version

Summary of AtREG620 (All List)

OrganismArabidopsis thaliana  
IDAtREG620  
SequenceCCCATATA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count297  

Entry Sequences (297 entries)

LocusGene modelSequenceDescription
AT1G01120AT1G01120.1CCCATATAEncodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. 
AT1G02170AT1G02170.1TATATGGGCTMetacaspase AtMCP1b. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam profile PF00656: ICE-like protease (caspase) p20 domain 
AT1G04860AT1G04860.1TATATGGGEncodes a ubiquitin-specific protease. 
AT1G05140AT1G05140.1AGCCCATATAmembrane-associated zinc metalloprotease, putative; FUNCTIONS IN: protein binding, metalloendopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, plastid; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M50 (InterPro:IPR008915), PDZ/DHR/GLGF (InterPro:IPR001478), Peptidase M50, putative membrane-associated zinc metallopeptidase (InterPro:IPR004387); BEST Arabidopsis thaliana protein match is: membrane-associated zinc metalloprotease, putative (TAIR:AT2G32480.1); Has 6877 Blast hits to 5459 proteins in 1201 species: Archae - 28; Bacteria - 3634; Metazoa - 12; Fungi - 4; Plants - 40; Viruses - 0; Other Eukaryotes - 3159 (source: NCBI BLink). 
AT1G06120AT1G06120.1CCCATATAfatty acid desaturase family protein; FUNCTIONS IN: oxidoreductase activity; INVOLVED IN: lipid metabolic process; CONTAINS InterPro DOMAIN/s: Fatty acid desaturase, type 1, core (InterPro:IPR015876), Fatty acid desaturase, type 1 (InterPro:IPR005804); BEST Arabidopsis thaliana protein match is: fatty acid desaturase family protein (TAIR:AT1G06090.1); Has 2696 Blast hits to 2696 proteins in 596 species: Archae - 0; Bacteria - 1082; Metazoa - 689; Fungi - 152; Plants - 71; Viruses - 3; Other Eukaryotes - 699 (source: NCBI BLink). 
AT1G07140AT1G07140.1TATATGGGCCATAEncodes a putative Ran-binding protein (siRanBP). 
AT1G10417AT1G10417.1TACTGGGCCCATATAEncodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. 
AT1G10950AT1G10950.1TATATGGGendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink). 
AT1G10950.1TATATGGGCCGendomembrane protein 70, putative; LOCATED IN: integral to membrane, Golgi apparatus, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Nonaspanin (TM9SF) (InterPro:IPR004240); BEST Arabidopsis thaliana protein match is: endomembrane protein 70, putative (TAIR:AT2G01970.1); Has 1032 Blast hits to 991 proteins in 166 species: Archae - 0; Bacteria - 8; Metazoa - 443; Fungi - 164; Plants - 234; Viruses - 0; Other Eukaryotes - 183 (source: NCBI BLink). 
AT1G11080AT1G11080.1CCCATATAserine carboxypeptidase-like 31 (scpl31); FUNCTIONS IN: serine-type carboxypeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Peptidase S10, serine carboxypeptidase (InterPro:IPR001563), Peptidase S10, serine carboxypeptidase, active site (InterPro:IPR018202); BEST Arabidopsis thaliana protein match is: SCPL32 (SERINE CARBOXYPEPTIDASE-LIKE 32); serine-type carboxypeptidase (TAIR:AT1G61130.1); Has 2478 Blast hits to 2433 proteins in 263 species: Archae - 0; Bacteria - 97; Metazoa - 570; Fungi - 568; Plants - 896; Viruses - 0; Other Eukaryotes - 347 (source: NCBI BLink). 
AT1G11800AT1G11800.1TATATGGGendonuclease/exonuclease/phosphatase family protein; FUNCTIONS IN: hydrolase activity, zinc ion binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Endonuclease/exonuclease/phosphatase (InterPro:IPR005135), Zinc finger, RanBP2-type (InterPro:IPR001876); Has 273 Blast hits to 263 proteins in 68 species: Archae - 0; Bacteria - 12; Metazoa - 134; Fungi - 10; Plants - 55; Viruses - 0; Other Eukaryotes - 62 (source: NCBI BLink). 
AT1G13330AT1G13330.1TAAAGGCCCATATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: Tat binding protein 1-interacting (InterPro:IPR010776); Has 2425 Blast hits to 2142 proteins in 283 species: Archae - 50; Bacteria - 240; Metazoa - 929; Fungi - 179; Plants - 47; Viruses - 23; Other Eukaryotes - 957 (source: NCBI BLink). 
AT1G13690AT1G13690.1TATATGGGAtE1 - stimulates the ATPase activity of DnaK/DnaJ 
AT1G13900AT1G13900.1GTAAGGCCCATAATATTGGGCTTAGATAGGCCCATATAcalcineurin-like phosphoesterase family protein; FUNCTIONS IN: hydrolase activity, protein serine/threonine phosphatase activity, metal ion binding, acid phosphatase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Purple acid phosphatase, N-terminal (InterPro:IPR015914), Metallophosphoesterase (InterPro:IPR004843), Purple acid phosphatase-like, N-terminal (InterPro:IPR008963); BEST Arabidopsis thaliana protein match is: PAP9 (PURPLE ACID PHOSPHATASE 9); acid phosphatase/ protein serine/threonine phosphatase (TAIR:AT2G03450.1); Has 1052 Blast hits to 1042 proteins in 232 species: Archae - 0; Bacteria - 259; Metazoa - 179; Fungi - 58; Plants - 399; Viruses - 0; Other Eukaryotes - 157 (source: NCBI BLink). 
AT1G13910AT1G13910.1TATATGGGCCTATCTAAGCCCAATATTATGGGCCTTACleucine-rich repeat family protein; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT5G61240.1); Has 54187 Blast hits to 17810 proteins in 751 species: Archae - 26; Bacteria - 3393; Metazoa - 14506; Fungi - 646; Plants - 32565; Viruses - 0; Other Eukaryotes - 3051 (source: NCBI BLink). 
AT1G14450AT1G14450.1TTAAAGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrial membrane, respiratory chain complex I; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G02510.1); Has 41 Blast hits to 41 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 4; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G14940AT1G14940.1TATATGGGmajor latex protein-related / MLP-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to biotic stimulus, defense response; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Bet v I allergen (InterPro:IPR000916); BEST Arabidopsis thaliana protein match is: major latex protein-related / MLP-related (TAIR:AT1G14930.1); Has 223 Blast hits to 201 proteins in 35 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 223; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G15440AT1G15440.1GAAGCCCATATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink). 
AT1G15440.2GAAGCCCATATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), Periodic tryptophan protein-associated region (InterPro:IPR007190), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 56570 Blast hits to 23907 proteins in 640 species: Archae - 46; Bacteria - 6391; Metazoa - 26660; Fungi - 10130; Plants - 5359; Viruses - 0; Other Eukaryotes - 7984 (source: NCBI BLink). 
AT1G17710AT1G17710.1CCCATATAphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT1G17710.2CCCATATAphosphatase; FUNCTIONS IN: phosphatase activity; INVOLVED IN: metabolic process; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate phosphatase, PHOSPHO2 (InterPro:IPR016965), HAD-superfamily hydrolase, subfamily IB, PSPase-like (InterPro:IPR006383), Pyridoxal phosphate phosphatase-related (InterPro:IPR006384); BEST Arabidopsis thaliana protein match is: phosphatase (TAIR:AT1G73010.1); Has 262 Blast hits to 260 proteins in 77 species: Archae - 0; Bacteria - 12; Metazoa - 155; Fungi - 12; Plants - 57; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT1G18080AT1G18080.1TAGCCCATATAEncodes the Arabidopsis thaliana homolog of the tobacco WD-40 repeat ArcA gene. 
AT1G19480AT1G19480.1TAAAAGCCCATATAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). 
AT1G19480.2TAAAAGCCCATATAHhH-GPD base excision DNA repair family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: DNA repair, base-excision repair; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: DNA glycosylase (InterPro:IPR011257), HhH-GPD domain (InterPro:IPR003265); BEST Arabidopsis thaliana protein match is: HhH-GPD base excision DNA repair family protein (TAIR:AT1G75230.1); Has 3475 Blast hits to 3475 proteins in 635 species: Archae - 37; Bacteria - 1340; Metazoa - 0; Fungi - 92; Plants - 45; Viruses - 0; Other Eukaryotes - 1961 (source: NCBI BLink). 
AT1G21140AT1G21140.1CCCATATAnodulin, putative; INVOLVED IN: biological_process unknown; EXPRESSED IN: 14 plant structures; EXPRESSED DURING: LP.06 six leaves visible, 4 anthesis, petal differentiation and expansion stage, LP.08 eight leaves visible; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF125, transmembrane (InterPro:IPR008217); BEST Arabidopsis thaliana protein match is: nodulin, putative (TAIR:AT3G43630.1); Has 1036 Blast hits to 1028 proteins in 341 species: Archae - 39; Bacteria - 627; Metazoa - 0; Fungi - 71; Plants - 99; Viruses - 0; Other Eukaryotes - 200 (source: NCBI BLink). 
AT1G23780AT1G23780.1CCCATATAF-box family protein; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT1G23770.1); Has 177 Blast hits to 177 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). 
AT1G23960AT1G23960.1TATATGGGCCCTTATAGCCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G23960.2TATATGGGCCCTTATAGCCCATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF626, Arabidopsis thaliana (InterPro:IPR006462); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G23970.1); Has 74 Blast hits to 73 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 74; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G24040AT1G24040.1TATATGGGCCATAAGGGCCCAATAAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G24040.2TATATGGGCCATAAGGGCCCAATAAGCN5-related N-acetyltransferase (GNAT) family protein; FUNCTIONS IN: N-acetyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: GCN5-related N-acetyltransferase (InterPro:IPR000182), Acyl-CoA N-acyltransferase (InterPro:IPR016181); Has 68 Blast hits to 68 proteins in 27 species: Archae - 9; Bacteria - 18; Metazoa - 3; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 7 (source: NCBI BLink). 
AT1G24050AT1G24050.1TTATTGGGCCCTTATGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70220.1); Has 153 Blast hits to 153 proteins in 71 species: Archae - 0; Bacteria - 0; Metazoa - 73; Fungi - 34; Plants - 30; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink). 
AT1G26530AT1G26530.1TATATGGGCCGAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: shoot apex, seed; EXPRESSED DURING: E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF652 (InterPro:IPR006984); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46230.1); Has 345 Blast hits to 345 proteins in 143 species: Archae - 0; Bacteria - 0; Metazoa - 142; Fungi - 99; Plants - 37; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT1G26880AT1G26880.1AAAAGGCCCATATA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). 
AT1G26880.2AAAAGGCCCATATA60S ribosomal protein L34 (RPL34A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, nucleolus, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L34e, conserved site (InterPro:IPR018065), Ribosomal protein L34e (InterPro:IPR008195); BEST Arabidopsis thaliana protein match is: RPL34 (RIBOSOMAL PROTEIN L34); structural constituent of ribosome (TAIR:AT1G69620.1); Has 600 Blast hits to 600 proteins in 236 species: Archae - 43; Bacteria - 0; Metazoa - 239; Fungi - 98; Plants - 100; Viruses - 0; Other Eukaryotes - 120 (source: NCBI BLink). 
AT1G27310AT1G27310.1CCCATATAEncodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. 
AT1G27770AT1G27770.1CCCATATAEncodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. 
AT1G27770.2CCCATATAEncodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. 
AT1G28710AT1G28710.1TATATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G28710.2TATATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G28700.1); Has 204 Blast hits to 200 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 191; Viruses - 0; Other Eukaryotes - 13 (source: NCBI BLink). 
