version

Summary of OsREG421 (All List)

OrganismOryza sativa  
IDOsREG421  
SequenceAAAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2238  

Entry Sequences (2238 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0104800AK067602AAAAGCCCATGTSas10/Utp3 family protein. 
J013109E04AAAAGCCCATGTNONE 
J033057M05AAAAGCCCATGTNONE 
J043021M24AAAAGCCCATGTNONE 
J090014N05AAAAGCCCATGTNONE 
J090077H23AAAAGCCCATGTNONE 
J090084H08AAAAGCCCATGTNONE 
Os01g0141600016-051-A03ATCTGGGCTTTNONE 
AK066922ATCTGGGCTTTProtein of unknown function DUF647 family protein. 
Os01g0155600006-048-F03AAAGCCCATATNONE 
AK060171AAAGCCCATATNONE 
AK071635AAAGCCCATATSimilar to Splicing factor RSZ33. 
J023080A03AAAGCCCATATNONE 
J023100L15AAAGCCCATATNONE 
J033075I17AAAGCCCATATNONE 
J033085O09AAAGCCCATATNONE 
J033105E15AAAGCCCATATNONE 
J033132N10AAAGCCCATATNONE 
J033132P12AAAGCCCATATNONE 
J033149H12AAAGCCCATATNONE 
J043026M03AAAGCCCATATNONE 
J080305J10AAAGCCCATATNONE 
J080308K03AAAGCCCATATNONE 
J090023M04AAAGCCCATATNONE 
J090078F24AAAGCCCATATNONE 
J100066P05AAAGCCCATATNONE 
Os01g0158900AK066765AAAAGCCCAATZinc finger, RING-type domain containing protein. 
Os01g0190400AK064011AAAAGCCCAACSimilar to Hexokinase. 
AK099119AAAAGCCCAACNONE 
Os01g0191100009-011-A02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-028-D05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-058-B11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-151-D09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-026-G03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-063-F04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-069-B05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-029-E04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-072-H04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-089-E09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
015-047-G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
016-033-G06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
AK058815CCACCTGTGGGCCTTCTGGGCTTTTSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023077K21CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023081F19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033052N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033058N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114O17CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033129L14CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J053029I12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065067N19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065084I19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065099O03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065201I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075035B08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075037B22CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075054L16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075059D15CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075164I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075185J01CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090042O06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090044F12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090063L02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090073I10CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090078E18CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J100072K16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
Os01g0196600AK101742TATGGGCTTTNONE 
U25430TATGGGCTTTSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0212100AK065467AAAAGCCCATTTNONE 
AK101456AAAAGCCCATTTATP-dependent helicase, DEAH-box family protein. 
Os01g0220300009-063-C12AGGTGGGCTTTNONE 
009-063-C12TATTGGGCTTTNONE 
AK105167AGGTGGGCTTTConserved hypothetical protein. 
AK105167TATTGGGCTTTConserved hypothetical protein. 
J065124E17AGGTGGGCTTTNONE 
J065124E17TATTGGGCTTTNONE 
J090096L11AGGTGGGCTTTNONE 
J090096L11TATTGGGCTTTNONE 
Os01g0231700012-002-F11TCATGGGCTTTTNONE 
013-082-F05TCATGGGCTTTTNONE 
AK107453TCATGGGCTTTTSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22TCATGGGCTTTTNONE 
J065023E21TCATGGGCTTTTNONE 
J065036H21TCATGGGCTTTTNONE 
J065037M24TCATGGGCTTTTNONE 
J065049L04TCATGGGCTTTTNONE 
J065072F17TCATGGGCTTTTNONE 
J065085H10TCATGGGCTTTTNONE 
J065109N19TCATGGGCTTTTNONE 
J065117M19TCATGGGCTTTTNONE 
J065144C15TCATGGGCTTTTNONE 
J065159G24TCATGGGCTTTTNONE 
J065164N14TCATGGGCTTTTNONE 
J075025K16TCATGGGCTTTTNONE 
J075057L05TCATGGGCTTTTNONE 
J075070I16TCATGGGCTTTTNONE 
J075089D10TCATGGGCTTTTNONE 
J075138F10TCATGGGCTTTTNONE 
J090018C11TCATGGGCTTTTNONE 
J100018L19TCATGGGCTTTTNONE 
J100024B14TCATGGGCTTTTNONE 
J100048L02TCATGGGCTTTTNONE 
J100055A22TCATGGGCTTTTNONE 
J100069K01TCATGGGCTTTTNONE 
Os01g0261500AK072194GTTGGTGGTGTGGGCTTTTNONE 
AK101899GTTGGTGGTGTGGGCTTTTConserved hypothetical protein. 
J065041N17GTTGGTGGTGTGGGCTTTTNONE 
Os01g0303300J053035N19AAAGCCCAACCNONE 
J075042F02AAAGCCCAACCNONE 
J075068E10AAAGCCCAACCNONE 
J075116E19AAAGCCCAACCNONE 
J075131C10AAAGCCCAACCNONE 
J075145J11AAAGCCCAACCNONE 
J075157P20AAAGCCCAACCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12AAAGCCCAACCNONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0495900AK065221TAATGGGCTTTTSimilar to CRS2-associated factor 1. 
Os01g0513800012-032-E11GGCCGAAAAGCCCATANONE 
AK100776GGCCGAAAAGCCCATASimilar to Brix domain containing protein 1 homolog. 
J023120C10GGCCGAAAAGCCCATANONE 
J033044A22GGCCGAAAAGCCCATANONE 
J033048H13GGCCGAAAAGCCCATANONE 
J033118F03GGCCGAAAAGCCCATANONE 
J065176B05GGCCGAAAAGCCCATANONE 
J075026B19GGCCGAAAAGCCCATANONE 
J075048I23GGCCGAAAAGCCCATANONE 
J075141A19GGCCGAAAAGCCCATANONE 
J075148E05GGCCGAAAAGCCCATANONE 
J090031M12GGCCGAAAAGCCCATANONE 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0585400AK103584AGCCCAAAGCCCAATConserved hypothetical protein. 
J033133B01AGCCCAAAGCCCAATNONE 
Os01g0590300014-089-E04AAAAGCCCAGCNONE 
AK063740AAAAGCCCAGCConserved hypothetical protein. 
Os01g0633000006-075-A01AAAGCCCAGCCNONE 
009-064-A11AAAGCCCAGCCNONE 
009-153-F07AAAGCCCAGCCNONE 
AK062051AAAGCCCAGCCSimilar to 50S ribosomal protein L31. 
J013073B08AAAGCCCAGCCNONE 
J065006K19AAAGCCCAGCCNONE 
J065053P08AAAGCCCAGCCNONE 
J065057D08AAAGCCCAGCCNONE 
J065086P07AAAGCCCAGCCNONE 
J065095C14AAAGCCCAGCCNONE 
J065116B05AAAGCCCAGCCNONE 
J065164L20AAAGCCCAGCCNONE 
J065185K19AAAGCCCAGCCNONE 
J065191E21AAAGCCCAGCCNONE 
J065199P21AAAGCCCAGCCNONE 
J065216M12AAAGCCCAGCCNONE 
J075002M09AAAGCCCAGCCNONE 
J075016N10AAAGCCCAGCCNONE 
J075041K05AAAGCCCAGCCNONE 
J075094E04AAAGCCCAGCCNONE 
J075154O04AAAGCCCAGCCNONE 
J075176D22AAAGCCCAGCCNONE 
J075186M09AAAGCCCAGCCNONE 
J075191H20AAAGCCCAGCCNONE 
Os01g0649900AK068077TTTTGGGCTTTTLipolytic enzyme, G-D-S-L family protein. 
Os01g0679600009-061-F03AAAGCCCAATAGGCCCAATANONE 
014-055-H04AAAGCCCAATAGGCCCAATANONE 
AK062530AAAGCCCAATAGGCCCAATAConserved hypothetical protein. 
J065015E10AAAGCCCAATAGGCCCAATANONE 
J065061F21AAAGCCCAATAGGCCCAATANONE 
J065128F13AAAGCCCAATAGGCCCAATANONE 
J065189E14AAAGCCCAATAGGCCCAATANONE 
J075006F04AAAGCCCAATAGGCCCAATANONE 
J075017A20AAAGCCCAATAGGCCCAATANONE 
J075075H02AAAGCCCAATAGGCCCAATANONE 
J075104C06AAAGCCCAATAGGCCCAATANONE 
J075154F23AAAGCCCAATAGGCCCAATANONE 
J075168N01AAAGCCCAATAGGCCCAATANONE 
J075189L15AAAGCCCAATAGGCCCAATANONE 
J075192J18AAAGCCCAATAGGCCCAATANONE 
J100062M10AAAGCCCAATAGGCCCAATANONE 
J100064C23AAAGCCCAATAGGCCCAATANONE 
J100080M16AAAGCCCAATAGGCCCAATANONE 
Os01g0686300014-073-D12AAAGCCCAGNONE 
016-075-E10AAAGCCCAGNONE 
AK109457AAAGCCCAGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os01g0688200AK120982AAAGCCCAATAAlpha/beta hydrolase family protein. 
Os01g0704700AK100296AAAGCCCAATSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os01g0736100011-091-H04TTTTGGGCTTTTNONE 
015-004-D10TTTTGGGCTTTTNONE 
AK064298TTTTGGGCTTTTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365TTTTGGGCTTTTNONE 
AK103355TTTTGGGCTTTTNONE 
J033044B20TTTTGGGCTTTTNONE 
J033094G06TTTTGGGCTTTTNONE 
J033111N02TTTTGGGCTTTTNONE 
J033111P10TTTTGGGCTTTTNONE 
J033126K03TTTTGGGCTTTTNONE 
J043034D12TTTTGGGCTTTTNONE 
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein. 
Os01g0749200006-074-H04TGTGGGCTGCAAAGCCCAGCNONE 
AK072760TGTGGGCTGCAAAGCCCAGCNONE 
AK099041TGTGGGCTGCAAAGCCCAGCNONE 
AK104146TGTGGGCTGCAAAGCCCAGCSimilar to 50S ribosomal protein L13. 
AK119189TGTGGGCTGCAAAGCCCAGCNONE 
Os01g0782300AK109175AAAAGCCCATAConserved hypothetical protein. 
Os01g0798800016-068-H08TTTGGGCTTTNONE 
AK064257TTTGGGCTTTProtein of unknown function DUF594 family protein. 
Os01g0829400AK109566AAAAGCCCAAAAGlutaredoxin domain containing protein. 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0847300AK071164AAAGCCCACCAProtein of unknown function DUF588 family protein. 
AK104027AAAGCCCACCANONE 
Os01g0850400AJ575220AAAAGCCCATTTNONE 
AK108582AAAAGCCCATTTSimilar to MYBY1 protein (Fragment). 
Os01g0850900009-089-D11AAAGCCCAAANONE 
AK063822AAAGCCCAAANONE 
AK102887AAAGCCCAAASOUL heme-binding protein family protein. 
J033112K22AAAGCCCAAANONE 
J065087B10AAAGCCCAAANONE 
J065100A05AAAGCCCAAANONE 
J075077M10AAAGCCCAAANONE 
Os01g0852200AK063954GGGCCGTATGGGCTTTNONE 
Os01g0857250J100049D24TGTGGGCTTTConserved hypothetical protein. 
Os01g0874800016-042-F01AAAAGCCCAGCNONE 
016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAAAGCCCAGCNONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAAAGCCCAGCNONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAAAGCCCAGCNONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAAAGCCCAGC5'-3' exonuclease domain containing protein. 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAAAGCCCAGCNONE 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAAAGCCCAGCNONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAAAGCCCAGCNONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAAAGCCCAGCNONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAAAGCCCAGCNONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAAAGCCCAGCNONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0878400AK073884AAAGCCCACAmino acid/polyamine transporter II family protein. 
J065163K23AAAGCCCACNONE 
J065207H17AAAGCCCACNONE 
Os01g0891400J065077E24AAAGCCCATTConserved hypothetical protein. 
J065206I07AAAGCCCATTNONE 
Os01g0907300015-031-F03AGATGGGCTTTNONE 
AK103626AGATGGGCTTTConserved hypothetical protein. 
AK108617AGATGGGCTTTNONE 
J013094D23AGATGGGCTTTNONE 
J013106G24AGATGGGCTTTNONE 
J013120M13AGATGGGCTTTNONE 
J023056M16AGATGGGCTTTNONE 
J023092M24AGATGGGCTTTNONE 
J033133N22AGATGGGCTTTNONE 
J043010O12AGATGGGCTTTNONE 
Os01g0914000AK101364TTGTGGGCTTTConserved hypothetical protein. 
