version

Summary of OsREG419 (All List)

OrganismOryza sativa  
IDOsREG419  
SequenceAAAAGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1410  

Entry Sequences (1410 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0104800AK067602AAAAGCCCATGTSas10/Utp3 family protein. 
J013109E04AAAAGCCCATGTNONE 
J033057M05AAAAGCCCATGTNONE 
J043021M24AAAAGCCCATGTNONE 
J090014N05AAAAGCCCATGTNONE 
J090077H23AAAAGCCCATGTNONE 
J090084H08AAAAGCCCATGTNONE 
Os01g0158900AK066765AAAAGCCCAATZinc finger, RING-type domain containing protein. 
Os01g0190400AK064011AAAAGCCCAACSimilar to Hexokinase. 
AK099119AAAAGCCCAACNONE 
Os01g0191100009-011-A02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-028-D05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-058-B11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-151-D09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-026-G03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-063-F04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-069-B05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-029-E04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-072-H04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-089-E09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
015-047-G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
016-033-G06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
AK058815CCACCTGTGGGCCTTCTGGGCTTTTSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023077K21CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023081F19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033052N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033058N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114O17CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033129L14CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J053029I12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065067N19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065084I19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065099O03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065201I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075035B08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075037B22CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075054L16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075059D15CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075164I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075185J01CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090042O06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090044F12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090063L02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090073I10CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090078E18CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J100072K16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
Os01g0209200AK103145AAAAGCCCSimilar to 14-3-3 protein 7. 
Os01g0212100AK065467AAAAGCCCATTTNONE 
AK101456AAAAGCCCATTTATP-dependent helicase, DEAH-box family protein. 
Os01g0231700012-002-F11TCATGGGCTTTTNONE 
013-082-F05TCATGGGCTTTTNONE 
AK107453TCATGGGCTTTTSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22TCATGGGCTTTTNONE 
J065023E21TCATGGGCTTTTNONE 
J065036H21TCATGGGCTTTTNONE 
J065037M24TCATGGGCTTTTNONE 
J065049L04TCATGGGCTTTTNONE 
J065072F17TCATGGGCTTTTNONE 
J065085H10TCATGGGCTTTTNONE 
J065109N19TCATGGGCTTTTNONE 
J065117M19TCATGGGCTTTTNONE 
J065144C15TCATGGGCTTTTNONE 
J065159G24TCATGGGCTTTTNONE 
J065164N14TCATGGGCTTTTNONE 
J075025K16TCATGGGCTTTTNONE 
J075057L05TCATGGGCTTTTNONE 
J075070I16TCATGGGCTTTTNONE 
J075089D10TCATGGGCTTTTNONE 
J075138F10TCATGGGCTTTTNONE 
J090018C11TCATGGGCTTTTNONE 
J100018L19TCATGGGCTTTTNONE 
J100024B14TCATGGGCTTTTNONE 
J100048L02TCATGGGCTTTTNONE 
J100055A22TCATGGGCTTTTNONE 
J100069K01TCATGGGCTTTTNONE 
Os01g0253100AK061932GGGCTTTTNONE 
Os01g0261500AK072194GTTGGTGGTGTGGGCTTTTNONE 
AK101899GTTGGTGGTGTGGGCTTTTConserved hypothetical protein. 
J065041N17GTTGGTGGTGTGGGCTTTTNONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0390400AK067433GGGCTTTTNONE 
AK106834GGGCTTTTNONE 
J033069B09GGGCTTTTNONE 
Os01g0495900AK065221TAATGGGCTTTTSimilar to CRS2-associated factor 1. 
Os01g0513800012-032-E11GGCCGAAAAGCCCATANONE 
AK100776GGCCGAAAAGCCCATASimilar to Brix domain containing protein 1 homolog. 
J023120C10GGCCGAAAAGCCCATANONE 
J033044A22GGCCGAAAAGCCCATANONE 
J033048H13GGCCGAAAAGCCCATANONE 
J033118F03GGCCGAAAAGCCCATANONE 
J065176B05GGCCGAAAAGCCCATANONE 
J075026B19GGCCGAAAAGCCCATANONE 
J075048I23GGCCGAAAAGCCCATANONE 
J075141A19GGCCGAAAAGCCCATANONE 
J075148E05GGCCGAAAAGCCCATANONE 
J090031M12GGCCGAAAAGCCCATANONE 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0590300014-089-E04AAAAGCCCAGCNONE 
AK063740AAAAGCCCAGCConserved hypothetical protein. 
Os01g0611100AB015288AAAAGCCCSimilar to GTP-binding nuclear protein Ran-2. 
AB015971AAAAGCCCNONE 
AK072731AAAAGCCCNONE 
J023140D03AAAAGCCCNONE 
J065013J15AAAAGCCCNONE 
J065061L17AAAAGCCCNONE 
J065122G07AAAAGCCCNONE 
J065130B16AAAAGCCCNONE 
J065198G08AAAAGCCCNONE 
J100079K21AAAAGCCCNONE 
Os01g0647700AK100691GGGCTTTTEpoxide hydrolase family protein. 
Os01g0649900AK068077TTTTGGGCTTTTLipolytic enzyme, G-D-S-L family protein. 
Os01g0695900AK108259AAAAGCCCOSMYB4. 
D88620AAAAGCCCNONE 
Os01g0736100011-091-H04TTTTGGGCTTTTNONE 
015-004-D10TTTTGGGCTTTTNONE 
AK064298TTTTGGGCTTTTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365TTTTGGGCTTTTNONE 
AK103355TTTTGGGCTTTTNONE 
J033044B20TTTTGGGCTTTTNONE 
J033094G06TTTTGGGCTTTTNONE 
J033111N02TTTTGGGCTTTTNONE 
J033111P10TTTTGGGCTTTTNONE 
J033126K03TTTTGGGCTTTTNONE 
J043034D12TTTTGGGCTTTTNONE 
Os01g0749900AK103588AAAAGCCCProtein of unknown function DUF250 domain containing protein. 
AK103588AAAAGCCCProtein of unknown function DUF250 domain containing protein. 
J033090O22AAAAGCCCNONE 
J033090O22AAAAGCCCNONE 
J033133C05AAAAGCCCNONE 
J033133C05AAAAGCCCNONE 
J065122N01AAAAGCCCNONE 
J065122N01AAAAGCCCNONE 
J065188K04AAAAGCCCNONE 
J065188K04AAAAGCCCNONE 
J090012D18AAAAGCCCNONE 
J090012D18AAAAGCCCNONE 
J100074N02AAAAGCCCNONE 
J100074N02AAAAGCCCNONE 
Os01g0782300AK109175AAAAGCCCATAConserved hypothetical protein. 
Os01g0817800AK073827AAAAGCCCWD40-like domain containing protein. 
J033068H02AAAAGCCCNONE 
J065042H22AAAAGCCCNONE 
J090083M24AAAAGCCCNONE 
Os01g0829400AK109566AAAAGCCCAAAAGlutaredoxin domain containing protein. 
Os01g0839700006-051-C07AAAAGCCCNONE 
006-068-C11AAAAGCCCNONE 
006-110-B10AAAAGCCCNONE 
006-116-G06AAAAGCCCNONE 
009-105-F07AAAAGCCCNONE 
AK099038AAAAGCCCNONE 
AK104148AAAAGCCCNONE 
AK112030AAAAGCCCSimilar to Ubiquitin carrier protein. 