AT1G29800AT1G29800.1TATATGGGphosphoinositide binding / zinc ion binding; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: zinc finger (FYVE type) family protein (TAIR:AT3G43230.1); Has 2856 Blast hits to 2789 proteins in 224 species: Archae - 0; Bacteria - 155; Metazoa - 1698; Fungi - 436; Plants - 186; Viruses - 3; Other Eukaryotes - 378 (source: NCBI BLink). 
AT1G29800.2TATATGGGphosphoinositide binding / zinc ion binding; FUNCTIONS IN: phosphoinositide binding, zinc ion binding; INVOLVED IN: signal transduction; CONTAINS InterPro DOMAIN/s: Zinc finger, FYVE-type (InterPro:IPR000306), Zinc finger, FYVE-related (InterPro:IPR017455), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011), Ysc84 actin-binding domain (InterPro:IPR007461); BEST Arabidopsis thaliana protein match is: zinc finger (FYVE type) family protein (TAIR:AT3G43230.1); Has 2856 Blast hits to 2789 proteins in 224 species: Archae - 0; Bacteria - 155; Metazoa - 1698; Fungi - 436; Plants - 186; Viruses - 3; Other Eukaryotes - 378 (source: NCBI BLink). 
AT1G32050AT1G32050.1AAAACGGCCCATATAsecretory carrier membrane protein (SCAMP) family protein; FUNCTIONS IN: transmembrane transporter activity; INVOLVED IN: protein transport; LOCATED IN: mitochondrion, plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SCAMP (InterPro:IPR007273); BEST Arabidopsis thaliana protein match is: secretory carrier membrane protein (SCAMP) family protein (TAIR:AT2G20840.1); Has 522 Blast hits to 522 proteins in 85 species: Archae - 0; Bacteria - 0; Metazoa - 335; Fungi - 12; Plants - 120; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink). 
AT1G32260AT1G32260.1ACGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G35480.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G32530AT1G32530.1TATATGGGCCCAAATzinc finger (C3HC4-type RING finger) family protein; FUNCTIONS IN: protein binding, zinc ion binding; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: protein binding / zinc ion binding (TAIR:AT2G35330.1); Has 33581 Blast hits to 21216 proteins in 1196 species: Archae - 227; Bacteria - 3237; Metazoa - 17526; Fungi - 2016; Plants - 985; Viruses - 132; Other Eukaryotes - 9458 (source: NCBI BLink). 
AT1G32730AT1G32730.1CCAGGCCCATATAAAAACGACunknown protein; LOCATED IN: chloroplast; EXPRESSED IN: 12 plant structures; EXPRESSED DURING: 6 growth stages; Has 87 Blast hits to 85 proteins in 30 species: Archae - 0; Bacteria - 7; Metazoa - 51; Fungi - 4; Plants - 13; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT1G33520AT1G33520.1TCGGCCCATATAHas single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; 
AT1G33610AT1G33610.1TATATGGGprotein binding; FUNCTIONS IN: protein binding; INVOLVED IN: signal transduction; LOCATED IN: endomembrane system; EXPRESSED IN: shoot apex, root, petiole, leaf; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.02 two leaves visible, LP.12 twelve leaves visible; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, typical subtype (InterPro:IPR003591), Leucine-rich repeat (InterPro:IPR001611), Leucine-rich repeat, N-terminal (InterPro:IPR013210); BEST Arabidopsis thaliana protein match is: disease resistance protein-related / LRR protein-related (TAIR:AT1G33590.1); Has 79875 Blast hits to 20687 proteins in 757 species: Archae - 36; Bacteria - 5035; Metazoa - 29153; Fungi - 774; Plants - 39232; Viruses - 6; Other Eukaryotes - 5639 (source: NCBI BLink). 
AT1G33980AT1G33980.1TTAAGGCCCATTAGAGGCCCATATAInvolved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) 
AT1G33980.2TTAAGGCCCATTAGAGGCCCATATAInvolved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD) 
AT1G48260AT1G48260.1TATATGGGEncodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). 
AT1G53690AT1G53690.1TATATGGGCCCATATProtein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. 
AT1G54340AT1G54340.1TCAGGCCCATATANADP-specific isocitrate dehydrogenase (ICDH) 
AT1G58200AT1G58200.1TATATGGGCTA member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. 
AT1G58200.2TATATGGGCTA member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. 
AT1G58210AT1G58210.1AGCCCATATAEMBRYO DEFECTIVE 1674 (EMB1674); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; EXPRESSED IN: leaf whorl, petal, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: SANT associated (InterPro:IPR015216), KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT1G09720.1); Has 24624 Blast hits to 15362 proteins in 900 species: Archae - 370; Bacteria - 1847; Metazoa - 13466; Fungi - 2008; Plants - 1045; Viruses - 70; Other Eukaryotes - 5818 (source: NCBI BLink). 
AT1G60780AT1G60780.1TATATGGGCCTGAHAPLESS 13 (HAP13); FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, conserved site (InterPro:IPR018240), Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT1G10730.1); Has 1643 Blast hits to 1593 proteins in 209 species: Archae - 0; Bacteria - 0; Metazoa - 929; Fungi - 318; Plants - 104; Viruses - 0; Other Eukaryotes - 292 (source: NCBI BLink). 
AT1G60900AT1G60900.1CCCATATAU2 snRNP auxiliary factor large subunit, putative; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: mRNA processing; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), U2 snRNP auxilliary factor, large subunit, splicing factor (InterPro:IPR006529); BEST Arabidopsis thaliana protein match is: ATU2AF65A; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G36690.1); Has 85440 Blast hits to 35122 proteins in 1401 species: Archae - 56; Bacteria - 10121; Metazoa - 44645; Fungi - 7960; Plants - 5595; Viruses - 646; Other Eukaryotes - 16417 (source: NCBI BLink). 
AT1G61990AT1G61990.1TATATGGGCCGAmitochondrial transcription termination factor-related / mTERF-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochodrial transcription termination factor-related (InterPro:IPR003690); BEST Arabidopsis thaliana protein match is: mitochondrial transcription termination factor-related / mTERF-related (TAIR:AT1G61960.1); Has 369 Blast hits to 350 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 2; Fungi - 0; Plants - 366; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT1G62580AT1G62580.1TATATGGGflavin-containing monooxygenase family protein / FMO family protein; FUNCTIONS IN: NADP or NADPH binding, monooxygenase activity, FAD binding, flavin-containing monooxygenase activity; INVOLVED IN: biological_process unknown; LOCATED IN: intrinsic to endoplasmic reticulum membrane; CONTAINS InterPro DOMAIN/s: Flavin-containing monooxygenase FMO (InterPro:IPR000960), FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027), Dimethylaniline monooxygenase, N-oxide-forming (InterPro:IPR012143); BEST Arabidopsis thaliana protein match is: FAD binding / NADP or NADPH binding / electron carrier/ flavin-containing monooxygenase/ monooxygenase (TAIR:AT1G63340.1); Has 8079 Blast hits to 7827 proteins in 911 species: Archae - 42; Bacteria - 3448; Metazoa - 964; Fungi - 712; Plants - 400; Viruses - 0; Other Eukaryotes - 2513 (source: NCBI BLink). 
AT1G62820AT1G62820.1ATGGGCTTAGGAAGCCCATATAcalmodulin, putative; FUNCTIONS IN: calcium ion binding; INVOLVED IN: response to cold; LOCATED IN: nucleus; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), Calcium-binding EF-hand (InterPro:IPR002048), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: calmodulin, putative (TAIR:AT1G12310.1); Has 12799 Blast hits to 10828 proteins in 1248 species: Archae - 0; Bacteria - 22; Metazoa - 5376; Fungi - 3677; Plants - 2002; Viruses - 0; Other Eukaryotes - 1722 (source: NCBI BLink). 
AT1G65310AT1G65310.1TATATGGGCTputative xyloglucan endotransglycosylase/hydrolase, expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. 
AT1G67680AT1G67680.1AAAGGCCCATATAAAAAGCCCATTAA7S RNA binding; FUNCTIONS IN: 7S RNA binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP72 subunit, RNA-binding (InterPro:IPR013699); BEST Arabidopsis thaliana protein match is: 7S RNA binding (TAIR:AT1G67650.1); Has 525 Blast hits to 512 proteins in 165 species: Archae - 12; Bacteria - 42; Metazoa - 217; Fungi - 108; Plants - 25; Viruses - 0; Other Eukaryotes - 121 (source: NCBI BLink). 
AT1G70410AT1G70410.2CCCATATABETA CARBONIC ANHYDRASE 4 (BCA4); FUNCTIONS IN: carbonate dehydratase activity, zinc ion binding; INVOLVED IN: carbon utilization; LOCATED IN: plasma membrane, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Carbonic anhydrase, prokaryotic-like, conserved site (InterPro:IPR015892), Carbonic anhydrase (InterPro:IPR001765); BEST Arabidopsis thaliana protein match is: BCA3 (BETA CARBONIC ANHYDRASE 4); carbonate dehydratase/ zinc ion binding (TAIR:AT1G23730.1); Has 3164 Blast hits to 3152 proteins in 940 species: Archae - 22; Bacteria - 2255; Metazoa - 48; Fungi - 145; Plants - 233; Viruses - 0; Other Eukaryotes - 461 (source: NCBI BLink). 
AT1G71500AT1G71500.1AGAGGCCCATATARieske (2Fe-2S) domain-containing protein; FUNCTIONS IN: electron carrier activity, oxidoreductase activity, 2 iron, 2 sulfur cluster binding; INVOLVED IN: oxidation reduction; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Rieske [2Fe-2S] iron-sulphur domain (InterPro:IPR017941), Rieske [2Fe-2S] region (InterPro:IPR005806); Has 207 Blast hits to 207 proteins in 61 species: Archae - 0; Bacteria - 101; Metazoa - 0; Fungi - 0; Plants - 72; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT1G74070AT1G74070.1TATATGGGCTTGGGCTTTAGTTTGGGCTTTTApeptidyl-prolyl cis-trans isomerase cyclophilin-type family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: chloroplast thylakoid lumen, chloroplast; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclophilin-like (InterPro:IPR015891), Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (InterPro:IPR002130); BEST Arabidopsis thaliana protein match is: peptidyl-prolyl cis-trans isomerase (TAIR:AT5G35100.1); Has 2382 Blast hits to 2382 proteins in 343 species: Archae - 0; Bacteria - 64; Metazoa - 1168; Fungi - 403; Plants - 432; Viruses - 0; Other Eukaryotes - 315 (source: NCBI BLink). 
AT1G75670AT1G75670.1TATATGGGDNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT1G75670.2TATATGGGDNA-directed RNA polymerase/ RNA binding; FUNCTIONS IN: DNA-directed RNA polymerase activity, RNA binding; INVOLVED IN: transcription; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: S1, RNA binding (InterPro:IPR003029), RNA polymerase Rpb7, N-terminal (InterPro:IPR005576); Has 39 Blast hits to 39 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 6; Plants - 25; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink). 
AT1G76120AT1G76120.1ATAAGCCCATATAtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). 
AT1G76120.2ATAAGCCCATATAtRNA pseudouridine synthase family protein; FUNCTIONS IN: pseudouridine synthase activity; INVOLVED IN: tRNA processing, pseudouridine synthesis; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: tRNA pseudouridine synthase (InterPro:IPR001406); BEST Arabidopsis thaliana protein match is: tRNA pseudouridine synthase family protein (TAIR:AT1G20370.1); Has 2167 Blast hits to 1972 proteins in 706 species: Archae - 78; Bacteria - 1060; Metazoa - 272; Fungi - 194; Plants - 74; Viruses - 0; Other Eukaryotes - 489 (source: NCBI BLink). 