J080302O10TTGTGGGCTTTNONE 
J080305G04TTGTGGGCTTTNONE 
J080316B11TTGTGGGCTTTNONE 
J090049A14TTGTGGGCTTTNONE 
J090066O10TTGTGGGCTTTNONE 
Os01g0915800AK103859AAAGCCCAAAASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAAGCCCAAAANONE 
J090056H03AAAGCCCAAAANONE 
J090058L14AAAGCCCAAAANONE 
J090058P16AAAGCCCAAAANONE 
J090076C19AAAGCCCAAAANONE 
J100086P14AAAGCCCAAAANONE 
Os01g0935700AK069403AAAGCCCACGTSimilar to Cytochrome c1 (Fragment). 
AK073125AAAGCCCACGTNONE 
J023013M20AAAGCCCACGTNONE 
Os01g0945300003-104-D07TCATGGGCTTTTNONE 
AK065371TCATGGGCTTTTAmino acid/polyamine transporter I family protein. 
AK072189TCATGGGCTTTTNONE 
J013023D09TCATGGGCTTTTNONE 
J013055J18TCATGGGCTTTTNONE 
J013146P21TCATGGGCTTTTNONE 
J075109G14TCATGGGCTTTTNONE 
J075158O19TCATGGGCTTTTNONE 
Os01g0954400003-009-F12ACATGGGCTTTNONE 
012-080-B09ACATGGGCTTTNONE 
AK065709ACATGGGCTTTSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335ACATGGGCTTTNONE 
J013039J02ACATGGGCTTTNONE 
J033081E17ACATGGGCTTTNONE 
J075058B02ACATGGGCTTTNONE 
J075067K19ACATGGGCTTTNONE 
J075120E23ACATGGGCTTTNONE 
J075147I16ACATGGGCTTTNONE 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0971200014-071-B08AAAAGCCCACNONE 
AK064075AAAAGCCCACNONE 
Os01g0972000006-090-C11AAAGCCCAAGNONE 
AK106003AAAGCCCAAGZinc finger, RING-type domain containing protein. 
J065184F12AAAGCCCAAGNONE 
J075085O21AAAGCCCAAGNONE 
Os02g0119700AK108777AAAGCCCAACAProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0133800006-092-D12CCTGGGCCAAAGCCCAATTNONE 
006-111-G01CCTGGGCCAAAGCCCAATTNONE 
AK103646CCTGGGCCAAAGCCCAATTNONE 
AK109376CCTGGGCCAAAGCCCAATTProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CCTGGGCCAAAGCCCAATTNONE 
J033135B19CCTGGGCCAAAGCCCAATTNONE 
J065200F01CCTGGGCCAAAGCCCAATTNONE 
J065213J11CCTGGGCCAAAGCCCAATTNONE 
J075031N16CCTGGGCCAAAGCCCAATTNONE 
J075032N17CCTGGGCCAAAGCCCAATTNONE 
J075047P04CCTGGGCCAAAGCCCAATTNONE 
J075063D01CCTGGGCCAAAGCCCAATTNONE 
J075105F23CCTGGGCCAAAGCCCAATTNONE 
J075121E16CCTGGGCCAAAGCCCAATTNONE 
J075176F10CCTGGGCCAAAGCCCAATTNONE 
J075182M16CCTGGGCCAAAGCCCAATTNONE 
J075190E09CCTGGGCCAAAGCCCAATTNONE 
J075191B14CCTGGGCCAAAGCCCAATTNONE 
J100055J24CCTGGGCCAAAGCCCAATTNONE 
J100066H24CCTGGGCCAAAGCCCAATTNONE 
J100073N01CCTGGGCCAAAGCCCAATTNONE 
Os02g0167700AK069128AAAAGCCCAACCGCCCACCTArmadillo-like helical domain containing protein. 
Os02g0186700AK064492AAAGCCCAACTConserved hypothetical protein. 
J065210K09AAAGCCCAACTNONE 
J075006A17AAAGCCCAACTNONE 
J075108C18AAAGCCCAACTNONE 
J075153E08AAAGCCCAACTNONE 
Os02g0193600AK060499AAAAGCCCAATTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0205000AK060003TGTTGGGCTTTNONE 
AK073514TGTTGGGCTTTRibosomal protein L19 family protein. 
J065106I07TGTTGGGCTTTNONE 
Os02g0209900Os02g0209900AAAGCCCAAAASyntaxin/epimorphin family protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0251900AK109286AAAGCCCAGCCCSimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0255200AK121591AAAGCCCACCASimilar to Ribosomal protein S15a homolog. 
J033023N03AAAGCCCACCANONE 
J033031C22AAAGCCCACCANONE 
J033037P22AAAGCCCACCANONE 
J090013J10AAAGCCCACCANONE 
J090030I04AAAGCCCACCANONE 
Os02g0316800009-104-A11AAAGCCCACCANONE 
AK062767AAAGCCCACCASimilar to MRNA binding protein precursor. 
Os02g0326700AK064977AAAGCCCACARhomboid-like protein family protein. 
Os02g0467200014-053-H06CACGTCACAAAAGCCCATTNONE 
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein. 
J065197J05CACGTCACAAAAGCCCATTNONE 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0517333AK105573GCTGGGCTTTNONE 
AK111331GCTGGGCTTTConserved hypothetical protein. 
Os02g0519900006-057-B12GGCTGGGCTTTNONE 
006-113-G04GGCTGGGCTTTNONE 
006-119-D01GGCTGGGCTTTNONE 
AK060953GGCTGGGCTTTNONE 
AK068869GGCTGGGCTTTNONE 
AK121453GGCTGGGCTTTNONE 
D21277GGCTGGGCTTTNONE 
D21278GGCTGGGCTTTNONE 
J023002E06GGCTGGGCTTTNONE 
J023106L15GGCTGGGCTTTNONE 
J023142O06GGCTGGGCTTTNONE 
J053089A15GGCTGGGCTTTNONE 
J053091H05GGCTGGGCTTTNONE 
J080303F06GGCTGGGCTTTNONE 
J090003E12GGCTGGGCTTTNONE 
Os02g0543200AK100963AAAAGCCCACGCGCyclin-like F-box domain containing protein. 
Os02g0555000015-020-G02AAAGCCCACCACNONE 
AK065270AAAGCCCACCACNONE 
AK121253AAAGCCCACCACProtein of unknown function, ATP binding family protein. 
J013002L01AAAGCCCACCACNONE 
J023060A02AAAGCCCACCACNONE 
J023101O11AAAGCCCACCACNONE 
J023140A15AAAGCCCACCACNONE 
J033042H19AAAGCCCACCACNONE 
J033046C02AAAGCCCACCACNONE 
J033080N19AAAGCCCACCACNONE 
J065026I02AAAGCCCACCACNONE 
J065040C18AAAGCCCACCACNONE 
J090004I16AAAGCCCACCACNONE 
Os02g0558300Os02g0558300AAAGCCCACAMolybdopterin converting factor, subunit 1 family protein. 
Os02g0595800Os02g0595800AAAGCCCACCCSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0639800006-081-G07GGTTGGGCTTTNONE 
012-042-E02GGTTGGGCTTTNONE 
AK070367GGTTGGGCTTTNONE 
AK071904GGTTGGGCTTTZinc finger, RING-type domain containing protein. 
AK105980GGTTGGGCTTTNONE 
Os02g0643500AK068423CATGGGCTTTPentapeptide repeat containing protein. 
Os02g0677700AK119947AAAGCCCAGNONE 
Os02g0681100AK100584AAAGCCCATGAProtein of unknown function DUF604 family protein. 
J023106A15AAAGCCCATGANONE 
Os02g0700100AK102954AAAGCCCATAAAGCCCAGCSimilar to WD-repeat protein. 
Os02g0708300009-007-C06TTTGGGCTTTTNONE 
009-162-G06TTTGGGCTTTTNONE 
014-048-F12TTTGGGCTTTTNONE 
AK066348TTTGGGCTTTTConserved hypothetical protein. 
J013059F24TTTGGGCTTTTNONE 
J023104H14TTTGGGCTTTTNONE 
J053052O22TTTGGGCTTTTNONE 
J053063A05TTTGGGCTTTTNONE 
J053093P09TTTGGGCTTTTNONE 
J065012F24TTTGGGCTTTTNONE 
J065063P09TTTGGGCTTTTNONE 
J065088F12TTTGGGCTTTTNONE 
J065094I11TTTGGGCTTTTNONE 
J065099H19TTTGGGCTTTTNONE 
J065116H07TTTGGGCTTTTNONE 
J065137N07TTTGGGCTTTTNONE 
J065137N11TTTGGGCTTTTNONE 
J065159L22TTTGGGCTTTTNONE 
J065159P11TTTGGGCTTTTNONE 
J065178F17TTTGGGCTTTTNONE 
J065181E07TTTGGGCTTTTNONE 
J075014L16TTTGGGCTTTTNONE 
J075030P11TTTGGGCTTTTNONE 
J075042K24TTTGGGCTTTTNONE 
J075077I15TTTGGGCTTTTNONE 
J075087P06TTTGGGCTTTTNONE 
J075089F20TTTGGGCTTTTNONE 
J075093B07TTTGGGCTTTTNONE 
J075115J23TTTGGGCTTTTNONE 
J075176O19TTTGGGCTTTTNONE 
J075178A04TTTGGGCTTTTNONE 
J075178J02TTTGGGCTTTTNONE 
J090027L02TTTGGGCTTTTNONE 
J100033M12TTTGGGCTTTTNONE 
J100065O08TTTGGGCTTTTNONE 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0744100006-070-H12AAAGCCCACACNONE 
006-070-H12ATATGGGCTTTNONE 
006-115-C05AAAGCCCACACNONE 
006-115-C05ATATGGGCTTTNONE 
AK061274AAAGCCCACACSAM (and some other nucleotide) binding motif domain containing protein. 
AK061274ATATGGGCTTTSAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0751600006-048-C01GGGAAAGCCCATGGNONE 
006-059-E07GGGAAAGCCCATGGNONE 
AK060441GGGAAAGCCCATGGNONE 
AK061027GGGAAAGCCCATGGNONE 
AK072946GGGAAAGCCCATGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104401GGGAAAGCCCATGGNONE 
J023150D22GGGAAAGCCCATGGNONE 
J075005E17GGGAAAGCCCATGGNONE 
J075019F10GGGAAAGCCCATGGNONE 
J075047K24GGGAAAGCCCATGGNONE 
J075052B13GGGAAAGCCCATGGNONE 
J075063M19GGGAAAGCCCATGGNONE 
J075136P10GGGAAAGCCCATGGNONE 
J075139E24GGGAAAGCCCATGGNONE 
J075152K11GGGAAAGCCCATGGNONE 
J075161A10GGGAAAGCCCATGGNONE 
J075187F20GGGAAAGCCCATGGNONE 
Os02g0768200006-059-D06AAAGCCCACCTNONE 
AK070007AAAGCCCACCTemp24/gp25L/p24 family protein. 
J033050A21AAAGCCCACCTNONE 
Os02g0771200011-006-B07AGATGGGCTTTNONE 
AK066823AGATGGGCTTTConserved hypothetical protein. 
AK071059AGATGGGCTTTNONE 
J013075K03AGATGGGCTTTNONE 
Os02g0780800J090080O19AAAGCCCATATNONE 
J090091I06AAAGCCCATATNONE 
Os02g0782500013-043-A07ATTTGGGCTTTNONE 
013-068-B10ATTTGGGCTTTNONE 
013-093-A08ATTTGGGCTTTNONE 
014-083-C12ATTTGGGCTTTNONE 
AK063602ATTTGGGCTTTNONE 
AK119261ATTTGGGCTTTSimilar to Small heat stress protein class CIII. 
J065013N12ATTTGGGCTTTNONE 
J075136E01ATTTGGGCTTTNONE 
J075149G04ATTTGGGCTTTNONE 
Os02g0785800005-017-E01TGGATGGGCTTTNONE 
009-104-F05TGGATGGGCTTTNONE 
009-149-A09TGGATGGGCTTTNONE 
009-192-D08TGGATGGGCTTTNONE 
AK063859TGGATGGGCTTTNONE 
AK121768TGGATGGGCTTTSimilar to Ribosomal protein L35A. 
