version

Summary of OsREG420 (All List)

OrganismOryza sativa  
IDOsREG420  
SequenceAAACGGCC  
Annotation  
PPDB MotifAAACG(C/G)  function unknown  
PLACE Motif 
Total Entry Count692  

Entry Sequences (692 entries)

LocusGene modelSequenceDescription
Os01g0146200J090080H03AAACGGCCCConserved hypothetical protein. 
Os01g0148700006-099-B04CATGGGCCGTTTNONE 
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein. 
AK109379CATGGGCCGTTTNONE 
J023101J18CATGGGCCGTTTNONE 
J033036D19CATGGGCCGTTTNONE 
J033051P05CATGGGCCGTTTNONE 
J033061D21CATGGGCCGTTTNONE 
J033071M06CATGGGCCGTTTNONE 
J033072D18CATGGGCCGTTTNONE 
J033073M13CATGGGCCGTTTNONE 
J033084N02CATGGGCCGTTTNONE 
J065092C13CATGGGCCGTTTNONE 
J080017H24CATGGGCCGTTTNONE 
J080032E16CATGGGCCGTTTNONE 
J080077J07CATGGGCCGTTTNONE 
Os01g0159600013-096-A02AAACGGCCNONE 
AK064055AAACGGCCSmall hydrophilic plant seed protein family protein. 
AK122153AAACGGCCNONE 
J033073N07AAACGGCCNONE 
J033088A13AAACGGCCNONE 
J033143J06AAACGGCCNONE 
J053031D05AAACGGCCNONE 
J053037K14AAACGGCCNONE 
J053045E08AAACGGCCNONE 
J053062D01AAACGGCCNONE 
J053083H22AAACGGCCNONE 
J053089G12AAACGGCCNONE 
J053089G24AAACGGCCNONE 
J053099O13AAACGGCCNONE 
J065070H11AAACGGCCNONE 
J075013L17AAACGGCCNONE 
J075021L24AAACGGCCNONE 
J075033B10AAACGGCCNONE 
J075034G01AAACGGCCNONE 
J075035A11AAACGGCCNONE 
J075045F22AAACGGCCNONE 
J075046N02AAACGGCCNONE 
J075047K11AAACGGCCNONE 
J075058N15AAACGGCCNONE 
J075059E22AAACGGCCNONE 
J075061G22AAACGGCCNONE 
J075078E12AAACGGCCNONE 
J075079B08AAACGGCCNONE 
J075090K12AAACGGCCNONE 
J075096P05AAACGGCCNONE 
J075097G05AAACGGCCNONE 
J075097O15AAACGGCCNONE 
J075101J04AAACGGCCNONE 
J075104K17AAACGGCCNONE 
J075110F15AAACGGCCNONE 
J075118D23AAACGGCCNONE 
J075118E10AAACGGCCNONE 
J075137K22AAACGGCCNONE 
J075138P08AAACGGCCNONE 
J075142E22AAACGGCCNONE 
J075147K12AAACGGCCNONE 
J075149D12AAACGGCCNONE 
J075152A15AAACGGCCNONE 
J075152H08AAACGGCCNONE 
J075156C11AAACGGCCNONE 
J075156H20AAACGGCCNONE 
J075162I01AAACGGCCNONE 
J075166H16AAACGGCCNONE 
J075186F11AAACGGCCNONE 
J075189F22AAACGGCCNONE 
J075190E16AAACGGCCNONE 
J075193O11AAACGGCCNONE 
Os01g0266400009-169-A06GGCCGTTTNONE 
AK121188GGCCGTTTConserved hypothetical protein. 
J023085H22GGCCGTTTNONE 
J080301K14GGCCGTTTNONE 
J080303B07GGCCGTTTNONE 
J080303H21GGCCGTTTNONE 
J080308F24GGCCGTTTNONE 
Os01g0349400AK064941AAACGGCCNONE 
AK100195AAACGGCCNONE 
AK105047AAACGGCCNONE 
AK122182AAACGGCCSimilar to Serine/threonine protein phosphatase PP1 (EC 3.1.3.16) (Fragment). 
Os01g0593700Os01g0593700AAACGGCCCAATSulphate anion transporter family protein. 
Os01g0621600AK100122AAACGGCCProtein of unknown function DUF1221 domain containing protein. 
Os01g0642900009-109-F01AAACGGCCCATATNONE 
AK063836AAACGGCCCATATSingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560AAACGGCCCATATNONE 
J033043K18AAACGGCCCATATNONE 
J100023C05AAACGGCCCATATNONE 
J100038C15AAACGGCCCATATNONE 
J100039C23AAACGGCCCATATNONE 
Os01g0705700003-130-H06AAACGGCCNONE 
AK064946AAACGGCCSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116). 
