version

Summary of AtREG609 (All List)

OrganismArabidopsis thaliana  
IDAtREG609  
SequenceTCAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE MotifTGGGCY  "Site II element" found in the promoter regions of cytochrome genes (Cytc-1, Cytc-2) in Arabidopsis; Located between -147 and -156 from the translational starts sites (Welchen et al., 2005); Y=C/T; See also S000308; Overrepresented in the promoters of nuclear genes encoding components of the oxidative phosphorylation (OxPhos) machinery from both Arabidopsis and rice (Welchen and Gonzalez, 2006);)  
Total Entry Count161  

Entry Sequences (161 entries)

LocusGene modelSequenceDescription
AT1G07210AT1G07210.1TCAGCCCATTAT30S ribosomal protein S18 family; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S18 (InterPro:IPR001648); Has 3606 Blast hits to 3606 proteins in 1189 species: Archae - 0; Bacteria - 2426; Metazoa - 33; Fungi - 15; Plants - 158; Viruses - 0; Other Eukaryotes - 974 (source: NCBI BLink). 
AT1G07650AT1G07650.1GAATGGGCTGAleucine-rich repeat transmembrane protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, kinase activity, ATP binding; INVOLVED IN: transmembrane receptor protein tyrosine kinase signaling pathway, protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Leucine-rich repeat (InterPro:IPR001611), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719), Leucine-rich repeat, typical subtype (InterPro:IPR003591); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / protein kinase family protein (TAIR:AT1G53430.1); Has 130529 Blast hits to 99787 proteins in 3434 species: Archae - 76; Bacteria - 9490; Metazoa - 46107; Fungi - 7763; Plants - 48132; Viruses - 454; Other Eukaryotes - 18507 (source: NCBI BLink). 
AT1G08640AT1G08640.1AGTTGGGCTGAunknown protein; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 54 Blast hits to 54 proteins in 19 species: Archae - 0; Bacteria - 17; Metazoa - 0; Fungi - 0; Plants - 29; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT1G08680AT1G08680.1TCAGCCCAAAAGCCCACA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15. 
AT1G08680.2TCAGCCCAAAAGCCCACA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15. 
AT1G08680.3TCAGCCCAAAAGCCCACA member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15. 
AT1G09520AT1G09520.1TCAGCCCACTAprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, PHD-type (InterPro:IPR001965); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT3G17460.1); Has 29 Blast hits to 29 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 23; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G09590AT1G09590.1TCAGCCCAAAT60S ribosomal protein L21 (RPL21A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, nucleolus, chloroplast; EXPRESSED IN: guard cell, juvenile leaf; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L21e (InterPro:IPR001147), Ribosomal protein L21e, conserved site (InterPro:IPR018259); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L21 (RPL21C) (TAIR:AT1G09690.1); Has 1146 Blast hits to 1146 proteins in 281 species: Archae - 143; Bacteria - 0; Metazoa - 615; Fungi - 122; Plants - 82; Viruses - 0; Other Eukaryotes - 184 (source: NCBI BLink). 
AT1G13180AT1G13180.1TCAGCCCAGTAMutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype. 
AT1G16870AT1G16870.1TCAGCCCACTmitochondrial 28S ribosomal protein S29-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 184 Blast hits to 183 proteins in 89 species: Archae - 0; Bacteria - 0; Metazoa - 92; Fungi - 30; Plants - 19; Viruses - 0; Other Eukaryotes - 43 (source: NCBI BLink). 
AT1G18080AT1G18080.1ATATGGGCTGAEncodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene. 
AT1G18485AT1G18485.1ATTTGGGCTGApentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G57430.1); Has 16634 Blast hits to 4852 proteins in 154 species: Archae - 0; Bacteria - 2; Metazoa - 40; Fungi - 40; Plants - 16325; Viruses - 0; Other Eukaryotes - 227 (source: NCBI BLink). 
AT1G23710AT1G23710.1TCAGCCCATCACGCGCTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1645 (InterPro:IPR012442); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70420.1); Has 203 Blast hits to 197 proteins in 42 species: Archae - 0; Bacteria - 4; Metazoa - 16; Fungi - 9; Plants - 112; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT1G26630AT1G26630.1GTTTGGGCTGGGCTGAEukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection. 
AT1G26630.2GTTTGGGCTGGGCTGAEukaryotic translation initiation factor 5A-2. Involved in programmed cell death triggered as a response to pseudomonas syringae infection. Loss of function mutants are more resistant to infection. 
AT1G27435AT1G27435.1TAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 8 Blast hits to 8 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G27450AT1G27450.1TTATGGGCTGAAdenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP. 
AT1G27450.2TTATGGGCTGAAdenosine phosphoribosyl transferase(E.C:2.4.2.7), involved in the one-step salvage of adenine to AMP. 
AT1G28060AT1G28060.1AAATGGGCTTCAGCCCATAAsmall nuclear ribonucleoprotein family protein / snRNP family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA-splicing factor 3 (InterPro:IPR013881); BEST Arabidopsis thaliana protein match is: RNA splicing factor-related (TAIR:AT3G55930.1); Has 21413 Blast hits to 11192 proteins in 554 species: Archae - 18; Bacteria - 874; Metazoa - 11490; Fungi - 2755; Plants - 1540; Viruses - 94; Other Eukaryotes - 4642 (source: NCBI BLink). 