J013037M21TGGATGGGCTTTNONE 
J023009A11TGGATGGGCTTTNONE 
J023010P14TGGATGGGCTTTNONE 
J033092B03TGGATGGGCTTTNONE 
J065009O06TGGATGGGCTTTNONE 
J065024K14TGGATGGGCTTTNONE 
J065053F16TGGATGGGCTTTNONE 
J065056D18TGGATGGGCTTTNONE 
J065056N12TGGATGGGCTTTNONE 
J065071L21TGGATGGGCTTTNONE 
J065075M21TGGATGGGCTTTNONE 
J065087D19TGGATGGGCTTTNONE 
J065111N01TGGATGGGCTTTNONE 
J065172M05TGGATGGGCTTTNONE 
J065176E03TGGATGGGCTTTNONE 
J065184D08TGGATGGGCTTTNONE 
J065188K21TGGATGGGCTTTNONE 
J065194I05TGGATGGGCTTTNONE 
J065196E09TGGATGGGCTTTNONE 
J065196O21TGGATGGGCTTTNONE 
J065204O06TGGATGGGCTTTNONE 
J065212J02TGGATGGGCTTTNONE 
J075066H03TGGATGGGCTTTNONE 
J075067C04TGGATGGGCTTTNONE 
J075070I09TGGATGGGCTTTNONE 
J075081J03TGGATGGGCTTTNONE 
J075086I05TGGATGGGCTTTNONE 
J075092E09TGGATGGGCTTTNONE 
J075096D13TGGATGGGCTTTNONE 
J075098A12TGGATGGGCTTTNONE 
J075110B18TGGATGGGCTTTNONE 
J075116E14TGGATGGGCTTTNONE 
J075117J23TGGATGGGCTTTNONE 
J075117O16TGGATGGGCTTTNONE 
J075130H10TGGATGGGCTTTNONE 
J075151B07TGGATGGGCTTTNONE 
J075156C02TGGATGGGCTTTNONE 
J075159C07TGGATGGGCTTTNONE 
J075172O12TGGATGGGCTTTNONE 
J075181K16TGGATGGGCTTTNONE 
J075185J05TGGATGGGCTTTNONE 
J075186D14TGGATGGGCTTTNONE 
J075187F23TGGATGGGCTTTNONE 
J075193B15TGGATGGGCTTTNONE 
J075194P20TGGATGGGCTTTNONE 
J090002B21TGGATGGGCTTTNONE 
J090018E03TGGATGGGCTTTNONE 
J090029I04TGGATGGGCTTTNONE 
J090065F12TGGATGGGCTTTNONE 
J090066M05TGGATGGGCTTTNONE 
J090078A20TGGATGGGCTTTNONE 
J090084O15TGGATGGGCTTTNONE 
J090088P20TGGATGGGCTTTNONE 
J090098L20TGGATGGGCTTTNONE 
J100025B19TGGATGGGCTTTNONE 
J100038H15TGGATGGGCTTTNONE 
J100045H17TGGATGGGCTTTNONE 
J100058E17TGGATGGGCTTTNONE 
J100060O16TGGATGGGCTTTNONE 
J100067I10TGGATGGGCTTTNONE 
J100082N24TGGATGGGCTTTNONE 
J100083C17TGGATGGGCTTTNONE 
J100085I24TGGATGGGCTTTNONE 
J100087K20TGGATGGGCTTTNONE 
Os02g0788400AK060351AAAAGCCCATCANONE 
AK103497AAAAGCCCATCASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0793000AK070242AAAGCCCAGNONE 
AK099173AAAGCCCAGNONE 
AK105863AAAGCCCAGZinc finger, CCCH-type domain containing protein. 
Os02g0819100AK100156AAAGCCCACAZinc finger, DHHC-type domain containing protein. 
J013088C21AAAGCCCACANONE 
Os02g0823800AK120318AAAGCCCACConserved hypothetical protein. 
J075055J16AAAGCCCACNONE 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
Os03g0110300006-043-D12AAAAGCCCATANONE 
009-061-E04AAAAGCCCATANONE 
009-181-H02AAAAGCCCATANONE 
009-193-F10AAAAGCCCATANONE 
AK066190AAAAGCCCATANONE 
AK066769AAAAGCCCATANONE 
AK106206AAAAGCCCATAConserved hypothetical protein. 
J065163L08AAAAGCCCATANONE 
J080034A14AAAAGCCCATANONE 
J080052E14AAAAGCCCATANONE 
J090012J01AAAAGCCCATANONE 
J100045M01AAAAGCCCATANONE 
J100065N06AAAAGCCCATANONE 
Os03g0111800AK121627AAAGCCCAAAGCCCAAGWD40-like domain containing protein. 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0124300AK069148AAAAGCCCACGCConserved hypothetical protein. 
AK106076AAAAGCCCACGCNONE 
J023003G19AAAAGCCCACGCNONE 
Os03g0125000006-032-D09AAAGCCCACCTGNONE 
006-033-B05AAAGCCCACCTGNONE 
006-048-G06AAAGCCCACCTGNONE 
006-048-G09AAAGCCCACCTGNONE 
006-052-D09AAAGCCCACCTGNONE 
006-072-A04AAAGCCCACCTGNONE 
006-076-F12AAAGCCCACCTGNONE 
006-080-B03AAAGCCCACCTGNONE 
006-092-H03AAAGCCCACCTGNONE 
006-103-G04AAAGCCCACCTGNONE 
009-079-E01AAAGCCCACCTGNONE 
009-150-F03AAAGCCCACCTGNONE 
AF095708AAAGCCCACCTGNONE 
AK059557AAAGCCCACCTGNONE 
AK070779AAAGCCCACCTGSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999AAAGCCCACCTGNONE 
AK104137AAAGCCCACCTGNONE 
J065002D07AAAGCCCACCTGNONE 
J065167E24AAAGCCCACCTGNONE 
J075199O14AAAGCCCACCTGNONE 
J100083L01AAAGCCCACCTGNONE 
Os03g0125700009-132-G03AAATGGGCCTTAAAGCCCATTTNONE 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
J075046C16AAATGGGCCTTAAAGCCCATTTNONE 
J075115L05AAATGGGCCTTAAAGCCCATTTNONE 
J075143I05AAATGGGCCTTAAAGCCCATTTNONE 
J075197O07AAATGGGCCTTAAAGCCCATTTNONE 
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein. 
J013152D10TAGGCCCAGCAAAGCCCACGTNONE 
J075167I20TAGGCCCAGCAAAGCCCACGTNONE 
J090067O04TAGGCCCAGCAAAGCCCACGTNONE 
Os03g0143400AK073999AAAGCCCATTTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21AAAGCCCATTTNONE 
J033073C08AAAGCCCATTTNONE 
J033094C19AAAGCCCATTTNONE 
J065017L10AAAGCCCATTTNONE 
J065070H22AAAGCCCATTTNONE 
J065079M09AAAGCCCATTTNONE 
J065091N18AAAGCCCATTTNONE 
J065109N03AAAGCCCATTTNONE 
J065113F05AAAGCCCATTTNONE 
J065135D23AAAGCCCATTTNONE 
J065156L16AAAGCCCATTTNONE 
J065207O04AAAGCCCATTTNONE 
J065208F03AAAGCCCATTTNONE 
J090010M15AAAGCCCATTTNONE 
J090056J18AAAGCCCATTTNONE 
Os03g0149400AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0159100AK065635AAAAGCCCAAAASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os03g0175600AK059981AAAGCCCAAGSimilar to Nit protein 2 (CUA002). 
Os03g0186800AK100356AAAGCCCACCTModifier of rudimentary, Modr family protein. 
Os03g0231950J075103H14AAAGCCCATTConserved hypothetical protein. 
Os03g0248300009-063-H02AAAGCCCATCANONE 
AK062535AAAGCCCATCASimilar to Cytochrome P450 76C4 (EC 1.14.-.-). 
Os03g0249200009-103-B08AAAGCCCACATAGGCCCAAATNONE 
AK069944AAAGCCCACATAGGCCCAAATClass I peptide chain release factor domain containing protein. 
J065166E13AAAGCCCACATAGGCCCAAATNONE 
Os03g0262400014-013-D09AAAAGCCCAAAAGGCCGAAANONE 
AK059989AAAAGCCCAAAAGGCCGAAASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18AAAAGCCCAAAAGGCCGAAANONE 
J033025J23AAAAGCCCAAAAGGCCGAAANONE 
J065047G10AAAAGCCCAAAAGGCCGAAANONE 
J065153H03AAAAGCCCAAAAGGCCGAAANONE 
J065155J08AAAAGCCCAAAAGGCCGAAANONE 
J075025C05AAAAGCCCAAAAGGCCGAAANONE 
Os03g0274000AK060769AAAAGCCCAAGOxysterol-binding protein family protein. 
Os03g0295500009-083-F02AAAAGCCCACGAANONE 
J053029J05AAAAGCCCACGAANONE 
J053054B07AAAAGCCCACGAACHCH domain containing protein. 
J065024G23AAAAGCCCACGAANONE 
J065036F08AAAAGCCCACGAANONE 
J065066M11AAAAGCCCACGAANONE 
J065143G19AAAAGCCCACGAANONE 
Os03g0300600003-125-G06AAAGCCCACGCNONE 
006-048-C04AAAGCCCACGCNONE 
009-044-A09AAAGCCCACGCNONE 
AK059801AAAGCCCACGCNONE 
AK066250AAAGCCCACGCSimilar to Chaperone protein dnaJ. 
AK069897AAAGCCCACGCNONE 
AK104186AAAGCCCACGCNONE 
J065197D15AAAGCCCACGCNONE 
J090031C11AAAGCCCACGCNONE 
J100024C23AAAGCCCACGCNONE 
J100030B16AAAGCCCACGCNONE 
J100033K12AAAGCCCACGCNONE 
J100043M19AAAGCCCACGCNONE 
J100056N09AAAGCCCACGCNONE 
J100058E12AAAGCCCACGCNONE 
J100084J08AAAGCCCACGCNONE 
Os03g0334800AK101595TTGTGGGCTTTLung seven transmembrane receptor family protein. 
J023110B03TTGTGGGCTTTNONE 
J065102E22TTGTGGGCTTTNONE 
J065102F24TTGTGGGCTTTNONE 
J065140O22TTGTGGGCTTTNONE 
J075001N09TTGTGGGCTTTNONE 
J075057F24TTGTGGGCTTTNONE 
J075197K01TTGTGGGCTTTNONE 
J090080D05TTGTGGGCTTTNONE 
Os03g0355800AK069271AATTGGGCTTTNONE 
AK103902AATTGGGCTTTSimilar to Diphthine synthase (EC 2.1.1.98) (Diphthamide biosynthesis methyltransferase). 
Os03g0421400J075194I21AAAGCCCACGTNONE 
Os03g0563300006-086-B06TTGTGGGCTTTNONE 
006-102-B09TTGTGGGCTTTNONE 
AK060389TTGTGGGCTTTNONE 
AK070720TTGTGGGCTTTSimilar to Mg-chelatase subunit (Fragment). 
AK071134TTGTGGGCTTTNONE 
AK104435TTGTGGGCTTTNONE 
J013128N14TTGTGGGCTTTNONE 
J023041F09TTGTGGGCTTTNONE 
J023056M13TTGTGGGCTTTNONE 
J023078K03TTGTGGGCTTTNONE 
J023132N12TTGTGGGCTTTNONE 
J023134B01TTGTGGGCTTTNONE 
J033093B14TTGTGGGCTTTNONE 
Os03g0577000012-055-F04AAAGCCCAATGGGCTTTNONE 
AK061051AAAGCCCAATGGGCTTTSimilar to Ribosomal protein S3 (Fragment). 
AK099146AAAGCCCAATGGGCTTTNONE 
J065060A01AAAGCCCAATGGGCTTTNONE 
J075079B17AAAGCCCAATGGGCTTTNONE 
J075134K12AAAGCCCAATGGGCTTTNONE 
J090048F23AAAGCCCAATGGGCTTTNONE 
J090072I19AAAGCCCAATGGGCTTTNONE 
J100087C19AAAGCCCAATGGGCTTTNONE 
J100090C21AAAGCCCAATGGGCTTTNONE 
Os03g0588200011-005-E04AAAAGCCCAAGNONE 
AK120221AAAAGCCCAAGFrigida-like family protein. 
J100086E17AAAAGCCCAAGNONE 
Os03g0604600J090093K23AAAAGCCCAATAConserved hypothetical protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0626250J075100A11AGTTGGGCTTTNONE 
J075134H15AGTTGGGCTTTNONE 
J075142J02AGTTGGGCTTTNONE 
J075181A14AGTTGGGCTTTNONE 
J075192K17AGTTGGGCTTTNONE 
J090046B06AGTTGGGCTTTNONE 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0673600009-011-C08CGTGTGGGCTTTTNONE 
009-033-C05CGTGTGGGCTTTTNONE 
AK062334CGTGTGGGCTTTTNONE 
AK068539CGTGTGGGCTTTTConserved hypothetical protein. 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0698900013-074-A08AAAGCCCAACANONE 
AK073303AAAGCCCAACAAlkaline phytoceramidase family protein. 