J013000P16AAACGGCCNONE 
Os01g0732200015-078-D03GGGCCGTTTNONE 
AK067563GGGCCGTTTGTP-binding protein, HSR1-related domain containing protein. 
J013111I12GGGCCGTTTNONE 
J033113N16GGGCCGTTTNONE 
J033124C05GGGCCGTTTNONE 
Os01g0869200AK073453AAACGGCCMg2+ transporter protein, CorA-like family protein. 
Os01g0880800AK059526AAACGGCCNONE 
AK101524AAACGGCCNONE 
AK120809AAACGGCCSimilar to Acyl-[acyl-carrier-protein] desaturase, chloroplast precursor (EC 1.14.19.2) (Stearoyl-ACP desaturase). 
J065112H13AAACGGCCNONE 
J090098J11AAACGGCCNONE 
Os01g0881100AK109822GCGGCCCAAACGGCCEpsin, N-terminal domain containing protein. 
Os01g0888900AK120651AAACGGCCConserved hypothetical protein. 
J013157C10AAACGGCCNONE 
J065019H01AAACGGCCNONE 
J065182E10AAACGGCCNONE 
J065195D16AAACGGCCNONE 
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14AAACGGCCCAAAANONE 
J013063O14AAACGGCCCAAAANONE 
J023023D20AAACGGCCCAAAANONE 
J075121J02AAACGGCCCAAAANONE 
Os02g0123200016-017-F04AAACGGCCCGGTNONE 
J033057C03AAACGGCCCGGTNONE 
J033087C11AAACGGCCCGGTNONE 
J033108J20AAACGGCCCGGTNONE 
J043015P08AAACGGCCCGGTNONE 
Os02g0186500AK068056AAACGGCCCACTSimilar to Protein kinase-like protein. 
AK099031AAACGGCCCACTNONE 
J013111A12AAACGGCCCACTNONE 
J013127K13AAACGGCCCACTNONE 
J013132O11AAACGGCCCACTNONE 
J023056A11AAACGGCCCACTNONE 
J023078M08AAACGGCCCACTNONE 
J033081F07AAACGGCCCACTNONE 
J090079E24AAACGGCCCACTNONE 
J090097I02AAACGGCCCACTNONE 
Os02g0188500AK102004AAACGGCCCAAAANONE 
AK106917AAACGGCCCAAAAUbiquitin domain containing protein. 
J090039N13AAACGGCCCAAAANONE 
Os02g0321000AK121840TAATGGGCCGTTTTetratricopeptide-like helical domain containing protein. 
Os02g0612900AK071108AAACGGCCSimilar to Temperature stress-induced lipocalin. 
J013045F10AAACGGCCNONE 
J023078B21AAACGGCCNONE 
Os02g0629900AK108563AGCCCAAAAACGGCCCConserved hypothetical protein. 
J065138O07AGCCCAAAAACGGCCCNONE 
Os02g0644000AK070079AAACGGCCSimilar to C13 endopeptidase NP1 (Fragment). 
Os02g0712400J065037K01AAACGGCCGTTTNONE 
J065083P10AAACGGCCGTTTNONE 
J065184E08AAACGGCCGTTTNONE 
J100033E07AAACGGCCGTTTNONE 
J100040I16AAACGGCCGTTTNONE 
J100076M16AAACGGCCGTTTNONE 
Os02g0712500003-128-B04GGCCGTTTNONE 
AK100094GGCCGTTTProtein of unknown function DUF23 family protein. 
J023003P08GGCCGTTTNONE 
J033070I23GGCCGTTTNONE 
J065019B12GGCCGTTTNONE 
J065021D22GGCCGTTTNONE 
J065063H05GGCCGTTTNONE 
J065103B14GGCCGTTTNONE 
J065136I12GGCCGTTTNONE 
J065195F24GGCCGTTTNONE 
J090045N11GGCCGTTTNONE 
Os02g0717800009-009-B02AAATGGGCCGTTTNONE 
J065185P06AAATGGGCCGTTTNONE 
J100061J04AAATGGGCCGTTTNONE 
J100064M21AAATGGGCCGTTTNONE 
Os02g0777800AK066978GGCCGTTTSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0777950J090078H24AAACGGCCCATAAConserved hypothetical protein. 