AT1G77600AT1G77600.1AGTTGGGCCTGTAGGCCCATATAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: HEAT (InterPro:IPR000357), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: binding (TAIR:AT5G47690.3); Has 420 Blast hits to 371 proteins in 114 species: Archae - 0; Bacteria - 2; Metazoa - 153; Fungi - 83; Plants - 153; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink). 
AT1G78920AT1G78920.1TATATGGGCCGAAvacuolar-type H+-translocating inorganic pyrophosphatase 
AT1G78920.1TTTTGGGCTAGGCCCATATAvacuolar-type H+-translocating inorganic pyrophosphatase 
AT1G78920.2TATATGGGCCGAAvacuolar-type H+-translocating inorganic pyrophosphatase 
AT1G78920.2TTTTGGGCTAGGCCCATATAvacuolar-type H+-translocating inorganic pyrophosphatase 
AT2G02140AT2G02140.1TATATGGGPredicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. 
AT2G03200AT2G03200.1ATTAGGCCCATATAaspartyl protease family protein; FUNCTIONS IN: aspartic-type endopeptidase activity; INVOLVED IN: proteolysis; LOCATED IN: endomembrane system; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Peptidase aspartic, catalytic (InterPro:IPR009007), Peptidase A1 (InterPro:IPR001461); BEST Arabidopsis thaliana protein match is: CDR1 (CONSTITUTIVE DISEASE RESISTANCE 1); aspartic-type endopeptidase (TAIR:AT5G33340.1); Has 1708 Blast hits to 1685 proteins in 189 species: Archae - 0; Bacteria - 0; Metazoa - 176; Fungi - 322; Plants - 1102; Viruses - 0; Other Eukaryotes - 108 (source: NCBI BLink). 
AT2G03667AT2G03667.1ATAAGCCCATATAasparagine synthase (glutamine-hydrolyzing); FUNCTIONS IN: asparagine synthase (glutamine-hydrolyzing) activity; INVOLVED IN: asparagine biosynthetic process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Asparagine synthase (InterPro:IPR001962), Glutamine amidotransferase, type II (InterPro:IPR017932); Has 804 Blast hits to 751 proteins in 286 species: Archae - 66; Bacteria - 218; Metazoa - 123; Fungi - 87; Plants - 17; Viruses - 3; Other Eukaryotes - 290 (source: NCBI BLink). 
AT2G04378AT2G04378.1CCCATATAbeta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G04378.2CCCATATAbeta-galactosidase; FUNCTIONS IN: beta-galactosidase activity; INVOLVED IN: carbohydrate metabolic process; LOCATED IN: endomembrane system, beta-galactosidase complex; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 35 (InterPro:IPR001944); BEST Arabidopsis thaliana protein match is: beta-galactosidase (TAIR:AT5G01080.1); Has 14 Blast hits to 14 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 14; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G11890AT2G11890.1TATATGGGCCTAGadenylate cyclase 
AT2G11890.2TATATGGGCCTAGadenylate cyclase 
AT2G16510AT2G16510.1TATATGGGvacuolar ATP synthase 16 kDa proteolipid subunit 5 / V-ATPase 16 kDa proteolipid subunit 5 (AVAP5); FUNCTIONS IN: ATPase activity; INVOLVED IN: ATP synthesis coupled proton transport; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, F0/V0 complex, subunit C (InterPro:IPR002379), ATPase, V0 complex, proteolipid subunit C, eukaryotic (InterPro:IPR011555), ATPase, V0 complex, proteolipid subunit C (InterPro:IPR000245); BEST Arabidopsis thaliana protein match is: ATVHA-C3 (VACUOLAR-TYPE H(+)-ATPASE C3); ATPase (TAIR:AT4G38920.1); Has 1813 Blast hits to 1633 proteins in 398 species: Archae - 127; Bacteria - 309; Metazoa - 519; Fungi - 314; Plants - 224; Viruses - 0; Other Eukaryotes - 320 (source: NCBI BLink). 
AT2G23310AT2G23310.1CCCATATAEncodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. 
AT2G23310.2CCCATATAEncodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. 
AT2G23940AT2G23940.1CTTAGGCCCATATAunknown protein; LOCATED IN: plasma membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF788 (InterPro:IPR008506); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30500.1); Has 231 Blast hits to 231 proteins in 115 species: Archae - 0; Bacteria - 0; Metazoa - 101; Fungi - 70; Plants - 27; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT2G25210AT2G25210.1CCCATATA60S ribosomal protein L39 (RPL39A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L39e (InterPro:IPR000077); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L39 (RPL39C) (TAIR:AT4G31985.1); Has 574 Blast hits to 574 proteins in 219 species: Archae - 142; Bacteria - 0; Metazoa - 205; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT2G26660AT2G26660.1TGGCCCATATASPX DOMAIN GENE 2 (SPX2); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: cellular response to phosphate starvation; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: SPX, N-terminal (InterPro:IPR004331); BEST Arabidopsis thaliana protein match is: SPX1 (SPX DOMAIN GENE 1) (TAIR:AT5G20150.1); Has 816 Blast hits to 812 proteins in 153 species: Archae - 0; Bacteria - 2; Metazoa - 225; Fungi - 334; Plants - 177; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT2G26890AT2G26890.1CCCATATAGRV2 has sequence similarity to the C. elegans protein RME-8 which is involved in endocytosis. grv2 mutants result in a reduction in gravitropic response in hypocotyls and shoots but do not affect root gravitropism. The mutants are defective in amyloplast sedimentation. 
AT2G27720AT2G27720.1TGAGCCCATATA60S acidic ribosomal protein P2 (RPP2A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to cold; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2B) (TAIR:AT2G27710.3). 
AT2G27720.2TGAGCCCATATA60S acidic ribosomal protein P2 (RPP2A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to cold; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2B) (TAIR:AT2G27710.3). 
AT2G27720.3TGAGCCCATATA60S acidic ribosomal protein P2 (RPP2A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translational elongation, response to cold; LOCATED IN: cytosol, cytosolic ribosome, ribosome, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813); BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein P2 (RPP2B) (TAIR:AT2G27710.3). 
AT2G29650AT2G29650.1ATTTGGGCCTTATATGGGCTTTATEncodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. 
AT2G29650.2ATTTGGGCCTTATATGGGCTTTATEncodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. 
AT2G29650.3ATTTGGGCCTTATATGGGCTTTATEncodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. 
AT2G31083AT2G31083.1CCCATATAMember of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. 
AT2G31170AT2G31170.1CCCATATASYCO ARATH; FUNCTIONS IN: cysteine-tRNA ligase activity, nucleotide binding, aminoacyl-tRNA ligase activity, ATP binding; INVOLVED IN: cysteinyl-tRNA aminoacylation, translation, tRNA aminoacylation for protein translation; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Rossmann-like alpha/beta/alpha sandwich fold (InterPro:IPR014729), Cysteinyl-tRNA synthetase, class Ia (InterPro:IPR002308), Cysteinyl-tRNA synthetase, class Ia, N-terminal (InterPro:IPR015803), Cysteinyl-tRNA synthetase, class Ia, C-terminal (InterPro:IPR015804), Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (InterPro:IPR009080); BEST Arabidopsis thaliana protein match is: tRNA synthetase class I (C) family protein (TAIR:AT5G38830.1); Has 8663 Blast hits to 8413 proteins in 1630 species: Archae - 200; Bacteria - 3464; Metazoa - 434; Fungi - 181; Plants - 82; Viruses - 3; Other Eukaryotes - 4299 (source: NCBI BLink). 
AT2G32520AT2G32520.1ATTTGGGCCTAATGGCCCATATAdienelactone hydrolase family protein; FUNCTIONS IN: hydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase (InterPro:IPR002155), Dienelactone hydrolase (InterPro:IPR002925); BEST Arabidopsis thaliana protein match is: dienelactone hydrolase family protein (TAIR:AT1G35420.1); Has 2362 Blast hits to 2362 proteins in 596 species: Archae - 20; Bacteria - 1757; Metazoa - 54; Fungi - 12; Plants - 53; Viruses - 0; Other Eukaryotes - 466 (source: NCBI BLink). 
AT2G33180AT2G33180.1TAAGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast stroma; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 30 Blast hits to 30 proteins in 13 species: Archae - 0; Bacteria - 7; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 3 (source: NCBI BLink). 
AT2G35480AT2G35480.1TATATGGGCunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 9 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G32260.1); Has 19 Blast hits to 19 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 19; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT2G36070AT2G36070.1TATATGGGCCTAAAOne of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP. 
AT2G40205AT2G40205.1AAAAGGCCCATATA60S ribosomal protein L41 (RPL41C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G40205.1TATATGGGCTAA60S ribosomal protein L41 (RPL41C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; CONTAINS InterPro DOMAIN/s: Ribosomal protein L41 (InterPro:IPR007836); Has 170 Blast hits to 170 proteins in 66 species: Archae - 0; Bacteria - 0; Metazoa - 77; Fungi - 35; Plants - 49; Viruses - 0; Other Eukaryotes - 9 (source: NCBI BLink). 
AT2G41060AT2G41060.1TATATGGGCCTCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink). 
AT2G41060.2TATATGGGCCTCARNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: UBP1 interacting protein 2a (UBA2a) (TAIR:AT3G56860.3); Has 17419 Blast hits to 11431 proteins in 532 species: Archae - 0; Bacteria - 698; Metazoa - 10129; Fungi - 1624; Plants - 2756; Viruses - 123; Other Eukaryotes - 2089 (source: NCBI BLink). 
AT2G42160AT2G42160.1TATATGGGCCGAACCAAAAGCCCATATzinc finger (ubiquitin-hydrolase) domain-containing protein; FUNCTIONS IN: protein binding, catalytic activity, zinc ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BRCA1-associated 2 (InterPro:IPR011422), Zinc finger, UBP-type (InterPro:IPR001607), Zinc finger, RING-type (InterPro:IPR001841); BEST Arabidopsis thaliana protein match is: zinc finger (C3HC4-type RING finger) family protein (TAIR:AT2G26000.2); Has 920 Blast hits to 905 proteins in 150 species: Archae - 0; Bacteria - 7; Metazoa - 531; Fungi - 172; Plants - 57; Viruses - 0; Other Eukaryotes - 153 (source: NCBI BLink). 
AT2G42370AT2G42370.1CCGGCCCATATAunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G58110.1); Has 174 Blast hits to 159 proteins in 47 species: Archae - 3; Bacteria - 17; Metazoa - 67; Fungi - 5; Plants - 22; Viruses - 0; Other Eukaryotes - 60 (source: NCBI BLink). 
AT2G46600AT2G46600.1TATATGGGcalcium-binding protein, putative; FUNCTIONS IN: calcium ion binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: EF-HAND 1 (InterPro:IPR018247), EF-HAND 2 (InterPro:IPR018249), EF-Hand type (InterPro:IPR011992), EF hand (InterPro:IPR018248); BEST Arabidopsis thaliana protein match is: PBP1 (PINOID-BINDING PROTEIN 1); calcium ion binding / protein binding (TAIR:AT5G54490.1); Has 2155 Blast hits to 2154 proteins in 355 species: Archae - 0; Bacteria - 4; Metazoa - 957; Fungi - 168; Plants - 633; Viruses - 0; Other Eukaryotes - 393 (source: NCBI BLink). 
AT2G47160AT2G47160.1TATATGGGBoron transporter. Protein accumulates in shoots and roots under conditions of boron deficiency and is degraded within several hours of restoring boron supply. Localized to the plasma membrane under B limitation, and to the cytoplasm after B application before degradation. Protein is transferred via the endosomes to the vacuole for degradation. 
AT2G47160.2TATATGGGBoron transporter. Protein accumulates in shoots and roots under conditions of boron deficiency and is degraded within several hours of restoring boron supply. Localized to the plasma membrane under B limitation, and to the cytoplasm after B application before degradation. Protein is transferred via the endosomes to the vacuole for degradation. 