AT1G29070AT1G29070.1TTATGGGCTGAribosomal protein L34 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34 (InterPro:IPR000271); Has 389 Blast hits to 389 proteins in 164 species: Archae - 0; Bacteria - 342; Metazoa - 0; Fungi - 9; Plants - 23; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT1G31220AT1G31220.1TCAGCCCATTAAGN10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide 
AT1G31660AT1G31660.1AGTTGGGCCTAATGGGCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Bystin (InterPro:IPR007955); Has 370 Blast hits to 362 proteins in 156 species: Archae - 0; Bacteria - 7; Metazoa - 139; Fungi - 93; Plants - 32; Viruses - 0; Other Eukaryotes - 99 (source: NCBI BLink). 
AT1G33120AT1G33120.1TAGTGGGCTGA60S ribosomal protein L9 (RPL90B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: fruit, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein L6 (InterPro:IPR000702), Ribosomal protein L6, conserved site-2 (InterPro:IPR002359); BEST Arabidopsis thaliana protein match is: PGY2 (PIGGYBACK2); structural constituent of ribosome (TAIR:AT1G33140.1); Has 1242 Blast hits to 1241 proteins in 345 species: Archae - 226; Bacteria - 118; Metazoa - 305; Fungi - 113; Plants - 279; Viruses - 0; Other Eukaryotes - 201 (source: NCBI BLink). 
AT1G34570AT1G34570.1AGTGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15750.1); Has 88 Blast hits to 88 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 44; Fungi - 7; Plants - 32; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT1G35580AT1G35580.1TCAGCCCAEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G35580.2TCAGCCCAEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G35580.3TCAGCCCAEncodes a protein with cytosolic (alkaline/neutral) invertase activity. The protein was shown to interact with PIP5K9. 
AT1G50120AT1G50120.1TGTTGGGCTCATGTTGGGCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rgp1 (InterPro:IPR014848), Immunoglobulin E-set (InterPro:IPR014756); Has 110 Blast hits to 108 proteins in 46 species: Archae - 0; Bacteria - 0; Metazoa - 76; Fungi - 10; Plants - 20; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT1G75560AT1G75560.1TCAGCCCAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). 
AT1G75560.2TCAGCCCAzinc knuckle (CCHC-type) family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, CCHC-type (InterPro:IPR001878), Zinc finger, CCHC retroviral-type (InterPro:IPR013084); BEST Arabidopsis thaliana protein match is: CSDP1 (cold shock domain protein 1); RNA binding / double-stranded DNA binding / nucleic acid binding / single-stranded DNA binding (TAIR:AT4G36020.1); Has 10551 Blast hits to 6586 proteins in 284 species: Archae - 0; Bacteria - 4; Metazoa - 1615; Fungi - 963; Plants - 500; Viruses - 6839; Other Eukaryotes - 630 (source: NCBI BLink). 
AT1G79550AT1G79550.1TCAGCCCACTAEncodes cytosolic phosphoglycerate kinase (PGK). 
AT1G79550.2TCAGCCCACTAEncodes cytosolic phosphoglycerate kinase (PGK). 
AT1G79560AT1G79560.1TAGTGGGCTGAencodes an FtsH protease that is localized to the chloroplast 
AT1G79610AT1G79610.1TCAGCCCAAAAsodium proton exchanger, putative (NHX6); FUNCTIONS IN: solute:hydrogen antiporter activity, sodium:hydrogen antiporter activity; INVOLVED IN: cation transport, sodium ion transport, regulation of pH; LOCATED IN: integral to membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Na+/H+ exchanger, subfamily (InterPro:IPR004709), Cation/H+ exchanger, conserved region (InterPro:IPR018422), Na+/H+ exchanger, isoform 5/6/8, conserved region (InterPro:IPR018409), Cation/H+ exchanger (InterPro:IPR006153), Na+/H+ exchanger, conserved region (InterPro:IPR018406); BEST Arabidopsis thaliana protein match is: NHX5; sodium ion transmembrane transporter/ sodium:hydrogen antiporter (TAIR:AT1G54370.1); Has 4010 Blast hits to 4005 proteins in 1041 species: Archae - 71; Bacteria - 2418; Metazoa - 735; Fungi - 95; Plants - 280; Viruses - 0; Other Eukaryotes - 411 (source: NCBI BLink). 
AT1G80080AT1G80080.1AAATGGGCTCAGCCCAAATEncodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. 
AT1G80580AT1G80580.1TGGGCTGAencodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. 
AT2G18740AT2G18740.1TTATGGGCTGAsmall nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink). 
AT2G18740.2TTATGGGCTGAsmall nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: small nuclear ribonucleoprotein E, putative / snRNP-E, putative / Sm protein E, putative (TAIR:AT4G30330.1); Has 513 Blast hits to 513 proteins in 151 species: Archae - 78; Bacteria - 0; Metazoa - 173; Fungi - 106; Plants - 69; Viruses - 0; Other Eukaryotes - 87 (source: NCBI BLink). 
