version

Summary of AtREG636 (All List)

OrganismArabidopsis thaliana  
IDAtREG636  
SequenceACCCCTTA  
Annotation  
PPDB MotifACCCCT  function unknown  
PLACE Motif 
Total Entry Count65  

Entry Sequences (65 entries)

LocusGene modelSequenceDescription
AT1G01260AT1G01260.1TAAGGGGTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G01260.2TAAGGGGTbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: ATAIB (ABA-INDUCIBLE BHLH-TYPE TRANSCRIPTION FACTOR); DNA binding / transcription factor (TAIR:AT2G46510.1); Has 2098 Blast hits to 1892 proteins in 178 species: Archae - 0; Bacteria - 2; Metazoa - 163; Fungi - 52; Plants - 1843; Viruses - 0; Other Eukaryotes - 38 (source: NCBI BLink). 
AT1G03470AT1G03470.1TAAGGGGTkinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink). 
AT1G03470.2TAAGGGGTkinase interacting family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: KIP1-like (InterPro:IPR011684); BEST Arabidopsis thaliana protein match is: kinase interacting family protein (TAIR:AT2G47920.1); Has 483 Blast hits to 464 proteins in 82 species: Archae - 6; Bacteria - 7; Metazoa - 113; Fungi - 35; Plants - 165; Viruses - 3; Other Eukaryotes - 154 (source: NCBI BLink). 
AT1G04570AT1G04570.1ACCCCTTAintegral membrane transporter family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: transport; LOCATED IN: chloroplast, membrane; CONTAINS InterPro DOMAIN/s: Biopterin transport-related protein BT1 (InterPro:IPR004324), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: integral membrane transporter family protein (TAIR:AT2G33280.1); Has 457 Blast hits to 455 proteins in 149 species: Archae - 6; Bacteria - 186; Metazoa - 0; Fungi - 8; Plants - 126; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink). 
AT1G05510AT1G05510.1TAAGGGGTProtein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. 
AT1G17520AT1G17520.1TTTGACCCCTTADNA-binding protein, putative; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: in 6 processes; LOCATED IN: nucleus, nucleosome; EXPRESSED IN: 11 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Winged helix repressor DNA-binding (InterPro:IPR011991), SANT, DNA-binding (InterPro:IPR001005), Homeodomain-like (InterPro:IPR009057), Myb, DNA-binding (InterPro:IPR014778), Histone H1/H5 (InterPro:IPR005818), Homeodomain-related (InterPro:IPR012287), Myb-type HTH DNA-binding domain (InterPro:IPR017930); BEST Arabidopsis thaliana protein match is: DNA-binding family protein / histone H1/H5 family protein (TAIR:AT1G72740.1); Has 615 Blast hits to 611 proteins in 121 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 63; Plants - 394; Viruses - 0; Other Eukaryotes - 53 (source: NCBI BLink). 
AT1G17530AT1G17530.1TAAGGGGTCAAAEncodes a translocase of inner mitochondrial membrane. 
AT1G26250AT1G26250.1TAAGGGGTproline-rich extensin, putative; FUNCTIONS IN: structural constituent of cell wall; INVOLVED IN: plant-type cell wall organization; LOCATED IN: endomembrane system; CONTAINS InterPro DOMAIN/s: Extensin-like region (InterPro:IPR006706); Has 254179 Blast hits to 36300 proteins in 1345 species: Archae - 786; Bacteria - 38672; Metazoa - 98390; Fungi - 32269; Plants - 40660; Viruses - 7285; Other Eukaryotes - 36117 (source: NCBI BLink). 
AT1G26470AT1G26470.1ACCCCTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus, H4/H2A histone acetyltransferase complex; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: CT20 (InterPro:IPR012423); Has 39 Blast hits to 39 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 24; Fungi - 0; Plants - 15; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G31320AT1G31320.1TAAGGGGTAALOB DOMAIN-CONTAINING PROTEIN 4 (LBD4); INVOLVED IN: biological_process unknown; EXPRESSED IN: 13 plant structures; EXPRESSED DURING: 4 anthesis, F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; CONTAINS InterPro DOMAIN/s: Lateral organ boundaries, LOB (InterPro:IPR004883); BEST Arabidopsis thaliana protein match is: ASL5; DNA binding / protein binding (TAIR:AT2G30130.1); Has 595 Blast hits to 592 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 595; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT1G49670AT1G49670.1ACCCCTTAmolecular function has not been defined. Was shown involved in oxidative stress tolerance. 