J013042A08AAAAGCCCNONE 
J013135H01AAAAGCCCNONE 
J033058E09AAAAGCCCNONE 
J043020K17AAAAGCCCNONE 
J065034F06AAAAGCCCNONE 
J065057B21AAAAGCCCNONE 
J065075F07AAAAGCCCNONE 
J065076D08AAAAGCCCNONE 
J065084E10AAAAGCCCNONE 
J065109L12AAAAGCCCNONE 
J065114J04AAAAGCCCNONE 
J065159L23AAAAGCCCNONE 
J075009L02AAAAGCCCNONE 
J075178P14AAAAGCCCNONE 
J075197L07AAAAGCCCNONE 
J090060O04AAAAGCCCNONE 
J100076I20AAAAGCCCNONE 
Os01g0850400AJ575220AAAAGCCCATTTNONE 
AK108582AAAAGCCCATTTSimilar to MYBY1 protein (Fragment). 
Os01g0874800016-042-F01AAAAGCCCAGCNONE 
016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAAAGCCCAGCNONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAAAGCCCAGCNONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAAAGCCCAGCNONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAAAGCCCAGC5'-3' exonuclease domain containing protein. 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAAAGCCCAGCNONE 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAAAGCCCAGCNONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAAAGCCCAGCNONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAAAGCCCAGCNONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAAAGCCCAGCNONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAAAGCCCAGCNONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0945300003-104-D07TCATGGGCTTTTNONE 
AK065371TCATGGGCTTTTAmino acid/polyamine transporter I family protein. 
AK072189TCATGGGCTTTTNONE 
J013023D09TCATGGGCTTTTNONE 
J013055J18TCATGGGCTTTTNONE 
J013146P21TCATGGGCTTTTNONE 
J075109G14TCATGGGCTTTTNONE 
J075158O19TCATGGGCTTTTNONE 
Os01g0971200014-071-B08AAAAGCCCACNONE 
AK064075AAAAGCCCACNONE 
Os02g0104800AK070860AAAAGCCCConserved hypothetical protein. 
J023002G20AAAAGCCCNONE 
J023022J19AAAAGCCCNONE 
J023067K03AAAAGCCCNONE 
J023108G24AAAAGCCCNONE 
J033075B01AAAAGCCCNONE 
J033087I15AAAAGCCCNONE 
J065087I11AAAAGCCCNONE 
J065194E02AAAAGCCCNONE 
Os02g0114000011-088-H03AAAAGCCCNONE 
015-012-A11AAAAGCCCBromodomain containing protein. 
Os02g0118400012-047-C10AAAAGCCCNONE 
AK064002AAAAGCCCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75). 
AK101004AAAAGCCCNONE 
J065022L23AAAAGCCCNONE 
J065087F24AAAAGCCCNONE 
Os02g0167700AK069128AAAAGCCCAACCGCCCACCTArmadillo-like helical domain containing protein. 
Os02g0193600AK060499AAAAGCCCAATTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0202400AK107368GTGTGGGGGGCTTTTSimilar to Plastidial ADP-glucose transporter. 
J075147G14GTGTGGGGGGCTTTTNONE 
J090009K03GTGTGGGGGGCTTTTNONE 
Os02g0225000J013020L01AAAAGCCCNONE 
J065069G03AAAAGCCCNONE 
Os02g0227400AK103143GGGCTTTTNONE 
AY785765GGGCTTTTPoly(A) polymerase, central region domain containing protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0467200014-053-H06CACGTCACAAAAGCCCATTNONE 
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein. 
J065197J05CACGTCACAAAAGCCCATTNONE 
Os02g0515600009-038-G02AAAAGCCCNONE 
AK058947AAAAGCCCLPS-induced tumor necrosis factor alpha factor domain containing protein. 
Os02g0543200AK100963AAAAGCCCACGCGCyclin-like F-box domain containing protein. 
Os02g0551900015-087-H08AAAAGCCCNONE 
AK103760AAAAGCCCZinc finger, C2H2-type domain containing protein. 
J013056L02AAAAGCCCNONE 
J013065B01AAAAGCCCNONE 
J013129F08AAAAGCCCNONE 
J033092A13AAAAGCCCNONE 
J033094D21AAAAGCCCNONE 
J100071B20AAAAGCCCNONE 
Os02g0652100AK072906AAAAGCCCSimilar to WRKY transcription factor 34. 
J075187F06AAAAGCCCNONE 
Os02g0708300009-007-C06TTTGGGCTTTTNONE 
009-162-G06TTTGGGCTTTTNONE 
014-048-F12TTTGGGCTTTTNONE 
AK066348TTTGGGCTTTTConserved hypothetical protein. 
J013059F24TTTGGGCTTTTNONE 
J023104H14TTTGGGCTTTTNONE 
J053052O22TTTGGGCTTTTNONE 
J053063A05TTTGGGCTTTTNONE 
J053093P09TTTGGGCTTTTNONE 
J065012F24TTTGGGCTTTTNONE 
J065063P09TTTGGGCTTTTNONE 
J065088F12TTTGGGCTTTTNONE 
J065094I11TTTGGGCTTTTNONE 
J065099H19TTTGGGCTTTTNONE 
J065116H07TTTGGGCTTTTNONE 
J065137N07TTTGGGCTTTTNONE 
J065137N11TTTGGGCTTTTNONE 
J065159L22TTTGGGCTTTTNONE 
J065159P11TTTGGGCTTTTNONE 
J065178F17TTTGGGCTTTTNONE 
J065181E07TTTGGGCTTTTNONE 
J075014L16TTTGGGCTTTTNONE 
J075030P11TTTGGGCTTTTNONE 
J075042K24TTTGGGCTTTTNONE 
J075077I15TTTGGGCTTTTNONE 
J075087P06TTTGGGCTTTTNONE 
J075089F20TTTGGGCTTTTNONE 
J075093B07TTTGGGCTTTTNONE 
J075115J23TTTGGGCTTTTNONE 
J075176O19TTTGGGCTTTTNONE 
J075178A04TTTGGGCTTTTNONE 
J075178J02TTTGGGCTTTTNONE 
J090027L02TTTGGGCTTTTNONE 
J100033M12TTTGGGCTTTTNONE 
J100065O08TTTGGGCTTTTNONE 
Os02g0721800AK100043AAAAGCCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0743400AF056027AAAAGCCCNONE 
AK099634AAAAGCCCNONE 
AK102343AAAAGCCCAuxin transport protein REH1. 
Os02g0745400AK072229AAAAGCCCCACATGTCAGTGACACGlycosyl transferase, family 8 protein. 
AK108072AAAAGCCCCACATGTCAGTGACACNONE 
Os02g0788400AK060351AAAAGCCCATCANONE 
AK103497AAAAGCCCATCASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0807750J075136J04GGGCTTTTHypothetical protein. 
Os03g0110300006-043-D12AAAAGCCCATANONE 
009-061-E04AAAAGCCCATANONE 
009-181-H02AAAAGCCCATANONE 
009-193-F10AAAAGCCCATANONE 
AK066190AAAAGCCCATANONE 
AK066769AAAAGCCCATANONE 
AK106206AAAAGCCCATAConserved hypothetical protein. 
J065163L08AAAAGCCCATANONE 
J080034A14AAAAGCCCATANONE 
J080052E14AAAAGCCCATANONE 
J090012J01AAAAGCCCATANONE 
J100045M01AAAAGCCCATANONE 
J100065N06AAAAGCCCATANONE 
Os03g0123300003-131-G09AAAAGCCCNONE 
AK058595AAAAGCCCNONE 
AK070642AAAAGCCCSimilar to Cell cycle switch protein. 
J075056B01AAAAGCCCNONE 
Os03g0124300AK069148AAAAGCCCACGCConserved hypothetical protein. 
