); Has 210106 Blast hits to 83883 proteins in 2248 species: Archae - 772; Bacteria - 18533; Metazoa - 91346; Fungi - 18704; Plants - 7840; Viruses - 1079; Other Eukaryotes - 71832 (source: NCBI BLink). 
AT5G61865AT5G61865.1AGATGGGCCGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; Has 51 Blast hits to 51 proteins in 26 species: Archae - 3; Bacteria - 6; Metazoa - 23; Fungi - 3; Plants - 4; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G65910AT5G65910.1AGATGGGCCTTAGBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT3G49800.1); Has 402 Blast hits to 370 proteins in 82 species: Archae - 0; Bacteria - 12; Metazoa - 122; Fungi - 40; Plants - 133; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). 
AT5G66280AT5G66280.1TTAAAGCCCATCTTGGCCCAATAGGDP-D-mannose 4,6-dehydratase 
AT5G66930AT5G66930.1AGATGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). 
AT5G66930.2AGATGGGCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1649 (InterPro:IPR012445). 
AT5G67510AT5G67510.1CAAAGCCCATCT60S ribosomal protein L26 (RPL26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26A) (TAIR:AT3G49910.1); Has 893 Blast hits to 893 proteins in 319 species: Archae - 233; Bacteria - 15; Metazoa - 308; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.