AT1G69870AT1G69870.1ACCCCTTAproton-dependent oligopeptide transport (POT) family protein; FUNCTIONS IN: transporter activity; INVOLVED IN: response to salt stress, oligopeptide transport; LOCATED IN: plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TGF-beta receptor, type I/II extracellular region (InterPro:IPR000109), Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: NRT1.6 (NITRATE TRANSPORTER 1.6); low affinity nitrate transmembrane transporter/ transporter (TAIR:AT1G27080.1); Has 2739 Blast hits to 2630 proteins in 509 species: Archae - 0; Bacteria - 693; Metazoa - 468; Fungi - 272; Plants - 1130; Viruses - 0; Other Eukaryotes - 176 (source: NCBI BLink). 
AT1G71692AT1G71692.1ACCCCTTAEncodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots. 
AT1G79060AT1G79060.1ACCCCTTAunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: F mature embryo stage, petal differentiation and expansion stage, D bilateral stage, E expanded cotyledon stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G56020.1); Has 3270 Blast hits to 887 proteins in 158 species: Archae - 0; Bacteria - 617; Metazoa - 634; Fungi - 189; Plants - 72; Viruses - 8; Other Eukaryotes - 1750 (source: NCBI BLink). 
AT1G79200AT1G79200.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 6 growth stages; Has 3292 Blast hits to 2186 proteins in 154 species: Archae - 0; Bacteria - 21; Metazoa - 1599; Fungi - 418; Plants - 200; Viruses - 0; Other Eukaryotes - 1054 (source: NCBI BLink). 
AT2G06510AT2G06510.1TAAGGGGTEncodes a homolog of Replication Protein A that is involved in meiosis I in pollen mother cells. rpa1a mutants have a reduced number of class I crossovers. The protein is located in chromatin-associated foci in early leptotene and can be detected in these foci until late pachytene of meiosis I. 
AT2G06510.2TAAGGGGTEncodes a homolog of Replication Protein A that is involved in meiosis I in pollen mother cells. rpa1a mutants have a reduced number of class I crossovers. The protein is located in chromatin-associated foci in early leptotene and can be detected in these foci until late pachytene of meiosis I. 
AT2G21640AT2G21640.1TAAGGGGTCAAAEncodes a protein of unknown function that is a marker for oxidative stress response. 
AT2G28290AT2G28290.1CAAGGCCCATTAAGGGGTEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. 
AT2G28290.2CAAGGCCCATTAAGGGGTEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. 
AT2G28290.3CAAGGCCCATTAAGGGGTEncodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. 
AT2G28620AT2G28620.1TAAGGGGTkinesin motor protein-related; FUNCTIONS IN: microtubule motor activity, ATP binding; INVOLVED IN: microtubule-based movement; LOCATED IN: microtubule associated complex, chloroplast; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Kinesin, motor region (InterPro:IPR001752); BEST Arabidopsis thaliana protein match is: kinesin motor protein-related (TAIR:AT3G45850.1); Has 38255 Blast hits to 26694 proteins in 1178 species: Archae - 315; Bacteria - 3865; Metazoa - 19131; Fungi - 3066; Plants - 1862; Viruses - 111; Other Eukaryotes - 9905 (source: NCBI BLink). 
AT2G32800AT2G32800.1TAAGGGGTAP4.3A; FUNCTIONS IN: protein serine/threonine kinase activity, protein tyrosine kinase activity, protein kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; LOCATED IN: plasma membrane; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding site (InterPro:IPR017441), Serine/threonine protein kinase (InterPro:IPR002290), Tyrosine protein kinase (InterPro:IPR001245), Serine/threonine protein kinase-related (InterPro:IPR017442), Protein kinase-like (InterPro:IPR011009), Serine/threonine protein kinase, active site (InterPro:IPR008271), Protein kinase, core (InterPro:IPR000719); BEST Arabidopsis thaliana protein match is: lectin protein kinase, putative (TAIR:AT3G53810.1); Has 111168 Blast hits to 73136 proteins in 2997 species: Archae - 51; Bacteria - 9911; Metazoa - 45746; Fungi - 7567; Plants - 30942; Viruses - 390; Other Eukaryotes - 16561 (source: NCBI BLink). 