AT2G20580AT2G20580.1TAATGGGCTGAencoding the RPN subunits of the 26S proteasome 
AT2G21590AT2G21590.1ATATGGGCTGAEncodes the large subunit of ADP-glucose pyrophosphorylase, the enzyme which catalyzes the first and limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described. 
AT2G21590.2ATATGGGCTGAEncodes the large subunit of ADP-glucose pyrophosphorylase, the enzyme which catalyzes the first and limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described. 
AT2G24395AT2G24395.1TCAGCCCACTAchaperone protein dnaJ-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 17 Blast hits to 17 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT2G26450AT2G26450.1TCAGCCCApectinesterase family protein; FUNCTIONS IN: enzyme inhibitor activity, pectinesterase activity; INVOLVED IN: cell wall modification; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pectinesterase, active site (InterPro:IPR018040), Pectin lyase fold/virulence factor (InterPro:IPR011050), Pectinesterase, catalytic (InterPro:IPR000070), Pectinesterase inhibitor (InterPro:IPR006501), Pectin lyase fold (InterPro:IPR012334); BEST Arabidopsis thaliana protein match is: pectinesterase family protein (TAIR:AT4G33230.1); Has 1480 Blast hits to 1433 proteins in 226 species: Archae - 0; Bacteria - 312; Metazoa - 5; Fungi - 138; Plants - 1022; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G31610AT2G31610.1CATTGGGCTGA40S ribosomal protein S3 (RPS3A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: response to salt stress, translation, response to abiotic stimulus; LOCATED IN: in 6 components; EXPRESSED IN: root, cultured cell, leaf; CONTAINS InterPro DOMAIN/s: K Homology, prokaryotic type (InterPro:IPR009019), K Homology, type 2 (InterPro:IPR004044), K Homology (InterPro:IPR004087), Ribosomal protein S3, C-terminal (InterPro:IPR001351), Ribosomal protein S3, conserved site (InterPro:IPR018280), Ribosomal protein S3, eukaryotic/archaeal (InterPro:IPR005703); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S3 (RPS3B) (TAIR:AT3G53870.1); Has 3946 Blast hits to 3943 proteins in 1195 species: Archae - 174; Bacteria - 1992; Metazoa - 298; Fungi - 94; Plants - 101; Viruses - 0; Other Eukaryotes - 1287 (source: NCBI BLink). 
AT2G32430AT2G32430.1TCAGCCCAgalactosyltransferase family protein; FUNCTIONS IN: transferase activity, transferring hexosyl groups, transferase activity, transferring glycosyl groups; INVOLVED IN: protein amino acid glycosylation; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, family 31 (InterPro:IPR002659); BEST Arabidopsis thaliana protein match is: galactosyltransferase family protein (TAIR:AT1G05170.2); Has 1014 Blast hits to 1008 proteins in 75 species: Archae - 0; Bacteria - 0; Metazoa - 686; Fungi - 0; Plants - 313; Viruses - 0; Other Eukaryotes - 15 (source: NCBI BLink). 
AT2G32600AT2G32600.1TGATGGGCTGATATTGGGCCTTAAhydroxyproline-rich glycoprotein family protein; FUNCTIONS IN: zinc ion binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, intracellular, spliceosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, C2H2-like (InterPro:IPR015880), Zinc finger, U1-type (InterPro:IPR003604), Zinc finger, C2H2-type matrin (InterPro:IPR000690); Has 17385 Blast hits to 7765 proteins in 482 species: Archae - 26; Bacteria - 1475; Metazoa - 7274; Fungi - 1847; Plants - 3510; Viruses - 897; Other Eukaryotes - 2356 (source: NCBI BLink). 
AT2G39390AT2G39390.1TCAGCCCATTAG60S ribosomal protein L35 (RPL35B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29 (InterPro:IPR001854), Ribosomal protein L29, conserved site (InterPro:IPR018254); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L35 (RPL35D) (TAIR:AT5G02610.1); Has 796 Blast hits to 796 proteins in 298 species: Archae - 108; Bacteria - 128; Metazoa - 237; Fungi - 93; Plants - 90; Viruses - 0; Other Eukaryotes - 140 (source: NCBI BLink). 
AT2G41780AT2G41780.1TAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G41780.2TAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; Has 4 Blast hits to 4 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 4; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G43770AT2G43770.1TCAGCCCAAAAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 76665 Blast hits to 29470 proteins in 693 species: Archae - 72; Bacteria - 7530; Metazoa - 35994; Fungi - 14726; Plants - 7106; Viruses - 6; Other Eukaryotes - 11231 (source: NCBI BLink). 
AT2G45710AT2G45710.1TCAGCCCAAAA40S ribosomal protein S27 (RPS27A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, nucleolus, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein S27e (InterPro:IPR000592); BEST Arabidopsis thaliana protein match is: ARS27A (ARABIDOPSIS RIBOSOMAL PROTEIN S27); structural constituent of ribosome (TAIR:AT3G61110.1); Has 690 Blast hits to 690 proteins in 269 species: Archae - 76; Bacteria - 0; Metazoa - 297; Fungi - 98; Plants - 99; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). 