AK103953AAAGCCCAACANONE 
J033024P22AAAGCCCAACANONE 
J065194N16AAAGCCCAACANONE 
J065195O11AAAGCCCAACANONE 
J075020F03AAAGCCCAACANONE 
J075032P18AAAGCCCAACANONE 
J075037H13AAAGCCCAACANONE 
J075147I01AAAGCCCAACANONE 
J075187B13AAAGCCCAACANONE 
J100043G08AAAGCCCAACANONE 
J100060L06AAAGCCCAACANONE 
J100063O21AAAGCCCAACANONE 
J100066O13AAAGCCCAACANONE 
J100072K20AAAGCCCAACANONE 
J100083G21AAAGCCCAACANONE 
J100085D07AAAGCCCAACANONE 
Os03g0701100014-015-E11GTATGGGCTTTNONE 
AK109455GTATGGGCTTTNONE 
AK110740GTATGGGCTTTNONE 
Os03g0701900AK068404AAATGGGCTTTTConserved hypothetical protein. 
Os03g0712200AK073205AAAAGCCCAATZinc finger, RanBP2-type domain containing protein. 
AK098968AAAAGCCCAATNONE 
Os03g0725400015-060-D03AAAAGCCCAACTNONE 
AK105499AAAAGCCCAACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860AAAAGCCCAACTNONE 
AK112085AAAAGCCCAACTNONE 
J100068K06AAAAGCCCAACTNONE 
J100073K24AAAAGCCCAACTNONE 
J100084M24AAAAGCCCAACTNONE 
Os03g0734500AK108001AAAAGCCCAGCConserved hypothetical protein. 
J080013F05AAAAGCCCAGCNONE 
J080030B16AAAAGCCCAGCNONE 
J080074G16AAAAGCCCAGCNONE 
J100062F08AAAAGCCCAGCNONE 
Os03g0736700006-022-F08AAAGCCCAAAANONE 
006-042-H09AAAGCCCAAAANONE 
006-053-H02AAAGCCCAAAANONE 
009-127-A06AAAGCCCAAAANONE 
013-089-C06AAAGCCCAAAANONE 
AK060947AAAGCCCAAAAGRAM domain containing protein. 
AK073026AAAGCCCAAAANONE 
AK104415AAAGCCCAAAANONE 
AK104642AAAGCCCAAAANONE 
J065027H19AAAGCCCAAAANONE 
J065059K06AAAGCCCAAAANONE 
J065065I02AAAGCCCAAAANONE 
J065085E10AAAGCCCAAAANONE 
J065140M09AAAGCCCAAAANONE 
J075115M21AAAGCCCAAAANONE 
Os03g0739700003-104-A04TTCGTGGGCTTTNONE 
AK062272TTCGTGGGCTTTUncharacterized protein UPF0114 family protein. 
Os03g0747700AK058795AAAAGCCCACConserved hypothetical protein. 
Os03g0752700011-093-A02AAAAGCCCATAANONE 
AK122157AAAAGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03AAAAGCCCATAANONE 
J033096O19AAAAGCCCATAANONE 
J033145P19AAAAGCCCATAANONE 
J065008K09AAAAGCCCATAANONE 
J065027J08AAAAGCCCATAANONE 
J065073H12AAAAGCCCATAANONE 
J065078G14AAAAGCCCATAANONE 
J065092L12AAAAGCCCATAANONE 
J065108D11AAAAGCCCATAANONE 
J065140G10AAAAGCCCATAANONE 
J065161D24AAAAGCCCATAANONE 
J065170F04AAAAGCCCATAANONE 
J075004K20AAAAGCCCATAANONE 
J075069F16AAAAGCCCATAANONE 
J075085B12AAAAGCCCATAANONE 
J075087D24AAAAGCCCATAANONE 
J075102G15AAAAGCCCATAANONE 
J075123M06AAAAGCCCATAANONE 
J090058D24AAAAGCCCATAANONE 
J090068I12AAAAGCCCATAANONE 
J090094A19AAAAGCCCATAANONE 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0758700AK106620AAAGCCCAACAWD40-like domain containing protein. 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0772800009-023-E05AAAGCCCACGAANONE 
009-059-F12AAAGCCCACGAANONE 
009-114-B08AAAGCCCACGAANONE 
009-115-G09AAAGCCCACGAANONE 
009-151-D08AAAGCCCACGAANONE 
009-158-A10AAAGCCCACGAANONE 
009-191-H02AAAGCCCACGAANONE 
009-192-E05AAAGCCCACGAANONE 
009-197-F11AAAGCCCACGAANONE 
AK059576AAAGCCCACGAANONE 
AK121608AAAGCCCACGAACytochrome c oxidase, subunit VIa family protein. 
J023087H20AAAGCCCACGAANONE 
J023105P14AAAGCCCACGAANONE 
J033026P15AAAGCCCACGAANONE 
J033042K10AAAGCCCACGAANONE 
J033133C09AAAGCCCACGAANONE 
J065123K13AAAGCCCACGAANONE 
J075190D03AAAGCCCACGAANONE 
J080310M14AAAGCCCACGAANONE 
J080317L14AAAGCCCACGAANONE 
J100067J19AAAGCCCACGAANONE 
J100079H21AAAGCCCACGAANONE 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0784400AK103474AAAAGCCCATCGProtein of unknown function DUF1692 domain containing protein. 
AK103474TGGTGGGCTTTProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAAAGCCCATCGNONE 
J023135I15TGGTGGGCTTTNONE 
J033130D12AAAAGCCCATCGNONE 
J033130D12TGGTGGGCTTTNONE 
J043035E20AAAAGCCCATCGNONE 
J043035E20TGGTGGGCTTTNONE 
J065206K15AAAAGCCCATCGNONE 
J065206K15TGGTGGGCTTTNONE 
J075053J20AAAAGCCCATCGNONE 
J075053J20TGGTGGGCTTTNONE 
J075129B11AAAAGCCCATCGNONE 
J075129B11TGGTGGGCTTTNONE 
J090003E22AAAAGCCCATCGNONE 
J090003E22TGGTGGGCTTTNONE 
J100023E23AAAAGCCCATCGNONE 
J100023E23TGGTGGGCTTTNONE 
Os03g0786700AK067936AAAAGCCCATAN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0808300006-053-B11AAAGCCCACANONE 
006-057-A01AAAGCCCACANONE 
006-090-F05AAAGCCCACANONE 
006-106-G01AAAGCCCACANONE 
006-120-D10AAAGCCCACANONE 
009-139-H09AAAGCCCACANONE 
AK109389AAAGCCCACARemorin, C-terminal region domain containing protein. 
J033065F13AAAGCCCACANONE 
J053045H15AAAGCCCACANONE 
J065021C02AAAGCCCACANONE 
J065021D01AAAGCCCACANONE 
J065039B14AAAGCCCACANONE 
J065064J22AAAGCCCACANONE 
J065167I09AAAGCCCACANONE 
J065170A13AAAGCCCACANONE 
J065183J10AAAGCCCACANONE 
J065202K10AAAGCCCACANONE 
J065218F21AAAGCCCACANONE 
J075028D07AAAGCCCACANONE 
J100048J08AAAGCCCACANONE 
J100050H06AAAGCCCACANONE 
J100054M24AAAGCCCACANONE 
J100068G07AAAGCCCACANONE 
J100079F23AAAGCCCACANONE 
Os03g0809300011-024-C02AAAGCCCATTTNONE 
016-071-E09AAAGCCCATTTNONE 
AK103140AAAGCCCATTTProtein phosphatase 2C-like domain containing protein. 
J013030O08AAAGCCCATTTNONE 
J013108D19AAAGCCCATTTNONE 
J013124D15AAAGCCCATTTNONE 
J013128F17AAAGCCCATTTNONE 
J013146J06AAAGCCCATTTNONE 
J013149D12AAAGCCCATTTNONE 
J013154P12AAAGCCCATTTNONE 
J013162N01AAAGCCCATTTNONE 
J013170G15AAAGCCCATTTNONE 
J013170H16AAAGCCCATTTNONE 
J023022I09AAAGCCCATTTNONE 
J023072B19AAAGCCCATTTNONE 
J023106H09AAAGCCCATTTNONE 
J023135C03AAAGCCCATTTNONE 
J023141C09AAAGCCCATTTNONE 
J033091K23AAAGCCCATTTNONE 
J033107I05AAAGCCCATTTNONE 
J033112M18AAAGCCCATTTNONE 
J033120G10AAAGCCCATTTNONE 
J033144G06AAAGCCCATTTNONE 
J043017L21AAAGCCCATTTNONE 
J043024O10AAAGCCCATTTNONE 
J053023K04AAAGCCCATTTNONE 
J053035D01AAAGCCCATTTNONE 
J053037P10AAAGCCCATTTNONE 
J053042K15AAAGCCCATTTNONE 
J053047C14AAAGCCCATTTNONE 
J053054A06AAAGCCCATTTNONE 
J053071H03AAAGCCCATTTNONE 
J053073G08AAAGCCCATTTNONE 
J053090D04AAAGCCCATTTNONE 
J053095E17AAAGCCCATTTNONE 
J090007O03AAAGCCCATTTNONE 
J090024G24AAAGCCCATTTNONE 
J090042M08AAAGCCCATTTNONE 
J090045I16AAAGCCCATTTNONE 
J090051E13AAAGCCCATTTNONE 
J090073B15AAAGCCCATTTNONE 
J090096F19AAAGCCCATTTNONE 
J100030M23AAAGCCCATTTNONE 
Os03g0821900AK070847AGTGGGCCTACCGGGCCAAAGCCCACASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0825300AK072216AAAGCCCACCACNONE 
AK102693AAAGCCCACCACNONE 
AK105593AAAGCCCACCACProtein kinase-like domain containing protein. 
BT014687AAAGCCCACCACNONE 
Os03g0837300AK111243AAAGCCCAATTNONE 
AK121140AAAGCCCAATTNicotinate phosphoribosyltransferase and related family protein. 
AY214337AAAGCCCAATTNONE 
J023077G12AAAGCCCAATTNONE 
J023078M10AAAGCCCAATTNONE 
J033031B10AAAGCCCAATTNONE 
J033067L18AAAGCCCAATTNONE 
J043005P09AAAGCCCAATTNONE 
J090013J15AAAGCCCAATTNONE 
J090042E10AAAGCCCAATTNONE 
J090045A20AAAGCCCAATTNONE 
J100022H02AAAGCCCAATTNONE 
Os03g0855600006-029-G09TAATGGGCTTTNONE 
006-033-E02TAATGGGCTTTNONE 
006-069-G07TAATGGGCTTTNONE 
006-083-A02TAATGGGCTTTNONE 
006-098-H04TAATGGGCTTTNONE 
009-054-C04TAATGGGCTTTNONE 
AK060030TAATGGGCTTTNONE 
AK061467TAATGGGCTTTConserved hypothetical protein. 
AK067858TAATGGGCTTTNONE 
AK106030TAATGGGCTTTNONE 
J013123A10TAATGGGCTTTNONE 
J065001I24TAATGGGCTTTNONE 
J065015N21TAATGGGCTTTNONE 
J065016H07TAATGGGCTTTNONE 
J065040A05TAATGGGCTTTNONE 
J065040F01TAATGGGCTTTNONE 
J065066G17TAATGGGCTTTNONE 
J065077I09TAATGGGCTTTNONE 
J065099M22TAATGGGCTTTNONE 
J065135B13TAATGGGCTTTNONE 
J065144H19TAATGGGCTTTNONE 
J065146I03TAATGGGCTTTNONE 
J065169E02TAATGGGCTTTNONE 
J065177D21TAATGGGCTTTNONE 
J065189L20TAATGGGCTTTNONE 
J065207H13TAATGGGCTTTNONE 
J065210D24TAATGGGCTTTNONE 
J065212I03TAATGGGCTTTNONE 
J075007E21TAATGGGCTTTNONE 
J075013H07TAATGGGCTTTNONE 
J075023K06TAATGGGCTTTNONE 
J075031D23TAATGGGCTTTNONE 
J075038K09TAATGGGCTTTNONE 
J075084C08TAATGGGCTTTNONE 
J075098K20TAATGGGCTTTNONE 
J090028E04TAATGGGCTTTNONE 
J090031E20TAATGGGCTTTNONE 
J090042F06TAATGGGCTTTNONE 
J090049L05TAATGGGCTTTNONE 
J090086G03TAATGGGCTTTNONE 
J090096J04TAATGGGCTTTNONE 
J100035O03TAATGGGCTTTNONE 
J100053H24TAATGGGCTTTNONE 
J100056L17TAATGGGCTTTNONE 
J100058K06TAATGGGCTTTNONE 
J100059G09TAATGGGCTTTNONE 
J100081C15TAATGGGCTTTNONE 
Os03g0861300AK109024TTTGGGCTTTSimilar to Aquaporin. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0304200AB018443ACATGGGCTTTNONE 
AK067128ACATGGGCTTTSimilar to Nonphototropic hypocotyl protein 1 (EC 2.7.1.37) (Phototropin). 