Os02g0788500006-024-A02AAACGGCCCAAGNONE 
006-031-G02AAACGGCCCAAGNONE 
006-081-F11AAACGGCCCAAGNONE 
006-082-H05AAACGGCCCAAGNONE 
AK061452AAACGGCCCAAGConserved hypothetical protein. 
AK104117AAACGGCCCAAGNONE 
AK104526AAACGGCCCAAGNONE 
J075024D11AAACGGCCCAAGNONE 
J075056B12AAACGGCCCAAGNONE 
J075108H12AAACGGCCCAAGNONE 
J075156P10AAACGGCCCAAGNONE 
J075197A19AAACGGCCCAAGNONE 
Os03g0122200009-052-H10GGCCGTTTNONE 
AB042934GGCCGTTTNONE 
AK065033GGCCGTTTSimilar to 50S ribosomal protein L11. 
J013001H03GGCCGTTTNONE 
J023149C23GGCCGTTTNONE 
J065025J15GGCCGTTTNONE 
J065093D22GGCCGTTTNONE 
Os03g0135700AK060029GGCCGTTTNONE 
AK103779GGCCGTTTSimilar to Transcriptional activator Rb homolog (Fragment). 
J033145C17GGCCGTTTNONE 
J043021B17GGCCGTTTNONE 
Os03g0143000AK073102AAACGGCCCGTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24AAACGGCCCGTTNONE 
Os03g0213600AK100407AAACGGCCCGConserved hypothetical protein. 
Os03g0222100AK070688GGCCGTTTSimilar to Topoisomerase-like protein. 
J023057E15GGCCGTTTNONE 
J023099M24GGCCGTTTNONE 
J023147F14GGCCGTTTNONE 
Os03g0231600AK105963AAACGGCCSimilar to Branched-chain-amino-acid aminotransferase 3, chloroplast precursor (EC 2.6.1.42) (Atbcat-3). 
AK120579AAACGGCCNONE 
Os03g0252800AK065537AAACGGCCCNONE 
AK067765AAACGGCCCAminotransferase, class I and II domain containing protein. 
Os03g0265400006-022-A01TAATGGGCCGTTTNONE 
006-033-E05TAATGGGCCGTTTNONE 
006-035-A03TAATGGGCCGTTTNONE 
006-057-D09TAATGGGCCGTTTNONE 
006-058-D03TAATGGGCCGTTTNONE 
006-061-B04TAATGGGCCGTTTNONE 
006-076-C01TAATGGGCCGTTTNONE 
006-089-C09TAATGGGCCGTTTNONE 
006-092-D01TAATGGGCCGTTTNONE 
006-100-D06TAATGGGCCGTTTNONE 
009-014-G04TAATGGGCCGTTTNONE 
009-060-C06TAATGGGCCGTTTNONE 
009-098-A06TAATGGGCCGTTTNONE 
AK061468TAATGGGCCGTTTNONE 
AK104116TAATGGGCCGTTTNONE 
AK104424TAATGGGCCGTTTNONE 
AK120527TAATGGGCCGTTTSimilar to 50S ribosomal protein L4, chloroplast precursor (R-protein L4). 
J013127C20TAATGGGCCGTTTNONE 
J023031E11TAATGGGCCGTTTNONE 
J023150F18TAATGGGCCGTTTNONE 
J033037G14TAATGGGCCGTTTNONE 
J065073K02TAATGGGCCGTTTNONE 
J065085P13TAATGGGCCGTTTNONE 
J065161B21TAATGGGCCGTTTNONE 
J065197G23TAATGGGCCGTTTNONE 
Os03g0278200AK103544AAACGGCCCGNAD-dependent epimerase/dehydratase family protein. 
Os03g0309000AK070071AAACGGCCVirulence factor, pectin lyase fold family protein. 
Os03g0332400AK103161GGCCGTTTSimilar to Hydroxyacylglutathione hydrolase cytoplasmic (EC 3.1.2.6) (Glyoxalase II) (Glx II). 
J033121D04GGCCGTTTNONE 
J065090F18GGCCGTTTNONE 
J100065F07GGCCGTTTNONE 
J100085G24GGCCGTTTNONE 
Os03g0332700AK072820AAACGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0359700AK060778AAACGGCCCArmadillo-like helical domain containing protein. 