AT2G47170AT2G47170.1TAAATGGGCCGAATTGGGCTGAGene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. 
AT2G47860AT2G47860.1TGGGCTGAphototropic-responsive NPH3 family protein; FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ fold (InterPro:IPR011333); BEST Arabidopsis thaliana protein match is: phototropic-responsive NPH3 family protein (TAIR:AT1G03010.1); Has 432 Blast hits to 418 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 432; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G47860.2TGGGCTGAphototropic-responsive NPH3 family protein; FUNCTIONS IN: protein binding, signal transducer activity; INVOLVED IN: response to light stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: hypocotyl, flower, root; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: NPH3 (InterPro:IPR004249), BTB/POZ fold (InterPro:IPR011333); BEST Arabidopsis thaliana protein match is: phototropic-responsive NPH3 family protein (TAIR:AT1G03010.1); Has 432 Blast hits to 418 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 432; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G02080AT3G02080.1TGGGCTGA40S ribosomal protein S19 (RPS19A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, ribosome, cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S19e, conserved site (InterPro:IPR018277), Ribosomal protein S19e (InterPro:IPR001266); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S19 (RPS19B) (TAIR:AT5G15520.1); Has 881 Blast hits to 881 proteins in 287 species: Archae - 134; Bacteria - 4; Metazoa - 345; Fungi - 96; Plants - 125; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink). 
AT3G02090AT3G02090.1TCAGCCCAMPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT3G02090.2TCAGCCCAMPPBETA; FUNCTIONS IN: metalloendopeptidase activity, zinc ion binding, catalytic activity, metal ion binding; INVOLVED IN: proteolysis; LOCATED IN: in 11 components; EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M16, zinc-binding site (InterPro:IPR001431), Peptidase M16, C-terminal (InterPro:IPR007863), Peptidase M16, N-terminal (InterPro:IPR011765), Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (InterPro:IPR011249), Peptidase M16, core (InterPro:IPR011237); BEST Arabidopsis thaliana protein match is: mitochondrial processing peptidase alpha subunit, putative (TAIR:AT1G51980.1); Has 8457 Blast hits to 8139 proteins in 1315 species: Archae - 16; Bacteria - 4766; Metazoa - 826; Fungi - 501; Plants - 201; Viruses - 3; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT3G02530AT3G02530.1TCAGCCCAchaperonin, putative; FUNCTIONS IN: unfolded protein binding, protein binding, ATP binding; INVOLVED IN: response to cadmium ion; LOCATED IN: membrane, cytoplasm; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Chaperonin Cpn60/TCP-1 (InterPro:IPR002423), Chaperone, tailless complex polypeptide 1 (InterPro:IPR017998), T-complex protein 1, zeta subunit (InterPro:IPR012722), Chaperonin TCP-1, conserved site (InterPro:IPR002194); BEST Arabidopsis thaliana protein match is: chaperonin, putative (TAIR:AT5G16070.1); Has 13554 Blast hits to 13062 proteins in 2289 species: Archae - 391; Bacteria - 5634; Metazoa - 1855; Fungi - 975; Plants - 487; Viruses - 0; Other Eukaryotes - 4212 (source: NCBI BLink). 
AT3G03150AT3G03150.1AAATGGGCTTAAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17165.1); Has 24 Blast hits to 24 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G03160AT3G03160.1TCAGCCCATTTAAGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G17190.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G04500AT3G04500.1CTATTGGGCCTCAGCCCAATAARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), RNA recognition motif-related (InterPro:IPR015464); BEST Arabidopsis thaliana protein match is: UBP1B (oligouridylate binding protein 1B); mRNA 3'-UTR binding (TAIR:AT1G17370.2); Has 10169 Blast hits to 8298 proteins in 506 species: Archae - 0; Bacteria - 623; Metazoa - 5880; Fungi - 1176; Plants - 1670; Viruses - 0; Other Eukaryotes - 820 (source: NCBI BLink). 
AT3G05020AT3G05020.1AAATGGGCTGAencodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. 
AT3G06310AT3G06310.1TGAGCCCAATATCAGCCCANADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G06310.2TGAGCCCAATATCAGCCCANADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein; FUNCTIONS IN: NADH dehydrogenase (ubiquinone) activity; INVOLVED IN: mitochondrial electron transport, NADH to ubiquinone; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: CHCH (InterPro:IPR010625); BEST Arabidopsis thaliana protein match is: NADH-ubiquinone oxidoreductase 19 kDa subunit (NDUFA8) family protein (TAIR:AT5G18800.2); Has 234 Blast hits to 234 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 72; Plants - 35; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G06320AT3G06320.1TGGGCTGATATTGGGCTCAribosomal protein L33 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular, large ribosomal subunit; CONTAINS InterPro DOMAIN/s: Ribosomal protein L33 (InterPro:IPR001705); BEST Arabidopsis thaliana protein match is: ribosomal protein L33 family protein (TAIR:AT5G18790.1); Has 1784 Blast hits to 1784 proteins in 750 species: Archae - 0; Bacteria - 1568; Metazoa - 22; Fungi - 13; Plants - 30; Viruses - 0; Other Eukaryotes - 151 (source: NCBI BLink). 