AK106076AAAAGCCCACGCNONE 
J023003G19AAAAGCCCACGCNONE 
Os03g0129900009-083-H12GGGCTTTTNONE 
009-130-E01GGGCTTTTNONE 
016-013-G02GGGCTTTTNONE 
AK059624GGGCTTTTNADH-ubiquinone oxidoreductase B18 subunit family protein. 
J065081B09GGGCTTTTNONE 
J075087B17GGGCTTTTNONE 
J075126C08GGGCTTTTNONE 
J090020D21GGGCTTTTNONE 
Os03g0130001Os03g0130001GGGCTTTTNONE 
Os03g0137300014-036-H06AAAAGCCCNONE 
AK120282AAAAGCCCConserved hypothetical protein. 
J013049K09AAAAGCCCNONE 
Os03g0159100AK065635AAAAGCCCAAAASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os03g0185200006-063-C06AAAAGCCCNONE 
AK061059AAAAGCCCNONE 
J065107M08AAAAGCCCNONE 
J075022J01AAAAGCCCNONE 
J100085M09AAAAGCCCNONE 
Os03g0221500012-039-D04AAAAGCCCNONE 
012-054-B07AAAAGCCCNONE 
015-016-G12AAAAGCCCNONE 
015-019-H05AAAAGCCCNONE 
015-029-G08AAAAGCCCNONE 
015-055-H07AAAAGCCCNONE 
015-073-H01AAAAGCCCNONE 
016-013-D09AAAAGCCCNONE 
016-013-F08AAAAGCCCNONE 
016-020-D06AAAAGCCCNONE 
016-058-B09AAAAGCCCNONE 
016-075-C06AAAAGCCCNONE 
016-083-H03AAAAGCCCNONE 
016-091-D01AAAAGCCCNONE 
016-096-G10AAAAGCCCNONE 
AK103138AAAAGCCCGlycoside hydrolase, family 17 protein. 
AK109516AAAAGCCCNONE 
AK119620AAAAGCCCNONE 
J023128B22AAAAGCCCNONE 
J033025N02AAAAGCCCNONE 
J033026A21AAAAGCCCNONE 
J033030H06AAAAGCCCNONE 
J033055C23AAAAGCCCNONE 
J033066E14AAAAGCCCNONE 
J033067L15AAAAGCCCNONE 
J033074J23AAAAGCCCNONE 
J033101O07AAAAGCCCNONE 
J033120F09AAAAGCCCNONE 
J075123J07AAAAGCCCNONE 
J090014F01AAAAGCCCNONE 
J090048K14AAAAGCCCNONE 
J090054D13AAAAGCCCNONE 
J090090K19AAAAGCCCNONE 
Os03g0249500AK121154AAAAGCCCSimilar to Nucleotide sugar epimerase-like protein (UDP-D-glucuronate 4- epimerase) (EC 5.1.3.6). 
J065102O04AAAAGCCCNONE 
J075092E12AAAAGCCCNONE 
J100063E24AAAAGCCCNONE 
J100074C15AAAAGCCCNONE 
Os03g0255100AK067479GGGCTTTTSimilar to Relative to SR12 protein (Fragment). 
J013047D12GGGCTTTTNONE 
J013063F07GGGCTTTTNONE 
Os03g0262400014-013-D09AAAAGCCCAAAAGGCCGAAANONE 
AK059989AAAAGCCCAAAAGGCCGAAASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18AAAAGCCCAAAAGGCCGAAANONE 
J033025J23AAAAGCCCAAAAGGCCGAAANONE 
J065047G10AAAAGCCCAAAAGGCCGAAANONE 
J065153H03AAAAGCCCAAAAGGCCGAAANONE 
J065155J08AAAAGCCCAAAAGGCCGAAANONE 
J075025C05AAAAGCCCAAAAGGCCGAAANONE 
Os03g0274000AK060769AAAAGCCCAAGOxysterol-binding protein family protein. 
Os03g0289200016-011-H02AAAAGCCCNONE 
AK064364AAAAGCCCSimilar to H/ACA ribonucleoprotein complex subunit 1-like protein (GCR 101 snRNP). 
AK073108AAAAGCCCNONE 
J043024P22AAAAGCCCNONE 
J100074J04AAAAGCCCNONE 
Os03g0295500009-083-F02AAAAGCCCACGAANONE 
J053029J05AAAAGCCCACGAANONE 
J053054B07AAAAGCCCACGAACHCH domain containing protein. 
J065024G23AAAAGCCCACGAANONE 
J065036F08AAAAGCCCACGAANONE 
J065066M11AAAAGCCCACGAANONE 
J065143G19AAAAGCCCACGAANONE 
Os03g0335300AK098846AAAAGCCCNONE 
AK098891AAAAGCCCNONE 
AK111509AAAAGCCCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847AAAAGCCCNONE 
AK121413AAAAGCCCNONE 
Os03g0339400AK065305AAAAGCCCCACCHaem peroxidase, plant/fungal/bacterial family protein. 
J013002O02AAAAGCCCCACCNONE 
Os03g0370400AK060059AAAAGCCCProtein of unknown function DUF679 family protein. 
J100031M03AAAAGCCCNONE 
J100088F24AAAAGCCCNONE 
Os03g0425100AK070206GGGCTTTTHypothetical protein. 
J023042E01GGGCTTTTNONE 
Os03g0565900AK100587AAAAGCCCProtein of unknown function DUF1723 domain containing protein. 
J023106C19AAAAGCCCNONE 
Os03g0578300014-071-F09AAAAGCCCNONE 
J065098N06AAAAGCCCNONE 
J065129D09AAAAGCCCNONE 
J075018K16AAAAGCCCNONE 
J075106D12AAAAGCCCNONE 
J075106D18AAAAGCCCNONE 
J075139J02AAAAGCCCNONE 
J075170G09AAAAGCCCNONE 
J080317I24AAAAGCCCNONE 
J080319E11AAAAGCCCNONE 
Os03g0584300009-018-H09GGGCTTTTCTGGGCCCTNONE 
AK105133GGGCTTTTCTGGGCCCTProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11GGGCTTTTCTGGGCCCTNONE 
Os03g0588200011-005-E04AAAAGCCCAAGNONE 
AK120221AAAAGCCCAAGFrigida-like family protein. 
J100086E17AAAAGCCCAAGNONE 
Os03g0604600J090093K23AAAAGCCCAATAConserved hypothetical protein. 
Os03g0606200009-030-E09AAAAGCCCNONE 
009-076-H10AAAAGCCCNONE 
009-122-H12AAAAGCCCNONE 
009-153-F09AAAAGCCCNONE 
AB055076AAAAGCCCMitochondrial ATP synthase 6 KD subunit. 
