version

Summary of OsREG422 (All List)

OrganismOryza sativa  
IDOsREG422  
SequenceAAATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2203  

Entry Sequences (2203 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087AGCCCATTTNONE 
AK103808AGCCCATTTC-type lectin domain containing protein. 
Os01g0104100AK072797AAATGGGCTZinc finger, RING-type domain containing protein. 
AK104280AAATGGGCTNONE 
Os01g0212100AK065467AAAAGCCCATTTNONE 
AK101456AAAAGCCCATTTATP-dependent helicase, DEAH-box family protein. 
Os01g0222700012-011-E01ATGGCCCATTTNONE 
AK068883ATGGCCCATTTNONE 
AK101946ATGGCCCATTTZinc finger, BED-type predicted domain containing protein. 
J033075C16ATGGCCCATTTNONE 
J043013D08ATGGCCCATTTNONE 
J065089G19ATGGCCCATTTNONE 
J065197K19ATGGCCCATTTNONE 
J075161L21ATGGCCCATTTNONE 
Os01g0228800AK058920AAATGGGCNONE 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
Os01g0248800009-103-G11CCAGCCCATTTNONE 
AK062766CCAGCCCATTTConserved hypothetical protein. 
Os01g0256400AK107950GCCCATTTSimilar to Dynein light chain 1 protein DLC-1 (Fragment). 
J100044J04GCCCATTTNONE 
Os01g0261500J033071B09GCCCATTTNONE 
J090095O22GCCCATTTNONE 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
Os01g0316800009-188-E08GACGGCCCATTTNONE 
AK058821GACGGCCCATTTNONE 
AK119788GACGGCCCATTTSimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09GACGGCCCATTTNONE 
J065102J21GACGGCCCATTTNONE 
J065173M10GACGGCCCATTTNONE 
J075066K08GACGGCCCATTTNONE 
J080302B04GACGGCCCATTTNONE 
J080310P14GACGGCCCATTTNONE 
J080311I23GACGGCCCATTTNONE 
J080319N12GACGGCCCATTTNONE 
J100024D14GACGGCCCATTTNONE 
J100055N12GACGGCCCATTTNONE 
Os01g0327600AK120216AAATGGGCTTGGNONE 
AK121799AAATGGGCTTGGConserved hypothetical protein. 
J065081I07AAATGGGCTTGGNONE 
J065082D04AAATGGGCTTGGNONE 
J065082G10AAATGGGCTTGGNONE 
J065085G24AAATGGGCTTGGNONE 
J065105J24AAATGGGCTTGGNONE 
J065128D18AAATGGGCTTGGNONE 
J065155D13AAATGGGCTTGGNONE 
J065200C11AAATGGGCTTGGNONE 
Os01g0348600AK062168TCAGCCCATTTNONE 
AK099063TCAGCCCATTTNONE 
J013157A11TCAGCCCATTTNONE 
Os01g0358300AK060388AAATGGGCTGGGNONE 
AK072081AAATGGGCTGGGTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11CCCAGCCCATTTNONE 
006-083-B11CCCAGCCCATTTNONE 
006-083-C09CCCAGCCCATTTNONE 
006-088-H03CCCAGCCCATTTNONE 
006-102-H05CCCAGCCCATTTNONE 
AK061826CCCAGCCCATTTSimilar to 40S ribosomal protein S4. 
J013105M07CCCAGCCCATTTNONE 
J013155A16CCCAGCCCATTTNONE 
J033025C03CCCAGCCCATTTNONE 
J033072L20CCCAGCCCATTTNONE 
J033095I15CCCAGCCCATTTNONE 
J033105E03CCCAGCCCATTTNONE 
J033112G18CCCAGCCCATTTNONE 
J033125D09CCCAGCCCATTTNONE 
J065100L16CCCAGCCCATTTNONE 
J065176I05CCCAGCCCATTTNONE 
J090001C14CCCAGCCCATTTNONE 
J090058E15CCCAGCCCATTTNONE 
J090068F07CCCAGCCCATTTNONE 
Os01g0369000AK064940AAATGGGCCAGSimilar to Cullin-1. 
AK104340AAATGGGCCAGNONE 
AY336990AAATGGGCCAGNONE 
J013000P07AAATGGGCCAGNONE 
J013056B18AAATGGGCCAGNONE 
J013056B20AAATGGGCCAGNONE 
J013098C09AAATGGGCCAGNONE 
J013099E23AAATGGGCCAGNONE 
J023007E10AAATGGGCCAGNONE 
J023064L04AAATGGGCCAGNONE 
J023119B15AAATGGGCCAGNONE 
J023126O19AAATGGGCCAGNONE 
J033120G16AAATGGGCCAGNONE 
J043007K19AAATGGGCCAGNONE 
J065037I22AAATGGGCCAGNONE 
J065051D18AAATGGGCCAGNONE 
J065073N09AAATGGGCCAGNONE 
J065084K20AAATGGGCCAGNONE 
J065115C15AAATGGGCCAGNONE 
J065115M01AAATGGGCCAGNONE 
J065121O10AAATGGGCCAGNONE 
J065197H21AAATGGGCCAGNONE 
J065211L23AAATGGGCCAGNONE 
J065214M19AAATGGGCCAGNONE 
J090006F13AAATGGGCCAGNONE 
J090012M21AAATGGGCCAGNONE 
J090029M05AAATGGGCCAGNONE 
J090048P16AAATGGGCCAGNONE 
J090051H13AAATGGGCCAGNONE 
J090062C14AAATGGGCCAGNONE 
J090072F21AAATGGGCCAGNONE 
J090085D11AAATGGGCCAGNONE 
J090090N24AAATGGGCCAGNONE 
J090095K17AAATGGGCCAGNONE 
J090099H12AAATGGGCCAGNONE 
J100031B11AAATGGGCCAGNONE 
J100053C15AAATGGGCCAGNONE 
J100075F19AAATGGGCCAGNONE 
J100087L22AAATGGGCCAGNONE 
Os01g0514300AK121086TTTCGGCCCATTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0530400016-019-E07AAATGGGCCCCAGNONE 
AK103724AAATGGGCCCCAGNONE 
AK106476AAATGGGCCCCAGGlutaredoxin-related protein family protein. 
J023108F14AAATGGGCCCCAGNONE 
J033138C10AAATGGGCCCCAGNONE 
Os01g0560200AK102003AAATGGGCAAGGCCCAATTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06AAATGGGCAAGGCCCAATTNONE 
J065092F14AAATGGGCAAGGCCCAATTNONE 
J065106D04AAATGGGCAAGGCCCAATTNONE 
J065194K23AAATGGGCAAGGCCCAATTNONE 
Os01g0571200014-074-A10TAGGCCCATTTNONE 
AK121299TAGGCCCATTTSimilar to Ribosomal protein L34. 
J023110L12TAGGCCCATTTNONE 
Os01g0575000AK101558GCCCATTTNONE 
J080022E06GCCCATTTNONE 
Os01g0596700AK107371AAATGGGCCCCAFBD domain containing protein. 
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein. 
J013094O21AAATGGGCCGAGCCCAACTNONE 
Os01g0612800AK071035AAATGGGCCGAConserved hypothetical protein. 
J090075K01AAATGGGCCGANONE 
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein. 
Os01g0667300Os01g0667300GCCCATTTConserved hypothetical protein. 