AK109309AAACGGCCCNONE 
J013106M15AAACGGCCCNONE 
J023099J09AAACGGCCCNONE 
J023112C23AAACGGCCCNONE 
J065190A21AAACGGCCCNONE 
J065206O20AAACGGCCCNONE 
J090027N12AAACGGCCCNONE 
Os03g0440900006-025-H04AAACGGCCNONE 
006-047-H07AAACGGCCNONE 
006-060-H12AAACGGCCNONE 
006-070-A03AAACGGCCNONE 
006-092-C02AAACGGCCNONE 
006-094-G10AAACGGCCNONE 
014-077-B09AAACGGCCNONE 
AK061730AAACGGCCSimilar to LRR protein. 
AK069710AAACGGCCNONE 
J013027E23AAACGGCCNONE 
J023031G03AAACGGCCNONE 
J065166J18AAACGGCCNONE 
J075034K19AAACGGCCNONE 
J075046I24AAACGGCCNONE 
J075176D13AAACGGCCNONE 
J090060I21AAACGGCCNONE 
J100025G01AAACGGCCNONE 
J100025O12AAACGGCCNONE 
J100041L24AAACGGCCNONE 
J100057B08AAACGGCCNONE 
J100060J12AAACGGCCNONE 
Os03g0735300AK071715AAACGGCCAlba, DNA/RNA-binding protein family protein. 
J065100I07AAACGGCCNONE 
Os03g0750000AK071321AAACGGCCUniversal stress protein (Usp) family protein. 
J023088M23AAACGGCCNONE 
J065163N07AAACGGCCNONE 
J075006P15AAACGGCCNONE 
J075007N13AAACGGCCNONE 
J075018H04AAACGGCCNONE 
J075025E04AAACGGCCNONE 
J075036K02AAACGGCCNONE 
J075049I06AAACGGCCNONE 
J075050F19AAACGGCCNONE 
J075055M07AAACGGCCNONE 
J075070D11AAACGGCCNONE 
J075072A01AAACGGCCNONE 
J075081I23AAACGGCCNONE 
J075083G08AAACGGCCNONE 
J075095B03AAACGGCCNONE 
J075099I22AAACGGCCNONE 
J075122G06AAACGGCCNONE 
J075130C13AAACGGCCNONE 
J075143H06AAACGGCCNONE 
J075154E20AAACGGCCNONE 
J075174D01AAACGGCCNONE 
J075175E01AAACGGCCNONE 
J075185H11AAACGGCCNONE 
J080005K09AAACGGCCNONE 
J080006M06AAACGGCCNONE 
J080009M15AAACGGCCNONE 
J080013J23AAACGGCCNONE 
J080014L22AAACGGCCNONE 
J080018B22AAACGGCCNONE 
J080023C20AAACGGCCNONE 
J080025B08AAACGGCCNONE 
J080025C17AAACGGCCNONE 
J080025D21AAACGGCCNONE 
J080027A19AAACGGCCNONE 
J080030K08AAACGGCCNONE 
J080034I08AAACGGCCNONE 
J080034P08AAACGGCCNONE 
J080039E04AAACGGCCNONE 
J080041J05AAACGGCCNONE 
J080043G01AAACGGCCNONE 
J080044M21AAACGGCCNONE 
J080045J24AAACGGCCNONE 
J080045M10AAACGGCCNONE 
J080047E17AAACGGCCNONE 
J080047I12AAACGGCCNONE 
J080052I15AAACGGCCNONE 
J080060L19AAACGGCCNONE 
J080062M06AAACGGCCNONE 
J080064F23AAACGGCCNONE 
J080068L14AAACGGCCNONE 
J080070H15AAACGGCCNONE 
J080071P16AAACGGCCNONE 
J080076H11AAACGGCCNONE 
J080076L20AAACGGCCNONE 
J080077H05AAACGGCCNONE 
J080079E17AAACGGCCNONE 
J080089N23AAACGGCCNONE 
J080095J09AAACGGCCNONE 
J080096M12AAACGGCCNONE 
J080097E11AAACGGCCNONE 
Os03g0799000013-010-A07GGCCGTTTCGGCCNONE 
013-081-H02GGCCGTTTCGGCCNONE 
AK067840GGCCGTTTCGGCCSimilar to Histone H1. 
AK099211GGCCGTTTCGGCCNONE 
J065066F23GGCCGTTTCGGCCNONE 
J065138O20GGCCGTTTCGGCCNONE 
J065163G22GGCCGTTTCGGCCNONE 
J065211J01GGCCGTTTCGGCCNONE 
J080027D02GGCCGTTTCGGCCNONE 
J080029E20GGCCGTTTCGGCCNONE 
J080045D03GGCCGTTTCGGCCNONE 
J080060G13GGCCGTTTCGGCCNONE 
J080067E14GGCCGTTTCGGCCNONE 
J080067J04GGCCGTTTCGGCCNONE 
J080067J21GGCCGTTTCGGCCNONE 
J080068L09GGCCGTTTCGGCCNONE 
J080077E15GGCCGTTTCGGCCNONE 
J080078B03GGCCGTTTCGGCCNONE 
J080086H09GGCCGTTTCGGCCNONE 
J090095G02GGCCGTTTCGGCCNONE 
J100058H04GGCCGTTTCGGCCNONE 
Os03g0833700011-060-A10TCATGGGCCGTTTNONE 
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein. 