AK072384AAAAGCCCNONE 
AK107928AAAAGCCCNONE 
J023078E13AAAAGCCCNONE 
J053031N01AAAAGCCCNONE 
J053046K19AAAAGCCCNONE 
J053062P07AAAAGCCCNONE 
J053091C23AAAAGCCCNONE 
J053099N19AAAAGCCCNONE 
J065005E06AAAAGCCCNONE 
J065030N03AAAAGCCCNONE 
J065138O21AAAAGCCCNONE 
J065159K03AAAAGCCCNONE 
J075030M08AAAAGCCCNONE 
J080006E23AAAAGCCCNONE 
J080010D10AAAAGCCCNONE 
J080016N17AAAAGCCCNONE 
J080024N09AAAAGCCCNONE 
J080028E23AAAAGCCCNONE 
J080035I11AAAAGCCCNONE 
J080038D15AAAAGCCCNONE 
J080040H08AAAAGCCCNONE 
J080043L04AAAAGCCCNONE 
J080047C06AAAAGCCCNONE 
J080061G04AAAAGCCCNONE 
J080066E10AAAAGCCCNONE 
J080067P03AAAAGCCCNONE 
J080082D07AAAAGCCCNONE 
J080089M13AAAAGCCCNONE 
J080094O09AAAAGCCCNONE 
J080095C24AAAAGCCCNONE 
J080309E21AAAAGCCCNONE 
J090016G15AAAAGCCCNONE 
J090031C20AAAAGCCCNONE 
J090033A15AAAAGCCCNONE 
J090037L07AAAAGCCCNONE 
J090038I10AAAAGCCCNONE 
J090072P19AAAAGCCCNONE 
J100040J02AAAAGCCCNONE 
J100047N05AAAAGCCCNONE 
J100048M10AAAAGCCCNONE 
J100076C02AAAAGCCCNONE 
J100077G23AAAAGCCCNONE 
J100080O08AAAAGCCCNONE 
J100085C06AAAAGCCCNONE 
J100085F16AAAAGCCCNONE 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0666700AK061309AAAAGCCCNONE 
AK061721AAAAGCCCNONE 
AK102010AAAAGCCCProtein of unknown function DUF887, TLC-like family protein. 
J013063C05AAAAGCCCNONE 
Os03g0673600009-011-C08CGTGTGGGCTTTTNONE 
009-033-C05CGTGTGGGCTTTTNONE 
AK062334CGTGTGGGCTTTTNONE 
AK068539CGTGTGGGCTTTTConserved hypothetical protein. 
Os03g0701900AK068404AAATGGGCTTTTConserved hypothetical protein. 
Os03g0712200AK073205AAAAGCCCAATZinc finger, RanBP2-type domain containing protein. 
AK098968AAAAGCCCAATNONE 
Os03g0725400015-060-D03AAAAGCCCAACTNONE 
AK105499AAAAGCCCAACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860AAAAGCCCAACTNONE 
AK112085AAAAGCCCAACTNONE 
J100068K06AAAAGCCCAACTNONE 
J100073K24AAAAGCCCAACTNONE 
J100084M24AAAAGCCCAACTNONE 
Os03g0734500AK108001AAAAGCCCAGCConserved hypothetical protein. 
J080013F05AAAAGCCCAGCNONE 
J080030B16AAAAGCCCAGCNONE 
J080074G16AAAAGCCCAGCNONE 
J100062F08AAAAGCCCAGCNONE 
Os03g0747700AK058795AAAAGCCCACConserved hypothetical protein. 
Os03g0751400AK069033GGGCTTTTSimilar to 50S ribosomal protein l6. 
J023004G24GGGCTTTTNONE 
J065176D08GGGCTTTTNONE 
Os03g0752700011-093-A02AAAAGCCCATAANONE 
AK122157AAAAGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03AAAAGCCCATAANONE 
J033096O19AAAAGCCCATAANONE 
J033145P19AAAAGCCCATAANONE 
J065008K09AAAAGCCCATAANONE 
J065027J08AAAAGCCCATAANONE 
J065073H12AAAAGCCCATAANONE 
J065078G14AAAAGCCCATAANONE 
J065092L12AAAAGCCCATAANONE 
J065108D11AAAAGCCCATAANONE 
J065140G10AAAAGCCCATAANONE 
J065161D24AAAAGCCCATAANONE 
J065170F04AAAAGCCCATAANONE 
J075004K20AAAAGCCCATAANONE 
J075069F16AAAAGCCCATAANONE 
J075085B12AAAAGCCCATAANONE 
J075087D24AAAAGCCCATAANONE 
J075102G15AAAAGCCCATAANONE 
J075123M06AAAAGCCCATAANONE 
J090058D24AAAAGCCCATAANONE 
J090068I12AAAAGCCCATAANONE 
J090094A19AAAAGCCCATAANONE 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0784400AK103474AAAAGCCCATCGProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAAAGCCCATCGNONE 
J033130D12AAAAGCCCATCGNONE 
J043035E20AAAAGCCCATCGNONE 
J065206K15AAAAGCCCATCGNONE 
J075053J20AAAAGCCCATCGNONE 
J075129B11AAAAGCCCATCGNONE 
J090003E22AAAAGCCCATCGNONE 
J100023E23AAAAGCCCATCGNONE 
Os03g0786700AK067936AAAAGCCCATAN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0819400009-131-F02AAAAGCCCNONE 
AK070263AAAAGCCCHeavy metal transport/detoxification protein domain containing protein. 
J023043H06AAAAGCCCNONE 
J033097J18AAAAGCCCNONE 
J033133G11AAAAGCCCNONE 
J065037K10AAAAGCCCNONE 
J065200J12AAAAGCCCNONE 
J075172I11AAAAGCCCNONE 
J100082F10AAAAGCCCNONE 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0312100AK120695AAAAGCCCAProtein of unknown function DUF860, plant family protein. 
Os04g0413600009-142-B05AAAAGCCCNONE 
AK121192AAAAGCCCSimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11AAAAGCCCNONE 
J065085D06AAAAGCCCNONE 
J075062H12AAAAGCCCNONE 
J075072I22AAAAGCCCNONE 
J075074H21AAAAGCCCNONE 
J075087L16AAAAGCCCNONE 
J075088D11AAAAGCCCNONE 
J075115N15AAAAGCCCNONE 
J100064G10AAAAGCCCNONE 
J100080E09AAAAGCCCNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0478600AK073788GGGCTTTTConserved hypothetical protein. 
AK073788GGTGGGCTTTTConserved hypothetical protein. 
Os04g0487100AK106016AAAAGCCCGalactose oxidase, central domain containing protein. 
Os04g0497600AK059415AAAAGCCCLupus La protein family protein. 
AK099054AAAAGCCCNONE 
J013121K15AAAAGCCCNONE 
J013149O10AAAAGCCCNONE 
J023112H08AAAAGCCCNONE 
J033050F07AAAAGCCCNONE 
Os04g0506300AK063591GGGCTTTTTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08GGGCTTTTNONE 
Os04g0531300016-006-E10GGGCTTTTNONE 
AK072647GGGCTTTTDihydrouridine synthase, DuS family protein. 
AK103911GGGCTTTTNONE 
J013038P22GGGCTTTTNONE 
J023130D01GGGCTTTTNONE 
J033150P13GGGCTTTTNONE 
J043026L14GGGCTTTTNONE 
J065049A08GGGCTTTTNONE 
J065215C17GGGCTTTTNONE 
Os04g0559400AK106376AAAAGCCCAGCCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0602900AK065982AAAAGCCCNONE 
AK100414AAAAGCCCIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05AAAAGCCCNONE 
J065196I21AAAAGCCCNONE 
J065205B13AAAAGCCCNONE 
J090017J24AAAAGCCCNONE 
Os04g0636100003-115-H08AAAAGCCCNONE 
AK067760AAAAGCCCGlycosyl transferase, family 8 protein. 
J013119I03AAAAGCCCNONE 
J075092K10AAAAGCCCNONE 
Os04g0643700AK072261AAAAGCCCNONE 
AK101087AAAAGCCCProtein prenyltransferase domain containing protein. 
AK108565AAAAGCCCNONE 
J033024K07AAAAGCCCNONE 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0670600AK064255AAAAGCCCGGCCCAGTTNONE 
Os04g0674600AK069645AAAAGCCCOligopeptide transporter OPT superfamily protein. 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0101600AK101021AGGTGGGCTTTTCytochrome P450 family protein. 