Os01g0672700AK121375AAATGGGCCAGDNA polymerase, beta-like region domain containing protein. 
J023127C22AAATGGGCCAGNONE 
J033092B05AAATGGGCCAGNONE 
J033129P21AAATGGGCCAGNONE 
J065079H18AAATGGGCCAGNONE 
Os01g0678700AK111611AAATGGGCTGTDP protein. 
AY224529AAATGGGCTGTNONE 
Os01g0686800006-098-B12GCAGCCCATTTNONE 
006-113-H04GCAGCCCATTTNONE 
AK060428GCAGCCCATTTNONE 
AK098877GCAGCCCATTTNONE 
AK098893GCAGCCCATTTNONE 
AK121587GCAGCCCATTTGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GCAGCCCATTTNONE 
J013001E12GCAGCCCATTTNONE 
J013001N15GCAGCCCATTTNONE 
J013098G22GCAGCCCATTTNONE 
J023004P15GCAGCCCATTTNONE 
J023014D09GCAGCCCATTTNONE 
J023020G09GCAGCCCATTTNONE 
J023034A19GCAGCCCATTTNONE 
J023050I11GCAGCCCATTTNONE 
J023079D13GCAGCCCATTTNONE 
J023091B11GCAGCCCATTTNONE 
J023099M03GCAGCCCATTTNONE 
J023101H20GCAGCCCATTTNONE 
J023106P14GCAGCCCATTTNONE 
J023111F19GCAGCCCATTTNONE 
J023132C22GCAGCCCATTTNONE 
J023139O03GCAGCCCATTTNONE 
J023146O10GCAGCCCATTTNONE 
J033022G16GCAGCCCATTTNONE 
J033030C10GCAGCCCATTTNONE 
J033032G18GCAGCCCATTTNONE 
J033034N09GCAGCCCATTTNONE 
J033037K24GCAGCCCATTTNONE 
J033038B22GCAGCCCATTTNONE 
J033061E06GCAGCCCATTTNONE 
J033065F08GCAGCCCATTTNONE 
J033065I24GCAGCCCATTTNONE 
J033069L01GCAGCCCATTTNONE 
J033086N21GCAGCCCATTTNONE 
J033102I06GCAGCCCATTTNONE 
J033111N07GCAGCCCATTTNONE 
J033118K11GCAGCCCATTTNONE 
J033125D08GCAGCCCATTTNONE 
J033129P22GCAGCCCATTTNONE 
J033131L12GCAGCCCATTTNONE 
J033139D08GCAGCCCATTTNONE 
J033141J08GCAGCCCATTTNONE 
J043024B14GCAGCCCATTTNONE 
J053048G19GCAGCCCATTTNONE 
J065023B15GCAGCCCATTTNONE 
J065082C15GCAGCCCATTTNONE 
J065087D24GCAGCCCATTTNONE 
J065122D11GCAGCCCATTTNONE 
J065128P13GCAGCCCATTTNONE 
J065149I19GCAGCCCATTTNONE 
J065154E16GCAGCCCATTTNONE 
J065156K21GCAGCCCATTTNONE 
J065166H09GCAGCCCATTTNONE 
J065169F24GCAGCCCATTTNONE 
J065194I16GCAGCCCATTTNONE 
J065213M20GCAGCCCATTTNONE 
J075020F19GCAGCCCATTTNONE 
J075051J16GCAGCCCATTTNONE 
J075093C18GCAGCCCATTTNONE 
J075119H02GCAGCCCATTTNONE 
J075120J11GCAGCCCATTTNONE 
J075173A15GCAGCCCATTTNONE 
J080302B05GCAGCCCATTTNONE 
J080304G10GCAGCCCATTTNONE 
J080305E13GCAGCCCATTTNONE 
J080315L11GCAGCCCATTTNONE 
J090005H15GCAGCCCATTTNONE 
J090021C24GCAGCCCATTTNONE 
J090025H24GCAGCCCATTTNONE 
J090025M11GCAGCCCATTTNONE 
J090026C22GCAGCCCATTTNONE 
J090027H15GCAGCCCATTTNONE 
J090034B17GCAGCCCATTTNONE 
J090045G11GCAGCCCATTTNONE 
J090048H02GCAGCCCATTTNONE 
J090051N04GCAGCCCATTTNONE 
J090052I06GCAGCCCATTTNONE 
J090054L17GCAGCCCATTTNONE 
J090060M22GCAGCCCATTTNONE 
J090075N17GCAGCCCATTTNONE 
J090079K13GCAGCCCATTTNONE 
J090086H08GCAGCCCATTTNONE 
J090094N20GCAGCCCATTTNONE 
J100021F03GCAGCCCATTTNONE 
J100031M01GCAGCCCATTTNONE 
J100033I18GCAGCCCATTTNONE 
J100034P07GCAGCCCATTTNONE 
J100043M16GCAGCCCATTTNONE 
J100046J12GCAGCCCATTTNONE 
J100055F09GCAGCCCATTTNONE 
J100057D19GCAGCCCATTTNONE 
J100060O10GCAGCCCATTTNONE 
J100064G09GCAGCCCATTTNONE 
J100077F24GCAGCCCATTTNONE 
J100080E12GCAGCCCATTTNONE 
J100089J04GCAGCCCATTTNONE 
Os01g0705300AK102719AAATGGGCCGTGConserved hypothetical protein. 
AK103903AAATGGGCCGTGNONE 
J013146O16AAATGGGCCGTGNONE 
J023024O09AAATGGGCCGTGNONE 
J033105F22AAATGGGCCGTGNONE 
J033150L19AAATGGGCCGTGNONE 
J075008G14AAATGGGCCGTGNONE 
J090089L03AAATGGGCCGTGNONE 
J100040H18AAATGGGCCGTGNONE 
Os01g0705500AK063120CACGGCCCATTTConserved hypothetical protein. 
J065063M12CACGGCCCATTTNONE 
J065165C11CACGGCCCATTTNONE 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
AK111794AAATGGGCCTASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J023006D22AAATGGGCCTANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCTANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCTANONE 
Os01g0754000014-081-F07AAATGGGCCGCNONE 
AK063730AAATGGGCCGCConserved hypothetical protein. 
J065219A11AAATGGGCCGCNONE 
J075136N13AAATGGGCCGCNONE 
J100051G01AAATGGGCCGCNONE 
J100053M22AAATGGGCCGCNONE 
Os01g0756400J065065A17ATGGCCCATTTNONE 
J075076N03ATGGCCCATTTNONE 
J075120O13ATGGCCCATTTNONE 
J075177C24ATGGCCCATTTNONE 
J080010J02ATGGCCCATTTNONE 
J080018F20ATGGCCCATTTNONE 
J080034I03ATGGCCCATTTNONE 
J080043P21ATGGCCCATTTNONE 
J080068B17ATGGCCCATTTNONE 
J080070F19ATGGCCCATTTNONE 
J080076D05ATGGCCCATTTNONE 
J080077E01ATGGCCCATTTNONE 
J080096C10ATGGCCCATTTNONE 
J080301B21ATGGCCCATTTNONE 
J080304K22ATGGCCCATTTNONE 
Os01g0764300J090053G03CTGGCCCATTTProtein of unknown function DUF155 family protein. 
Os01g0794400AK122041GCCCATTTThioredoxin domain 2 containing protein. 