Os03g0844100AK067164AAACGGCCSimilar to Pti1 kinase-like protein. 
Os03g0851300013-070-G05AAACGGCCNONE 
AK071162AAACGGCCProteasome component region PCI domain containing protein. 
AK073581AAACGGCCNONE 
AK104846AAACGGCCNONE 
AK105457AAACGGCCNONE 
J033030N18AAACGGCCNONE 
Os04g0381000AK105435AAACGGCCDynamin family protein. 
J075003I06AAACGGCCNONE 
Os04g0418000006-025-C05AAACGGCCCATTTNONE 
006-025-D11AAACGGCCCATTTNONE 
006-045-F02AAACGGCCCATTTNONE 
006-060-B04AAACGGCCCATTTNONE 
006-063-E03AAACGGCCCATTTNONE 
006-070-G08AAACGGCCCATTTNONE 
006-072-H05AAACGGCCCATTTNONE 
AK061030AAACGGCCCATTTNONE 
AK099124AAACGGCCCATTTNONE 
AK106155AAACGGCCCATTTConserved hypothetical protein. 
AK119714AAACGGCCCATTTNONE 
J023039I07AAACGGCCCATTTNONE 
J065025N03AAACGGCCCATTTNONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0462500006-073-E08GGCCGTTTNONE 
AK062065GGCCGTTTNONE 
AK071311GGCCGTTTSimilar to 14-3-3-like protein GF14-6. 
AK071822GGCCGTTTNONE 
AK099243GGCCGTTTNONE 
AK101938GGCCGTTTNONE 
J013056F02GGCCGTTTNONE 
J023020E08GGCCGTTTNONE 
J023085B16GGCCGTTTNONE 
J023117D08GGCCGTTTNONE 
J023133K12GGCCGTTTNONE 
J033025G04GGCCGTTTNONE 
J033052A15GGCCGTTTNONE 
J033074G16GGCCGTTTNONE 
J033090A16GGCCGTTTNONE 
J033122A07GGCCGTTTNONE 
J033133G09GGCCGTTTNONE 
J065002F16GGCCGTTTNONE 
J065030M09GGCCGTTTNONE 
J065056B11GGCCGTTTNONE 
J065115I10GGCCGTTTNONE 
J065120O09GGCCGTTTNONE 
J065124G21GGCCGTTTNONE 
J075031C14GGCCGTTTNONE 
J075040H07GGCCGTTTNONE 
J075047F04GGCCGTTTNONE 
J075065F14GGCCGTTTNONE 
J075066G20GGCCGTTTNONE 
J075105D01GGCCGTTTNONE 
J075147B04GGCCGTTTNONE 
J075149A12GGCCGTTTNONE 
J075172D07GGCCGTTTNONE 
J075190J11GGCCGTTTNONE 
J090038H18GGCCGTTTNONE 
J090087G05GGCCGTTTNONE 
J100025A10GGCCGTTTNONE 
J100025O10GGCCGTTTNONE 
J100027D02GGCCGTTTNONE 
J100027P06GGCCGTTTNONE 
J100032K04GGCCGTTTNONE 
J100056D21GGCCGTTTNONE 
J100060J08GGCCGTTTNONE 
J100063N19GGCCGTTTNONE 
J100064C14GGCCGTTTNONE 
J100064K18GGCCGTTTNONE 
J100070L21GGCCGTTTNONE 
J100072M17GGCCGTTTNONE 
J100074F21GGCCGTTTNONE 
J100087E05GGCCGTTTNONE 
U65956GGCCGTTTNONE 
Os04g0574500AK110934GGCCGTTTSimilar to Growth-regulating factor 3. 