AT3G09030AT3G09030.1GTTTGGGCTGApotassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT5G41330.1); Has 1331 Blast hits to 1319 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 1177; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). 
AT3G12150AT3G12150.1TCAGCCCAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 276 Blast hits to 200 proteins in 88 species: Archae - 0; Bacteria - 59; Metazoa - 189; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT3G13700AT3G13700.1TCAGCCCATAARNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G13700.2TCAGCCCATAARNA-binding protein, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: nucleic acid binding / nucleotide binding (TAIR:AT2G42240.3); Has 539 Blast hits to 520 proteins in 125 species: Archae - 2; Bacteria - 0; Metazoa - 265; Fungi - 138; Plants - 101; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G14150AT3G14150.1TAAAGCCCATGGGCTGA(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). 
AT3G14150.1TTTTGGGCTGA(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). 
AT3G14150.2TAAAGCCCATGGGCTGA(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). 
AT3G14150.2TTTTGGGCTGA(S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative; FUNCTIONS IN: glycolate oxidase activity, electron carrier activity, oxidoreductase activity, FMN binding, catalytic activity; INVOLVED IN: metabolic process; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), FMN-dependent alpha-hydroxy acid dehydrogenase (InterPro:IPR017934), FMN-dependent alpha-hydroxy acid dehydrogenase, active site (InterPro:IPR008259), FMN-dependent dehydrogenase (InterPro:IPR000262), Alpha-hydroxy acid dehydrogenase, FMN-dependent (InterPro:IPR012133); BEST Arabidopsis thaliana protein match is: (S)-2-hydroxy-acid oxidase, peroxisomal, putative / glycolate oxidase, putative / short chain alpha-hydroxy acid oxidase, putative (TAIR:AT3G14130.1); Has 10273 Blast hits to 10261 proteins in 1264 species: Archae - 169; Bacteria - 3686; Metazoa - 393; Fungi - 514; Plants - 209; Viruses - 0; Other Eukaryotes - 5302 (source: NCBI BLink). 
AT3G14160AT3G14160.1TCAGCCCAAAAoxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G14140.1); Has 756 Blast hits to 755 proteins in 353 species: Archae - 0; Bacteria - 523; Metazoa - 76; Fungi - 30; Plants - 41; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). 
AT3G14160.1TCAGCCCATGGGCTTTAoxidoreductase; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: 2OG-Fe(II) oxygenase (InterPro:IPR005123); BEST Arabidopsis thaliana protein match is: oxidoreductase, 2OG-Fe(II) oxygenase family protein (TAIR:AT3G14140.1); Has 756 Blast hits to 755 proteins in 353 species: Archae - 0; Bacteria - 523; Metazoa - 76; Fungi - 30; Plants - 41; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). 
AT3G18520AT3G18520.1TCAGCCCAAATEncodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. 
AT3G18520.2TCAGCCCAAATEncodes a protein with similarity to histone deacetylases. Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. 
AT3G18880AT3G18880.1AATTGGGCTGAribosomal protein S17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome, intracellular; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: emb1129 (embryo defective 1129); structural constituent of ribosome (TAIR:AT1G49400.1); Has 4907 Blast hits to 4907 proteins in 1461 species: Archae - 81; Bacteria - 2923; Metazoa - 31; Fungi - 32; Plants - 65; Viruses - 0; Other Eukaryotes - 1775 (source: NCBI BLink). 
AT3G19340AT3G19340.1CATTGGGCTGALOCATED IN: plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: aminopeptidase (TAIR:AT5G13940.1); Has 143 Blast hits to 138 proteins in 46 species: Archae - 0; Bacteria - 59; Metazoa - 12; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT3G19950AT3G19950.1TATGGGCTTCAGCCCAAAAzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT1G55530.1); Has 7591 Blast hits to 7571 proteins in 232 species: Archae - 0; Bacteria - 6; Metazoa - 2575; Fungi - 757; Plants - 2818; Viruses - 60; Other Eukaryotes - 1375 (source: NCBI BLink). 
AT3G21110AT3G21110.1CAATTGGGCTTCAGCCCA5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. 
AT3G21110.2CAATTGGGCTTCAGCCCA5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole synthetase (PUR7, syn. SAICAR synthetase), catalyzes aspartate addition at the alpha-amino group to the growing purine backbone. 
AT3G21210AT3G21210.1TCAGCCCATTTTAGGCCprotein binding / zinc ion binding; FUNCTIONS IN: protein binding, zinc ion binding; INVOLVED IN: intracellular signaling cascade, response to stress; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), UspA (InterPro:IPR006016), Protein kinase C, phorbol ester/diacylglycerol binding (InterPro:IPR002219), Zinc finger, PHD-type (InterPro:IPR001965), DC1 (InterPro:IPR004146), C1-like (InterPro:IPR011424); BEST Arabidopsis thaliana protein match is: DC1 domain-containing protein (TAIR:AT1G34480.1); Has 1530 Blast hits to 740 proteins in 38 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 1494; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT3G23490AT3G23490.1TCAGCCCATTTAcyanase 
AT3G25520AT3G25520.1TCAGCCCAEncodes ribosomal protein L5 that binds to 5S ribosomal RNA and in involved in its export from the nucleus to the cytoplasm. Identified in a screen for enhancers of as1. as1/pgy double mutants show defects in leaf vascular patterning and adaxial cell fate. Double mutant analysis indicates pgy genes function in the same pathway as REV, KAN1 and KAN2. 