Os01g0794900AK106644CTGGCCCATTTConserved hypothetical protein. 
Os01g0801700AK073813AAATGGGCCTTConserved hypothetical protein. 
J033067K14AAATGGGCCTTNONE 
Os01g0850400AJ575220AAAAGCCCATTTNONE 
AK108582AAAAGCCCATTTSimilar to MYBY1 protein (Fragment). 
Os01g0863166J065007F23CCACGGCCCATTTNONE 
J065124H21CCACGGCCCATTTConserved hypothetical protein. 
Os01g0874800016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0876500J053026A07GAGGCCCATTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GAGGCCCATTTNONE 
Os01g0880300003-107-C05GCCCATTTGCCCAACCNONE 
AK101962GCCCATTTGCCCAACCSimilar to Pectin methylesterase-like protein. 
AK105682GCCCATTTGCCCAACCNONE 
Os01g0894700009-177-F04AAGGCCCATTTNONE 
009-177-F04AGCCCAAAGGCCCATTTNONE 
AK067623AAGGCCCATTTConserved hypothetical protein. 
AK067623AGCCCAAAGGCCCATTTConserved hypothetical protein. 
AK104876AAGGCCCATTTNONE 
AK104876AGCCCAAAGGCCCATTTNONE 
J013095G01AAGGCCCATTTNONE 
J013095G01AGCCCAAAGGCCCATTTNONE 
J013108L20AAGGCCCATTTNONE 
J013108L20AGCCCAAAGGCCCATTTNONE 
J013120P13AAGGCCCATTTNONE 
J013120P13AGCCCAAAGGCCCATTTNONE 
Os01g0895100AK058611TAATGGGCCCATTTSimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TAATGGGCCCATTTNONE 
AK099166TAATGGGCCCATTTNONE 
J023065I03TAATGGGCCCATTTNONE 
J023081J06TAATGGGCCCATTTNONE 
J023126H17TAATGGGCCCATTTNONE 
J023126O09TAATGGGCCCATTTNONE 
J033035I06TAATGGGCCCATTTNONE 
J090065C10TAATGGGCCCATTTNONE 
J090095O16TAATGGGCCCATTTNONE 
Os01g0908400009-140-E01GAGGCCCATTTNONE 
AK062957GAGGCCCATTTConserved hypothetical protein. 
AK099301GAGGCCCATTTNONE 
J065123M13GAGGCCCATTTNONE 
J075020O14GAGGCCCATTTNONE 
J075136L21GAGGCCCATTTNONE 
Os01g0912600009-186-H02AGCCCATTTNONE 
AK063179AGCCCATTTConserved hypothetical protein. 
Os01g0915800AK103859AAATGGGCCTCSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAATGGGCCTCNONE 
J090056H03AAATGGGCCTCNONE 
J090058L14AAATGGGCCTCNONE 
J090058P16AAATGGGCCTCNONE 
J090076C19AAATGGGCCTCNONE 
J100086P14AAATGGGCCTCNONE 
Os01g0916300011-018-B12AAATGGGCNONE 
AK063922AAATGGGCSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107AAATGGGCNONE 
AK121061AAATGGGCNONE 
AK121997AAATGGGCNONE 
J033118P14AAATGGGCNONE 
J065002N16AAATGGGCNONE 
J065079B04AAATGGGCNONE 
J065102J07AAATGGGCNONE 
J065128F16AAATGGGCNONE 
J065184D11AAATGGGCNONE 
J065186A07AAATGGGCNONE 
J075115C07AAATGGGCNONE 
J075147C04AAATGGGCNONE 
Os01g0938900006-059-H02AAATGGGCCTTNONE 
006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12AAATGGGCCTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437AAATGGGCCTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971AAATGGGCCTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341AAATGGGCCTTNONE 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08AAATGGGCCTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24AAATGGGCCTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04AAATGGGCCTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04AAATGGGCCTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24AAATGGGCCTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07AAATGGGCCTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09AAATGGGCCTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0946200AK071060AAATGGGCCGCNo apical meristem (NAM) protein domain containing protein. 
J023080K20AAATGGGCCGCNONE 
Os01g0953100AK064981TTGGCCCATTTNONE 
AK068882TTGGCCCATTTProtein of unknown function DUF594 family protein. 
J013001C07TTGGCCCATTTNONE 
J013169K14TTGGCCCATTTNONE 
J033114G07TTGGCCCATTTNONE 
J065035K15TTGGCCCATTTNONE 
J065082E12TTGGCCCATTTNONE 
Os01g0958100AK058574AAATGGGCTNONE 
AK103090AAATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369AAATGGGCTNONE 
Os02g0119300AK065427AGCCCATTTPeptidase M14, carboxypeptidase A family protein. 
Os02g0130300011-005-D07AAATGGGCCGAGNONE 
011-041-B06AAATGGGCCGAGNONE 
015-099-D11AAATGGGCCGAGNONE 
016-049-D06AAATGGGCCGAGNONE 
AK102708AAATGGGCCGAGZinc finger, RING-type domain containing protein. 
Os02g0168500011-010-B05AAATGGGCTNONE 
AJ831493AAATGGGCTNONE 
AK073338AAATGGGCTNONE 
AK073486AAATGGGCTConserved hypothetical protein. 
J100059F05AAATGGGCTNONE 
J100082K14AAATGGGCTNONE 
J100090P09AAATGGGCTNONE 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0220600AK103901AAGGCCCATTTCAGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
Os02g0227000J023084F07ACCGGCCCATTTNONE 
J033051H22ACCGGCCCATTTProtein of unknown function UPF0054 family protein. 
Os02g0230200AK105482GACGGCCCATTTConserved hypothetical protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0240300006-044-B12GCCCATTTNONE 
006-047-E01GCCCATTTNONE 
006-107-G10GCCCATTTNONE 
AK067000GCCCATTTSimilar to Class III peroxidase GvPx2b (Fragment). 
AK104645GCCCATTTNONE 
J013091I12GCCCATTTNONE 
J065023C19GCCCATTTNONE 
J065035P20GCCCATTTNONE 
J065059K23GCCCATTTNONE 
J065067P03GCCCATTTNONE 
J065097G05GCCCATTTNONE 
J065113E09GCCCATTTNONE 
J065120H13GCCCATTTNONE 
J065137M20GCCCATTTNONE 
J065158G15GCCCATTTNONE 
J065161A12GCCCATTTNONE 
J065175A01GCCCATTTNONE 
J065189B18GCCCATTTNONE 
J065198L19GCCCATTTNONE 
J075003E22GCCCATTTNONE 
J075021F10GCCCATTTNONE 
J075021J06GCCCATTTNONE 
J075030L15GCCCATTTNONE 
J075033E17GCCCATTTNONE 
J075037C14GCCCATTTNONE 
J075055G09GCCCATTTNONE 
J075069D12GCCCATTTNONE 
J075082K05GCCCATTTNONE 
J075108E07GCCCATTTNONE 
J075127F12GCCCATTTNONE 
J075147I15GCCCATTTNONE 
J075156P08GCCCATTTNONE 
J075166B03GCCCATTTNONE 
J075167E10GCCCATTTNONE 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0266500AK100307TCGGCCCATTTSimilar to RASPBERRY3. 