AT3G02350AT3G02350.1TAAGGGGTEncodes a protein with putative galacturonosyltransferase activity. 
AT3G05060AT3G05060.1AAATACCCCTTASAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein 
AT3G05070AT3G05070.1TAAGGGGTATTTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: mRNA splicing factor, Cwf18 (InterPro:IPR013169); Has 221 Blast hits to 221 proteins in 113 species: Archae - 0; Bacteria - 0; Metazoa - 107; Fungi - 54; Plants - 17; Viruses - 9; Other Eukaryotes - 34 (source: NCBI BLink). 
AT3G11880AT3G11880.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G70770.1); Has 64 Blast hits to 63 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 38; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G12560AT3G12560.1TAAGGGGTEncodes a telomeric DNA-binding protein. 
AT3G23290AT3G23290.2AAATACCCCTTALIGHT SENSITIVE HYPOCOTYLS 4 (LSH4); EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF640 (InterPro:IPR006936); BEST Arabidopsis thaliana protein match is: LSH3 (LIGHT SENSITIVE HYPOCOTYLS 3) (TAIR:AT2G31160.1); Has 185 Blast hits to 185 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 171; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G27850AT3G27850.1AAATACCCCTTA50S ribosomal protein L12-C 
AT3G52930AT3G52930.1TAAGGGGTfructose-bisphosphate aldolase, putative; FUNCTIONS IN: fructose-bisphosphate aldolase activity, catalytic activity; INVOLVED IN: response to cadmium ion, response to salt stress, pentose-phosphate shunt; LOCATED IN: in 7 components; EXPRESSED IN: 29 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Aldolase-type TIM barrel (InterPro:IPR013785), Fructose-bisphosphate aldolase, class-I (InterPro:IPR000741); BEST Arabidopsis thaliana protein match is: fructose-bisphosphate aldolase, putative (TAIR:AT2G36460.1); Has 4403 Blast hits to 4398 proteins in 740 species: Archae - 0; Bacteria - 427; Metazoa - 1257; Fungi - 2; Plants - 339; Viruses - 0; Other Eukaryotes - 2378 (source: NCBI BLink). 
AT3G53370AT3G53370.1TAAGGGGTDNA-binding S1FA family protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: DNA binding protein S1FA (InterPro:IPR006779); Has 54 Blast hits to 54 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT3G54190AT3G54190.1ACCCCTTAAACGCTGCGTTTTAFUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G38630.1); Has 77 Blast hits to 77 proteins in 20 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 26 (source: NCBI BLink). 
AT3G59540AT3G59540.1TTAATGGGCCTAAGGGGT60S ribosomal protein L38 (RPL38B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic large ribosomal subunit, ribosome; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L38e (InterPro:IPR002675); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L38 (RPL38A) (TAIR:AT2G43460.1); Has 458 Blast hits to 458 proteins in 191 species: Archae - 3; Bacteria - 0; Metazoa - 220; Fungi - 79; Plants - 70; Viruses - 0; Other Eukaryotes - 86 (source: NCBI BLink). 
AT3G63210AT3G63210.1TAAGGGGTAAencodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 
AT4G10270AT4G10270.1CCCAATATTACCCCTTAwound-responsive family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to wounding; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; BEST Arabidopsis thaliana protein match is: wound-responsive protein, putative (TAIR:AT4G10265.1); Has 110 Blast hits to 109 proteins in 12 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 110; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT4G11980AT4G11980.1ACCCCTTAARABIDOPSIS THALIANA NUDIX HYDROLASE HOMOLOG 14 (ATNUDX14); FUNCTIONS IN: hydrolase activity, ADP-sugar diphosphatase activity, ADP-ribose pyrophosphohydrolase activity, ADP-glucose pyrophosphohydrolase activity; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: NUDIX (InterPro:IPR015797), NUDIX hydrolase, core (InterPro:IPR000086); Has 845 Blast hits to 845 proteins in 388 species: Archae - 4; Bacteria - 636; Metazoa - 8; Fungi - 51; Plants - 17; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink). 