AT2G47640AT2G47640.1TTAAAGCCCATATAsmall nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT2G47640.2TTAAAGCCCATATAsmall nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT2G47640.3TTAAAGCCCATATAsmall nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT2G47640.4TTAAAGCCCATATAsmall nuclear ribonucleoprotein D2, putative / snRNP core protein D2, putative / Sm protein D2, putative; FUNCTIONS IN: molecular_function unknown; LOCATED IN: nucleolus, small nucleolar ribonucleoprotein complex, nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Like-Sm ribonucleoprotein, core (InterPro:IPR001163), Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core (InterPro:IPR006649), Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G62840.1); Has 534 Blast hits to 534 proteins in 163 species: Archae - 2; Bacteria - 0; Metazoa - 239; Fungi - 108; Plants - 78; Viruses - 0; Other Eukaryotes - 107 (source: NCBI BLink). 
AT3G01130AT3G01130.1TAAAGGCCCATATAAAGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G01130.2TAAAGGCCCATATAAAGCCCAATAAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G15320.1); Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06680AT3G06680.1TAAGCCCATATA60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G06680.2TAAGCCCATATA60S ribosomal protein L29 (RPL29B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29A) (TAIR:AT3G06700.3); Has 566 Blast hits to 566 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 344; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G06700AT3G06700.1AGAGGCCCATATA60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G06700.2AGAGGCCCATATA60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G06700.3AGAGGCCCATATA60S ribosomal protein L29 (RPL29A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, nucleolus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L29e (InterPro:IPR002673); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L29 (RPL29B) (TAIR:AT3G06680.2); Has 567 Blast hits to 567 proteins in 179 species: Archae - 0; Bacteria - 0; Metazoa - 345; Fungi - 69; Plants - 75; Viruses - 0; Other Eukaryotes - 78 (source: NCBI BLink). 
AT3G06710AT3G06710.1TATATGGGCCTCTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT4G32670.1); Has 8 Blast hits to 8 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 8; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06790AT3G06790.1CAAAGGCCCACTAAGCCCATATAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G06790.2CAAAGGCCCACTAAGCCCATATAplastid developmental protein DAG, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G15000.1); Has 160 Blast hits to 148 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 160; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G08530AT3G08530.1CCCATATAclathrin heavy chain, putative; FUNCTIONS IN: protein binding, structural molecule activity, binding; INVOLVED IN: intracellular protein transport, vesicle-mediated transport; LOCATED IN: plasma membrane, chloroplast, membrane; EXPRESSED IN: guard cell, leaf; EXPRESSED DURING: seedling growth; CONTAINS InterPro DOMAIN/s: Clathrin, heavy chain (InterPro:IPR016341), Clathrin, heavy chain, linker and propeller (InterPro:IPR016025), Tetratricopeptide-like helical (InterPro:IPR011990), Clathrin, heavy chain, propeller, N-terminal (InterPro:IPR001473), Clathrin, heavy chain, linker, core motif (InterPro:IPR015348), Armadillo-type fold (InterPro:IPR016024), Clathrin, heavy chain/VPS, 7-fold repeat (InterPro:IPR000547); BEST Arabidopsis thaliana protein match is: clathrin heavy chain, putative (TAIR:AT3G11130.1); Has 1212 Blast hits to 1102 proteins in 356 species: Archae - 0; Bacteria - 29; Metazoa - 727; Fungi - 112; Plants - 61; Viruses - 0; Other Eukaryotes - 283 (source: NCBI BLink). 
AT3G09030AT3G09030.1ACAGGCCCATATApotassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT5G41330.1); Has 1331 Blast hits to 1319 proteins in 94 species: Archae - 0; Bacteria - 0; Metazoa - 1177; Fungi - 0; Plants - 81; Viruses - 0; Other Eukaryotes - 73 (source: NCBI BLink). 
AT3G09080AT3G09080.1TATATGGGCCTGAAAAGCCCACtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G49660.1); Has 11046 Blast hits to 7089 proteins in 331 species: Archae - 36; Bacteria - 2713; Metazoa - 3924; Fungi - 1952; Plants - 817; Viruses - 0; Other Eukaryotes - 1604 (source: NCBI BLink). 
AT3G09085AT3G09085.1GTGGGCTTTTCAGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2253, membrane (InterPro:IPR018722); Has 550 Blast hits to 550 proteins in 186 species: Archae - 0; Bacteria - 294; Metazoa - 0; Fungi - 2; Plants - 21; Viruses - 0; Other Eukaryotes - 233 (source: NCBI BLink). 
AT3G09922AT3G09922.1TATATGGGAF236376 Arabidopsis thaliana IPS1 mRNA, complete sequence 
AT3G11270AT3G11270.1TTTAGGCCCATATAATTGGGCTTTATmaternal effect embryo arrest 34 (MEE34); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy, protein catabolic process, ubiquitin-dependent protein catabolic process; LOCATED IN: nucleus, proteasome regulatory particle, lid subcomplex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mov34/MPN/PAD-1 (InterPro:IPR000555); BEST Arabidopsis thaliana protein match is: RPN8A (RP NON-ATPASE SUBUNIT 8A) (TAIR:AT5G05780.1); Has 981 Blast hits to 977 proteins in 171 species: Archae - 0; Bacteria - 0; Metazoa - 446; Fungi - 210; Plants - 166; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink). 
AT3G12100AT3G12100.1TATATGGGCTTAGcation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). 
AT3G12100.2TATATGGGCTTAGcation efflux family protein / metal tolerance protein, putative; FUNCTIONS IN: cation transmembrane transporter activity, efflux transmembrane transporter activity; INVOLVED IN: cation transport, response to nematode; LOCATED IN: membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cation efflux protein (InterPro:IPR002524); BEST Arabidopsis thaliana protein match is: cation efflux family protein (TAIR:AT2G04620.1); Has 3834 Blast hits to 3552 proteins in 1043 species: Archae - 81; Bacteria - 2187; Metazoa - 847; Fungi - 320; Plants - 155; Viruses - 0; Other Eukaryotes - 244 (source: NCBI BLink). 
AT3G12140AT3G12140.1TATATGGGCCGAAemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G12140.2TATATGGGCCGAAemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G12140.3TATATGGGCCGAAemsy N terminus domain-containing protein / ENT domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: ENT (InterPro:IPR005491), Tudor-like, plant (InterPro:IPR014002); BEST Arabidopsis thaliana protein match is: emsy N terminus domain-containing protein / ENT domain-containing protein (TAIR:AT5G06780.1); Has 157 Blast hits to 145 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 8; Fungi - 0; Plants - 148; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT3G13030AT3G13030.1TATATGGGhAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Protein of unknown function DUF659 (InterPro:IPR007021); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G13020.1); Has 392 Blast hits to 369 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G13030.2TATATGGGhAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Protein of unknown function DUF659 (InterPro:IPR007021); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G13020.1); Has 392 Blast hits to 369 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G13030.3TATATGGGhAT dimerisation domain-containing protein; FUNCTIONS IN: protein dimerization activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: HAT dimerisation (InterPro:IPR008906), Protein of unknown function DUF659 (InterPro:IPR007021); BEST Arabidopsis thaliana protein match is: hAT dimerisation domain-containing protein (TAIR:AT3G13020.1); Has 392 Blast hits to 369 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 392; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G13290AT3G13290.1GTGGCCCATATAVARICOSE-RELATED (VCR); FUNCTIONS IN: nucleotide binding; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, cultured cell, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40 repeat (InterPro:IPR001680), WD40/YVTN repeat-like (InterPro:IPR015943); BEST Arabidopsis thaliana protein match is: VCS (VARICOSE); nucleotide binding / protein homodimerization (TAIR:AT3G13300.1); Has 812 Blast hits to 636 proteins in 176 species: Archae - 4; Bacteria - 160; Metazoa - 282; Fungi - 137; Plants - 80; Viruses - 0; Other Eukaryotes - 149 (source: NCBI BLink). 
AT3G15060AT3G15060.1TATATGGGCCATArabidopsis Rab GTPase homolog A1g (AtRABA1g); FUNCTIONS IN: GTP binding; INVOLVED IN: response to cadmium ion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579), Rab11-related (InterPro:IPR015595); BEST Arabidopsis thaliana protein match is: AtRABA1f (Arabidopsis Rab GTPase homolog A1f); GTP binding (TAIR:AT5G60860.1); Has 22374 Blast hits to 22336 proteins in 611 species: Archae - 21; Bacteria - 95; Metazoa - 12471; Fungi - 2920; Plants - 1850; Viruses - 19; Other Eukaryotes - 4998 (source: NCBI BLink). 
AT3G15220AT3G15220.1TATATGGGCCGTTAAAprotein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: spindle, cytoplasm; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase (InterPro:IPR002290), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: ATMAP4K ALPHA1; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase (TAIR:AT1G53165.2); Has 97460 Blast hits to 95819 proteins in 3033 species: Archae - 88; Bacteria - 8614; Metazoa - 42541; Fungi - 8570; Plants - 18723; Viruses - 614; Other Eukaryotes - 18310 (source: NCBI BLink). 
AT3G15690AT3G15690.1GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAATbiotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). 
AT3G15690.2GGGCCAATAATGGGCTTATATGGGCTATAAAGGCCCAAATbiotin carboxyl carrier protein of acetyl-CoA carboxylase-related; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Single hybrid motif (InterPro:IPR011053), Biotin/lipoyl attachment (InterPro:IPR000089); BEST Arabidopsis thaliana protein match is: biotin/lipoyl attachment domain-containing protein (TAIR:AT1G52670.1); Has 1999 Blast hits to 1999 proteins in 727 species: Archae - 2; Bacteria - 1353; Metazoa - 8; Fungi - 0; Plants - 75; Viruses - 0; Other Eukaryotes - 561 (source: NCBI BLink). 
AT3G16700AT3G16700.1TATATGGGCCAATAATGGGCCATAfumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). 
AT3G16700.2TATATGGGCCAATAATGGGCCATAfumarylacetoacetate hydrolase family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Fumarylacetoacetase, C-terminal-like (InterPro:IPR002529), Fumarylacetoacetase, C-terminal-related (InterPro:IPR011234); BEST Arabidopsis thaliana protein match is: fumarylacetoacetate hydrolase family protein (TAIR:AT4G15940.1); Has 7547 Blast hits to 7448 proteins in 1055 species: Archae - 132; Bacteria - 3815; Metazoa - 259; Fungi - 271; Plants - 44; Viruses - 0; Other Eukaryotes - 3026 (source: NCBI BLink). 
AT3G18790AT3G18790.1TATATGGGCTAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Isy1-like splicing (InterPro:IPR009360); Has 1075 Blast hits to 879 proteins in 176 species: Archae - 8; Bacteria - 11; Metazoa - 379; Fungi - 177; Plants - 27; Viruses - 9; Other Eukaryotes - 464 (source: NCBI BLink). 
AT3G18910AT3G18910.1TATATGGGCTTTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), F-box associated (InterPro:IPR006527), F-box associated type 1 (InterPro:IPR017451); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G18900.1); Has 733 Blast hits to 711 proteins in 28 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 731; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT3G19220AT3G19220.1TATATGGGEncodes a zinc finger protein that is similar to DnaJ and is involved in cotyledon chloroplast biogenesis. Cyo1 is localized to the thylakoid membrane and has protein disulfide isomerase activity in vivo.Cyo1 is more highly expressed in light grown seedlings. Loss of function mutants have albino cotyledons and abnormal plastids. 