Os02g0287000006-107-B10AAATGGGCCTCNONE 
006-120-E07AAATGGGCCTCNONE 
AF052503AAATGGGCCTCNONE 
AK059647AAATGGGCCTCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131AAATGGGCCTCNONE 
J023048M05AAATGGGCCTCNONE 
J033107L10AAATGGGCCTCNONE 
J065019A12AAATGGGCCTCNONE 
J065064J21AAATGGGCCTCNONE 
J065071D15AAATGGGCCTCNONE 
J065094L12AAATGGGCCTCNONE 
J065095L06AAATGGGCCTCNONE 
J065097J11AAATGGGCCTCNONE 
J065099M08AAATGGGCCTCNONE 
J065104D01AAATGGGCCTCNONE 
J065107L02AAATGGGCCTCNONE 
J065110D14AAATGGGCCTCNONE 
J065135J07AAATGGGCCTCNONE 
J065137C16AAATGGGCCTCNONE 
J065150C07AAATGGGCCTCNONE 
J065165I10AAATGGGCCTCNONE 
J065189F07AAATGGGCCTCNONE 
J065205L22AAATGGGCCTCNONE 
J065214C09AAATGGGCCTCNONE 
J065217G17AAATGGGCCTCNONE 
J075029E17AAATGGGCCTCNONE 
J075054O16AAATGGGCCTCNONE 
J075068N23AAATGGGCCTCNONE 
J075135N18AAATGGGCCTCNONE 
J075152G09AAATGGGCCTCNONE 
J075162D10AAATGGGCCTCNONE 
J075164F11AAATGGGCCTCNONE 
J080036L12AAATGGGCCTCNONE 
J080049K18AAATGGGCCTCNONE 
J080060P03AAATGGGCCTCNONE 
J080062G16AAATGGGCCTCNONE 
J080062G21AAATGGGCCTCNONE 
J080064N07AAATGGGCCTCNONE 
J080075I22AAATGGGCCTCNONE 
J080086F20AAATGGGCCTCNONE 
J080087G07AAATGGGCCTCNONE 
J080088I06AAATGGGCCTCNONE 
J080302B20AAATGGGCCTCNONE 
J080303L14AAATGGGCCTCNONE 
J080309O12AAATGGGCCTCNONE 
J080317F12AAATGGGCCTCNONE 
J080317P18AAATGGGCCTCNONE 
J090013L15AAATGGGCCTCNONE 
J090043N04AAATGGGCCTCNONE 
J090085G01AAATGGGCCTCNONE 
J090085G19AAATGGGCCTCNONE 
Os02g0288200AK073147GTGGCCCATTTNONE 
Os02g0526500006-107-D09AAATGGGCCTCNONE 
Os02g0555700AK108057GCCCATTTSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
Os02g0573400Os02g0573400AAATGGGCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os02g0584900AK102041AGCCCATTTConserved hypothetical protein. 
J013156E02AGCCCATTTNONE 
J033081H13AGCCCATTTNONE 
J033120M20AGCCCATTTNONE 
J080005N16AGCCCATTTNONE 
J080061N19AGCCCATTTNONE 
Os02g0618700AK070657GAGGCCCATTTLung seven transmembrane receptor family protein. 
J023056H15GAGGCCCATTTNONE 
Os02g0622400005-010-C04TAATGGGCCGGCCCATTTNONE 
AK061679TAATGGGCCGGCCCATTTConserved hypothetical protein. 
J013058H01TAATGGGCCGGCCCATTTNONE 
J013095D07TAATGGGCCGGCCCATTTNONE 
J023054G05TAATGGGCCGGCCCATTTNONE 
J023093A17TAATGGGCCGGCCCATTTNONE 
J023146P16TAATGGGCCGGCCCATTTNONE 
J033089D16TAATGGGCCGGCCCATTTNONE 
J033099G12TAATGGGCCGGCCCATTTNONE 
J033131N10TAATGGGCCGGCCCATTTNONE 
J053073J04TAATGGGCCGGCCCATTTNONE 
J053074P03TAATGGGCCGGCCCATTTNONE 
J053075M06TAATGGGCCGGCCCATTTNONE 
J053088K13TAATGGGCCGGCCCATTTNONE 
J090039F18TAATGGGCCGGCCCATTTNONE 
J090045M03TAATGGGCCGGCCCATTTNONE 
Os02g0655700AK101068AAATGGGCCTCAmino acid/polyamine transporter I family protein. 
AK101068AAATGGGCCTTAmino acid/polyamine transporter I family protein. 
J013026C06AAATGGGCCTCNONE 
J013026C06AAATGGGCCTTNONE 
J033023I17AAATGGGCCTCNONE 
J033023I17AAATGGGCCTTNONE 
Os02g0656500011-045-C08AAATGGGCCGAANONE 
011-045-E06AAATGGGCCGAANONE 
016-046-A01AAATGGGCCGAANONE 
016-046-B01AAATGGGCCGAANONE 
AK062239AAATGGGCCGAANONE 
AK066420AAATGGGCCGAADnaJ-like protein. 
J013067J21AAATGGGCCGAANONE 
J065047L09AAATGGGCCGAANONE 
J065104M20AAATGGGCCGAANONE 
J065134B04AAATGGGCCGAANONE 
J065152C10AAATGGGCCGAANONE 
J065161O03AAATGGGCCGAANONE 
J065169F18AAATGGGCCGAANONE 
J065210M21AAATGGGCCGAANONE 
J065217B03AAATGGGCCGAANONE 
J065218C10AAATGGGCCGAANONE 
J075041F09AAATGGGCCGAANONE 
J075048A02AAATGGGCCGAANONE 
J075083F21AAATGGGCCGAANONE 
J080005F10AAATGGGCCGAANONE 
J080013P21AAATGGGCCGAANONE 
J080027J09AAATGGGCCGAANONE 
J080037O17AAATGGGCCGAANONE 
J080039F02AAATGGGCCGAANONE 
J080039G01AAATGGGCCGAANONE 
J080041I09AAATGGGCCGAANONE 
J080043M01AAATGGGCCGAANONE 
J080060H17AAATGGGCCGAANONE 
J080062O07AAATGGGCCGAANONE 
J080079F05AAATGGGCCGAANONE 
J080093H04AAATGGGCCGAANONE 
J080096B15AAATGGGCCGAANONE 
J080097H24AAATGGGCCGAANONE 
J090032O11AAATGGGCCGAANONE 
J090044F01AAATGGGCCGAANONE 
J090045E04AAATGGGCCGAANONE 
J090048O03AAATGGGCCGAANONE 
J090049E04AAATGGGCCGAANONE 
J090070E19AAATGGGCCGAANONE 
J090079E13AAATGGGCCGAANONE 
J090089L14AAATGGGCCGAANONE 
J090095K13AAATGGGCCGAANONE 
J090096I19AAATGGGCCGAANONE 
J090098B04AAATGGGCCGAANONE 
J100027P13AAATGGGCCGAANONE 
J100048H06AAATGGGCCGAANONE 
J100060J15AAATGGGCCGAANONE 
J100070K16AAATGGGCCGAANONE 
J100074O22AAATGGGCCGAANONE 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0666800AK101444CAAGGCCCATTTProtein of unknown function DUF788 family protein. 