Os05g0103500AK060306AAAAGCCCAATACHCH domain containing protein. 
AK102829AAAAGCCCAATANONE 
J033109D16AAAAGCCCAATANONE 
J043016E20AAAAGCCCAATANONE 
J065001C14AAAAGCCCAATANONE 
J065116L24AAAAGCCCAATANONE 
J075018E04AAAAGCCCAATANONE 
J075045E18AAAAGCCCAATANONE 
J075093G20AAAAGCCCAATANONE 
J075171A09AAAAGCCCAATANONE 
J100029F18AAAAGCCCAATANONE 
J100046I24AAAAGCCCAATANONE 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0155300AK069217GTGGGCTTTTSimilar to HIRA interacting protein 5. 
Os05g0161400AK105485AAAAGCCCAACTPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0357850J065118C17AAAAGCCCHypothetical protein. 
J065118C17AAAAGCCCCCACHypothetical protein. 
J065159C03AAAAGCCCNONE 
J065159C03AAAAGCCCCCACNONE 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0399700AB012855AAAAGCCCATACNONE 
AB018248AAAAGCCCATACNONE 
AB096139AAAAGCCCATACNONE 
AK071196AAAAGCCCATACChitinase (EC 3.2.1.14). 
J023012C04AAAAGCCCATACNONE 
J023086B11AAAAGCCCATACNONE 
J023143A20AAAAGCCCATACNONE 
J080040G15AAAAGCCCATACNONE 
J080306P19AAAAGCCCATACNONE 
J080307K24AAAAGCCCATACNONE 
J090040G17AAAAGCCCATACNONE 
J090047J17AAAAGCCCATACNONE 
J090075E21AAAAGCCCATACNONE 
J090088L05AAAAGCCCATACNONE 
Os05g0413000AK058277AAAAGCCCATGMitochodrial transcription termination factor-related family protein. 
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0447700014-074-G11AAAAGCCCNONE 
AK071331AAAAGCCCNONE 
AK072154AAAAGCCCFerritin/ribonucleotide reductase-like family protein. 
Os05g0460800AK058842AAAAGCCCAProtein tyrosine phosphatase-like protein, PTPLA family protein. 
Os05g0490800J065037L19AAAAGCCCAGCCNONE 
Os05g0495100AK108028GGGCTGGGCTTTTConserved hypothetical protein. 
Os05g0513400AK069309AAAAGCCCProtein of unknown function DUF803 family protein. 
AK121638AAAAGCCCNONE 
Os05g0571800009-157-G07AAAAGCCCNONE 
AK063033AAAAGCCCConserved hypothetical protein. 
Os05g0580900AK108609AAAAGCCCNONE 
AK120030AAAAGCCCConserved hypothetical protein. 
Os05g0592600011-064-D09GTTTGGGCTTTTNONE 
015-032-B11GTTTGGGCTTTTNONE 
AK073484GTTTGGGCTTTTInitiation factor 2 family protein. 
AK099632GTTTGGGCTTTTNONE 
Os05g0594800AK058332GGGCTTTTATATGGGCCATAdhesion regulating molecule family protein. 
AK068013GGGCTTTTATATGGGCCATNONE 
J013129L24GGGCTTTTATATGGGCCATNONE 
Os06g0116600AK103500AAAAGCCCATCTProteinase inhibitor, propeptide domain containing protein. 
J033131B10AAAAGCCCATCTNONE 
J075154F17AAAAGCCCATCTNONE 
J075169L23AAAAGCCCATCTNONE 
Os06g0222900AK109820AAAAGCCCAAAASimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0268700AK120783AAAAGCCCAAACPeptidase A1, pepsin family protein. 
Os06g0298500AK108252AAAAGCCCACCAConserved hypothetical protein. 
J065144C04AAAAGCCCACCANONE 
J075054P09AAAAGCCCACCANONE 
J075165A13AAAAGCCCACCANONE 
J075172E10AAAAGCCCACCANONE 
Os06g0309000AK121021ACGTGGGCTTTTZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0332500009-108-G06AAAAGCCCNONE 
009-119-F06AAAAGCCCNONE 
AK121262AAAAGCCCConserved hypothetical protein. 
J023104L05AAAAGCCCNONE 
J033022F22AAAAGCCCNONE 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0639000AK102470GGGCTTTTNONE 
J013106M02GGGCTTTTNONE 
J100051K23GGGCTTTTNONE 
Os06g0661500AK099401AAAAGCCCConserved hypothetical protein. 
J013001E16AAAAGCCCNONE 
Os06g0667600AK058606AAAAGCCCATTANONE 
AK071621AAAAGCCCATTASimilar to Glycine decarboxylase complex H-protein. 
J023101D03AAAAGCCCATTANONE 
J033095E17AAAAGCCCATTANONE 
J065020B16AAAAGCCCATTANONE 
Os06g0678700AK109845AAAAGCCCHypothetical protein. 
J075013D22AAAAGCCCNONE 
J075041H23AAAAGCCCNONE 
J075060A19AAAAGCCCNONE 
J075069J01AAAAGCCCNONE 
J075123N11AAAAGCCCNONE 
J075143K15AAAAGCCCNONE 
Os06g0694200AK106962AAAAGCCCLipolytic enzyme, G-D-S-L family protein. 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0710900AK073326AAAAGCCCConserved hypothetical protein. 
Os06g0712500AK068531AAATGGGCTTTTSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0715400012-007-C01AAAAGCCCAGNONE 
012-038-G03AAAAGCCCAGNONE 
AK071262AAAAGCCCAGt-snare domain containing protein. 
AK073963AAAAGCCCAGNONE 
J023085J06AAAAGCCCAGNONE 
J033073I09AAAAGCCCAGNONE 
J080316N15AAAAGCCCAGNONE 
J090062N15AAAAGCCCAGNONE 
Os06g0717900AK069070AAAAGCCCPeptidase A1, pepsin family protein. 
AK121147AAAAGCCCNONE 
J023007C05AAAAGCCCNONE 
J043040A14AAAAGCCCNONE 
Os07g0100800AK066298GGGCTTTTSimilar to Amino acid permease. 
Os07g0176200AK062003AAAAGCCCNONE 
J013048O08AAAAGCCCNONE 
J013093K05AAAAGCCCNONE 
J023075A11AAAAGCCCNONE 
J033022L15AAAAGCCCNONE 
J033123I21AAAAGCCCNONE 
J065152L07AAAAGCCCNONE 
J065195F21AAAAGCCCNONE 
J090008P11AAAAGCCCNONE 
J090011C01AAAAGCCCNONE 
J090019H19AAAAGCCCNONE 
J090043M15AAAAGCCCNONE 
J100060I19AAAAGCCCNONE 
J100072B03AAAAGCCCNONE 
Os07g0187300AK103069AAAAGCCCAAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAAAGCCCAAAANONE 
J033117P16AAAAGCCCAAAANONE 
Os07g0202100AK101736AAAAGCCCATACSimilar to ATP-dependent RNA helicase ded1. 
Os07g0213400003-104-B01GGGCTTTTNONE 
AK062273GGGCTTTTConserved hypothetical protein. 
J065122P17GGGCTTTTNONE 
J065160A01GGGCTTTTNONE 
J090065M11GGGCTTTTNONE 
Os07g0227700AK120258AAAAGCCCAConserved hypothetical protein. 
J090030H24AAAAGCCCANONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0409100003-111-B11AAAAGCCCNONE 
AK060230AAAAGCCCSimilar to CLB1. 