AT3G23390AT3G23390.1TATATGGGCCTTAT60S ribosomal protein L36a/L44 (RPL36aA); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L44e (InterPro:IPR000552), Ribosomal protein, zinc-binding (InterPro:IPR011332); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L36a/L44 (RPL36aB) (TAIR:AT4G14320.1); Has 750 Blast hits to 748 proteins in 259 species: Archae - 104; Bacteria - 1; Metazoa - 299; Fungi - 120; Plants - 71; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT3G27230AT3G27230.1TATATGGGCTTGLOCATED IN: Golgi apparatus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: methyltransferase (TAIR:AT5G40830.2); Has 184 Blast hits to 183 proteins in 14 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 182; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G27630AT3G27630.1GTAAGGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G40460.1); Has 16 Blast hits to 16 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G44600AT3G44600.1TATATGGGCTTACyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3. 
AT3G45030AT3G45030.1GTTGGGCCCAACAAGCCCATATA40S ribosomal protein S20 (RPS20A); FUNCTIONS IN: structural constituent of ribosome, RNA binding; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, small ribosomal subunit; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Ribosomal protein S10, conserved site (InterPro:IPR018268), Ribosomal protein S10, eukaryotic/archaeal (InterPro:IPR005729), Ribosomal protein S10 (InterPro:IPR001848); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S20 (RPS20C) (TAIR:AT5G62300.2); Has 5001 Blast hits to 5001 proteins in 1494 species: Archae - 173; Bacteria - 2599; Metazoa - 280; Fungi - 90; Plants - 120; Viruses - 0; Other Eukaryotes - 1739 (source: NCBI BLink). 
AT3G45140AT3G45140.1CCCATATAChloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. 
AT3G47390AT3G47390.1CTTATTGGGCCTATATGGGCTTCcytidine/deoxycytidylate deaminase family protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: riboflavin biosynthetic process; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Conserved hypothetical protein CHP02464 (InterPro:IPR012816), CMP/dCMP deaminase, zinc-binding (InterPro:IPR002125), Cytidine deaminase-like (InterPro:IPR016193), Riboflavin-specific deaminase, C-terminal (InterPro:IPR011549), Bacterial bifunctional deaminase-reductase, C-terminal (InterPro:IPR002734), Riboflavin biosynthesis protein RibD (InterPro:IPR004794); BEST Arabidopsis thaliana protein match is: cytidine/deoxycytidylate deaminase family protein (TAIR:AT4G20960.1); Has 5155 Blast hits to 5155 proteins in 1224 species: Archae - 129; Bacteria - 2674; Metazoa - 23; Fungi - 93; Plants - 54; Viruses - 14; Other Eukaryotes - 2168 (source: NCBI BLink). 
AT3G48140AT3G48140.1TATATGGGsenescence-associated protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: leaf senescence; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: B12D (InterPro:IPR010530); BEST Arabidopsis thaliana protein match is: germination protein-related (TAIR:AT3G29970.1); Has 78 Blast hits to 78 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 78; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G48380AT3G48380.1ATATTGGGCTAGGCCCATATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G48380.1TATATGGGCTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G48380.2ATATTGGGCTAGGCCCATATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G48380.2TATATGGGCTTATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Peptidase C78, ubiquitin fold modifier-specific peptidase 1 and 2 (InterPro:IPR012462); Has 257 Blast hits to 257 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 209; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 33 (source: NCBI BLink). 
AT3G49645AT3G49645.1TATATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; Has 15 Blast hits to 15 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G50700AT3G50700.1TATATGGGzinc finger protein, similar to maize Indeterminate1 (ID1) 
AT3G50920AT3G50920.1TATATGGGCCTCAphosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT3G50920.2TATATGGGCCTCAphosphatidic acid phosphatase-related / PAP2-related; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Phosphatidic acid phosphatase type 2/haloperoxidase (InterPro:IPR000326); BEST Arabidopsis thaliana protein match is: phosphatidic acid phosphatase-related / PAP2-related (TAIR:AT5G66450.1); Has 226 Blast hits to 226 proteins in 101 species: Archae - 0; Bacteria - 16; Metazoa - 73; Fungi - 69; Plants - 40; Viruses - 0; Other Eukaryotes - 28 (source: NCBI BLink). 
AT3G51420AT3G51420.1TTTAGGCCCATATASTRICTOSIDINE SYNTHASE-LIKE 4 (SSL4); FUNCTIONS IN: strictosidine synthase activity; INVOLVED IN: alkaloid biosynthetic process, biosynthetic process; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Strictosidine synthase, conserved region (InterPro:IPR018119), Strictosidine synthase (InterPro:IPR004141), Six-bladed beta-propeller, TolB-like (InterPro:IPR011042); BEST Arabidopsis thaliana protein match is: YLS2; strictosidine synthase (TAIR:AT3G51430.1); Has 925 Blast hits to 920 proteins in 207 species: Archae - 3; Bacteria - 290; Metazoa - 196; Fungi - 4; Plants - 277; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT3G51800AT3G51800.1TGACGTGGGCTTATATGGGCCCGGTTAAGGGTAputative nuclear DNA-binding protein G2p (AtG2) mRNA, 
AT3G51800.2TGACGTGGGCTTATATGGGCCCGGTTAAGGGTAputative nuclear DNA-binding protein G2p (AtG2) mRNA, 
AT3G51880AT3G51880.1TCAGGCCCATATAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. 
AT3G51880.2TCAGGCCCATATAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. 
AT3G51880.3TCAGGCCCATATAEncodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. 
AT3G52040AT3G52040.1TCAGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; Has 21 Blast hits to 21 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G52050AT3G52050.1TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.2TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.3TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.4TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G52050.5TATATGGGCTGA5'-3' exonuclease family protein; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity; CONTAINS InterPro DOMAIN/s: 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918); BEST Arabidopsis thaliana protein match is: 5'-3' exonuclease family protein (TAIR:AT1G34380.2); Has 6752 Blast hits to 6747 proteins in 1396 species: Archae - 3; Bacteria - 3268; Metazoa - 5; Fungi - 10; Plants - 48; Viruses - 26; Other Eukaryotes - 3392 (source: NCBI BLink). 
AT3G53020AT3G53020.1TATATGGGCTAARPL24B encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B. Mutants showed defects in apical-basal gynoecium patterning similar to previously described ett and mp mutants. Transformation of stv1-1 mutant with a uORF-eliminated ETT construct partially suppressed the stv1 gynoecium phenotype, implying that STV1 could influence ETT translation through its uORFs. Regulated by TCP20. 
AT3G53030AT3G53030.1TTAGCCCATATAEncodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. 
AT3G53430AT3G53430.1CTAAGCCCATATAATATTGGGTTGGGCCGTT60S ribosomal protein L12 (RPL12B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L11 (InterPro:IPR000911); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L12 (RPL12A) (TAIR:AT2G37190.1); Has 1163 Blast hits to 1163 proteins in 435 species: Archae - 208; Bacteria - 279; Metazoa - 292; Fungi - 110; Plants - 81; Viruses - 0; Other Eukaryotes - 193 (source: NCBI BLink). 
AT3G55110AT3G55110.1CCCATATAABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport; LOCATED IN: membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: ATPase, AAA+ type, core (InterPro:IPR003593), ABC transporter-like (InterPro:IPR003439), ABC-2 (InterPro:IPR000412), ABC-2 type transporter (InterPro:IPR013525), ABC transporter, conserved site (InterPro:IPR017871); BEST Arabidopsis thaliana protein match is: ATWBC19 (White-Brown Complex homolog 19); ATPase, coupled to transmembrane movement of substances (TAIR:AT3G55130.1); Has 227231 Blast hits to 207994 proteins in 2641 species: Archae - 4288; Bacteria - 157682; Metazoa - 7085; Fungi - 4180; Plants - 2671; Viruses - 12; Other Eukaryotes - 51313 (source: NCBI BLink). 
AT3G55200AT3G55200.1TATATGGGCTTAGsplicing factor, putative; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: WD40 repeat (InterPro:IPR001680), Cleavage and polyadenylation specificity factor, A subunit, C-terminal (InterPro:IPR004871); BEST Arabidopsis thaliana protein match is: splicing factor, putative (TAIR:AT3G55220.1); Has 768 Blast hits to 695 proteins in 165 species: Archae - 0; Bacteria - 2; Metazoa - 341; Fungi - 160; Plants - 119; Viruses - 0; Other Eukaryotes - 146 (source: NCBI BLink). 
AT3G56210AT3G56210.1AGGGCCCATATAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G56210.2AGGGCCCATATAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G56210.4AGGGCCCATATAbinding; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; CONTAINS InterPro DOMAIN/s: Armadillo-type fold (InterPro:IPR016024); Has 32 Blast hits to 32 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 32; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G56240AT3G56240.1CCCATATACCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper homeostasis by delivering this metal to the secretory pathway; mainly located along the vascular bundles of senescing leaves and petioles as well as in stem sieve elements; hypothesized to have a role in copper mobilization from decaying organs towards reproductive structures, as a result of metalloprotein breakdown. The plant-specific C-terminal domain of the CCH protein forms amyloid-like fibrils in vitro. 
AT3G57440AT3G57440.1CATGGGCCTAATATATGGGCTCAunknown protein; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; Has 17 Blast hits to 17 proteins in 5 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G60245AT3G60245.1ATGGCCCATATA60S ribosomal protein L37a (RPL37aC); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein, zinc-binding (InterPro:IPR011332), Ribosomal protein L37ae (InterPro:IPR002674), Ribosomal protein L37ae/L37e, core (InterPro:IPR011331); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L37a (RPL37aB) (TAIR:AT3G10950.1); Has 762 Blast hits to 762 proteins in 273 species: Archae - 200; Bacteria - 0; Metazoa - 221; Fungi - 91; Plants - 82; Viruses - 0; Other Eukaryotes - 168 (source: NCBI BLink). 
AT3G60770AT3G60770.1TAAAGCCCATATA40S ribosomal protein S13 (RPS13A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, cell wall, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S13/S15, N-terminal (InterPro:IPR012606), Ribosomal protein S15 (InterPro:IPR000589), S15/NS1, RNA-binding (InterPro:IPR009068); BEST Arabidopsis thaliana protein match is: ATRPS13A (ARABIDOPSIS THALIANA RIBOSOMAL PROTEIN S13A); structural constituent of ribosome (TAIR:AT4G00100.1); Has 787 Blast hits to 787 proteins in 301 species: Archae - 177; Bacteria - 0; Metazoa - 232; Fungi - 99; Plants - 90; Viruses - 0; Other Eukaryotes - 189 (source: NCBI BLink). 
AT4G01150AT4G01150.1CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G01150.2CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G38100.1); Has 229 Blast hits to 229 proteins in 43 species: Archae - 0; Bacteria - 81; Metazoa - 0; Fungi - 0; Plants - 138; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink). 
AT4G01860AT4G01860.1TAAAAGCCCATATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). 
AT4G01860.2TAAAAGCCCATATAtransducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: transducin family protein / WD-40 repeat family protein (TAIR:AT3G21540.1); Has 13497 Blast hits to 7940 proteins in 390 species: Archae - 34; Bacteria - 3268; Metazoa - 4828; Fungi - 2519; Plants - 940; Viruses - 0; Other Eukaryotes - 1908 (source: NCBI BLink). 
AT4G08280AT4G08280.1TATATGGGCCGAAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutaredoxin 2 (InterPro:IPR008554), Thioredoxin fold (InterPro:IPR012335), Thioredoxin-like fold (InterPro:IPR012336); Has 214 Blast hits to 214 proteins in 65 species: Archae - 0; Bacteria - 107; Metazoa - 0; Fungi - 2; Plants - 15; Viruses - 0; Other Eukaryotes - 90 (source: NCBI BLink). 