J033039F09CAAGGCCCATTTNONE 
J065041E15CAAGGCCCATTTNONE 
J075087I24CAAGGCCCATTTNONE 
J100079A10CAAGGCCCATTTNONE 
Os02g0672600AK070286AAATGGGCTSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174AAATGGGCTNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0717800009-009-B02AAATGGGCCGTTTNONE 
J065185P06AAATGGGCCGTTTNONE 
J100061J04AAATGGGCCGTTTNONE 
J100064M21AAATGGGCCGTTTNONE 
Os02g0723200AK108140GCCCATTTSimilar to Alpha galactosyltransferase (Fragment). 
J090087D22GCCCATTTNONE 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
Os02g0750500AK101960GCGGCCCATTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GCGGCCCATTTNONE 
J065054F02GCGGCCCATTTNONE 
J065124N03GCGGCCCATTTNONE 
J090001H12GCGGCCCATTTNONE 
J100057J01GCGGCCCATTTNONE 
J100062F12GCGGCCCATTTNONE 
Os02g0769700AK111328AAATGGGCCTGGProtein kinase-like domain containing protein. 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0775600003-118-H07AAATGGGCCGGGNONE 
009-075-H07AAATGGGCCGGGNONE 
AK058592AAATGGGCCGGGNONE 
AK068762AAATGGGCCGGGZinc finger, C2H2-type domain containing protein. 
Os02g0780800J090080O19TTTCGGCCCATTTNONE 
J090091I06TTTCGGCCCATTTNONE 
Os02g0796500AK065276AAATGGGCCCCASimilar to Two-component response regulator ARR11 (Receiver-like protein 3). 
AK065276GCCCATTTSimilar to Two-component response regulator ARR11 (Receiver-like protein 3). 
AK099581AAATGGGCCCCANONE 
AK099581GCCCATTTNONE 
AK120648AAATGGGCCCCANONE 
AK120648GCCCATTTNONE 
Os02g0796900009-121-E06AAATGGGCCACNONE 
D29725AAATGGGCCACSimilar to 60S ribosomal protein L39. 
J075016N24AAATGGGCCACNONE 
J075085F03AAATGGGCCACNONE 
J075147P11AAATGGGCCACNONE 
J075180E16AAATGGGCCACNONE 
J075182A19AAATGGGCCACNONE 
Os02g0798700AK101070GAGGCCCATTTNeurochondrin family protein. 
AK103079GAGGCCCATTTNONE 
J090045L09GAGGCCCATTTNONE 
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE 
AK060165TCTCGGCCCATTTCACGTGTCNONE 
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TCTCGGCCCATTTCACGTGTCNONE 
J023098C22TCTCGGCCCATTTCACGTGTCNONE 
J033123P06TCTCGGCCCATTTCACGTGTCNONE 
J065060N24TCTCGGCCCATTTCACGTGTCNONE 
J065069H22TCTCGGCCCATTTCACGTGTCNONE 
J065155N20TCTCGGCCCATTTCACGTGTCNONE 
J065170K07TCTCGGCCCATTTCACGTGTCNONE 
J090033D12TCTCGGCCCATTTCACGTGTCNONE 
Os02g0810300AK059363AAATGGGCCAGGGCCCAGGSimilar to NBD-like protein. 
AK099203AAATGGGCCAGGGCCCAGGNONE 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
Os02g0823600AK070498TCCGGCCCATTTConserved hypothetical protein. 
J065055C02TCCGGCCCATTTNONE 
J065098A17TCCGGCCCATTTNONE 
J065119B13TCCGGCCCATTTNONE 
J065146F10TCCGGCCCATTTNONE 
J065209G06TCCGGCCCATTTNONE 
J080001K12TCCGGCCCATTTNONE 
J080004O17TCCGGCCCATTTNONE 
J080005P21TCCGGCCCATTTNONE 
J080009M18TCCGGCCCATTTNONE 
J080013O18TCCGGCCCATTTNONE 
J080014B04TCCGGCCCATTTNONE 
J080014O21TCCGGCCCATTTNONE 
J080015B04TCCGGCCCATTTNONE 
J080016B17TCCGGCCCATTTNONE 
J080017G09TCCGGCCCATTTNONE 
J080022A17TCCGGCCCATTTNONE 
J080024M10TCCGGCCCATTTNONE 
J080025F17TCCGGCCCATTTNONE 
J080025O16TCCGGCCCATTTNONE 
J080029H09TCCGGCCCATTTNONE 
J080030G24TCCGGCCCATTTNONE 
J080031E02TCCGGCCCATTTNONE 
J080032A18TCCGGCCCATTTNONE 
J080032G24TCCGGCCCATTTNONE 
J080033C05TCCGGCCCATTTNONE 
J080033N19TCCGGCCCATTTNONE 
J080035H10TCCGGCCCATTTNONE 
J080035L05TCCGGCCCATTTNONE 
J080042N09TCCGGCCCATTTNONE 
J080044C14TCCGGCCCATTTNONE 
J080048K16TCCGGCCCATTTNONE 
J080050L07TCCGGCCCATTTNONE 
J080051L06TCCGGCCCATTTNONE 
J080051P22TCCGGCCCATTTNONE 
J080053D09TCCGGCCCATTTNONE 
J080053J15TCCGGCCCATTTNONE 
J080053O12TCCGGCCCATTTNONE 
J080057L01TCCGGCCCATTTNONE 
J080062E08TCCGGCCCATTTNONE 
J080062I09TCCGGCCCATTTNONE 
J080063A21TCCGGCCCATTTNONE 
J080063E04TCCGGCCCATTTNONE 
J080063E08TCCGGCCCATTTNONE 
J080064D15TCCGGCCCATTTNONE 
J080064N15TCCGGCCCATTTNONE 
J080068F13TCCGGCCCATTTNONE 
J080070L16TCCGGCCCATTTNONE 
J080072O17TCCGGCCCATTTNONE 
J080075A07TCCGGCCCATTTNONE 
J080076H10TCCGGCCCATTTNONE 
J080077K19TCCGGCCCATTTNONE 
J080078E19TCCGGCCCATTTNONE 
J080082A02TCCGGCCCATTTNONE 
J080083O05TCCGGCCCATTTNONE 
J080091I07TCCGGCCCATTTNONE 
J080094K10TCCGGCCCATTTNONE 
J080094N03TCCGGCCCATTTNONE 
J080096F09TCCGGCCCATTTNONE 
J080097O04TCCGGCCCATTTNONE 
J090037B19TCCGGCCCATTTNONE 
J100017A13TCCGGCCCATTTNONE 
J100068N22TCCGGCCCATTTNONE 
J100072C06TCCGGCCCATTTNONE 
Os02g0823800AK120318GCCCATTTConserved hypothetical protein. 
J075055J16GCCCATTTNONE 
Os02g0824900AK073217AGTGGGCCCATTTNONE 
AK103528AGTGGGCCCATTTConserved hypothetical protein. 
J090069J01AGTGGGCCCATTTNONE 
J090081B04AGTGGGCCCATTTNONE 
Os02g0829500016-020-D10AAATGGGCNONE 
AK064830AAATGGGCNONE 
AK065244AAATGGGCNONE 
AK104364AAATGGGCNONE 
AK104532AAATGGGCNONE 
AK122029AAATGGGCBeta-lactamase-like domain containing protein. 