J065101K11GGCCGTTTNONE 
J065207F18GGCCGTTTNONE 
Os04g0636900011-028-G03AAACGGCCCAGTTNONE 
012-040-G03AAACGGCCCAGTTNONE 
AK058405AAACGGCCCAGTTNONE 
AK065789AAACGGCCCAGTTNONE 
AK101408AAACGGCCCAGTTNONE 
AK119286AAACGGCCCAGTTNONE 
J013042J24AAACGGCCCAGTTNONE 
J033037I12AAACGGCCCAGTTNONE 
J043031B12AAACGGCCCAGTTNONE 
J065152N10AAACGGCCCAGTTNONE 
J090060K17AAACGGCCCAGTTNONE 
J090083K14AAACGGCCCAGTTNONE 
J100046O13AAACGGCCCAGTTNONE 
J100066G22AAACGGCCCAGTTNONE 
Os04g0668900AF085174AAACGGCCNONE 
AK067891AAACGGCCSimilar to Plastid terminal oxidase. 
Os05g0120800AK066865AAACGGCCCATATConserved hypothetical protein. 
AK066865GGCCGTTTConserved hypothetical protein. 
Os05g0408300AK068553AAACGGCCConserved hypothetical protein. 
Os05g0435800AK067138AAACGGCCSimilar to Subtilisin-like protease. 
J013096L15AAACGGCCNONE 
J023003D11AAACGGCCNONE 
Os05g0437300AK102760AAACGGCCHnRNP-L/PTB/hephaestus splicing factor family protein. 
Os05g0481900AK106744GGCCGTTTNONE 
AK119626GGCCGTTTAuxin Efflux Carrier family protein. 
Os05g0595100014-099-H02GGCCGTTTNONE 
015-074-F02GGCCGTTTNONE 
015-085-E10GGCCGTTTNONE 
016-007-E01GGCCGTTTNONE 
016-017-A05GGCCGTTTNONE 
016-029-D07GGCCGTTTNONE 
016-037-A03GGCCGTTTNONE 
AB087745GGCCGTTTSimilar to UDPglucose 4-epimerase-like protein. 
AK066249GGCCGTTTNONE 
D21120GGCCGTTTNONE 
J013051I17GGCCGTTTNONE 
J065040G16GGCCGTTTNONE 
J075017N14GGCCGTTTNONE 
J075021P07GGCCGTTTNONE 
J075089K07GGCCGTTTNONE 
J075106A18GGCCGTTTNONE 
J075122M09GGCCGTTTNONE 
J075123O04GGCCGTTTNONE 
J075133K19GGCCGTTTNONE 
J075168G10GGCCGTTTNONE 
Os06g0666400AK108002GGCCGTTTVQ domain containing protein. 
J065043C22GGCCGTTTNONE 
J065120O19GGCCGTTTNONE 
J075197D23GGCCGTTTNONE 
J100030E22GGCCGTTTNONE 
J100031I22GGCCGTTTNONE 
J100072I12GGCCGTTTNONE 
Os06g0675700AK065487AAACGGCCNONE 
AK119824AAACGGCCSimilar to High pI alpha-glucosidase. 
Os07g0142000AK059877AAACGGCCCReticulon family protein. 
AK099414AAACGGCCCNONE 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0222800009-072-E05AAACGGCCCAGCNONE 
AK060442AAACGGCCCAGCNONE 
AK100823AAACGGCCCAGCAcyl carrier protein-like protein. 
AK103131AAACGGCCCAGCNONE 
AY224456AAACGGCCCAGCNONE 
J075026H13AAACGGCCCAGCNONE 
J075142G06AAACGGCCCAGCNONE 
J100033K08AAACGGCCCAGCNONE 
Os07g0408500AK103596AAACGGCCSimilar to Rac GTPase activating protein 3 (Fragment). 
Os07g0516900009-108-C10GGCCGTTTNONE 
AK062798GGCCGTTTNONE 
Os07g0570700AK065242AAACGGCCCATTARibosome recycling factor family protein. 
J013002I12AAACGGCCCATTANONE 
Os07g0574800006-097-G09GGCCGTTTNONE 
013-077-E02GGCCGTTTNONE 
014-010-B04GGCCGTTTNONE 
AK067721GGCCGTTTTubulin alpha-1 chain. 