J065178I05AAAAGCCCNONE 
Os07g0496300AK119387AAAAGCCCPleckstrin homology-type domain containing protein. 
Os07g0498300009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0504601J065068H15AAAAGCCCConserved hypothetical protein. 
J065068H15GGGCTTTTTTTCGGCCCGCAConserved hypothetical protein. 
J065095H08AAAAGCCCNONE 
J065095H08GGGCTTTTTTTCGGCCCGCANONE 
Os07g0598300AK073674AAAAGCCCGCCCATTTDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK101648AAAAGCCCGCCCATTTNONE 
AK122151AAAAGCCCGCCCATTTNONE 
J090007H05AAAAGCCCGCCCATTTNONE 
J090066O03AAAAGCCCGCCCATTTNONE 
Os07g0627700AK070893AAAAGCCCACAASterol desaturase family protein. 
AK110696AAAAGCCCACAANONE 
J065068I04AAAAGCCCACAANONE 
J065121P07AAAAGCCCACAANONE 
Os07g0680400AK110900GGGCTTTTDNA-binding WRKY domain containing protein. 
J065147G07GGGCTTTTNONE 
J065148F04GGGCTTTTNONE 
J065190F09GGGCTTTTNONE 
J100067L08GGGCTTTTNONE 
Os08g0113800J033069I12AAAAGCCCATTTNONE 
J053050I07AAAAGCCCATTTNONE 
J065006J11AAAAGCCCATTTNONE 
J065013D02AAAAGCCCATTTNONE 
J065055L24AAAAGCCCATTTNONE 
J065071I11AAAAGCCCATTTConserved hypothetical protein. 
J065093G12AAAAGCCCATTTNONE 
J065101N03AAAAGCCCATTTNONE 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0158900AK067062AAAAGCCCAATTGTP1/OBG domain containing protein. 
J013089F04AAAAGCCCAATTNONE 
J013092D16AAAAGCCCAATTNONE 
J033120K14AAAAGCCCAATTNONE 
J033133F24AAAAGCCCAATTNONE 
J033145A10AAAAGCCCAATTNONE 
J033145A11AAAAGCCCAATTNONE 
J053048H24AAAAGCCCAATTNONE 
J053075H10AAAAGCCCAATTNONE 
Os08g0159000AK073617AATTGGGCTTTTNONE 
AK103973AATTGGGCTTTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14AATTGGGCTTTTNONE 
J033051J11AATTGGGCTTTTNONE 
J065101C10AATTGGGCTTTTNONE 
J065168B04AATTGGGCTTTTNONE 
J065184E22AATTGGGCTTTTNONE 
J080021D11AATTGGGCTTTTNONE 
J080025H10AATTGGGCTTTTNONE 
J080026N19AATTGGGCTTTTNONE 
J080034A12AATTGGGCTTTTNONE 
J080040L02AATTGGGCTTTTNONE 
J080042H19AATTGGGCTTTTNONE 
J080047B05AATTGGGCTTTTNONE 
J080047E09AATTGGGCTTTTNONE 
J080047I01AATTGGGCTTTTNONE 
J080052H19AATTGGGCTTTTNONE 
J080062K13AATTGGGCTTTTNONE 
J080063A22AATTGGGCTTTTNONE 
J080068G18AATTGGGCTTTTNONE 
J080068N19AATTGGGCTTTTNONE 
J080076G08AATTGGGCTTTTNONE 
J080077H13AATTGGGCTTTTNONE 
J080077K06AATTGGGCTTTTNONE 
J080093D15AATTGGGCTTTTNONE 
J080094D21AATTGGGCTTTTNONE 
J080097A20AATTGGGCTTTTNONE 
J080097E21AATTGGGCTTTTNONE 
J080097N17AATTGGGCTTTTNONE 
J100071K18AATTGGGCTTTTNONE 
J100072F09AATTGGGCTTTTNONE 
Os08g0172300AK111274AAAAGCCCACHAT dimerisation domain containing protein. 
J065184J06AAAAGCCCACNONE 
Os08g0192900AK103422AAAAGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AAAAGCCCAAACNONE 
Os08g0197200AK106882AAAAGCCCCyclin-like F-box domain containing protein. 
Os08g0256000AK105511AAAAGCCCConserved hypothetical protein. 
J100077G08AAAAGCCCNONE 
Os08g0327400AK070992AAAAGCCCACCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAAAGCCCACCNONE 
J065075F06AAAAGCCCACCNONE 
J065112N14AAAAGCCCACCNONE 
J090028K07AAAAGCCCACCNONE 
J090039C15AAAAGCCCACCNONE 
J090048I11AAAAGCCCACCNONE 
J090083M10AAAAGCCCACCNONE 
Os08g0346400003-103-D08ACATGGGCTTTTNONE 
009-135-G12ACATGGGCTTTTNONE 
AK059644ACATGGGCTTTTNONE 
AK062928ACATGGGCTTTTNONE 
AK103873ACATGGGCTTTTSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11ACATGGGCTTTTNONE 
J065137E08ACATGGGCTTTTNONE 
J065194M22ACATGGGCTTTTNONE 
J075083O16ACATGGGCTTTTNONE 
Os08g0375800AK101199GGGCTTTTProtein prenyltransferase domain containing protein. 
J033030L22GGGCTTTTNONE 
Os08g0389700009-141-B12AAAAGCCCNONE 
J013001N20AAAAGCCCNONE 
J043040L02AAAAGCCCNONE 
Os08g0485900AK110716AAAAGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0504600AK064868TACTGGGCTTTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013051G08TACTGGGCTTTTNONE 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
015-019-D06AAAAGCCCAACANONE 
015-019-D06AAAAGCCCATTACGGCCCACACNONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
AK064304AAAAGCCCAACASimilar to 30S ribosomal protein S16. 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os09g0103300009-007-D10AAAAGCCCATATNONE 
AK062317AAAAGCCCATATHypothetical protein. 
Os09g0280600AK070961CGTGTGGGGCTTTTMnd1 family protein. 
J023066B13CGTGTGGGGCTTTTNONE 
Os09g0293500J033025B10AAAAGCCCNONE 
J100049C05AAAAGCCCProtein kinase-like domain containing protein. 
Os09g0306700J023045A19AAAAGCCCACCTNONE 
Os09g0345700009-020-H05GGGCTTTTNONE 
AK073719GGGCTTTTConserved hypothetical protein. 
Os09g0363700AK103667ATTGGGCTTTTConserved hypothetical protein. 
J075001L14ATTGGGCTTTTNONE 
J075049M23ATTGGGCTTTTNONE 
J075051I04ATTGGGCTTTTNONE 
J075073L04ATTGGGCTTTTNONE 
J075077E03ATTGGGCTTTTNONE 
J075083J11ATTGGGCTTTTNONE 
J075094J22ATTGGGCTTTTNONE 
J075112E08ATTGGGCTTTTNONE 
J075137J23ATTGGGCTTTTNONE 
J075192E02ATTGGGCTTTTNONE 
J100039K04ATTGGGCTTTTNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0438700006-093-A11AAAAGCCCAANONE 
AK061837AAAAGCCCAANONE 
AK098903AAAAGCCCAASimilar to 20 kDa chaperonin, chloroplast precursor (Protein Cpn21) (Chloroplast protein Cpn10) (Chloroplast chaperonin 10) (Ch-CPN10) (Chaperonin 20). 
J013002C22AAAAGCCCAANONE 
J065053C07AAAAGCCCAANONE 
J065118J22AAAAGCCCAANONE 
J065213B13AAAAGCCCAANONE 
J075065H24AAAAGCCCAANONE 
Os09g0465800009-106-E01AAAAGCCCACNONE 
AK062785AAAAGCCCACConserved hypothetical protein. 