J013000F10AAATGGGCNONE 
J013002I14AAATGGGCNONE 
J013104C08AAATGGGCNONE 
J013129D17AAATGGGCNONE 
J023001C18AAATGGGCNONE 
J033073L12AAATGGGCNONE 
J033112F11AAATGGGCNONE 
J043017J09AAATGGGCNONE 
J053080K12AAATGGGCNONE 
J053094B07AAATGGGCNONE 
J065195N12AAATGGGCNONE 
Os03g0125700009-132-G03AAATGGGCCTTAAAGCCCATTTNONE 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
J075046C16AAATGGGCCTTAAAGCCCATTTNONE 
J075115L05AAATGGGCCTTAAAGCCCATTTNONE 
J075143I05AAATGGGCCTTAAAGCCCATTTNONE 
J075197O07AAATGGGCCTTAAAGCCCATTTNONE 
Os03g0126300J065075F09GCCCATTTNONE 
J065135O11GCCCATTTNONE 
Os03g0127000AK068479AAGGCCCATTTConserved hypothetical protein. 
J013152D10AAGGCCCATTTNONE 
J075167I20AAGGCCCATTTNONE 
J090067O04AAGGCCCATTTNONE 
Os03g0130700AK110670TCCGGCCCATTTNONE 
Os03g0136900005-011-B09GCCCATTTNONE 
J065038L05GCCCATTTNONE 
Os03g0141200AK068968GCCCATTTSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092GCCCATTTNONE 
J023003L18GCCCATTTNONE 
J023022K18GCCCATTTNONE 
J023107H13GCCCATTTNONE 
J023107K02GCCCATTTNONE 
Os03g0143400AK073999AAAGCCCATTTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21AAAGCCCATTTNONE 
J033073C08AAAGCCCATTTNONE 
J033094C19AAAGCCCATTTNONE 
J065017L10AAAGCCCATTTNONE 
J065070H22AAAGCCCATTTNONE 
J065079M09AAAGCCCATTTNONE 
J065091N18AAAGCCCATTTNONE 
J065109N03AAAGCCCATTTNONE 
J065113F05AAAGCCCATTTNONE 
J065135D23AAAGCCCATTTNONE 
J065156L16AAAGCCCATTTNONE 
J065207O04AAAGCCCATTTNONE 
J065208F03AAAGCCCATTTNONE 
J090010M15AAAGCCCATTTNONE 
J090056J18AAAGCCCATTTNONE 
Os03g0143600AB110188AAATGGGCCGCNONE 
AK068424AAATGGGCCGCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464AAATGGGCCGCNONE 
AY224545AAATGGGCCGCNONE 
J013154F02AAATGGGCCGCNONE 
Os03g0145700AK065716AAATGGGCCGGTNONE 
J013039F14AAATGGGCCGGTNONE 
J013091M20AAATGGGCCGGTNONE 
J065059P20AAATGGGCCGGTNONE 
J065128M07AAATGGGCCGGTNONE 
J065136N23AAATGGGCCGGTNONE 
J065163H21AAATGGGCCGGTNONE 
J065176B18AAATGGGCCGGTNONE 
J065177A17AAATGGGCCGGTNONE 
J065201F24AAATGGGCCGGTNONE 
Os03g0168200AK099530AGCCCATTTConserved hypothetical protein. 
Os03g0210800J090024C01AAATGGGCNONE 
Os03g0253100AK119618TTCGGCCCATTTPhosphomevalonate kinase Erg8 family protein. 
J033052A14TTCGGCCCATTTNONE 
Os03g0257900009-150-G06AGCCCATTTNONE 
009-181-H05AGCCCATTTNONE 
AK063892AGCCCATTTNONE 
AK100114AGCCCATTTSimilar to Lectin-like receptor kinase 7;2. 
AK103486AGCCCATTTNONE 
J023006K11AGCCCATTTNONE 
J075005E15AGCCCATTTNONE 
J075007K24AGCCCATTTNONE 
J075034G06AGCCCATTTNONE 
J075051I19AGCCCATTTNONE 
J075076A08AGCCCATTTNONE 
J075096H04AGCCCATTTNONE 
J075115I09AGCCCATTTNONE 
J075132K23AGCCCATTTNONE 
J075147C17AGCCCATTTNONE 
J090059O20AGCCCATTTNONE 
Os03g0261800AK060717AAATGGGCACACACCNONE 
AK121181AAATGGGCACACACCConserved hypothetical protein. 
J023084D19AAATGGGCACACACCNONE 
J065127D11AAATGGGCACACACCNONE 
J065179G15AAATGGGCACACACCNONE 
J090050I07AAATGGGCACACACCNONE 
Os03g0268200AK069243AAATGGGCNONE 
AK099658AAATGGGCNONE 
AK101486AAATGGGCProtein kinase-like domain containing protein. 
AK121160AAATGGGCNONE 
J023010P21AAATGGGCNONE 
J023079P09AAATGGGCNONE 
J033041M21AAATGGGCNONE 
J065013H06AAATGGGCNONE 
J065024C01AAATGGGCNONE 
J065038G21AAATGGGCNONE 
J065062C15AAATGGGCNONE 
J090026J03AAATGGGCNONE 
J090080F03AAATGGGCNONE 
Os03g0282900006-088-H05TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK061166TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK102161TAATGGGCCTAGCCCATTTAGGCCCATTTConserved hypothetical protein. 
AK104514TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
Os03g0283300AK070169ATGGCCCAAGGGCCCATTTConserved hypothetical protein. 
Os03g0297100AK059192AAGGCCCATTTNONE 
AK122143AAGGCCCATTTNONE 
J023012D24AAGGCCCATTTNONE 
J023041A08AAGGCCCATTTNONE 
J033067H08AAGGCCCATTTNONE 
J033131K19AAGGCCCATTTNONE 
J033136J20AAGGCCCATTTNONE 
J053027D07AAGGCCCATTTNONE 
J065191B01AAGGCCCATTTNONE 
J075112A12AAGGCCCATTTNONE 
J075136D05AAGGCCCATTTNONE 
J090073P06AAGGCCCATTTNONE 
J100026B16AAGGCCCATTTNONE 
J100068P21AAGGCCCATTTNONE 
J100088C15AAGGCCCATTTNONE 
Os03g0300600003-125-G06AAATGGGCCTANONE 
006-048-C04AAATGGGCCTANONE 
009-044-A09AAATGGGCCTANONE 
AK059801AAATGGGCCTANONE 
AK066250AAATGGGCCTASimilar to Chaperone protein dnaJ. 
AK069897AAATGGGCCTANONE 
AK104186AAATGGGCCTANONE 
J065197D15AAATGGGCCTANONE 
J090031C11AAATGGGCCTANONE 
J100024C23AAATGGGCCTANONE 
J100030B16AAATGGGCCTANONE 
J100033K12AAATGGGCCTANONE 
J100043M19AAATGGGCCTANONE 
J100056N09AAATGGGCCTANONE 
J100058E12AAATGGGCCTANONE 
J100084J08AAATGGGCCTANONE 
Os03g0321800006-065-G02GTGGCCCATTTNONE 
AK061075GTGGCCCATTTNONE 
AK111447GTGGCCCATTTSimilar to WRKY transcription factor 55. 