Os04g0312100AK120695AAAAGCCCAProtein of unknown function DUF860, plant family protein. 
Os04g0382300AK071912AAAGCCCAGNONE 
AK101795AAAGCCCAGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0418500AK121255GTGGTGGGCTTTU box domain containing protein. 
J065172M13GTGGTGGGCTTTNONE 
J100026H21GTGGTGGGCTTTNONE 
J100032D22GTGGTGGGCTTTNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0439100J013026H11AAAGCCCAGNONE 
J013097L15AAAGCCCAGNONE 
J013112G22AAAGCCCAGNONE 
J013160E02AAAGCCCAGNONE 
J043026G08AAAGCCCAGNONE 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0461100009-136-H10GCTGGGCCATATTGGGCTTTNONE 
009-147-H12GCTGGGCCATATTGGGCTTTNONE 
AK068022GCTGGGCCATATTGGGCTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24GCTGGGCCATATTGGGCTTTNONE 
J065019D10GCTGGGCCATATTGGGCTTTNONE 
J065168O21GCTGGGCCATATTGGGCTTTNONE 
J075051G06GCTGGGCCATATTGGGCTTTNONE 
J075148G11GCTGGGCCATATTGGGCTTTNONE 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
J065138J21TATTGGGCTTTGAGGCCCATANONE 
Os04g0478600AK073788GGTGGGCTTTTConserved hypothetical protein. 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0527900AK108116AAAGCCCATASimilar to Tonoplast membrane integral protein ZmTIP3-2. 
J075013N09AAAGCCCATANONE 
J075023I21AAAGCCCATANONE 
Os04g0559400AK106376AAAAGCCCAGCCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0566900AK072344AAAGCCCAAACConserved hypothetical protein. 
Os04g0577000AK073711CAAGTGGGCTTTUbiquitin fusion degradation protein UFD1 family protein. 
AK119957CAAGTGGGCTTTNONE 
J013127H04CAAGTGGGCTTTNONE 
J033035G06CAAGTGGGCTTTNONE 
J033061G23CAAGTGGGCTTTNONE 
J033127L07CAAGTGGGCTTTNONE 
J065015F17CAAGTGGGCTTTNONE 
J065062G08CAAGTGGGCTTTNONE 
J065132M07CAAGTGGGCTTTNONE 
J065155C12CAAGTGGGCTTTNONE 
J075055I08CAAGTGGGCTTTNONE 
J075140D07CAAGTGGGCTTTNONE 
J090055B21CAAGTGGGCTTTNONE 
J100031D23CAAGTGGGCTTTNONE 
Os04g0581000AK061337TTTTGGGCTTTSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TTTTGGGCTTTNONE 
Os04g0600200AB004864AAAGCCCATCTNONE 
AB007452AAAGCCCATCTNONE 
AK064040AAAGCCCATCTSimilar to Alternative oxidase 1a (Fragment). 
Os04g0634500AK071656AAAGCCCATTASimilar to S-receptor kinase-like protein 2. 
Os04g0638800AK070319AAAGCCCATCAProtein of unknown function DUF617, plant family protein. 
AK071753AAAGCCCATCANONE 
Os04g0658300AK067399AAAGCCCAAAASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0659400AK070174ATCTGGGCTTTENT domain containing protein. 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0665700013-084-D06GAGGCCCAAAGCCCAACTNONE 
013-084-D06GTGGCCCAAAGCCCAAGNONE 
AK121951GAGGCCCAAAGCCCAACTZinc finger, CCCH-type domain containing protein. 
AK121951GTGGCCCAAAGCCCAAGZinc finger, CCCH-type domain containing protein. 
J013020L20GAGGCCCAAAGCCCAACTNONE 
J013020L20GTGGCCCAAAGCCCAAGNONE 
J033034K12GAGGCCCAAAGCCCAACTNONE 
J033034K12GTGGCCCAAAGCCCAAGNONE 
J033107K04GAGGCCCAAAGCCCAACTNONE 
J033107K04GTGGCCCAAAGCCCAAGNONE 
J065044C03GAGGCCCAAAGCCCAACTNONE 
J065044C03GTGGCCCAAAGCCCAAGNONE 
J065103I10GAGGCCCAAAGCCCAACTNONE 
J065103I10GTGGCCCAAAGCCCAAGNONE 
J065106P15GAGGCCCAAAGCCCAACTNONE 
J065106P15GTGGCCCAAAGCCCAAGNONE 
J075061O20GAGGCCCAAAGCCCAACTNONE 
J075061O20GTGGCCCAAAGCCCAAGNONE 
J075091P11GAGGCCCAAAGCCCAACTNONE 
J075091P11GTGGCCCAAAGCCCAAGNONE 
J075095A18GAGGCCCAAAGCCCAACTNONE 
J075095A18GTGGCCCAAAGCCCAAGNONE 
J075117C22GAGGCCCAAAGCCCAACTNONE 
J075117C22GTGGCCCAAAGCCCAAGNONE 
J075166B22GAGGCCCAAAGCCCAACTNONE 
J075166B22GTGGCCCAAAGCCCAAGNONE 
J075198L04GAGGCCCAAAGCCCAACTNONE 
J075198L04GTGGCCCAAAGCCCAAGNONE 
J090032K13GAGGCCCAAAGCCCAACTNONE 
J090032K13GTGGCCCAAAGCCCAAGNONE 
J090045E22GAGGCCCAAAGCCCAACTNONE 
J090045E22GTGGCCCAAAGCCCAAGNONE 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0101600AK101021AGGTGGGCTTTTCytochrome P450 family protein. 
Os05g0103500AK060306AAAAGCCCAATACHCH domain containing protein. 
AK102829AAAAGCCCAATANONE 
J033109D16AAAAGCCCAATANONE 
J043016E20AAAAGCCCAATANONE 
J065001C14AAAAGCCCAATANONE 
J065116L24AAAAGCCCAATANONE 
J075018E04AAAAGCCCAATANONE 
J075045E18AAAAGCCCAATANONE 
J075093G20AAAAGCCCAATANONE 
J075171A09AAAAGCCCAATANONE 
J100029F18AAAAGCCCAATANONE 
J100046I24AAAAGCCCAATANONE 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0155300AK069217GTGGGCTTTTSimilar to HIRA interacting protein 5. 
Os05g0161400AK105485AAAAGCCCAACTPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0323100AK109472AAAGCCCAATARhodanese-like domain containing protein. 
AK109472AAAGCCCACARhodanese-like domain containing protein. 
Os05g0346300009-033-C06AGATGGGCTTGGGCTTTNONE 
AF529175AGATGGGCTTGGGCTTTNONE 
AK061627AGATGGGCTTGGGCTTTSimilar to 40S ribosomal protein S7. 
AK103081AGATGGGCTTGGGCTTTNONE 
AK104191AGATGGGCTTGGGCTTTNONE 
J013049B09AGATGGGCTTGGGCTTTNONE 
J023142E24AGATGGGCTTGGGCTTTNONE 
J033052M14AGATGGGCTTGGGCTTTNONE 
J033089N04AGATGGGCTTGGGCTTTNONE 
J033118F01AGATGGGCTTGGGCTTTNONE 
J065054E07AGATGGGCTTGGGCTTTNONE 
J065066L18AGATGGGCTTGGGCTTTNONE 
J065078C21AGATGGGCTTGGGCTTTNONE 
J065127G23AGATGGGCTTGGGCTTTNONE 
J065128N24AGATGGGCTTGGGCTTTNONE 
J065144P17AGATGGGCTTGGGCTTTNONE 
J065147P14AGATGGGCTTGGGCTTTNONE 
J065170E16AGATGGGCTTGGGCTTTNONE 
J065175D17AGATGGGCTTGGGCTTTNONE 
J065176M05AGATGGGCTTGGGCTTTNONE 
J065218G20AGATGGGCTTGGGCTTTNONE 
J090074J12AGATGGGCTTGGGCTTTNONE 
J100019H16AGATGGGCTTGGGCTTTNONE 
J100031N24AGATGGGCTTGGGCTTTNONE 
J100072G08AGATGGGCTTGGGCTTTNONE 
J100086I23AGATGGGCTTGGGCTTTNONE 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0399700AB012855AAAAGCCCATACNONE 
AB018248AAAAGCCCATACNONE 
AB096139AAAAGCCCATACNONE 
AK071196AAAAGCCCATACChitinase (EC 3.2.1.14). 
J023012C04AAAAGCCCATACNONE 
J023086B11AAAAGCCCATACNONE 
J023143A20AAAAGCCCATACNONE 
J080040G15AAAAGCCCATACNONE 
J080306P19AAAAGCCCATACNONE 
J080307K24AAAAGCCCATACNONE 
J090040G17AAAAGCCCATACNONE 
J090047J17AAAAGCCCATACNONE 
J090075E21AAAAGCCCATACNONE 
J090088L05AAAAGCCCATACNONE 
Os05g0401300009-111-H03GTGGGCTTTNONE 
AK060678GTGGGCTTTTwin-arginine translocation pathway signal domain containing protein. 
Os05g0413000AK058277AAAAGCCCATGMitochodrial transcription termination factor-related family protein. 
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0450600016-072-G10AAAGCCCAAGNONE 
AK064266AAAGCCCAAGProtein of unknown function DUF740 family protein. 
Os05g0458100006-084-A05AAAGCCCATACNONE 
009-091-H05AAAGCCCATACNONE 
AJ557547AAAGCCCATACNONE 
AK059467AAAGCCCATACNONE 
AK061127AAAGCCCATACNONE 
AK101652AAAGCCCATACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AAAGCCCATACNONE 
J033057B20AAAGCCCATACNONE 
J033087A05AAAGCCCATACNONE 
J043009C05AAAGCCCATACNONE 
J090009E10AAAGCCCATACNONE 
Os05g0460800AK058842AAAAGCCCAProtein tyrosine phosphatase-like protein, PTPLA family protein. 
Os05g0490800J065037L19AAAAGCCCAGCCNONE 
Os05g0495100AK108028GGGCTGGGCTTTTConserved hypothetical protein. 
Os05g0545500AK101095TATTGGGCTTTConserved hypothetical protein. 
AK119499TATTGGGCTTTNONE 
Os05g0553700006-100-D08AAAGCCCAAATNONE 
AK099747AAAGCCCAAATNONE 
AK101606AAAGCCCAAATNONE 
AK103396AAAGCCCAAATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23AAAGCCCAAATNONE 
J090086G01AAAGCCCAAATNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
Os05g0592600011-064-D09GTTTGGGCTTTTNONE 
015-032-B11GTTTGGGCTTTTNONE 
AK073484GTTTGGGCTTTTInitiation factor 2 family protein. 
AK099632GTTTGGGCTTTTNONE 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0112800J090052L21AGGTGGGCTTTNONE 
Os06g0115400AK111656GAAGCCCAAAGCCCACASimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0116600AK103500AAAAGCCCATCTProteinase inhibitor, propeptide domain containing protein. 
J033131B10AAAAGCCCATCTNONE 
J075154F17AAAAGCCCATCTNONE 
J075169L23AAAAGCCCATCTNONE 
Os06g0128500AK058563AAAGCCCAGTTRibosomal protein L47, mitochondrial family protein. 
AK122132AAAGCCCAGTTNONE 
J033133F04AAAGCCCAGTTNONE 
J065094M24AAAGCCCAGTTNONE 
J065122J07AAAGCCCAGTTNONE 
J065137G10AAAGCCCAGTTNONE 
J065178L09AAAGCCCAGTTNONE 
J080011E11AAAGCCCAGTTNONE 
J080020G21AAAGCCCAGTTNONE 
J080039H03AAAGCCCAGTTNONE 
J080039J04AAAGCCCAGTTNONE 
Os06g0137500AK072896AAAGCCCATCTBrix domain containing protein. 
AK121945AAAGCCCATCTNONE 
Os06g0139700006-052-C07AAAGCCCAAACNONE 
009-009-A08AAAGCCCAAACNONE 
015-020-D09AAAGCCCAAACNONE 
015-087-H06AAAGCCCAAACNONE 
016-078-A03AAAGCCCAAACNONE 
AK067884AAAGCCCAAACNONE 
AK103245AAAGCCCAAACConserved hypothetical protein. 
AK106116AAAGCCCAAACNONE 
AK106220AAAGCCCAAACNONE 
Os06g0152800003-125-D04AAAGCCCAACANONE 
AK099578AAAGCCCAACAConserved hypothetical protein. 