J065122K21AAAAGCCCACNONE 
Os09g0516300AK065222AAAAGCCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os11g0114700AK065865AAAAGCCCACGANONE 
AK066583AAAAGCCCACGANONE 
AK070834AAAAGCCCACGAPAP/25A core domain containing protein. 
AK072543AAAAGCCCACGANONE 
Os11g0127700AK103742AAAAGCCCAATAHypothetical protein. 
J090083M11AAAAGCCCAATANONE 
Os11g0159000AK065738AAAAGCCCAAAAConserved hypothetical protein. 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0518900AK063772GGGCTTTTConserved hypothetical protein. 
AK102677GGGCTTTTNONE 
AK121776GGGCTTTTNONE 
Os11g0527000J065137N17AAAAGCCCConserved hypothetical protein. 
Os11g0543100AK108274ACATGGGCTTTTConserved hypothetical protein. 
Os11g0554200016-030-B02AAAAGCCCNONE 
AK106479AAAAGCCCConserved hypothetical protein. 
Os11g0570000AK111751GGGCTTTTSimilar to Receptor kinase-like protein. 
J013060M13GGGCTTTTNONE 
J013104G05GGGCTTTTNONE 
J013124F03GGGCTTTTNONE 
J023002F04GGGCTTTTNONE 
J023010B08GGGCTTTTNONE 
J023024F23GGGCTTTTNONE 
J023026B16GGGCTTTTNONE 
J023034L02GGGCTTTTNONE 
J023050J11GGGCTTTTNONE 
J023098L16GGGCTTTTNONE 
J023109B14GGGCTTTTNONE 
J023130I24GGGCTTTTNONE 
J023132B14GGGCTTTTNONE 
J023141A01GGGCTTTTNONE 
J090021N24GGGCTTTTNONE 
J090061H08GGGCTTTTNONE 
Os11g0616300AK103590GGGCTTTTRemorin, C-terminal region domain containing protein. 
Os11g0660500009-031-D10AAAAGCCCAAACNONE 
009-100-G09AAAAGCCCAAACNONE 
009-162-G10AAAAGCCCAAACNONE 
009-183-H11AAAAGCCCAAACNONE 
013-010-B11AAAAGCCCAAACNONE 
013-050-A05AAAAGCCCAAACNONE 
013-070-E10AAAAGCCCAAACNONE 
AK105453AAAAGCCCAAACSimilar to Translationally controlled tumor protein (Fragment). 
D12626AAAAGCCCAAACNONE 
J013128M15AAAAGCCCAAACNONE 
J023004I19AAAAGCCCAAACNONE 
J033114F08AAAAGCCCAAACNONE 
J033147I20AAAAGCCCAAACNONE 
J065031M04AAAAGCCCAAACNONE 
J065033J03AAAAGCCCAAACNONE 
J065038E01AAAAGCCCAAACNONE 
J065048O06AAAAGCCCAAACNONE 
J065054E01AAAAGCCCAAACNONE 
J065075N08AAAAGCCCAAACNONE 
J065080C07AAAAGCCCAAACNONE 
J065096A12AAAAGCCCAAACNONE 
J065115P22AAAAGCCCAAACNONE 
J065122I21AAAAGCCCAAACNONE 
J065127A13AAAAGCCCAAACNONE 
J065158B06AAAAGCCCAAACNONE 
J065162E04AAAAGCCCAAACNONE 
J065162E05AAAAGCCCAAACNONE 
J065163L06AAAAGCCCAAACNONE 
J065177B16AAAAGCCCAAACNONE 
J065181M15AAAAGCCCAAACNONE 
J065201G15AAAAGCCCAAACNONE 
J065202J06AAAAGCCCAAACNONE 
J075002B19AAAAGCCCAAACNONE 
J075008G19AAAAGCCCAAACNONE 
J075010P05AAAAGCCCAAACNONE 
J075018H23AAAAGCCCAAACNONE 
J075051E18AAAAGCCCAAACNONE 
J075053C24AAAAGCCCAAACNONE 
J075077B06AAAAGCCCAAACNONE 
J075080B11AAAAGCCCAAACNONE 
J075083M04AAAAGCCCAAACNONE 
J075085H01AAAAGCCCAAACNONE 
J075109E11AAAAGCCCAAACNONE 
J075111O09AAAAGCCCAAACNONE 
J075130D13AAAAGCCCAAACNONE 
J075132H13AAAAGCCCAAACNONE 
J075147H19AAAAGCCCAAACNONE 
J075148J01AAAAGCCCAAACNONE 
J075159A18AAAAGCCCAAACNONE 
J075166F03AAAAGCCCAAACNONE 
J075191F09AAAAGCCCAAACNONE 
J075192K09AAAAGCCCAAACNONE 
J080006P15AAAAGCCCAAACNONE 
J080013J18AAAAGCCCAAACNONE 
J080023O06AAAAGCCCAAACNONE 
J080024I17AAAAGCCCAAACNONE 
J080029P03AAAAGCCCAAACNONE 
J080030C14AAAAGCCCAAACNONE 
J080038K15AAAAGCCCAAACNONE 
J080042I15AAAAGCCCAAACNONE 
J080053L07AAAAGCCCAAACNONE 
J080061H12AAAAGCCCAAACNONE 
J080064H24AAAAGCCCAAACNONE 
J080066J20AAAAGCCCAAACNONE 
J080074N07AAAAGCCCAAACNONE 
J080079F16AAAAGCCCAAACNONE 
J080079O07AAAAGCCCAAACNONE 
J080092E15AAAAGCCCAAACNONE 
J080301F19AAAAGCCCAAACNONE 
J080302O21AAAAGCCCAAACNONE 
J080306L02AAAAGCCCAAACNONE 
J080307F16AAAAGCCCAAACNONE 
J080307G01AAAAGCCCAAACNONE 
J080307K01AAAAGCCCAAACNONE 
J080309O22AAAAGCCCAAACNONE 
J080311E17AAAAGCCCAAACNONE 
J080311N08AAAAGCCCAAACNONE 
J080312O12AAAAGCCCAAACNONE 
J080315C08AAAAGCCCAAACNONE 
J080316D07AAAAGCCCAAACNONE 
J080318C17AAAAGCCCAAACNONE 
J090004B08AAAAGCCCAAACNONE 
J090009K02AAAAGCCCAAACNONE 
J090025O15AAAAGCCCAAACNONE 
J090026L03AAAAGCCCAAACNONE 
J090036P17AAAAGCCCAAACNONE 
J090047A21AAAAGCCCAAACNONE 
J090053O03AAAAGCCCAAACNONE 
J090059C04AAAAGCCCAAACNONE 
J090062O21AAAAGCCCAAACNONE 
J090064M11AAAAGCCCAAACNONE 
J090070C14AAAAGCCCAAACNONE 
J090075I03AAAAGCCCAAACNONE 
J090081G22AAAAGCCCAAACNONE 
J090083E18AAAAGCCCAAACNONE 
J090084A05AAAAGCCCAAACNONE 
J100019L11AAAAGCCCAAACNONE 
J100022D16AAAAGCCCAAACNONE 
J100042F09AAAAGCCCAAACNONE 
J100051J12AAAAGCCCAAACNONE 
J100065G21AAAAGCCCAAACNONE 
J100066D08AAAAGCCCAAACNONE 
J100069H04AAAAGCCCAAACNONE 
J100078I16AAAAGCCCAAACNONE 
J100090D15AAAAGCCCAAACNONE 
Os11g0695850J100031F10AAAAGCCCNONE 
Os12g0111000AK064603AAAAGCCCConserved hypothetical protein. 