J065122E07GTGGCCCATTTNONE 
J065187N05GTGGCCCATTTNONE 
J065214K09GTGGCCCATTTNONE 
J090050M01GTGGCCCATTTNONE 
Os03g0322500009-014-F03AAATGGGCNONE 
009-076-G10AAATGGGCNONE 
009-100-C01AAATGGGCNONE 
009-106-F02AAATGGGCNONE 
009-123-H11AAATGGGCNONE 
009-158-C09AAATGGGCNONE 
009-172-D04AAATGGGCNONE 
009-179-C11AAATGGGCNONE 
009-188-B12AAATGGGCNONE 
009-194-D07AAATGGGCNONE 
AK103503AAATGGGCNONE 
AK121029AAATGGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI). 
J013066O21AAATGGGCNONE 
J023050G22AAATGGGCNONE 
J023103H15AAATGGGCNONE 
J033075B11AAATGGGCNONE 
J033091E24AAATGGGCNONE 
J033098N14AAATGGGCNONE 
J053089B02AAATGGGCNONE 
J065039M05AAATGGGCNONE 
J065210G05AAATGGGCNONE 
J090036P06AAATGGGCNONE 
J090040M04AAATGGGCNONE 
Os03g0326200AK099837GCCCATTTNONE 
AK108821GCCCATTTSimilar to Phospholipid-transporting ATPase 1 (EC 3.6.3.1) (Aminophospholipid flippase 1). 
J065001D06GCCCATTTNONE 
J065037M19GCCCATTTNONE 
Os03g0327600014-081-C01AAATGGGCNONE 
AK069815AAATGGGCRicin B-related lectin domain containing protein. 
X95402AAATGGGCNONE 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0336600AK061202GCCCATTTReticulon family protein. 
AK103014GCCCATTTNONE 
AK104475GCCCATTTNONE 
J065166F12GCCCATTTNONE 
Os03g0363500AK062124AAATGGGCNONE 
AK066510AAATGGGCNONE 
J013068L16AAATGGGCNONE 
Os03g0390400009-175-E06TCCGGGCCCATTTNONE 
013-040-G01TCCGGGCCCATTTNONE 
014-050-G05TCCGGGCCCATTTNONE 
AB025187TCCGGGCCCATTTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TCCGGGCCCATTTNONE 
J013033A17TCCGGGCCCATTTNONE 
J023028J08TCCGGGCCCATTTNONE 
J023061N05TCCGGGCCCATTTNONE 
J023077A03TCCGGGCCCATTTNONE 
J023086E01TCCGGGCCCATTTNONE 
J033022A08TCCGGGCCCATTTNONE 
J033040F24TCCGGGCCCATTTNONE 
J075073I24TCCGGGCCCATTTNONE 
J075081H01TCCGGGCCCATTTNONE 
J075175N19TCCGGGCCCATTTNONE 
J100025M03TCCGGGCCCATTTNONE 
J100036J06TCCGGGCCCATTTNONE 
J100045O18TCCGGGCCCATTTNONE 
J100062G15TCCGGGCCCATTTNONE 
J100090N19TCCGGGCCCATTTNONE 
Os03g0574600009-151-F06AAGGCCCATTTNONE 
AK063006AAGGCCCATTTConserved hypothetical protein. 
AK104941AAGGCCCATTTNONE 
J065063L24AAGGCCCATTTNONE 
Os03g0584300009-018-H09AAATGGGCNONE 
AK105133AAATGGGCProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11AAATGGGCNONE 
Os03g0586800003-114-H11CCAGGCCCATTTNONE 
AK063765CCAGGCCCATTTSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302CCAGGCCCATTTNONE 
J090004H06CCAGGCCCATTTNONE 
J090022N15CCAGGCCCATTTNONE 
J100035E05CCAGGCCCATTTNONE 
J100041L05CCAGGCCCATTTNONE 
J100041M18CCAGGCCCATTTNONE 
J100057P04CCAGGCCCATTTNONE 
J100089H06CCAGGCCCATTTNONE 
J100090C23CCAGGCCCATTTNONE 
Os03g0604600J090093K23AGGGCCCATTTConserved hypothetical protein. 
Os03g0634000014-034-A03AGCCCATTTNONE 
AK063673AGCCCATTTSimilar to THA4. 
Os03g0639700AK099587GAGGCCCATTTSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0656900AK066416TACGGCCCATTTNusB/RsmB/TIM44 domain containing protein. 
J065157L23TACGGCCCATTTNONE 
J065166P22TACGGCCCATTTNONE 
Os03g0669000AK067769GCTGGGCCCATTTSimilar to RNA helicase (Fragment). 
AK099820GCTGGGCCCATTTNONE 
Os03g0701900AK068404AAATGGGCTTTTConserved hypothetical protein. 
Os03g0736700006-022-F08GCCCATTTNONE 
006-042-H09GCCCATTTNONE 
006-053-H02GCCCATTTNONE 
009-127-A06GCCCATTTNONE 
013-089-C06GCCCATTTNONE 
AK060947GCCCATTTGRAM domain containing protein. 
AK073026GCCCATTTNONE 
AK104415GCCCATTTNONE 
AK104642GCCCATTTNONE 
J065027H19GCCCATTTNONE 
J065059K06GCCCATTTNONE 
J065065I02GCCCATTTNONE 
J065085E10GCCCATTTNONE 
J065140M09GCCCATTTNONE 
J075115M21GCCCATTTNONE 
Os03g0744700AK071178TCCGGCCCATTTConserved hypothetical protein. 
J075006D24TCCGGCCCATTTNONE 
J075165F21TCCGGCCCATTTNONE 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0752000AK121199AAATGGGCConserved hypothetical protein. 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0761200011-038-H02AAATGGGCCGGAAAATGGGCCNONE 
015-055-D12AAATGGGCCGGAAAATGGGCCNONE 
016-032-B01AAATGGGCCGGAAAATGGGCCNONE 
AK064205AAATGGGCCGGAAAATGGGCCNONE 
AK101534AAATGGGCCGGAAAATGGGCCAnkyrin repeat containing protein. 
J075033L23AAATGGGCCGGAAAATGGGCCNONE 
J075046K09AAATGGGCCGGAAAATGGGCCNONE 
J075134K18AAATGGGCCGGAAAATGGGCCNONE 
J075157I10AAATGGGCCGGAAAATGGGCCNONE 
Os03g0766900AK066137TCCGGCCCATTTAllene oxide synthase. 
AK071361TCCGGCCCATTTNONE 
AK103989TCCGGCCCATTTNONE 
J023090K09TCCGGCCCATTTNONE 
J043022H11TCCGGCCCATTTNONE 
J053078F12TCCGGCCCATTTNONE 
Os03g0784400AK103474AAATGGGCCCAATTProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAATGGGCCCAATTNONE 
J033130D12AAATGGGCCCAATTNONE 
J043035E20AAATGGGCCCAATTNONE 
J065206K15AAATGGGCCCAATTNONE 
J075053J20AAATGGGCCCAATTNONE 
J075129B11AAATGGGCCCAATTNONE 
J090003E22AAATGGGCCCAATTNONE 
J100023E23AAATGGGCCCAATTNONE 
Os03g0792800015-057-G07AAATGGGCNONE 
J023112L23AAATGGGCNONE 
J023146L23AAATGGGCNONE 
J033115D17AAATGGGCGlycoside hydrolase, family 17 protein. 