AK069140GGCCGTTTNONE 
AK104900GGCCGTTTNONE 
J013037J23GGCCGTTTNONE 
J013045O05GGCCGTTTNONE 
J013056A21GGCCGTTTNONE 
J013119N24GGCCGTTTNONE 
J023036H19GGCCGTTTNONE 
J023036K16GGCCGTTTNONE 
J023067J23GGCCGTTTNONE 
J023075H08GGCCGTTTNONE 
J023084K13GGCCGTTTNONE 
J023097O10GGCCGTTTNONE 
J033093K22GGCCGTTTNONE 
J033105L08GGCCGTTTNONE 
J065219H05GGCCGTTTNONE 
J075010N07GGCCGTTTNONE 
J075130I08GGCCGTTTNONE 
J090014E16GGCCGTTTNONE 
J090025K17GGCCGTTTNONE 
J090030L19GGCCGTTTNONE 
J090035J05GGCCGTTTNONE 
J090036B17GGCCGTTTNONE 
J090037A15GGCCGTTTNONE 
J090064C17GGCCGTTTNONE 
J090069L18GGCCGTTTNONE 
J090073N11GGCCGTTTNONE 
J090077F23GGCCGTTTNONE 
J090099F02GGCCGTTTNONE 
J100029N06GGCCGTTTNONE 
J100056I04GGCCGTTTNONE 
J100061A13GGCCGTTTNONE 
J100062B10GGCCGTTTNONE 
J100062J17GGCCGTTTNONE 
J100072F22GGCCGTTTNONE 
J100072J22GGCCGTTTNONE 
J100076C03GGCCGTTTNONE 
X91808GGCCGTTTNONE 
Z11931GGCCGTTTNONE 
Os07g0602000AK071832GGGCCGTTTCCACGCCACSimilar to NADPH HC toxin reductase (Fragment). 
J023121D11GGGCCGTTTCCACGCCACNONE 
J023138E01GGGCCGTTTCCACGCCACNONE 
J023149O13GGGCCGTTTCCACGCCACNONE 
J090074M19GGGCCGTTTCCACGCCACNONE 
Os07g0606600AK111621AAACGGCCNONE 
AK112118AAACGGCCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22AAACGGCCNONE 
Os07g0673900J080092A21CCACGGCCGTTTNONE 
Os08g0120000006-042-E02AAACGGCCCAACANONE 
006-051-F06AAACGGCCCAACANONE 
006-052-G03AAACGGCCCAACANONE 
006-095-B11AAACGGCCCAACANONE 
AB017427AAACGGCCCAACANONE 
AB017428AAACGGCCCAACANONE 
AK059789AAACGGCCCAACANONE 
AK059815AAACGGCCCAACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077AAACGGCCCAACANONE 
AK102607AAACGGCCCAACANONE 
AK104303AAACGGCCCAACANONE 
AK104304AAACGGCCCAACANONE 
AK104421AAACGGCCCAACANONE 
D10414AAACGGCCCAACANONE 
J013170D08AAACGGCCCAACANONE 
J023086D16AAACGGCCCAACANONE 
J033099B04AAACGGCCCAACANONE 
J065042P05AAACGGCCCAACANONE 
J065144E22AAACGGCCCAACANONE 
J065162J20AAACGGCCCAACANONE 
J065196N13AAACGGCCCAACANONE 
J090013B11AAACGGCCCAACANONE 
Os08g0164100AK108589GGCCGTTTProtein of unknown function DUF295 family protein. 
Os08g0302000AK106760AAACGGCCCAACSimilar to Peroxidase 40 precursor (EC 1.11.1.7) (Atperox P40). 
Os08g0309300Os08g0309300AAACGGCCSimilar to AtRer1B. 
Os08g0398000AK101910GGCCGTTTABC transporter related domain containing protein. 
Os08g0463900AK120178TTCGTGGGCCGTTTConserved hypothetical protein. 
J013033H06TTCGTGGGCCGTTTNONE 
J075006G17TTCGTGGGCCGTTTNONE 
Os08g0475100AK105839AAACGGCCEsterase/lipase/thioesterase domain containing protein. 
Os08g0497300AK068384AAACGGCCNONE 
AK070235AAACGGCCCellular retinaldehyde binding/alpha-tocopherol transport family protein. 
Os08g0546300AK064717TGATGGGCCGTTTConserved hypothetical protein. 
AK119794TGATGGGCCGTTTNONE 
D10982TGATGGGCCGTTTNONE 
J080044B21TGATGGGCCGTTTNONE 
Os08g0548300AK073266TGATGGGCCGTTTZinc finger, RING-type domain containing protein. 