AT4G09150AT4G09150.1TGGCCCAATAGTAAGCCCATATAT-complex protein 11; FUNCTIONS IN: phosphopantetheine binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: T-complex 11 (InterPro:IPR008862), Phosphopantetheine attachment site (InterPro:IPR006162); BEST Arabidopsis thaliana protein match is: T-complex protein 11 (TAIR:AT1G22930.1); Has 12960 Blast hits to 8305 proteins in 753 species: Archae - 49; Bacteria - 1704; Metazoa - 5727; Fungi - 995; Plants - 381; Viruses - 20; Other Eukaryotes - 4084 (source: NCBI BLink). 
AT4G13200AT4G13200.1TATATGGGCCTTTTAAAGCCCAAATunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, plastoglobule; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 68 Blast hits to 68 proteins in 35 species: Archae - 0; Bacteria - 48; Metazoa - 2; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT4G13340AT4G13340.1TATATGGGleucine-rich repeat family protein / extensin family protein; FUNCTIONS IN: structural constituent of cell wall, protein binding; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Leucine-rich repeat, N-terminal (InterPro:IPR013210), Leucine-rich repeat (InterPro:IPR001611); BEST Arabidopsis thaliana protein match is: leucine-rich repeat family protein / extensin family protein (TAIR:AT3G24480.1); Has 527469 Blast hits to 98695 proteins in 2588 species: Archae - 1432; Bacteria - 100230; Metazoa - 200562; Fungi - 58262; Plants - 84057; Viruses - 13216; Other Eukaryotes - 69710 (source: NCBI BLink). 
AT4G16130AT4G16130.1CCCATATASimilar to galactokinase. 
AT4G16180AT4G16180.1CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown. 
AT4G16180.2CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown. 
AT4G16500AT4G16500.1TATATGGGCCCATTTAcysteine protease inhibitor family protein / cystatin family protein; FUNCTIONS IN: enzyme regulator activity, cysteine-type endopeptidase inhibitor activity; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, vacuole; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Proteinase inhibitor I25, cystatin, conserved site (InterPro:IPR018073), Proteinase inhibitor I25, cystatin (InterPro:IPR000010); BEST Arabidopsis thaliana protein match is: cysteine protease inhibitor, putative / cystatin, putative (TAIR:AT5G47550.1); Has 461 Blast hits to 440 proteins in 79 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 452; Viruses - 0; Other Eukaryotes - 5 (source: NCBI BLink). 
AT4G16515AT4G16515.1CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; Has 3 Blast hits to 3 proteins in 1 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G16970AT4G16970.1TATATGGGCTCAATP binding / kinase/ protein kinase/ protein serine/threonine kinase; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: casein kinase II alpha chain, putative (TAIR:AT2G23070.1); Has 28325 Blast hits to 23063 proteins in 766 species: Archae - 4; Bacteria - 1025; Metazoa - 12500; Fungi - 3604; Plants - 4846; Viruses - 36; Other Eukaryotes - 6310 (source: NCBI BLink). 
AT4G19460AT4G19460.1CCCATATAglycosyl transferase family 1 protein; FUNCTIONS IN: transferase activity, transferring glycosyl groups; INVOLVED IN: biosynthetic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycosyl transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis thaliana protein match is: glycosyl transferase family 1 protein (TAIR:AT1G73160.1); Has 8459 Blast hits to 8455 proteins in 1224 species: Archae - 402; Bacteria - 5966; Metazoa - 68; Fungi - 63; Plants - 88; Viruses - 0; Other Eukaryotes - 1872 (source: NCBI BLink). 
AT4G20070AT4G20070.1TATATGGGCCCThe gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. 
AT4G20980AT4G20980.1TATATGGGeukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G20980.2TATATGGGeukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G20980.3TATATGGGeukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative; FUNCTIONS IN: translation initiation factor activity; INVOLVED IN: translational initiation; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Eukaryotic translation initiation factor 3, subunit 7 (InterPro:IPR007783); BEST Arabidopsis thaliana protein match is: eukaryotic translation initiation factor 3 subunit 7, putative / eIF-3 zeta, putative / eIF3d, putative (TAIR:AT5G44320.1); Has 344 Blast hits to 335 proteins in 135 species: Archae - 0; Bacteria - 0; Metazoa - 173; Fungi - 61; Plants - 41; Viruses - 0; Other Eukaryotes - 69 (source: NCBI BLink). 
AT4G21660AT4G21660.1TATATGGGCCTTATproline-rich spliceosome-associated (PSP) family protein; INVOLVED IN: mRNA processing; LOCATED IN: nucleus, chloroplast; CONTAINS InterPro DOMAIN/s: PSP, proline-rich (InterPro:IPR006568), Protein of unknown function DUF382 (InterPro:IPR007180); BEST Arabidopsis thaliana protein match is: pliceosome associated protein-related (TAIR:AT1G11520.1); Has 12288 Blast hits to 5916 proteins in 388 species: Archae - 20; Bacteria - 224; Metazoa - 7139; Fungi - 832; Plants - 388; Viruses - 239; Other Eukaryotes - 3446 (source: NCBI BLink). 
AT4G24440AT4G24440.1TATATGGGCCTTGTGTTGGGCCTTtranscription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT4G24440.2TATATGGGCCTTGTGTTGGGCCTTtranscription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S); FUNCTIONS IN: RNA polymerase II transcription factor activity; INVOLVED IN: transcription initiation from RNA polymerase II promoter; LOCATED IN: transcription factor TFIIA complex; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transcription initiation factor IIA, gamma subunit (InterPro:IPR003194), Transcription factor IIA, beta-barrel (InterPro:IPR009088), Transcription initiation factor IIA, gamma subunit, N-terminal (InterPro:IPR015872), Transcription initiation factor IIA, gamma subunit, C-terminal (InterPro:IPR015871), Transcription factor IIA, helical (InterPro:IPR009083); Has 411 Blast hits to 411 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 93; Plants - 150; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT4G24550AT4G24550.1AATAGGCCCATATAclathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT5G46630.1); Has 1549 Blast hits to 1524 proteins in 208 species: Archae - 0; Bacteria - 0; Metazoa - 875; Fungi - 294; Plants - 96; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink). 
AT4G24550.2AATAGGCCCATATAclathrin adaptor complexes medium subunit family protein; FUNCTIONS IN: protein binding; INVOLVED IN: intracellular protein transport, transport, vesicle-mediated transport; LOCATED IN: membrane coat, clathrin vesicle coat, clathrin adaptor complex; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Clathrin adaptor, mu subunit, C-terminal (InterPro:IPR008968), Clathrin adaptor, mu subunit (InterPro:IPR001392), Clathrin adaptor, sigma subunit/coatomer, zeta subunit (InterPro:IPR000804), Longin-like (InterPro:IPR011012); BEST Arabidopsis thaliana protein match is: clathrin adaptor complexes medium subunit family protein (TAIR:AT5G46630.1); Has 1549 Blast hits to 1524 proteins in 208 species: Archae - 0; Bacteria - 0; Metazoa - 875; Fungi - 294; Plants - 96; Viruses - 0; Other Eukaryotes - 284 (source: NCBI BLink). 
AT4G25340AT4G25340.1TATATGGGCTTCimmunophilin-related / FKBP-type peptidyl-prolyl cis-trans isomerase-related; FUNCTIONS IN: FK506 binding, peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding; LOCATED IN: nucleolus; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); BEST Arabidopsis thaliana protein match is: immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative (TAIR:AT5G05420.1); Has 31917 Blast hits to 22495 proteins in 1589 species: Archae - 95; Bacteria - 4690; Metazoa - 11105; Fungi - 3414; Plants - 1586; Viruses - 220; Other Eukaryotes - 10807 (source: NCBI BLink). 
AT4G26190AT4G26190.1TATATGGGCCTAATFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NLI interacting factor (InterPro:IPR004274); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G36550.1); Has 24148 Blast hits to 14674 proteins in 713 species: Archae - 56; Bacteria - 1518; Metazoa - 9576; Fungi - 1916; Plants - 955; Viruses - 87; Other Eukaryotes - 10040 (source: NCBI BLink). 
AT4G26430AT4G26430.1TATATGGGCTAAone of two genes encoding subunit 6 of COP9 signalosome complex 
AT4G27230AT4G27230.1CAAGCCCAATATAGCCCATATAEncodes HTA2, a histone H2A protein. 
AT4G29040AT4G29040.1TATATGGGCCTTAG26S proteasome AAA-ATPase subunit RPT2a (RPT2a) mRNA, 
AT4G30800AT4G30800.1AGCCCATATA40S ribosomal protein S11 (RPS11B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), Nucleic acid-binding, OB-fold (InterPro:IPR012340), Ribosomal protein S17 (InterPro:IPR000266); BEST Arabidopsis thaliana protein match is: EMB1080 (embryo defective 1080); structural constituent of ribosome (TAIR:AT3G48930.1); Has 1016 Blast hits to 1014 proteins in 353 species: Archae - 160; Bacteria - 205; Metazoa - 241; Fungi - 98; Plants - 98; Viruses - 0; Other Eukaryotes - 214 (source: NCBI BLink). 
AT4G30940AT4G30940.1TATATGGGCTTTApotassium channel tetramerisation domain-containing protein; FUNCTIONS IN: protein binding, voltage-gated potassium channel activity; INVOLVED IN: potassium ion transport; LOCATED IN: voltage-gated potassium channel complex, membrane; EXPRESSED IN: leaf whorl, male gametophyte, flower, pollen tube; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), BTB/POZ fold (InterPro:IPR011333), Potassium channel, voltage dependent, Kv, tetramerisation (InterPro:IPR003131), BTB/POZ-like (InterPro:IPR000210); BEST Arabidopsis thaliana protein match is: potassium channel tetramerisation domain-containing protein (TAIR:AT2G24240.1); Has 948 Blast hits to 933 proteins in 91 species: Archae - 0; Bacteria - 2; Metazoa - 800; Fungi - 0; Plants - 69; Viruses - 0; Other Eukaryotes - 77 (source: NCBI BLink). 
AT4G31700AT4G31700.1AAAACGGCCCATATAEncodes a putative ribosomal protein S6 (rps6). 
AT4G31700.2AAAACGGCCCATATAEncodes a putative ribosomal protein S6 (rps6). 
AT4G33865AT4G33865.1ATAAGGCCCATATA40S ribosomal protein S29 (RPS29C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S14 (InterPro:IPR001209); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S29 (RPS29B) (TAIR:AT3G44010.1); Has 694 Blast hits to 694 proteins in 260 species: Archae - 152; Bacteria - 0; Metazoa - 229; Fungi - 88; Plants - 102; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink). 
AT4G33865.1TTTAGGCCCATATA40S ribosomal protein S29 (RPS29C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S14 (InterPro:IPR001209); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S29 (RPS29B) (TAIR:AT3G44010.1); Has 694 Blast hits to 694 proteins in 260 species: Archae - 152; Bacteria - 0; Metazoa - 229; Fungi - 88; Plants - 102; Viruses - 0; Other Eukaryotes - 123 (source: NCBI BLink). 
AT4G35020AT4G35020.1TATATGGGCTA member of ROP GTPase gene family; Encodes a Rho-like GTP binding protein. 
AT4G35440AT4G35440.1ATTGGCCCATATAEnclodes a choride channel protein that is localized to the thlakoid membrane. 
AT4G35450AT4G35450.1TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G35450.2TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G35450.3TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G35450.4TATATGGGCCAATInvolved in targeting of chloroplast outer membrane proteins to the chloroplast. Double mutants of AKR2A and the highly homologous AKR2B have yellow leaves, significantly reduced chloroplast proteins, and no thylakoid membranes. 