AT4G13010AT4G13010.1TTACCCCTTAoxidoreductase, zinc-binding dehydrogenase family protein; FUNCTIONS IN: oxidoreductase activity, binding, catalytic activity, zinc ion binding; INVOLVED IN: oxidation reduction, metabolic process; LOCATED IN: chloroplast thylakoid membrane, chloroplast, plasma membrane, vacuole; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GroES-like (InterPro:IPR011032), NAD(P)-binding (InterPro:IPR016040), Alcohol dehydrogenase GroES-like (InterPro:IPR013154), Alcohol dehydrogenase, zinc-binding (InterPro:IPR013149), Alcohol dehydrogenase superfamily, zinc-containing (InterPro:IPR002085); BEST Arabidopsis thaliana protein match is: oxidoreductase, zinc-binding dehydrogenase family protein (TAIR:AT1G23740.1); Has 22117 Blast hits to 22019 proteins in 1513 species: Archae - 254; Bacteria - 11468; Metazoa - 1023; Fungi - 2323; Plants - 851; Viruses - 3; Other Eukaryotes - 6195 (source: NCBI BLink). 
AT4G20930AT4G20930.1TAAGGGGT3-hydroxyisobutyrate dehydrogenase, putative; FUNCTIONS IN: in 7 functions; INVOLVED IN: pentose-phosphate shunt, valine metabolic process, valine catabolic process, metabolic process; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: 6-phosphogluconate dehydrogenase, NAD-binding (InterPro:IPR006115), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), Dehydrogenase, multihelical (InterPro:IPR013328), 3-hydroxyacid dehydrogenase/reductase (InterPro:IPR015815), 3-hydroxyisobutyrate dehydrogenase (InterPro:IPR011548), NAD(P)-binding (InterPro:IPR016040), 3-hydroxyisobutyrate dehydrogenase-related, conserved site (InterPro:IPR002204); BEST Arabidopsis thaliana protein match is: GLYR2 (GLYOXYLATE REDUCTASE 2); glyoxylate reductase (NADP)/ phosphogluconate dehydrogenase (decarboxylating) (TAIR:AT1G17650.1); Has 10362 Blast hits to 10344 proteins in 1053 species: Archae - 94; Bacteria - 4661; Metazoa - 269; Fungi - 232; Plants - 134; Viruses - 2; Other Eukaryotes - 4970 (source: NCBI BLink). 
AT4G24840AT4G24840.1TAAGGGGTFUNCTIONS IN: molecular_function unknown; INVOLVED IN: protein transport, Golgi organization; LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: COG complex component, COG2 (InterPro:IPR009316); Has 214 Blast hits to 204 proteins in 99 species: Archae - 0; Bacteria - 0; Metazoa - 105; Fungi - 56; Plants - 22; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink). 
AT4G25670AT4G25670.1TAAGGGGTunknown protein; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte, pollen tube; EXPRESSED DURING: M germinated pollen stage; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G25690.2); Has 46 Blast hits to 40 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 5; Fungi - 2; Plants - 38; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT4G39220AT4G39220.1TAAGGGGTKey player of retrieval of ER membrane proteins 
AT5G05730AT5G05730.1TAAGGGGTATTASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. 
AT5G06450AT5G06450.1ACCCCTTAnucleic acid binding; FUNCTIONS IN: nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: cultured cell; CONTAINS InterPro DOMAIN/s: Polynucleotidyl transferase, Ribonuclease H fold (InterPro:IPR012337); BEST Arabidopsis thaliana protein match is: nucleic acid binding (TAIR:AT3G11770.1); Has 41 Blast hits to 41 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G07190AT5G07190.1TAAGGGGTGene is expressed preferentially in the embryo and encodes a unique protein of unknown function. 
AT5G07190.2TAAGGGGTGene is expressed preferentially in the embryo and encodes a unique protein of unknown function. 
AT5G07440AT5G07440.1TAAGGGGTAAEncodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. 
AT5G07440.2TAAGGGGTAAEncodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. 
AT5G07440.3TAAGGGGTAAEncodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. 
AT5G11500AT5G11500.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF814 (InterPro:IPR008532); Has 474 Blast hits to 464 proteins in 164 species: Archae - 0; Bacteria - 62; Metazoa - 174; Fungi - 86; Plants - 37; Viruses - 1; Other Eukaryotes - 114 (source: NCBI BLink). 