J053025I03AAAAGCCCNONE 
Os12g0123900016-031-A06AAAAGCCCAACANONE 
AK061862AAAAGCCCAACAHypothetical protein. 
J013031P10AAAAGCCCAACANONE 
J053034P22AAAAGCCCAACANONE 
J053046O16AAAAGCCCAACANONE 
J053048D20AAAAGCCCAACANONE 
J090031I07AAAAGCCCAACANONE 
J100025B02AAAAGCCCAACANONE 
Os12g0158800AK059233GGGCTTTTSimilar to E2F homolog (Fragment). 
Os12g0167900005-004-A06AAAAGCCCATTNONE 
006-024-H01AAAAGCCCATTNONE 
006-044-H12AAAAGCCCATTNONE 
006-053-B08AAAAGCCCATTNONE 
015-080-F12AAAAGCCCATTNONE 
AK060925AAAAGCCCATT60S ribosomal protein L3. 
D10403AAAAGCCCATTNONE 
D12630AAAAGCCCATTNONE 
J013046A17AAAAGCCCATTNONE 
J013048A16AAAAGCCCATTNONE 
J013057L14AAAAGCCCATTNONE 
J023058G08AAAAGCCCATTNONE 
J023058I08AAAAGCCCATTNONE 
J023078E17AAAAGCCCATTNONE 
J023087E03AAAAGCCCATTNONE 
J023097D18AAAAGCCCATTNONE 
J023141E14AAAAGCCCATTNONE 
J023150P21AAAAGCCCATTNONE 
J033045K05AAAAGCCCATTNONE 
J033071G03AAAAGCCCATTNONE 
J033071I15AAAAGCCCATTNONE 
J033136D08AAAAGCCCATTNONE 
J043012M21AAAAGCCCATTNONE 
J043015C13AAAAGCCCATTNONE 
J053031L19AAAAGCCCATTNONE 
J053050C01AAAAGCCCATTNONE 
J053055I20AAAAGCCCATTNONE 
J053074B18AAAAGCCCATTNONE 
J053091I08AAAAGCCCATTNONE 
J053097N01AAAAGCCCATTNONE 
J065058A02AAAAGCCCATTNONE 
J065141H11AAAAGCCCATTNONE 
J075019D10AAAAGCCCATTNONE 
J075078G18AAAAGCCCATTNONE 
J075094C12AAAAGCCCATTNONE 
J075165H12AAAAGCCCATTNONE 
J090011E05AAAAGCCCATTNONE 
J090021H18AAAAGCCCATTNONE 
J090027N07AAAAGCCCATTNONE 
J090035F04AAAAGCCCATTNONE 
J090050F21AAAAGCCCATTNONE 
J090051M02AAAAGCCCATTNONE 
J090060F21AAAAGCCCATTNONE 
J090075G15AAAAGCCCATTNONE 
J090092P11AAAAGCCCATTNONE 
J090097B18AAAAGCCCATTNONE 
J100019C17AAAAGCCCATTNONE 
J100022O04AAAAGCCCATTNONE 
J100034G13AAAAGCCCATTNONE 
J100048A13AAAAGCCCATTNONE 
J100050P18AAAAGCCCATTNONE 
J100054B21AAAAGCCCATTNONE 
J100062L01AAAAGCCCATTNONE 
J100065E11AAAAGCCCATTNONE 
J100074P09AAAAGCCCATTNONE 
J100086E10AAAAGCCCATTNONE 
Os12g0188900012-030-C08AAAAGCCCNONE 
J013027N23AAAAGCCCConserved hypothetical protein. 
J013156K23AAAAGCCCNONE 
J023134K02AAAAGCCCNONE 
J033051M18AAAAGCCCNONE 
J033143K05AAAAGCCCNONE 
J080003C24AAAAGCCCNONE 
J080004K05AAAAGCCCNONE 
J080009D14AAAAGCCCNONE 
J080014L12AAAAGCCCNONE 
J080020E23AAAAGCCCNONE 
J080021K20AAAAGCCCNONE 
J080024B19AAAAGCCCNONE 
J080024C12AAAAGCCCNONE 
J080031K10AAAAGCCCNONE 
J080034G09AAAAGCCCNONE 
J080036C10AAAAGCCCNONE 
J080037K18AAAAGCCCNONE 
J080039J17AAAAGCCCNONE 
J080040A20AAAAGCCCNONE 
J080042B06AAAAGCCCNONE 
J080046P07AAAAGCCCNONE 
J080047G02AAAAGCCCNONE 
J080049E12AAAAGCCCNONE 
J080056N14AAAAGCCCNONE 
J080059K10AAAAGCCCNONE 
J080064F05AAAAGCCCNONE 
J080064I04AAAAGCCCNONE 
J080064K17AAAAGCCCNONE 
J080069A15AAAAGCCCNONE 
J080071E22AAAAGCCCNONE 
J080071M24AAAAGCCCNONE 
J080074C17AAAAGCCCNONE 
J080075J07AAAAGCCCNONE 
J080079F11AAAAGCCCNONE 
J080083F15AAAAGCCCNONE 
J080084N21AAAAGCCCNONE 
J080086O03AAAAGCCCNONE 
J080089K02AAAAGCCCNONE 
J080092K22AAAAGCCCNONE 
J080093P09AAAAGCCCNONE 
J090001N04AAAAGCCCNONE 
J090041M02AAAAGCCCNONE 
Os12g0223700J075049J03CTTGGGCCAAAAGCCCAAGHypothetical protein. 
J075101F23CTTGGGCCAAAAGCCCAAGNONE 
Os12g0442700AK111062AGGTGGGCTTTTHypothetical protein. 
J065080H14AGGTGGGCTTTTNONE 
J075019H22AGGTGGGCTTTTNONE 
J075088M09AGGTGGGCTTTTNONE 
Os12g0508300009-006-G07AAAAGCCCATTANONE 
009-133-E05AAAAGCCCATTANONE 
009-137-F10AAAAGCCCATTANONE 
014-024-A06AAAAGCCCATTANONE 
AK059123AAAAGCCCATTARibosomal protein S14 family protein. 
J100088E22AAAAGCCCATTANONE 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0564800AK103886GGGCTTTTDisease resistance protein family protein. 
Os12g0631100006-045-F12TTTTGGGCTTTTNONE 
006-077-C09TTTTGGGCTTTTNONE 
006-078-B11TTTTGGGCTTTTNONE 
AJ292320TTTTGGGCTTTTNONE 
AK061116TTTTGGGCTTTTNONE 
AK066784TTTTGGGCTTTTNONE 
AY029301TTTTGGGCTTTTRas small GTPase, Ras type family protein. 
J065015G13TTTTGGGCTTTTNONE 
J065035E22TTTTGGGCTTTTNONE 
J065037H03TTTTGGGCTTTTNONE 
J065065F12TTTTGGGCTTTTNONE 
J065078K22TTTTGGGCTTTTNONE 
J065081K09TTTTGGGCTTTTNONE 
J065121I23TTTTGGGCTTTTNONE 
J065127I03TTTTGGGCTTTTNONE 
J065130G24TTTTGGGCTTTTNONE 
J065134E23TTTTGGGCTTTTNONE 
J065154H14TTTTGGGCTTTTNONE 
J065183K16TTTTGGGCTTTTNONE 
J065209P13TTTTGGGCTTTTNONE 
J075087O18TTTTGGGCTTTTNONE 
J090065E06TTTTGGGCTTTTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.