AT4G37300AT4G37300.1AAAAGGCCCACTAAAAGCCCATATAmaternal effect embryo arrest 59 (MEE59); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 37 Blast hits to 37 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G37400AT4G37400.1TATATGGGmember of CYP81F 
AT4G37440AT4G37440.1CCCATATAunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae - 0; Bacteria - 5; Metazoa - 46; Fungi - 9; Plants - 44; Viruses - 3; Other Eukaryotes - 59 (source: NCBI BLink). 
AT4G37440.2CCCATATAunknown protein; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G59670.1); Has 166 Blast hits to 154 proteins in 41 species: Archae - 0; Bacteria - 5; Metazoa - 46; Fungi - 9; Plants - 44; Viruses - 3; Other Eukaryotes - 59 (source: NCBI BLink). 
AT4G37460AT4G37460.1AGTGGGCTAGGCCCATATAEncodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms.Involved in mediating effector-triggered immunity. 
AT4G39520AT4G39520.1TATATGGGCCTAAAGTP-binding protein, putative; FUNCTIONS IN: GTP binding; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Small GTP-binding protein (InterPro:IPR005225), TGS (InterPro:IPR004095), GTP1/OBG (InterPro:IPR006073), GTP1/OBG, conserved site (InterPro:IPR006074), GTP-binding protein, HSR1-related (InterPro:IPR002917); BEST Arabidopsis thaliana protein match is: developmentally regulated GTP-binding protein, putative (TAIR:AT1G72660.3); Has 12043 Blast hits to 12023 proteins in 1588 species: Archae - 468; Bacteria - 6069; Metazoa - 728; Fungi - 429; Plants - 176; Viruses - 0; Other Eukaryotes - 4173 (source: NCBI BLink). 
AT5G01370AT5G01370.1CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; Has 1409 Blast hits to 1156 proteins in 159 species: Archae - 0; Bacteria - 100; Metazoa - 453; Fungi - 138; Plants - 56; Viruses - 1; Other Eukaryotes - 661 (source: NCBI BLink). 
AT5G02050AT5G02050.1TATATGGGCTTCmitochondrial glycoprotein family protein / MAM33 family protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast, mitochondrial matrix; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial glycoprotein (InterPro:IPR003428); BEST Arabidopsis thaliana protein match is: mitochondrial glycoprotein family protein / MAM33 family protein (TAIR:AT3G55605.1); Has 329 Blast hits to 328 proteins in 116 species: Archae - 0; Bacteria - 2; Metazoa - 39; Fungi - 94; Plants - 115; Viruses - 0; Other Eukaryotes - 79 (source: NCBI BLink). 
AT5G03560AT5G03560.1TATATGGGCCGAAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G03560.2TATATGGGCCGAAnucleobase:cation symporter; FUNCTIONS IN: nucleobase:cation symporter activity; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G38150.2). 
AT5G04710AT5G04710.1TAGCCCATATAaspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis; LOCATED IN: chloroplast, vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G60160.1); Has 1276 Blast hits to 1273 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 40; Viruses - 0; Other Eukaryotes - 252 (source: NCBI BLink). 
AT5G04820AT5G04820.1CCCATATAARABIDOPSIS THALIANA OVATE FAMILY PROTEIN 13 (OFP13); INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF623, plant (InterPro:IPR006458); BEST Arabidopsis thaliana protein match is: OFP18 (OVATE FAMILY PROTEIN 18) (TAIR:AT3G52540.1); Has 225 Blast hits to 225 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 225; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G06830AT5G06830.1CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF773 (InterPro:IPR008491); Has 301 Blast hits to 298 proteins in 82 species: Archae - 7; Bacteria - 7; Metazoa - 191; Fungi - 5; Plants - 24; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink). 
AT5G09500AT5G09500.1TATATGGGCCTCA40S ribosomal protein S15 (RPS15C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Ribosomal protein S15, eukaryotic/archaeal (InterPro:IPR005713), Ribosomal protein S19/S15 (InterPro:IPR002222); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S15 (RPS15E) (TAIR:AT5G43640.1); Has 4939 Blast hits to 4939 proteins in 1445 species: Archae - 179; Bacteria - 2209; Metazoa - 207; Fungi - 132; Plants - 460; Viruses - 0; Other Eukaryotes - 1752 (source: NCBI BLink). 
AT5G09770AT5G09770.1TATATGGGCCCAAAGCCCAAACribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G09770.1TATATGGGCCCTribosomal protein L17 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: ribosome, intracellular; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L17 (InterPro:IPR000456); BEST Arabidopsis thaliana protein match is: ribosomal protein L17 family protein (TAIR:AT5G64650.1); Has 5413 Blast hits to 5398 proteins in 1518 species: Archae - 0; Bacteria - 3032; Metazoa - 81; Fungi - 83; Plants - 73; Viruses - 0; Other Eukaryotes - 2144 (source: NCBI BLink). 
AT5G10150AT5G10150.1TTAGCCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF966 (InterPro:IPR010369); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G59790.1); Has 96 Blast hits to 96 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 88; Viruses - 0; Other Eukaryotes - 4 (source: NCBI BLink). 
AT5G10160AT5G10160.1AAAAGGCCCATATAbeta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). 
AT5G10160.1AAAGGCCCATATAbeta-hydroxyacyl-ACP dehydratase, putative; FUNCTIONS IN: hydro-lyase activity, 3-hydroxyacyl-[acyl-carrier-protein] dehydratase activity; INVOLVED IN: fatty acid biosynthetic process; LOCATED IN: cell wall, chloroplast, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase, FabA/FabZ (InterPro:IPR013114), Beta-hydroxyacyl-(acyl-carrier-protein) dehydratase FabZ (InterPro:IPR010084); BEST Arabidopsis thaliana protein match is: beta-hydroxyacyl-ACP dehydratase, putative (TAIR:AT2G22230.1); Has 4912 Blast hits to 4909 proteins in 1231 species: Archae - 0; Bacteria - 2978; Metazoa - 1; Fungi - 0; Plants - 43; Viruses - 0; Other Eukaryotes - 1890 (source: NCBI BLink). 
AT5G10780AT5G10780.1TATATGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT5G10780.2TATATGGGFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised conserved protein UCP017207, transmembrane protein 85 (InterPro:IPR016687), Protein of unknown function DUF1077 (InterPro:IPR009445); Has 281 Blast hits to 281 proteins in 136 species: Archae - 0; Bacteria - 0; Metazoa - 114; Fungi - 83; Plants - 23; Viruses - 0; Other Eukaryotes - 61 (source: NCBI BLink). 
AT5G12020AT5G12020.1TAAAAGCCCATATA17.6 KDA CLASS II HEAT SHOCK PROTEIN (HSP17.6II); INVOLVED IN: response to heat; LOCATED IN: cellular_component unknown; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, C globular stage, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: AT-HSP17.6A (ARABIDOPSIS THALIANA HEAT SHOCK PROTEIN 17.6A); unfolded protein binding (TAIR:AT5G12030.1); Has 4227 Blast hits to 4227 proteins in 942 species: Archae - 102; Bacteria - 2394; Metazoa - 83; Fungi - 183; Plants - 932; Viruses - 0; Other Eukaryotes - 533 (source: NCBI BLink). 
AT5G14440AT5G14440.1TAAAGGCCCATATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). 
AT5G14440.2TAAAGGCCCATATAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Surfeit locus 2 (InterPro:IPR008833); BEST Arabidopsis thaliana protein match is: surfeit locus protein 2 family protein / SURF2 family protein (TAIR:AT5G40570.1); Has 6533 Blast hits to 4299 proteins in 259 species: Archae - 4; Bacteria - 127; Metazoa - 2727; Fungi - 698; Plants - 260; Viruses - 77; Other Eukaryotes - 2640 (source: NCBI BLink). 
AT5G15730AT5G15730.1TATATGGGCTAAserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G54590.2); Has 85200 Blast hits to 84239 proteins in 3312 species: Archae - 48; Bacteria - 7076; Metazoa - 38106; Fungi - 6592; Plants - 18568; Viruses - 406; Other Eukaryotes - 14404 (source: NCBI BLink). 
AT5G15730.2TATATGGGCTAAserine/threonine protein kinase, putative; FUNCTIONS IN: protein serine/threonine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G54590.2); Has 85200 Blast hits to 84239 proteins in 3312 species: Archae - 48; Bacteria - 7076; Metazoa - 38106; Fungi - 6592; Plants - 18568; Viruses - 406; Other Eukaryotes - 14404 (source: NCBI BLink). 
AT5G16350AT5G16350.1TATATGGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1298 (InterPro:IPR009721), Uncharacterised protein family UPF0089 (InterPro:IPR004255); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G12420.1); Has 652 Blast hits to 646 proteins in 102 species: Archae - 2; Bacteria - 515; Metazoa - 5; Fungi - 2; Plants - 109; Viruses - 0; Other Eukaryotes - 19 (source: NCBI BLink). 
AT5G17610AT5G17610.1CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; Has 44 Blast hits to 44 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 23; Fungi - 0; Plants - 21; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G19540AT5G19540.1CCCATATAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 48 Blast hits to 47 proteins in 16 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 18 (source: NCBI BLink). 
AT5G19750AT5G19750.1CCCATATAperoxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisomal membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein 22 kDa, putative (TAIR:AT2G14860.1); Has 15236 Blast hits to 7051 proteins in 599 species: Archae - 10; Bacteria - 4387; Metazoa - 5579; Fungi - 966; Plants - 2426; Viruses - 138; Other Eukaryotes - 1730 (source: NCBI BLink). 
AT5G19750.1TAAAGCCCATATAAAAGCCCAAAAperoxisomal membrane 22 kDa family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: peroxisomal membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Mpv17/PMP22 (InterPro:IPR007248); BEST Arabidopsis thaliana protein match is: peroxisomal membrane protein 22 kDa, putative (TAIR:AT2G14860.1); Has 15236 Blast hits to 7051 proteins in 599 species: Archae - 10; Bacteria - 4387; Metazoa - 5579; Fungi - 966; Plants - 2426; Viruses - 138; Other Eukaryotes - 1730 (source: NCBI BLink). 
AT5G20660AT5G20660.2TATATGGG24 kDa vacuolar protein, putative; FUNCTIONS IN: peptidase activity; INVOLVED IN: proteolysis; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M28 (InterPro:IPR007484); BEST Arabidopsis thaliana protein match is: peptidase (TAIR:AT1G67420.1); Has 935 Blast hits to 925 proteins in 208 species: Archae - 6; Bacteria - 236; Metazoa - 415; Fungi - 154; Plants - 39; Viruses - 0; Other Eukaryotes - 85 (source: NCBI BLink). 
AT5G22640AT5G22640.1TTCGGCCCATATAembryo defective 1211 (emb1211); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: embryonic development ending in seed dormancy; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: MORN motif (InterPro:IPR003409); Has 20090 Blast hits to 11448 proteins in 643 species: Archae - 30; Bacteria - 1497; Metazoa - 7184; Fungi - 2271; Plants - 998; Viruses - 319; Other Eukaryotes - 7791 (source: NCBI BLink). 
AT5G23575AT5G23575.1TATATGGGtransmembrane protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: callus, leaf; CONTAINS InterPro DOMAIN/s: Cleft lip and palate transmembrane 1 (InterPro:IPR008429); BEST Arabidopsis thaliana protein match is: transmembrane CLPTM1 family protein (TAIR:AT5G08500.1); Has 385 Blast hits to 385 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 50; Plants - 26; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink). 
AT5G23630AT5G23630.1GCCCATATAA novel member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. 
AT5G26680AT5G26680.1TATATGGGCTAendonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). 