AT5G11610AT5G11610.1TAAGGGGTexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 809 Blast hits to 805 proteins in 87 species: Archae - 0; Bacteria - 10; Metazoa - 228; Fungi - 4; Plants - 492; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT5G11610.2TAAGGGGTexostosin family protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, membrane; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: LP.06 six leaves visible, LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Exostosin-like (InterPro:IPR004263); BEST Arabidopsis thaliana protein match is: exostosin family protein (TAIR:AT5G25820.1); Has 809 Blast hits to 805 proteins in 87 species: Archae - 0; Bacteria - 10; Metazoa - 228; Fungi - 4; Plants - 492; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink). 
AT5G15710AT5G15710.1ACCCCTTAF-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), F-box associated type 1 (InterPro:IPR017451), Kelch-type beta propeller (InterPro:IPR015915); BEST Arabidopsis thaliana protein match is: UFO (UNUSUAL FLORAL ORGANS); transcription factor binding / ubiquitin-protein ligase (TAIR:AT1G30950.1); Has 767 Blast hits to 766 proteins in 48 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 767; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G22330AT5G22330.1ACCCCTTARESISTANCE TO PSEUDOMONAS SYRINGAE PV MACULICOLA INTERACTOR 1 (RIN1); FUNCTIONS IN: protein binding; INVOLVED IN: defense response to fungus, incompatible interaction, meristem development; LOCATED IN: nucleolus, nucleus, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TIP49, C-terminal (InterPro:IPR010339), ATPase, AAA-type, core (InterPro:IPR003959), ATPase, AAA+ type, core (InterPro:IPR003593); BEST Arabidopsis thaliana protein match is: DNA helicase, putative (TAIR:AT5G67630.1); Has 2675 Blast hits to 2634 proteins in 789 species: Archae - 254; Bacteria - 1222; Metazoa - 326; Fungi - 290; Plants - 78; Viruses - 0; Other Eukaryotes - 505 (source: NCBI BLink). 
AT5G22340AT5G22340.1TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G22340.2TAAGGGGTunknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 24 Blast hits to 24 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 23; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). 
AT5G36230AT5G36230.1TAAGGGGTAAeIF4-gamma/eIF5/eIF2-epsilon domain-containing protein; FUNCTIONS IN: binding, translation initiation factor activity; INVOLVED IN: regulation of translational initiation; LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: eIF4-gamma/eIF5/eIF2-epsilon (InterPro:IPR003307), Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis thaliana protein match is: eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein (TAIR:AT1G65220.1); Has 758 Blast hits to 756 proteins in 100 species: Archae - 0; Bacteria - 0; Metazoa - 591; Fungi - 39; Plants - 97; Viruses - 3; Other Eukaryotes - 28 (source: NCBI BLink). 
AT5G43513AT5G43513.1ACCCCTTAEncodes a defensin-like (DEFL) family protein. 
AT5G45550AT5G45550.1TAAGGGGTmob1/phocein family protein; FUNCTIONS IN: protein binding; INVOLVED IN: biological_process unknown; LOCATED IN: nucleus; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Mob1/phocein (InterPro:IPR005301); BEST Arabidopsis thaliana protein match is: protein binding (TAIR:AT4G19045.1); Has 961 Blast hits to 955 proteins in 140 species: Archae - 0; Bacteria - 0; Metazoa - 597; Fungi - 188; Plants - 65; Viruses - 0; Other Eukaryotes - 111 (source: NCBI BLink). 
AT5G58430AT5G58430.1TAAGGGGTA member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. 
AT5G65320AT5G65320.1AATACCCCTTAbasic helix-loop-helix (bHLH) family protein; FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: hypocotyl, root, leaf; EXPRESSED DURING: LP.04 four leaves visible, LP.10 ten leaves visible, 4 leaf senescence stage; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: basic helix-loop-helix (bHLH) family protein (bHLH096) (TAIR:AT1G72210.1); Has 641 Blast hits to 636 proteins in 80 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi - 18; Plants - 603; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). 
AT5G66700AT5G66700.1TAAGGGGTEncodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. 
ATCG00170ATCG00170.1TAAGGGGTRNA polymerase beta' subunit-2 
ATCG00300ATCG00300.1TAAGGGGTencodes PsbZ, which is a subunit of photosystem II. In Chlamydomonas, this protein has been shown to be essential in the interaction between PS II and the light harvesting complex II. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.