J013030C19TGATGGGCCGTTTNONE 
J033029A20TGATGGGCCGTTTNONE 
J033050L14TGATGGGCCGTTTNONE 
J033058F03TGATGGGCCGTTTNONE 
J033110K01TGATGGGCCGTTTNONE 
J033123D21TGATGGGCCGTTTNONE 
Os08g0549300009-008-F01AAACGGCCCATCCNONE 
009-033-G10AAACGGCCCATCCNONE 
AK120938AAACGGCCCATCCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420AAACGGCCCATCCNONE 
J023037A21AAACGGCCCATCCNONE 
J023066D20AAACGGCCCATCCNONE 
J033099K13AAACGGCCCATCCNONE 
J065116C14AAACGGCCCATCCNONE 
J075009K15AAACGGCCCATCCNONE 
J075071P13AAACGGCCCATCCNONE 
J075080D18AAACGGCCCATCCNONE 
J075124F24AAACGGCCCATCCNONE 
J075198F23AAACGGCCCATCCNONE 
J080006B15AAACGGCCCATCCNONE 
J090078H13AAACGGCCCATCCNONE 
J090089J09AAACGGCCCATCCNONE 
J100017A03AAACGGCCCATCCNONE 
J100023G03AAACGGCCCATCCNONE 
Os09g0267600003-130-C11GGCCGTTTNONE 
AK065728GGCCGTTTSnf7 family protein. 
J013036O11GGCCGTTTNONE 
J013110D08GGCCGTTTNONE 
J033095H15GGCCGTTTNONE 
J065073F24GGCCGTTTNONE 
J065116E02GGCCGTTTNONE 
J080319E18GGCCGTTTNONE 
Os09g0407900016-010-E10GGCCGTTTNONE 
AK070971GGCCGTTTPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J033140K02GGCCGTTTNONE 
J033142K02GGCCGTTTNONE 
Os09g0454900011-052-B02AAACGGCCCGNONE 
016-025-D09AAACGGCCCGNONE 
AK102152AAACGGCCCGCurculin-like (mannose-binding) lectin domain containing protein. 
J033086D22AAACGGCCCGNONE 
Os09g0461800009-087-C07CGGGCCGTTTNONE 
AK062676CGGGCCGTTTEsterase/lipase/thioesterase domain containing protein. 
Os09g0485800AK108749GTTTGGGCCGTTTConserved hypothetical protein. 
J065137H03GTTTGGGCCGTTTNONE 
Os09g0567000012-071-E09AAACGGCCNONE 
013-099-E05AAACGGCCNONE 
AK065613AAACGGCCConserved hypothetical protein. 
J013026M04AAACGGCCNONE 
J023103F04AAACGGCCNONE 
J033119N04AAACGGCCNONE 
J065011I19AAACGGCCNONE 
J065042A10AAACGGCCNONE 
J100023F16AAACGGCCNONE 
Os11g0139100009-099-H06AAACGGCCCAGTTNONE 
AK121443AAACGGCCCAGTTSimilar to 50S ribosomal protein L24. 
J023140O18AAACGGCCCAGTTNONE 
J023143M23AAACGGCCCAGTTNONE 
J033079G04AAACGGCCCAGTTNONE 
J043004D20AAACGGCCCAGTTNONE 
J065097F05AAACGGCCCAGTTNONE 
Os11g0444900009-136-A09GGCCGTTTNONE 
009-154-A11GGCCGTTTNONE 
AF493074GGCCGTTTOcticosapeptide/Phox/Bem1p domain containing protein. 
J053033M12GGCCGTTTNONE 
J053074N04GGCCGTTTNONE 
J053075A20GGCCGTTTNONE 
J053095D10GGCCGTTTNONE 
J065034G24GGCCGTTTNONE 
J065102M17GGCCGTTTNONE 
J065214D08GGCCGTTTNONE 
J075010E19GGCCGTTTNONE 
J075010L20GGCCGTTTNONE 
J075017G03GGCCGTTTNONE 
J075098J18GGCCGTTTNONE 
J075130C14GGCCGTTTNONE 
J075132P21GGCCGTTTNONE 
J075134G15GGCCGTTTNONE 
J075145F02GGCCGTTTNONE 
J075182B15GGCCGTTTNONE 
J075186G06GGCCGTTTNONE 
J100045J19GGCCGTTTNONE 
J100061O07GGCCGTTTNONE 
J100090H07GGCCGTTTNONE 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0621400009-043-B05AAACGGCCNONE 
AK062468AAACGGCCConserved hypothetical protein. 
Os11g0641500AK103094AAACGGCCCupredoxin domain containing protein. 
J065012G11AAACGGCCNONE 
Os11g0703000AK108011AAACGGCCThaumatin, pathogenesis-related family protein. 
J100084D12AAACGGCCNONE 
Os12g0141400AK071576AAACGGCCCGHypothetical protein. 
J023105A17AAACGGCCCGNONE 
Os12g0165200AK110577AAACGGCCCAAAHSP20-like chaperone domain containing protein. 
Os12g0592200Os12g0592200AAACGGCCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.