AT5G26680.2TATATGGGCTAendonuclease, putative; FUNCTIONS IN: 5'-3' exonuclease activity, DNA binding, catalytic activity, nuclease activity; INVOLVED IN: DNA repair; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: XPG N-terminal (InterPro:IPR006085), DNA repair protein (XPGC)/yeast Rad (InterPro:IPR006084), 5'-3' exonuclease (InterPro:IPR002421), Helix-hairpin-helix motif, class 2 (InterPro:IPR008918), XPG I (InterPro:IPR006086); BEST Arabidopsis thaliana protein match is: DNA binding / catalytic/ nuclease (TAIR:AT1G29630.2); Has 2583 Blast hits to 2338 proteins in 522 species: Archae - 199; Bacteria - 468; Metazoa - 566; Fungi - 511; Plants - 145; Viruses - 33; Other Eukaryotes - 661 (source: NCBI BLink). 
AT5G27640AT5G27640.1AATTGGGCTTACCCGGCCCATATAencodes a member of eukaryotic translation initiation factor 3B family. 
AT5G27640.2AATTGGGCTTACCCGGCCCATATAencodes a member of eukaryotic translation initiation factor 3B family. 
AT5G27650AT5G27650.1TATATGGGCCGGGTAAGCCCAATTPWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G05430.1); Has 6970 Blast hits to 4442 proteins in 299 species: Archae - 10; Bacteria - 363; Metazoa - 3592; Fungi - 627; Plants - 302; Viruses - 141; Other Eukaryotes - 1935 (source: NCBI BLink). 
AT5G35360AT5G35360.1CCCATATAEncodes biotin carboxylase subunit (CAC2). 
AT5G35360.2CCCATATAEncodes biotin carboxylase subunit (CAC2). 
AT5G39250AT5G39250.1TAATTGGGCTTCTATATGGGCTAAGGCCTTTTF-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). 
AT5G45420AT5G45420.1TATATGGGCTTTAmyb family transcription factor; FUNCTIONS IN: transcription factor activity, DNA binding; LOCATED IN: endoplasmic reticulum, plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005), Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Homeodomain-like (InterPro:IPR009057), MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana protein match is: DNAJ heat shock N-terminal domain-containing protein / cell division protein-related (TAIR:AT3G11450.1); Has 321 Blast hits to 281 proteins in 86 species: Archae - 0; Bacteria - 2; Metazoa - 227; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 41 (source: NCBI BLink). 
AT5G45950AT5G45950.1CCCATATAGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT5G45960.1); Has 1989 Blast hits to 1968 proteins in 231 species: Archae - 0; Bacteria - 404; Metazoa - 1; Fungi - 6; Plants - 1558; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT5G45950.1CCCATATAGDSL-motif lipase/hydrolase family protein; FUNCTIONS IN: hydrolase activity, acting on ester bonds, carboxylesterase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, GDSL (InterPro:IPR001087); BEST Arabidopsis thaliana protein match is: GDSL-motif lipase/hydrolase family protein (TAIR:AT5G45960.1); Has 1989 Blast hits to 1968 proteins in 231 species: Archae - 0; Bacteria - 404; Metazoa - 1; Fungi - 6; Plants - 1558; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink). 
AT5G47110AT5G47110.1TATATGGGCTGAlil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G48710AT5G48710.1TATATGGGCTATTubiquitin-related; INVOLVED IN: protein modification process; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Ubiquitin (InterPro:IPR000626); BEST Arabidopsis thaliana protein match is: ubiquitin-related (TAIR:AT5G48700.1); Has 703 Blast hits to 702 proteins in 164 species: Archae - 0; Bacteria - 0; Metazoa - 438; Fungi - 87; Plants - 102; Viruses - 1; Other Eukaryotes - 75 (source: NCBI BLink). 
AT5G51210AT5G51210.1CCCATATAEncodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation. 
AT5G54080AT5G54080.1CCCATATAhomogentisate 1,2-dioxygenase 
AT5G54080.2CCCATATAhomogentisate 1,2-dioxygenase 
AT5G55610AT5G55610.1TTATTGGGCCTTATATGGGunknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G55610.2TTATTGGGCCTTATATGGGunknown protein; LOCATED IN: mitochondrion, chloroplast, plastid, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; Has 28 Blast hits to 27 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 28; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G56680AT5G56680.1CCCATATAEncodes a putative cytosolic asparaginyl-tRNA synthetase. 
AT5G58420AT5G58420.1CCCATATA40S ribosomal protein S4 (RPS4D); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4e, central (InterPro:IPR013845), Ribosomal protein S4e, N-terminal, conserved site (InterPro:IPR018199), KOW (InterPro:IPR005824), RNA-binding S4 (InterPro:IPR002942), Ribosomal protein S4e, N-terminal (InterPro:IPR013843), Ribosomal protein S4e (InterPro:IPR000876); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S4 (RPS4B) (TAIR:AT5G07090.1); Has 941 Blast hits to 941 proteins in 319 species: Archae - 166; Bacteria - 0; Metazoa - 329; Fungi - 122; Plants - 101; Viruses - 0; Other Eukaryotes - 223 (source: NCBI BLink). 
AT5G59590AT5G59590.1TATATGGGCUDP-GLUCOSYL TRANSFERASE 76E2 (UGT76E2); FUNCTIONS IN: quercetin 3-O-glucosyltransferase activity, quercetin 7-O-glucosyltransferase activity, UDP-glycosyltransferase activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: UDP-glucuronosyl/UDP-glucosyltransferase (InterPro:IPR002213); BEST Arabidopsis thaliana protein match is: UGT76E1 (UDP-GLUCOSYL TRANSFERASE 76E1); UDP-glycosyltransferase/ quercetin 3-O-glucosyltransferase/ quercetin 7-O-glucosyltransferase (TAIR:AT5G59580.1); Has 4913 Blast hits to 4888 proteins in 333 species: Archae - 0; Bacteria - 148; Metazoa - 1910; Fungi - 21; Plants - 2692; Viruses - 112; Other Eukaryotes - 30 (source: NCBI BLink). 
AT5G60590AT5G60590.1GCCCATATAyrdC protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sua5/YciO/YrdC/YwlC (InterPro:IPR004388), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945), Sua5/YciO/YrdC, N-terminal (InterPro:IPR006070); BEST Arabidopsis thaliana protein match is: yrdC family protein (TAIR:AT3G01920.1); Has 5651 Blast hits to 5650 proteins in 1402 species: Archae - 124; Bacteria - 3268; Metazoa - 130; Fungi - 89; Plants - 38; Viruses - 0; Other Eukaryotes - 2002 (source: NCBI BLink). 
AT5G60590.2GCCCATATAyrdC protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Sua5/YciO/YrdC/YwlC (InterPro:IPR004388), DHBP synthase RibB-like alpha/beta domain (InterPro:IPR017945), Sua5/YciO/YrdC, N-terminal (InterPro:IPR006070); BEST Arabidopsis thaliana protein match is: yrdC family protein (TAIR:AT3G01920.1); Has 5651 Blast hits to 5650 proteins in 1402 species: Archae - 124; Bacteria - 3268; Metazoa - 130; Fungi - 89; Plants - 38; Viruses - 0; Other Eukaryotes - 2002 (source: NCBI BLink). 
AT5G60790AT5G60790.1TTAAAGCCCATATAmember of GCN subfamily 
AT5G61865AT5G61865.1TATATGGGCCTGGunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; Has 51 Blast hits to 51 proteins in 26 species: Archae - 3; Bacteria - 6; Metazoa - 23; Fungi - 3; Plants - 4; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink). 
AT5G61970AT5G61970.1AGAGGCCCATATAsignal recognition particle-related / SRP-related; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; Has 286 Blast hits to 286 proteins in 120 species: Archae - 2; Bacteria - 4; Metazoa - 134; Fungi - 62; Plants - 27; Viruses - 0; Other Eukaryotes - 57 (source: NCBI BLink). 
AT5G63460AT5G63460.1TTAAGGCCCATATASAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT5G63460.2TTAAGGCCCATATASAP domain-containing protein; FUNCTIONS IN: DNA binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus, chloroplast; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: L mature pollen stage; CONTAINS InterPro DOMAIN/s: DNA-binding SAP (InterPro:IPR003034), Ubiquitin ligase, Det1/DDB1-complexing (InterPro:IPR018276); Has 67 Blast hits to 67 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 33; Viruses - 0; Other Eukaryotes - 34 (source: NCBI BLink). 
AT5G65910AT5G65910.1TATATGGGCTATTBSD domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: BSD (InterPro:IPR005607); BEST Arabidopsis thaliana protein match is: BSD domain-containing protein (TAIR:AT3G49800.1); Has 402 Blast hits to 370 proteins in 82 species: Archae - 0; Bacteria - 12; Metazoa - 122; Fungi - 40; Plants - 133; Viruses - 0; Other Eukaryotes - 95 (source: NCBI BLink). 
AT5G66010AT5G66010.1TATATGGGCCTCARNA binding / nucleic acid binding / nucleotide binding; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT3G20890.1); Has 2870 Blast hits to 1043 proteins in 107 species: Archae - 0; Bacteria - 0; Metazoa - 2605; Fungi - 10; Plants - 100; Viruses - 0; Other Eukaryotes - 155 (source: NCBI BLink). 
AT5G66080AT5G66080.1AGGGCCCATATAprotein phosphatase 2C family protein / PP2C family protein; FUNCTIONS IN: protein serine/threonine phosphatase activity, catalytic activity; INVOLVED IN: protein amino acid dephosphorylation; LOCATED IN: protein serine/threonine phosphatase complex; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein phosphatase 2C, manganese/magnesium aspartate binding site (InterPro:IPR000222), Protein phosphatase 2C-related (InterPro:IPR001932), Protein phosphatase 2C (InterPro:IPR015655), Protein phosphatase 2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis thaliana protein match is: protein phosphatase 2C, putative / PP2C, putative (TAIR:AT3G51370.1); Has 3605 Blast hits to 3604 proteins in 217 species: Archae - 0; Bacteria - 11; Metazoa - 1260; Fungi - 366; Plants - 1225; Viruses - 5; Other Eukaryotes - 738 (source: NCBI BLink). 
AT5G66090AT5G66090.1TATATGGGCCCTunknown protein; FUNCTIONS IN: molecular_function unknown; LOCATED IN: chloroplast, chloroplast stroma; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 10; Metazoa - 0; Fungi - 0; Plants - 18; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G66910AT5G66910.1TTATGGGCCCATATAdisease resistance protein (CC-NBS-LRR class), putative; FUNCTIONS IN: protein binding, ATP binding; INVOLVED IN: defense response, apoptosis; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: NB-ARC (InterPro:IPR002182), Disease resistance, plant (InterPro:IPR014011), Leucine-rich repeat (InterPro:IPR001611), Mildew-resistance, broad-spectrum (InterPro:IPR008808); BEST Arabidopsis thaliana protein match is: disease resistance protein (CC-NBS-LRR class), putative (TAIR:AT5G66900.1); Has 19423 Blast hits to 11897 proteins in 451 species: Archae - 22; Bacteria - 1182; Metazoa - 2936; Fungi - 103; Plants - 14487; Viruses - 0; Other Eukaryotes - 693 (source: NCBI BLink). 
AT5G67510AT5G67510.1AAAGCCCATATA60S ribosomal protein L26 (RPL26B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, large ribosomal subunit; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Translation protein SH3-like (InterPro:IPR008991), Ribosomal protein L26, eukaryotic/archaeal (InterPro:IPR005756), Ribosomal protein L24, SH3-like (InterPro:IPR014723), Ribosomal protein L24/L26, conserved site (InterPro:IPR005825), KOW (InterPro:IPR005824); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L26 (RPL26A) (TAIR:AT3G49910.1); Has 893 Blast hits to 893 proteins in 319 species: Archae - 233; Bacteria - 15; Metazoa - 308; Fungi - 91; Plants - 68; Viruses - 0; Other Eukaryotes - 178 (source: NCBI BLink). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.