Os06g0159400AK101286GGTTGGGCTTTU box domain containing protein. 
J033033F04GGTTGGGCTTTNONE 
Os06g0222900AK109820AAAAGCCCAAAASimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0268700AK120783AAAAGCCCAAACPeptidase A1, pepsin family protein. 
Os06g0274200009-090-A02AAAGCCCAAGCCCAGNONE 
AK073155AAAGCCCAAGCCCAGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08AAAGCCCAAGCCCAGNONE 
J065061C07AAAGCCCAAGCCCAGNONE 
J065105L08AAAGCCCAAGCCCAGNONE 
J075013C12AAAGCCCAAGCCCAGNONE 
J090010N17AAAGCCCAAGCCCAGNONE 
J090068K07AAAGCCCAAGCCCAGNONE 
J100058A21AAAGCCCAAGCCCAGNONE 
J100066C07AAAGCCCAAGCCCAGNONE 
Os06g0286228AK069113AAAGCCCAAATCupredoxin domain containing protein. 
Os06g0298500AK108252AAAAGCCCACCAConserved hypothetical protein. 
J065144C04AAAAGCCCACCANONE 
J075054P09AAAAGCCCACCANONE 
J075165A13AAAAGCCCACCANONE 
J075172E10AAAAGCCCACCANONE 
Os06g0309000AK121021ACGTGGGCTTTTZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0325500011-037-D06AAAGCCCATGTNONE 
011-093-G07AAAGCCCATGTNONE 
AK063974AAAGCCCATGTProtein of unknown function DUF89 family protein. 
AK099286AAAGCCCATGTNONE 
J065124G18AAAGCCCATGTNONE 
J065160K08AAAGCCCATGTNONE 
J065207O08AAAGCCCATGTNONE 
J075011D18AAAGCCCATGTNONE 
J075012D02AAAGCCCATGTNONE 
J075090F13AAAGCCCATGTNONE 
J075164A04AAAGCCCATGTNONE 
J075198I19AAAGCCCATGTNONE 
Os06g0326500AK068142CTGGGCTTTMitochondrial glycoprotein family protein. 
AK071483CTGGGCTTTNONE 
J053065A20CTGGGCTTTNONE 
J065082D14CTGGGCTTTNONE 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0656800AK109762AAAGCCCAATGGGCCAGABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0667600AK058606AAAAGCCCATTANONE 
AK058606AAAGCCCATTNONE 
AK071621AAAAGCCCATTASimilar to Glycine decarboxylase complex H-protein. 
AK071621AAAGCCCATTSimilar to Glycine decarboxylase complex H-protein. 
J023101D03AAAAGCCCATTANONE 
J023101D03AAAGCCCATTNONE 
J033095E17AAAAGCCCATTANONE 
J033095E17AAAGCCCATTNONE 
J065020B16AAAAGCCCATTANONE 
J065020B16AAAGCCCATTNONE 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0712500AK068531AAATGGGCTTTTSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0714100AK121079AAAGCCCAGCCCAComplex 1 LYR protein family protein. 
J023062M13AAAGCCCAGCCCANONE 
J043020D18AAAGCCCAGCCCANONE 
J065073A17AAAGCCCAGCCCANONE 
J065158D09AAAGCCCAGCCCANONE 
J065195H04AAAGCCCAGCCCANONE 
J065214P13AAAGCCCAGCCCANONE 
J080079I22AAAGCCCAGCCCANONE 
J100031M06AAAGCCCAGCCCANONE 
J100036I12AAAGCCCAGCCCANONE 
Os06g0715400012-007-C01AAAAGCCCAGNONE 
012-038-G03AAAAGCCCAGNONE 
AK071262AAAAGCCCAGt-snare domain containing protein. 
AK073963AAAAGCCCAGNONE 
J023085J06AAAAGCCCAGNONE 
J033073I09AAAAGCCCAGNONE 
J080316N15AAAAGCCCAGNONE 
J090062N15AAAAGCCCAGNONE 
Os07g0100200006-022-D06AAAGCCCACGGNONE 
011-025-B06AAAGCCCACGGNONE 
012-069-A07AAAGCCCACGGNONE 
AK060986AAAGCCCACGGNONE 
AK073305AAAGCCCACGGSimilar to PDX1-like protein 4. 
J023055C05AAAGCCCACGGNONE 
J033024J11AAAGCCCACGGNONE 
J065045F14AAAGCCCACGGNONE 
J075097C22AAAGCCCACGGNONE 
Os07g0110100009-059-D11AAAGCCCAAAANONE 
AK071499AAAGCCCAAAAConserved hypothetical protein. 
J065064P17AAAGCCCAAAANONE 
J065111B09AAAGCCCAAAANONE 
J075099A14AAAGCCCAAAANONE 
J075139C23AAAGCCCAAAANONE 
Os07g0110800009-107-B11ATTTGGGCTTTNONE 
AK062792ATTTGGGCTTTConserved hypothetical protein. 
J053026P09ATTTGGGCTTTNONE 
J053074L17ATTTGGGCTTTNONE 
J065057E24ATTTGGGCTTTNONE 
J065149B18ATTTGGGCTTTNONE 
J075002O20ATTTGGGCTTTNONE 
J090002C13ATTTGGGCTTTNONE 
Os07g0110900AK058987AAAGCCCAAATConserved hypothetical protein. 
J065032L02AAAGCCCAAATNONE 
J065074H06AAAGCCCAAATNONE 
J065168M23AAAGCCCAAATNONE 
Os07g0113200AK108787TTTTGGGCTTTConserved hypothetical protein. 
J065090J04TTTTGGGCTTTNONE 
J065116K24TTTTGGGCTTTNONE 
J065161F14TTTTGGGCTTTNONE 
J065203E23TTTTGGGCTTTNONE 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0187300AK103069AAAAGCCCAAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAAAGCCCAAAANONE 
J033117P16AAAAGCCCAAAANONE 
Os07g0191700AK066389TAGGCCCAAAGCCCAGTASimilar to AT.I.24-9 protein (Fragment). 
AK103768TAGGCCCAAAGCCCAGTANONE 
Os07g0202100AK101736AAAAGCCCATACSimilar to ATP-dependent RNA helicase ded1. 
Os07g0227700AK120258AAAAGCCCAConserved hypothetical protein. 
J090030H24AAAAGCCCANONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0479200005-017-H08ATCTGGGCTTTNONE 
AK058326ATCTGGGCTTTSimilar to SL15-like (Fragment). 
J013092A08ATCTGGGCTTTNONE 
J033139E04ATCTGGGCTTTNONE 
J043016M16ATCTGGGCTTTNONE 
J053050O18ATCTGGGCTTTNONE 
J053098B03ATCTGGGCTTTNONE 
J065068G10ATCTGGGCTTTNONE 
J065091I17ATCTGGGCTTTNONE 
J065109A03ATCTGGGCTTTNONE 
J065168B17ATCTGGGCTTTNONE 
J065177A05ATCTGGGCTTTNONE 
J065180J01ATCTGGGCTTTNONE 
J075006F13ATCTGGGCTTTNONE 
J075022J03ATCTGGGCTTTNONE 
J075024N09ATCTGGGCTTTNONE 
J075114B12ATCTGGGCTTTNONE 
J080023M06ATCTGGGCTTTNONE 
J080081N24ATCTGGGCTTTNONE 
J090060N07ATCTGGGCTTTNONE 
Os07g0498300009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0565600AK071983TATTGGGCTTTGGGCTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481TATTGGGCTTTGGGCTNONE 
Os07g0565700006-106-C01AAAGCCCAACANONE 
AK111937AAAGCCCAACANONE 
AK112115AAAGCCCAACAAlpha/beta hydrolase family protein. 
Os07g0568100AK099778AAAGCCCAACCSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0626600Os07g0626600AAAGCCCAAATSimilar to Embryogenic callus protein-like. 
Os07g0627700AK070893AAAAGCCCACAASterol desaturase family protein. 
AK110696AAAAGCCCACAANONE 
J065068I04AAAAGCCCACAANONE 
J065121P07AAAAGCCCACAANONE 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0673100AK060100AAAGCCCAAGNONE 
AK103678AAAGCCCAAGRibosomal protein S8E family protein. 
AK104794AAAGCCCAAGNONE 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os07g0695400015-036-B08CTGGGCTTTNONE 
AK100615CTGGGCTTTNONE 
AK106304CTGGGCTTTKIP1-like domain containing protein. 
J023108B01CTGGGCTTTNONE 
Os08g0113800J033069I12AAAAGCCCATTTNONE 
J033069I12AAAGCCCATCANONE 
J053050I07AAAAGCCCATTTNONE 
J053050I07AAAGCCCATCANONE 
J065006J11AAAAGCCCATTTNONE 
J065006J11AAAGCCCATCANONE 
J065013D02AAAAGCCCATTTNONE 
J065013D02AAAGCCCATCANONE 
J065055L24AAAAGCCCATTTNONE 
J065055L24AAAGCCCATCANONE 
J065071I11AAAAGCCCATTTConserved hypothetical protein. 
J065071I11AAAGCCCATCAConserved hypothetical protein. 
J065093G12AAAAGCCCATTTNONE 
J065093G12AAAGCCCATCANONE 
J065101N03AAAAGCCCATTTNONE 
J065101N03AAAGCCCATCANONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0133000006-050-B01AAAGCCCACNONE 
006-068-G03AAAGCCCACNONE 
AK061574AAAGCCCACNONE 
AK099391AAAGCCCACProtein of unknown function DUF1637 family protein. 
J065108C24AAAGCCCACNONE 
J075075K24AAAGCCCACNONE 
J075092A19AAAGCCCACNONE 
J100061O19AAAGCCCACNONE 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0156900AJ605583AAAGCCCATGTNONE 
AK073344AAAGCCCATGTSpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397AAAGCCCATGTNONE 
Os08g0158900AK067062AAAAGCCCAATTGTP1/OBG domain containing protein. 
J013089F04AAAAGCCCAATTNONE 
J013092D16AAAAGCCCAATTNONE 
J033120K14AAAAGCCCAATTNONE 
J033133F24AAAAGCCCAATTNONE 
J033145A10AAAAGCCCAATTNONE 
J033145A11AAAAGCCCAATTNONE 
J053048H24AAAAGCCCAATTNONE 
J053075H10AAAAGCCCAATTNONE 
Os08g0159000AK073617AATTGGGCTTTTNONE 
AK103973AATTGGGCTTTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14AATTGGGCTTTTNONE 
J033051J11AATTGGGCTTTTNONE 
J065101C10AATTGGGCTTTTNONE 
J065168B04AATTGGGCTTTTNONE 
J065184E22AATTGGGCTTTTNONE 
J080021D11AATTGGGCTTTTNONE 
J080025H10AATTGGGCTTTTNONE 
J080026N19AATTGGGCTTTTNONE 
J080034A12AATTGGGCTTTTNONE 
J080040L02AATTGGGCTTTTNONE 
J080042H19AATTGGGCTTTTNONE 
J080047B05AATTGGGCTTTTNONE 
J080047E09AATTGGGCTTTTNONE 
J080047I01AATTGGGCTTTTNONE 
J080052H19AATTGGGCTTTTNONE 
J080062K13AATTGGGCTTTTNONE 
J080063A22AATTGGGCTTTTNONE 
J080068G18AATTGGGCTTTTNONE 
J080068N19AATTGGGCTTTTNONE 
J080076G08AATTGGGCTTTTNONE 
J080077H13AATTGGGCTTTTNONE 
J080077K06AATTGGGCTTTTNONE 
J080093D15AATTGGGCTTTTNONE 
J080094D21AATTGGGCTTTTNONE 
J080097A20AATTGGGCTTTTNONE 
J080097E21AATTGGGCTTTTNONE 
J080097N17AATTGGGCTTTTNONE 
J100071K18AATTGGGCTTTTNONE 
J100072F09AATTGGGCTTTTNONE 
Os08g0172300AK111274AAAAGCCCACHAT dimerisation domain containing protein. 
J065184J06AAAAGCCCACNONE 
Os08g0192900AK103422AAAAGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AAAAGCCCAAACNONE 
Os08g0202400AK070769ATTGGGCTTTDisease resistance protein family protein. 
Os08g0206600AK064336AAAGCCCATCAAICARFT/IMPCHase bienzyme family protein. 