AT3G46790AT3G46790.1TCAGCCCAATTEncodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation. 
AT3G47510AT3G47510.1TGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 11 growth stages; Has 7 Blast hits to 7 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 7; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G47960AT3G47960.1TCAGCCCAproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: proton-dependent oligopeptide transport (POT) family protein (TAIR:AT5G62680.1); Has 2355 Blast hits to 2218 proteins in 361 species: Archae - 0; Bacteria - 385; Metazoa - 535; Fungi - 246; Plants - 1124; Viruses - 0; Other Eukaryotes - 65 (source: NCBI BLink). 
AT3G52040AT3G52040.1TCAGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G52050AT3G52050.1TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.2TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.3TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.4TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.5TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G56720AT3G56720.1TCAGCCCATTATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 5618 Blast hits to 4117 proteins in 284 species: Archae - 6; Bacteria - 147; Metazoa - 3194; Fungi - 606; Plants - 492; Viruses - 13; Other Eukaryotes - 1160 (source: NCBI BLink). 
AT3G61130AT3G61130.1TCAGCCCAAAAEncodes a protein with putative galacturonosyltransferase activity. 
AT3G63070AT3G63070.1ATAATGGGCTGAPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Regulation of nuclear pre-mRNA protein (InterPro:IPR006569), PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G48160.1); Has 977 Blast hits to 907 proteins in 123 species: Archae - 0; Bacteria - 34; Metazoa - 607; Fungi - 134; Plants - 84; Viruses - 0; Other Eukaryotes - 118 (source: NCBI BLink). 
AT3G63160AT3G63160.1TCAGCCCATATTAGGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast outer membrane, thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 18 Blast hits to 18 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G03280AT4G03280.1TCAGCCCAATAAGGCCCACEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. 
AT4G03280.2TCAGCCCAATAAGGCCCACEncodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. 
AT4G07390AT4G07390.1AACGACGTAATTGGGCTGAPQ-loop repeat family protein / transmembrane family protein; LOCATED IN: membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cystinosin/ERS1p repeat (InterPro:IPR006603), Mannose-P-dolichol utilization defect 1 protein (InterPro:IPR016817); BEST Arabidopsis thaliana protein match is: PQ-loop repeat family protein / transmembrane family protein (TAIR:AT5G59470.1); Has 451 Blast hits to 449 proteins in 128 species: Archae - 0; Bacteria - 0; Metazoa - 207; Fungi - 81; Plants - 111; Viruses - 0; Other Eukaryotes - 52 (source: NCBI BLink). 
AT4G10330AT4G10330.1CTATTGGGCTGAAGTTGGGCCTTGglycine-rich protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 4017 Blast hits to 987 proteins in 153 species: Archae - 18; Bacteria - 164; Metazoa - 2052; Fungi - 67; Plants - 1382; Viruses - 57; Other Eukaryotes - 277 (source: NCBI BLink). 
AT4G16500AT4G16500.1TCAGCCCAcysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G21570AT4G21570.1TCAGCCCATGACGTGTunknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF300 (InterPro:IPR005178); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G11200.1); Has 590 Blast hits to 587 proteins in 141 species: Archae - 0; Bacteria - 0; Metazoa - 255; Fungi - 125; Plants - 125; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT4G25740AT4G25740.1TCAGCCCAATAAAAGCCCAAAT40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). 
AT4G25740.2TCAGCCCAATAAAAGCCCAAAT40S ribosomal protein S10 (RPS10A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Plectin/S10, N-terminal (InterPro:IPR005326); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S10 (RPS10C) (TAIR:AT5G52650.1); Has 1958 Blast hits to 1535 proteins in 282 species: Archae - 0; Bacteria - 275; Metazoa - 679; Fungi - 156; Plants - 119; Viruses - 1; Other Eukaryotes - 728 (source: NCBI BLink). 
AT4G28470AT4G28470.1TTATGGGCTGAGCCCAencoding the RPN subunits of the 26S proteasome 
AT4G31560AT4G31560.1TCAGCCCATTGEncodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane. 
AT4G32570AT4G32570.1TTTTGGGCTGATIFY DOMAIN PROTEIN 8 (TIFY8); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399); Has 46 Blast hits to 46 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 1; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G33110AT4G33110.1TAGTGGGCTGAcoclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; LOCATED IN: plasma membrane; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33120.1); Has 6032 Blast hits to 6030 proteins in 921 species: Archae - 32; Bacteria - 2504; Metazoa - 56; Fungi - 238; Plants - 239; Viruses - 0; Other Eukaryotes - 2963 (source: NCBI BLink). 