AK102764AAAGCCCATCANONE 
Os08g0327400AK070992AAAAGCCCACCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAAAGCCCACCNONE 
J065075F06AAAAGCCCACCNONE 
J065112N14AAAAGCCCACCNONE 
J090028K07AAAAGCCCACCNONE 
J090039C15AAAAGCCCACCNONE 
J090048I11AAAAGCCCACCNONE 
J090083M10AAAAGCCCACCNONE 
Os08g0346400003-103-D08ACATGGGCTTTTNONE 
009-135-G12ACATGGGCTTTTNONE 
AK059644ACATGGGCTTTTNONE 
AK062928ACATGGGCTTTTNONE 
AK103873ACATGGGCTTTTSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11ACATGGGCTTTTNONE 
J065137E08ACATGGGCTTTTNONE 
J065194M22ACATGGGCTTTTNONE 
J075083O16ACATGGGCTTTTNONE 
Os08g0363000015-090-A07AAAGCCCAAATNONE 
AK103677AAAGCCCAAATNONE 
AK106532AAAGCCCAAATProtein of unknown function DUF295 family protein. 
J033136B21AAAGCCCAAATNONE 
J033136E01AAAGCCCAAATNONE 
J043029N11AAAGCCCAAATNONE 
J065071G13AAAGCCCAAATNONE 
J065105J22AAAGCCCAAATNONE 
J075084B18AAAGCCCAAATNONE 
Os08g0442300006-067-F05GCTGGGCTGGGCTTTNONE 
AK059843GCTGGGCTGGGCTTTNONE 
AK071719GCTGGGCTGGGCTTTSimilar to Calcineurin-like protein. 
AK102411GCTGGGCTGGGCTTTNONE 
J023108H11GCTGGGCTGGGCTTTNONE 
J033092P05GCTGGGCTGGGCTTTNONE 
J075109C09GCTGGGCTGGGCTTTNONE 
J090070B02GCTGGGCTGGGCTTTNONE 
J090076M14GCTGGGCTGGGCTTTNONE 
J100064B16GCTGGGCTGGGCTTTNONE 
Os08g0456600AK059009AAAGCCCAAGConserved hypothetical protein. 
Os08g0485900AK110716AAAAGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0504600AK064868TACTGGGCTTTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013051G08TACTGGGCTTTTNONE 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
015-019-D06AAAAGCCCAACANONE 
015-019-D06AAAAGCCCATTACGGCCCACACNONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
AK064304AAAAGCCCAACASimilar to 30S ribosomal protein S16. 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
Os08g0526500016-063-D04TGATGGGCTTTNONE 
AK073431TGATGGGCTTTSimilar to SOX-1 protein. 
J033042D10TGATGGGCTTTNONE 
J065019E02TGATGGGCTTTNONE 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os08g0548900006-043-D07CCATGGGCTTTNONE 
006-043-H11CCATGGGCTTTNONE 
006-081-G06CCATGGGCTTTNONE 
006-109-E04CCATGGGCTTTNONE 
011-033-E04CCATGGGCTTTNONE 
AK061808CCATGGGCTTTSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875CCATGGGCTTTNONE 
J013001D12CCATGGGCTTTNONE 
J033126N14CCATGGGCTTTNONE 
J053069M09CCATGGGCTTTNONE 
J053098E10CCATGGGCTTTNONE 
J053101C24CCATGGGCTTTNONE 
J065002F21CCATGGGCTTTNONE 
J065006C22CCATGGGCTTTNONE 
J065076J02CCATGGGCTTTNONE 
J065134M22CCATGGGCTTTNONE 
J075007M19CCATGGGCTTTNONE 
J075040I11CCATGGGCTTTNONE 
J075047E20CCATGGGCTTTNONE 
J075052D22CCATGGGCTTTNONE 
J075076L13CCATGGGCTTTNONE 
J075157P22CCATGGGCTTTNONE 
J075161M18CCATGGGCTTTNONE 
J075168P22CCATGGGCTTTNONE 
J075181E04CCATGGGCTTTNONE 
U92540CCATGGGCTTTNONE 
Os09g0103300009-007-D10AAAAGCCCATATNONE 
AK062317AAAAGCCCATATHypothetical protein. 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0306700J023045A19AAAAGCCCACCTNONE 
Os09g0324300AK109691TTATGGGCCGCCGTGGGCTTTCyclin-like F-box domain containing protein. 
Os09g0343200AK064806GTTTGGGCTTTAnkyrin repeat containing protein. 
AK064994GTTTGGGCTTTNONE 
J013000D17GTTTGGGCTTTNONE 
J013001D17GTTTGGGCTTTNONE 
J013067O17GTTTGGGCTTTNONE 
J013097A16GTTTGGGCTTTNONE 
J013097H22GTTTGGGCTTTNONE 
J090014I04GTTTGGGCTTTNONE 
J090046D15GTTTGGGCTTTNONE 
Os09g0363700AK103667ATTGGGCTTTTConserved hypothetical protein. 
J075001L14ATTGGGCTTTTNONE 
J075049M23ATTGGGCTTTTNONE 
J075051I04ATTGGGCTTTTNONE 
J075073L04ATTGGGCTTTTNONE 
J075077E03ATTGGGCTTTTNONE 
J075083J11ATTGGGCTTTTNONE 
J075094J22ATTGGGCTTTTNONE 
J075112E08ATTGGGCTTTTNONE 
J075137J23ATTGGGCTTTTNONE 
J075192E02ATTGGGCTTTTNONE 
J100039K04ATTGGGCTTTTNONE 
Os09g0364500J100031B16AAAGCCCAACAGTP-binding protein, HSR1-related domain containing protein. 
J100052H07AAAGCCCAACANONE 
J100078G03AAAGCCCAACANONE 
Os09g0370300AK108199AAAGCCCACCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0381600AK107716AAAGCCCAATConserved hypothetical protein. 
J065046L11AAAGCCCAATNONE 
J075140N02AAAGCCCAATNONE 
J075156D10AAAGCCCAATNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0401200AK063980GGAGTGGGCTTTSimilar to HSP associated protein like. 
Os09g0438700006-093-A11AAAAGCCCAANONE 
AK061837AAAAGCCCAANONE 
AK098903AAAAGCCCAASimilar to 20 kDa chaperonin, chloroplast precursor (Protein Cpn21) (Chloroplast protein Cpn10) (Chloroplast chaperonin 10) (Ch-CPN10) (Chaperonin 20). 
J013002C22AAAAGCCCAANONE 
J065053C07AAAAGCCCAANONE 
J065118J22AAAAGCCCAANONE 
J065213B13AAAAGCCCAANONE 
J075065H24AAAAGCCCAANONE 
Os09g0461500006-107-E02AAAGCCCACCACNONE 
011-089-D02AAAGCCCACCACNONE 
AK063400AAAGCCCACCACNONE 
AK102328AAAGCCCACCACEsterase/lipase/thioesterase domain containing protein. 
J033090L22AAAGCCCACCACNONE 
J065031O14AAAGCCCACCACNONE 
J065083D22AAAGCCCACCACNONE 
J065182N14AAAGCCCACCACNONE 
J065190H22AAAGCCCACCACNONE 
J065219H11AAAGCCCACCACNONE 
J075007O22AAAGCCCACCACNONE 
J075025E09AAAGCCCACCACNONE 
J075041K24AAAGCCCACCACNONE 
J075046F11AAAGCCCACCACNONE 
J090032E12AAAGCCCACCACNONE 
Os09g0463700016-008-D06AAAGCCCAAATNONE 
AK060708AAAGCCCAAATSimilar to AHM1. 
J090013G05AAAGCCCAAATNONE 
Os09g0465800009-106-E01AAAAGCCCACNONE 
009-106-E01AAAGCCCAAAANONE 
AK062785AAAAGCCCACConserved hypothetical protein. 
AK062785AAAGCCCAAAAConserved hypothetical protein. 
J065122K21AAAAGCCCACNONE 
J065122K21AAAGCCCAAAANONE 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0495200AK102989CTTGGGCCAAGTGGGCTTTConserved hypothetical protein. 
J075062H18CTTGGGCCAAGTGGGCTTTNONE 
J075098G06CTTGGGCCAAGTGGGCTTTNONE 
Os09g0498100015-046-G11TTGGCCCATGGGCTAAAGCCCAGNONE 
AK064108TTGGCCCATGGGCTAAAGCCCAGSimilar to 30S ribosomal protein S16. 
J065040H21TTGGCCCATGGGCTAAAGCCCAGNONE 
J065062F05TTGGCCCATGGGCTAAAGCCCAGNONE 
J065147B17TTGGCCCATGGGCTAAAGCCCAGNONE 
J075098J22TTGGCCCATGGGCTAAAGCCCAGNONE 
Os09g0502200AK102600AAAGCCCACASimilar to Beta-1,3-glucanase (Fragment). 
AK121879AAAGCCCACANONE 
J100061G20AAAGCCCACANONE 
Os09g0509200AK069525AAAGCCCATCASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0513900AK107699AAAGCCCATTTConserved hypothetical protein. 
Os09g0516800009-017-A01AAAGCCCAACAConserved hypothetical protein. 
009-017-A01AAAGCCCAATAConserved hypothetical protein. 
Os09g0517800012-034-H10AAAGCCCACANONE 
AK121391AAAGCCCACACyclin-like F-box domain containing protein. 
J023129D04AAAGCCCACANONE 
J043012D11AAAGCCCACANONE 
Os09g0533900003-104-E05AAAGCCCACGCGAGCCCATCCNONE 
012-076-C03AAAGCCCACGCGAGCCCATCCNONE 
AK067774AAAGCCCACGCGAGCCCATCCNONE 
AK100449AAAGCCCACGCGAGCCCATCCSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07AAAGCCCACGCGAGCCCATCCNONE 
J023026E11AAAGCCCACGCGAGCCCATCCNONE 
J023028B20AAAGCCCACGCGAGCCCATCCNONE 
J023050P11AAAGCCCACGCGAGCCCATCCNONE 
J023052K08AAAGCCCACGCGAGCCCATCCNONE 
J023075J03AAAGCCCACGCGAGCCCATCCNONE 
J023078E15AAAGCCCACGCGAGCCCATCCNONE 
J023090P12AAAGCCCACGCGAGCCCATCCNONE 
J023120E01AAAGCCCACGCGAGCCCATCCNONE 
J023142K01AAAGCCCACGCGAGCCCATCCNONE 
J033027K23AAAGCCCACGCGAGCCCATCCNONE 
J033058A09AAAGCCCACGCGAGCCCATCCNONE 
J033058C12AAAGCCCACGCGAGCCCATCCNONE 
J033125A04AAAGCCCACGCGAGCCCATCCNONE 
J043040L01AAAGCCCACGCGAGCCCATCCNONE 
J053061D06AAAGCCCACGCGAGCCCATCCNONE 
J053096N13AAAGCCCACGCGAGCCCATCCNONE 
J065193H10AAAGCCCACGCGAGCCCATCCNONE 
J090075L17AAAGCCCACGCGAGCCCATCCNONE 
J100050D10AAAGCCCACGCGAGCCCATCCNONE 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os11g0114700AK065865AAAAGCCCACGANONE 
AK066583AAAAGCCCACGANONE 
AK070834AAAAGCCCACGAPAP/25A core domain containing protein. 
AK072543AAAAGCCCACGANONE 
Os11g0127700AK103742AAAAGCCCAATAHypothetical protein. 
J090083M11AAAAGCCCAATANONE 
Os11g0131200J065024D18AAAGCCCATCAMpv17/PMP22 family protein. 
J065206C17AAAGCCCATCANONE 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0159000AK065738AAAAGCCCAAAAConserved hypothetical protein. 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0175500015-087-F02TCAGGCCCATGAAAGCCCATGTNONE 
AK064320TCAGGCCCATGAAAGCCCATGTZinc finger, RING-type domain containing protein. 
AK101592TCAGGCCCATGAAAGCCCATGTNONE 
Os11g0298400AK068577AGAGTGGGTTGGGCTTTRibulose bisphosphate carboxylase, small chain family protein. 
Os11g0417400AK070536AAAGCCCAATProtein phosphatase 2C-like domain containing protein. 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0543100AK108274ACATGGGCTTTTConserved hypothetical protein. 
Os11g0616200AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0657200AK059959TCATGGGCTTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAAGCCCATGANONE 
AK062752AAAGCCCATGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0660500009-031-D10AAAAGCCCAAACNONE 
009-100-G09AAAAGCCCAAACNONE 
009-162-G10AAAAGCCCAAACNONE 
009-183-H11AAAAGCCCAAACNONE 
013-010-B11AAAAGCCCAAACNONE 
013-050-A05AAAAGCCCAAACNONE 
013-070-E10AAAAGCCCAAACNONE 
AK105453AAAAGCCCAAACSimilar to Translationally controlled tumor protein (Fragment). 