AT4G33120AT4G33120.1TAGTGGGCTGAcoclaurine N-methyltransferase, putative; FUNCTIONS IN: cyclopropane-fatty-acyl-phospholipid synthase activity, (S)-coclaurine-N-methyltransferase activity; INVOLVED IN: lipid biosynthetic process; CONTAINS InterPro DOMAIN/s: Cyclopropane-fatty-acyl-phospholipid synthase (InterPro:IPR003333); BEST Arabidopsis thaliana protein match is: coclaurine N-methyltransferase, putative (TAIR:AT4G33110.1); Has 5982 Blast hits to 5978 proteins in 904 species: Archae - 32; Bacteria - 2580; Metazoa - 59; Fungi - 244; Plants - 209; Viruses - 0; Other Eukaryotes - 2858 (source: NCBI BLink). 
AT4G37090AT4G37090.1TTAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). 
AT4G37090.2TTAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 1174 Blast hits to 794 proteins in 120 species: Archae - 2; Bacteria - 24; Metazoa - 344; Fungi - 98; Plants - 43; Viruses - 11; Other Eukaryotes - 652 (source: NCBI BLink). 
AT5G01110AT5G01110.1TCAGCCCAATTAAAACCGGATpentatricopeptide (PPR) repeat-containing protein; LOCATED IN: chloroplast; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: UDP-glucoronosyl/UDP-glucosyl transferase family protein (TAIR:AT1G05670.2); Has 28807 Blast hits to 6228 proteins in 193 species: Archae - 4; Bacteria - 24; Metazoa - 956; Fungi - 844; Plants - 25427; Viruses - 0; Other Eukaryotes - 1552 (source: NCBI BLink). 
AT5G01930AT5G01930.1TTTTGGGCTGA(1-4)-beta-mannan endohydrolase, putative; FUNCTIONS IN: cation binding, hydrolase activity, hydrolyzing O-glycosyl compounds, catalytic activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, family 5 (InterPro:IPR001547), Glycoside hydrolase, family 5, conserved site (InterPro:IPR018087), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781); BEST Arabidopsis thaliana protein match is: (1-4)-beta-mannan endohydrolase, putative (TAIR:AT5G66460.1); Has 442 Blast hits to 438 proteins in 116 species: Archae - 4; Bacteria - 111; Metazoa - 0; Fungi - 119; Plants - 187; Viruses - 0; Other Eukaryotes - 21 (source: NCBI BLink). 
AT5G08190AT5G08190.1TGGGCTGANUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G08190.2TGGGCTGANUCLEAR FACTOR Y, SUBUNIT B12 (NF-YB12); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB13 (NUCLEAR FACTOR Y, SUBUNIT B13); transcription factor (TAIR:AT5G23090.2); Has 985 Blast hits to 985 proteins in 178 species: Archae - 0; Bacteria - 0; Metazoa - 382; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink). 
AT5G09390AT5G09390.1TCAGCCCATTAATACGGCCCAATTCD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G09390.2TCAGCCCATTAATACGGCCCAATTCD2-binding protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 835 Blast hits to 815 proteins in 140 species: Archae - 4; Bacteria - 18; Metazoa - 471; Fungi - 92; Plants - 65; Viruses - 0; Other Eukaryotes - 185 (source: NCBI BLink). 
AT5G09450AT5G09450.1CTAATGGGCTGApentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02820.1); Has 2335 Blast hits to 1588 proteins in 52 species: Archae - 0; Bacteria - 0; Metazoa - 7; Fungi - 6; Plants - 2224; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT5G09995AT5G09995.1TCAGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G09995.2TCAGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G09995.3TCAGCCCAAACunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08530.1); Has 86 Blast hits to 86 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G11680AT5G11680.1AAATGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cytosol, plasma membrane; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; Has 136 Blast hits to 136 proteins in 70 species: Archae - 0; Bacteria - 0; Metazoa - 58; Fungi - 26; Plants - 24; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT5G14440AT5G14440.1TTATTGGGCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). 
AT5G14440.2TTATTGGGCTGAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). 
AT5G16380AT5G16380.1ATATGGGCTGAATAAGGGCCCATTTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF538 (InterPro:IPR007493); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G07470.1); Has 277 Blast hits to 277 proteins in 13 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 276; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G16710AT5G16710.1TAATGGGCTGAThe protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. 
AT5G17190AT5G17190.1TGTTGGGCTGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G03160.1); Has 58 Blast hits to 58 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 58; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G19930AT5G19930.1CTATTGGGTCAGCCCATTTGAGGCCCATGintegral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink). 
AT5G19940AT5G19940.1CATGGGCCTCAAATGGGCTGACCCAATAGplastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G19940.2CATGGGCCTCAAATGGGCTGACCCAATAGplastid-lipid associated protein PAP-related / fibrillin-related; FUNCTIONS IN: structural molecule activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, chloroplast envelope; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: PAP fibrillin (InterPro:IPR006843); Has 80 Blast hits to 80 proteins in 23 species: Archae - 0; Bacteria - 19; Metazoa - 0; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G20500AT5G20500.1GTTGGGCTGAglutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity; INVOLVED IN: cell redox homeostasis; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin (InterPro:IPR002109), Glutaredoxin active site (InterPro:IPR011767), Glutaredoxin, eukaryotic and viruses (InterPro:IPR011899), Glutaredoxin subgroup (InterPro:IPR014025), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: glutaredoxin, putative (TAIR:AT1G77370.1); Has 4164 Blast hits to 4161 proteins in 811 species: Archae - 10; Bacteria - 1751; Metazoa - 378; Fungi - 232; Plants - 403; Viruses - 108; Other Eukaryotes - 1282 (source: NCBI BLink). 