D12626AAAAGCCCAAACNONE 
J013128M15AAAAGCCCAAACNONE 
J023004I19AAAAGCCCAAACNONE 
J033114F08AAAAGCCCAAACNONE 
J033147I20AAAAGCCCAAACNONE 
J065031M04AAAAGCCCAAACNONE 
J065033J03AAAAGCCCAAACNONE 
J065038E01AAAAGCCCAAACNONE 
J065048O06AAAAGCCCAAACNONE 
J065054E01AAAAGCCCAAACNONE 
J065075N08AAAAGCCCAAACNONE 
J065080C07AAAAGCCCAAACNONE 
J065096A12AAAAGCCCAAACNONE 
J065115P22AAAAGCCCAAACNONE 
J065122I21AAAAGCCCAAACNONE 
J065127A13AAAAGCCCAAACNONE 
J065158B06AAAAGCCCAAACNONE 
J065162E04AAAAGCCCAAACNONE 
J065162E05AAAAGCCCAAACNONE 
J065163L06AAAAGCCCAAACNONE 
J065177B16AAAAGCCCAAACNONE 
J065181M15AAAAGCCCAAACNONE 
J065201G15AAAAGCCCAAACNONE 
J065202J06AAAAGCCCAAACNONE 
J075002B19AAAAGCCCAAACNONE 
J075008G19AAAAGCCCAAACNONE 
J075010P05AAAAGCCCAAACNONE 
J075018H23AAAAGCCCAAACNONE 
J075051E18AAAAGCCCAAACNONE 
J075053C24AAAAGCCCAAACNONE 
J075077B06AAAAGCCCAAACNONE 
J075080B11AAAAGCCCAAACNONE 
J075083M04AAAAGCCCAAACNONE 
J075085H01AAAAGCCCAAACNONE 
J075109E11AAAAGCCCAAACNONE 
J075111O09AAAAGCCCAAACNONE 
J075130D13AAAAGCCCAAACNONE 
J075132H13AAAAGCCCAAACNONE 
J075147H19AAAAGCCCAAACNONE 
J075148J01AAAAGCCCAAACNONE 
J075159A18AAAAGCCCAAACNONE 
J075166F03AAAAGCCCAAACNONE 
J075191F09AAAAGCCCAAACNONE 
J075192K09AAAAGCCCAAACNONE 
J080006P15AAAAGCCCAAACNONE 
J080013J18AAAAGCCCAAACNONE 
J080023O06AAAAGCCCAAACNONE 
J080024I17AAAAGCCCAAACNONE 
J080029P03AAAAGCCCAAACNONE 
J080030C14AAAAGCCCAAACNONE 
J080038K15AAAAGCCCAAACNONE 
J080042I15AAAAGCCCAAACNONE 
J080053L07AAAAGCCCAAACNONE 
J080061H12AAAAGCCCAAACNONE 
J080064H24AAAAGCCCAAACNONE 
J080066J20AAAAGCCCAAACNONE 
J080074N07AAAAGCCCAAACNONE 
J080079F16AAAAGCCCAAACNONE 
J080079O07AAAAGCCCAAACNONE 
J080092E15AAAAGCCCAAACNONE 
J080301F19AAAAGCCCAAACNONE 
J080302O21AAAAGCCCAAACNONE 
J080306L02AAAAGCCCAAACNONE 
J080307F16AAAAGCCCAAACNONE 
J080307G01AAAAGCCCAAACNONE 
J080307K01AAAAGCCCAAACNONE 
J080309O22AAAAGCCCAAACNONE 
J080311E17AAAAGCCCAAACNONE 
J080311N08AAAAGCCCAAACNONE 
J080312O12AAAAGCCCAAACNONE 
J080315C08AAAAGCCCAAACNONE 
J080316D07AAAAGCCCAAACNONE 
J080318C17AAAAGCCCAAACNONE 
J090004B08AAAAGCCCAAACNONE 
J090009K02AAAAGCCCAAACNONE 
J090025O15AAAAGCCCAAACNONE 
J090026L03AAAAGCCCAAACNONE 
J090036P17AAAAGCCCAAACNONE 
J090047A21AAAAGCCCAAACNONE 
J090053O03AAAAGCCCAAACNONE 
J090059C04AAAAGCCCAAACNONE 
J090062O21AAAAGCCCAAACNONE 
J090064M11AAAAGCCCAAACNONE 
J090070C14AAAAGCCCAAACNONE 
J090075I03AAAAGCCCAAACNONE 
J090081G22AAAAGCCCAAACNONE 
J090083E18AAAAGCCCAAACNONE 
J090084A05AAAAGCCCAAACNONE 
J100019L11AAAAGCCCAAACNONE 
J100022D16AAAAGCCCAAACNONE 
J100042F09AAAAGCCCAAACNONE 
J100051J12AAAAGCCCAAACNONE 
J100065G21AAAAGCCCAAACNONE 
J100066D08AAAAGCCCAAACNONE 
J100069H04AAAAGCCCAAACNONE 
J100078I16AAAAGCCCAAACNONE 
J100090D15AAAAGCCCAAACNONE 
Os12g0100050Os12g0100050TTTTGGGCTTTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AAAGCCCAAAANONE 
AK061492AAAGCCCAAAASimilar to ALY protein. 
AK068452AAAGCCCAAAANONE 
J013153E18AAAGCCCAAAANONE 
J033140D06AAAGCCCAAAANONE 
J065046A19AAAGCCCAAAANONE 
J065061F08AAAGCCCAAAANONE 
J065101I03AAAGCCCAAAANONE 
J065158B05AAAGCCCAAAANONE 
J065162H06AAAGCCCAAAANONE 
J065195I23AAAGCCCAAAANONE 
J065218E07AAAGCCCAAAANONE 
Os12g0120000011-024-E09AAAGCCCATATNONE 
AK105399AAAGCCCATATProtein of unknown function DUF936, plant family protein. 
Os12g0123900016-031-A06AAAAGCCCAACANONE 
AK061862AAAAGCCCAACAHypothetical protein. 
J013031P10AAAAGCCCAACANONE 
J053034P22AAAAGCCCAACANONE 
J053046O16AAAAGCCCAACANONE 
J053048D20AAAAGCCCAACANONE 
J090031I07AAAAGCCCAACANONE 
J100025B02AAAAGCCCAACANONE 
Os12g0133600AK103096ACGTGGGCTTTConserved hypothetical protein. 
J033118M03ACGTGGGCTTTNONE 
Os12g0146300J065162K17TGTTGGGCTTTACATGGGCCGAGHypothetical protein. 
Os12g0167900005-004-A06AAAAGCCCATTNONE 
006-024-H01AAAAGCCCATTNONE 
006-044-H12AAAAGCCCATTNONE 
006-053-B08AAAAGCCCATTNONE 
015-080-F12AAAAGCCCATTNONE 
AK060925AAAAGCCCATT60S ribosomal protein L3. 
D10403AAAAGCCCATTNONE 
D12630AAAAGCCCATTNONE 
J013046A17AAAAGCCCATTNONE 
J013048A16AAAAGCCCATTNONE 
J013057L14AAAAGCCCATTNONE 
J023058G08AAAAGCCCATTNONE 
J023058I08AAAAGCCCATTNONE 
J023078E17AAAAGCCCATTNONE 
J023087E03AAAAGCCCATTNONE 
J023097D18AAAAGCCCATTNONE 
J023141E14AAAAGCCCATTNONE 
J023150P21AAAAGCCCATTNONE 
J033045K05AAAAGCCCATTNONE 
J033071G03AAAAGCCCATTNONE 
J033071I15AAAAGCCCATTNONE 
J033136D08AAAAGCCCATTNONE 
J043012M21AAAAGCCCATTNONE 
J043015C13AAAAGCCCATTNONE 
J053031L19AAAAGCCCATTNONE 
J053050C01AAAAGCCCATTNONE 
J053055I20AAAAGCCCATTNONE 
J053074B18AAAAGCCCATTNONE 
J053091I08AAAAGCCCATTNONE 
J053097N01AAAAGCCCATTNONE 
J065058A02AAAAGCCCATTNONE 
J065141H11AAAAGCCCATTNONE 
J075019D10AAAAGCCCATTNONE 
J075078G18AAAAGCCCATTNONE 
J075094C12AAAAGCCCATTNONE 
J075165H12AAAAGCCCATTNONE 
J090011E05AAAAGCCCATTNONE 
J090021H18AAAAGCCCATTNONE 
J090027N07AAAAGCCCATTNONE 
J090035F04AAAAGCCCATTNONE 
J090050F21AAAAGCCCATTNONE 
J090051M02AAAAGCCCATTNONE 
J090060F21AAAAGCCCATTNONE 
J090075G15AAAAGCCCATTNONE 
J090092P11AAAAGCCCATTNONE 
J090097B18AAAAGCCCATTNONE 
J100019C17AAAAGCCCATTNONE 
J100022O04AAAAGCCCATTNONE 
J100034G13AAAAGCCCATTNONE 
J100048A13AAAAGCCCATTNONE 
J100050P18AAAAGCCCATTNONE 
J100054B21AAAAGCCCATTNONE 
J100062L01AAAAGCCCATTNONE 
J100065E11AAAAGCCCATTNONE 
J100074P09AAAAGCCCATTNONE 
J100086E10AAAAGCCCATTNONE 
Os12g0223700J075049J03CTTGGGCCAAAAGCCCAAGHypothetical protein. 
J075101F23CTTGGGCCAAAAGCCCAAGNONE 
Os12g0279600AK070295AAAGCCCAAGExodeoxyribonuclease III xth family protein. 
Os12g0442700AK111062AGGTGGGCTTTTHypothetical protein. 
J065080H14AGGTGGGCTTTTNONE 
J075019H22AGGTGGGCTTTTNONE 
J075088M09AGGTGGGCTTTTNONE 
Os12g0479400AK065254AAAGCCCAAANONE 
AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAASimilar to Auxin response factor 1. 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 
Os12g0508300009-006-G07AAAAGCCCATTANONE 
009-133-E05AAAAGCCCATTANONE 
009-137-F10AAAAGCCCATTANONE 
014-024-A06AAAAGCCCATTANONE 
AK059123AAAAGCCCATTARibosomal protein S14 family protein. 
J100088E22AAAAGCCCATTANONE 
Os12g0554400AK104059TATTGGGCTTTNONE 
Os12g0562300AK061984AGAGTGGGCTTTSmr protein/MutS2 C-terminal domain containing protein. 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0565800AK072828AAAGCCCACZinc finger, TTF-type domain containing protein. 
Os12g0569500AK066624CGTGGGCTTTThaumatin, pathogenesis-related family protein. 
J065041B03CGTGGGCTTTNONE 
J065046P11CGTGGGCTTTNONE 
J075140J11CGTGGGCTTTNONE 
Os12g0572400016-084-F04AAAGCCCATAAGGCCCACCCNONE 
AK065531AAAGCCCATAAGGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03AAAGCCCATAAGGCCCACCCNONE 
J013034H02AAAGCCCATAAGGCCCACCCNONE 
J033117N05AAAGCCCATAAGGCCCACCCNONE 
J065027L09AAAGCCCATAAGGCCCACCCNONE 
J065037D09AAAGCCCATAAGGCCCACCCNONE 
J065197I09AAAGCCCATAAGGCCCACCCNONE 
J090045C01AAAGCCCATAAGGCCCACCCNONE 
J100031E11AAAGCCCATAAGGCCCACCCNONE 
Os12g0588900AK069966AAAGCCCATTGGGCCTGGConserved hypothetical protein. 
J023038A10AAAGCCCATTGGGCCTGGNONE 
J065061J23AAAGCCCATTGGGCCTGGNONE 
J065176O08AAAGCCCATTGGGCCTGGNONE 
J075143K13AAAGCCCATTGGGCCTGGNONE 
Os12g0631100006-045-F12TTTTGGGCTTTTNONE 
006-077-C09TTTTGGGCTTTTNONE 
006-078-B11TTTTGGGCTTTTNONE 
AJ292320TTTTGGGCTTTTNONE 
AK061116TTTTGGGCTTTTNONE 
AK066784TTTTGGGCTTTTNONE 
AY029301TTTTGGGCTTTTRas small GTPase, Ras type family protein. 
J065015G13TTTTGGGCTTTTNONE 
J065035E22TTTTGGGCTTTTNONE 
J065037H03TTTTGGGCTTTTNONE 
J065065F12TTTTGGGCTTTTNONE 
J065078K22TTTTGGGCTTTTNONE 
J065081K09TTTTGGGCTTTTNONE 
J065121I23TTTTGGGCTTTTNONE 
J065127I03TTTTGGGCTTTTNONE 
J065130G24TTTTGGGCTTTTNONE 
J065134E23TTTTGGGCTTTTNONE 
J065154H14TTTTGGGCTTTTNONE 
J065183K16TTTTGGGCTTTTNONE 
J065209P13TTTTGGGCTTTTNONE 
J075087O18TTTTGGGCTTTTNONE 
J090065E06TTTTGGGCTTTTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.