AT5G24165AT5G24165.1TCAGCCCATTAGCCCATTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G23885.1); Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G40770AT5G40770.1TCAGCCCAATGprohibitin 3 
AT5G40930AT5G40930.1TGTTGGGCTGAForm of TOM20, which is a component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins 
AT5G44170AT5G44170.1TCAGCCCAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: Expressed protein (TAIR:AT1G08125.1); Has 565 Blast hits to 565 proteins in 102 species: Archae - 0; Bacteria - 6; Metazoa - 261; Fungi - 146; Plants - 99; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT5G46800AT5G46800.1TGGGCTGASeedling lethal mutation; Mitochondrial Carnitine Acyl Carrier-Like Protein 
AT5G46840AT5G46840.2CTAATGGGCTGARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). 
AT5G46840.2TCAGCCCAATGRNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); Has 10345 Blast hits to 6884 proteins in 384 species: Archae - 15; Bacteria - 291; Metazoa - 4575; Fungi - 1048; Plants - 877; Viruses - 42; Other Eukaryotes - 3497 (source: NCBI BLink). 
AT5G47110AT5G47110.1TATATGGGCTGAlil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G47300AT5G47300.1TGGGCTGAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G25460.1); Has 1056 Blast hits to 1034 proteins in 40 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1054; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G48710AT5G48710.1TCAGCCCATTAAGGCCCAACTubiquitin-related; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin-related (TAIR:AT5G48700.1); Has 703 Blast hits to 702 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 438; Fungi - 87; Plants - 102; Viruses - 1; Other Eukaryotes - 75 (source: NCBI BLink). 
AT5G53620AT5G53620.1TCAGCCCAATAGGCCCAACAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.1TCAGCCCAATAGGCCCGTunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.2TCAGCCCAATAGGCCCAACAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.2TCAGCCCAATAGGCCCGTunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.3TCAGCCCAATAGGCCCAACAunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G53620.3TCAGCCCAATAGGCCCGTunknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink). 
AT5G54900AT5G54900.1CTAATGGGCTGARNA-binding protein 45A (ATRBP45A); FUNCTIONS IN: RNA binding; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: ATRBP45C; RNA binding (TAIR:AT4G27000.1); Has 26274 Blast hits to 15473 proteins in 616 species: Archae - 10; Bacteria - 1663; Metazoa - 15334; Fungi - 2743; Plants - 3912; Viruses - 0; Other Eukaryotes - 2612 (source: NCBI BLink). 
AT5G60940AT5G60940.1TCAGCCCATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G60940.1TCAGCCCATATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G60940.2TCAGCCCATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G60940.2TCAGCCCATATtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex, heterotrimeric G-protein complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 25427 Blast hits to 14466 proteins in 495 species: Archae - 44; Bacteria - 4154; Metazoa - 11377; Fungi - 4590; Plants - 1838; Viruses - 0; Other Eukaryotes - 3424 (source: NCBI BLink). 
AT5G61020AT5G61020.1TCAGCCCATTTECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT5G61020.2TCAGCCCATTTECT3; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: YT521-B-like protein (InterPro:IPR007275); BEST Arabidopsis thaliana protein match is: ECT2; protein binding (TAIR:AT3G13460.4); Has 838 Blast hits to 830 proteins in 142 species: Archae - 0; Bacteria - 4; Metazoa - 413; Fungi - 108; Plants - 206; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT5G61840AT5G61840.1TCAGCCCATTAGUT1; FUNCTIONS IN: glucuronoxylan glucuronosyltransferase activity, catalytic activity; INVOLVED IN: secondary cell wall biogenesis, glucuronoxylan biosynthetic process; LOCATED IN: Golgi apparatus, membrane; EXPRESSED IN: 30 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: GUT2; catalytic/ glucuronoxylan glucuronosyltransferase (TAIR:AT1G27440.1); Has 853 Blast hits to 845 proteins in 89 species: Archae - 0; Bacteria - 12; Metazoa - 227; Fungi - 4; Plants - 512; Viruses - 0; Other Eukaryotes - 98 (source: NCBI BLink). 
AT5G62300AT5G62300.1TTATTGGGCTGA40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT5G62300.2TTATTGGGCTGA40S ribosomal protein S20 (RPS20C); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit, cell wall; EXPRESSED IN: leaf; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20A) (TAIR:AT3G45030.1); Has 5009 Blast hits to 5009 proteins in 1497 species: Archae - 173; Bacteria - 2606; Metazoa - 280; Fungi - 91; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT5G67490AT5G67490.1TCAGCCCACGTCAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1674 (InterPro:IPR012875); Has 340 Blast hits to 340 proteins in 113 species: Archae - 0; Bacteria - 97; Metazoa - 109; Fungi - 4; Plants - 24; Viruses - 0; Other Eukaryotes - 106 (source: NCBI BLink). 
AT5G67500AT5G67500.1TGACGTGGGCTGAEncodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.