J090009C02AAATGGGCNONE 
J090078D21AAATGGGCNONE 
Os03g0798600AK121716AAATGGGCCAGSimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18AAATGGGCCAGNONE 
J033079G18AAATGGGCCAGNONE 
J043038B19AAATGGGCCAGNONE 
J065091E15AAATGGGCCAGNONE 
J065092P10AAATGGGCCAGNONE 
J065189F18AAATGGGCCAGNONE 
J065189L12AAATGGGCCAGNONE 
J075021B11AAATGGGCCAGNONE 
J075022L15AAATGGGCCAGNONE 
J075046G12AAATGGGCCAGNONE 
J075080H15AAATGGGCCAGNONE 
J090045H01AAATGGGCCAGNONE 
J090077H16AAATGGGCCAGNONE 
J090083D22AAATGGGCCAGNONE 
J100021D24AAATGGGCCAGNONE 
J100023G04AAATGGGCCAGNONE 
J100049J23AAATGGGCCAGNONE 
J100075K23AAATGGGCCAGNONE 
J100077G22AAATGGGCCAGNONE 
Os03g0809300011-024-C02AAAGCCCATTTNONE 
016-071-E09AAAGCCCATTTNONE 
AK103140AAAGCCCATTTProtein phosphatase 2C-like domain containing protein. 
J013030O08AAAGCCCATTTNONE 
J013108D19AAAGCCCATTTNONE 
J013124D15AAAGCCCATTTNONE 
J013128F17AAAGCCCATTTNONE 
J013146J06AAAGCCCATTTNONE 
J013149D12AAAGCCCATTTNONE 
J013154P12AAAGCCCATTTNONE 
J013162N01AAAGCCCATTTNONE 
J013170G15AAAGCCCATTTNONE 
J013170H16AAAGCCCATTTNONE 
J023022I09AAAGCCCATTTNONE 
J023072B19AAAGCCCATTTNONE 
J023106H09AAAGCCCATTTNONE 
J023135C03AAAGCCCATTTNONE 
J023141C09AAAGCCCATTTNONE 
J033091K23AAAGCCCATTTNONE 
J033107I05AAAGCCCATTTNONE 
J033112M18AAAGCCCATTTNONE 
J033120G10AAAGCCCATTTNONE 
J033144G06AAAGCCCATTTNONE 
J043017L21AAAGCCCATTTNONE 
J043024O10AAAGCCCATTTNONE 
J053023K04AAAGCCCATTTNONE 
J053035D01AAAGCCCATTTNONE 
J053037P10AAAGCCCATTTNONE 
J053042K15AAAGCCCATTTNONE 
J053047C14AAAGCCCATTTNONE 
J053054A06AAAGCCCATTTNONE 
J053071H03AAAGCCCATTTNONE 
J053073G08AAAGCCCATTTNONE 
J053090D04AAAGCCCATTTNONE 
J053095E17AAAGCCCATTTNONE 
J090007O03AAAGCCCATTTNONE 
J090024G24AAAGCCCATTTNONE 
J090042M08AAAGCCCATTTNONE 
J090045I16AAAGCCCATTTNONE 
J090051E13AAAGCCCATTTNONE 
J090073B15AAAGCCCATTTNONE 
J090096F19AAAGCCCATTTNONE 
J100030M23AAAGCCCATTTNONE 
Os03g0809700J023093B03AAATGGGCCAANONE 
Os03g0824500AK058990TCATGGGCCCATTTConserved hypothetical protein. 
J065057L18TCATGGGCCCATTTNONE 
J065083L02TCATGGGCCCATTTNONE 
J065086L24TCATGGGCCCATTTNONE 
J065121L10TCATGGGCCCATTTNONE 
J065168N03TCATGGGCCCATTTNONE 
J100035J22TCATGGGCCCATTTNONE 
J100050G18TCATGGGCCCATTTNONE 
J100055F15TCATGGGCCCATTTNONE 
Os03g0828100009-088-D04AAATGGGCCAANONE 
009-125-F01AAATGGGCCAANONE 
009-169-C06AAATGGGCCAANONE 
AK059132AAATGGGCCAANONE 
AK062799AAATGGGCCAANONE 
AK099043AAATGGGCCAASimilar to 50S ribosomal protein L18. 
J013146D01AAATGGGCCAANONE 
J065057J16AAATGGGCCAANONE 
Os03g0833900AK073655AAATGGGCCCTSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800AAATGGGCCCTNONE 
AK104068AAATGGGCCCTNONE 
J075031J11AAATGGGCCCTNONE 
J075051N01AAATGGGCCCTNONE 
J075166D18AAATGGGCCCTNONE 
J075171E14AAATGGGCCCTNONE 
Os03g0834000AB080084GAGGCCCATTTFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB088391GAGGCCCATTTNONE 
AK062149GAGGCCCATTTNONE 
AK069540GAGGCCCATTTNONE 
J013047J01GAGGCCCATTTNONE 
J023019F12GAGGCCCATTTNONE 
J043004H21GAGGCCCATTTNONE 
Os03g0835400AK061773TCCGGCCCATTTSimilar to Uvs101. 
AK098986TCCGGCCCATTTNONE 
AK105896TCCGGCCCATTTNONE 
Os03g0837300AK111243TTCGGCCCATTTNONE 
AK121140TTCGGCCCATTTNicotinate phosphoribosyltransferase and related family protein. 
AY214337TTCGGCCCATTTNONE 
J023077G12TTCGGCCCATTTNONE 
J023078M10TTCGGCCCATTTNONE 
J033031B10TTCGGCCCATTTNONE 
J033067L18TTCGGCCCATTTNONE 
J043005P09TTCGGCCCATTTNONE 
J090013J15TTCGGCCCATTTNONE 
J090042E10TTCGGCCCATTTNONE 
J090045A20TTCGGCCCATTTNONE 
J100022H02TTCGGCCCATTTNONE 
Os03g0844600AK059168TTGGCCCATTTLipolytic enzyme, G-D-S-L family protein. 
Os03g0847500AK073859AAATGGGCCGTGGSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0851900AK102145TAGGCCCATTTAFG1-like ATPase family protein. 
J033086B08TAGGCCCATTTNONE 
Os03g0860600AK071828CCCGGCCCATTTSimilar to 2-oxoglutarate-dependent oxygenase. 
J023118E08CCCGGCCCATTTNONE 
J100032J11CCCGGCCCATTTNONE 
Os04g0105700004-005-E05AAATGGGCCTANONE 
006-037-C11AAATGGGCCTANONE 
006-039-E07AAATGGGCCTANONE 
006-049-A02AAATGGGCCTANONE 
006-076-D05AAATGGGCCTANONE 
006-089-E04AAATGGGCCTANONE 
006-097-F12AAATGGGCCTANONE 
AK060872AAATGGGCCTANONE 
AK065082AAATGGGCCTANONE 
AK104254AAATGGGCCTAConserved hypothetical protein. 
AK104546AAATGGGCCTANONE 
AK104634AAATGGGCCTANONE 
AY224557AAATGGGCCTANONE 
J013001L09AAATGGGCCTANONE 
J013151B18AAATGGGCCTANONE 
J023054G18AAATGGGCCTANONE 
Os04g0258900009-146-B02CCCGGCCCATTTNONE 
AK062983CCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0395600011-002-A05GCCCATTTNONE 
011-009-C09GCCCATTTNONE 
AK072338GCCCATTTSimilar to TRANSPORT INHIBITOR RESPONSE 1 protein (F-box/LRR-repeat protein 1). 
AK100862GCCCATTTNONE 
J023123O09GCCCATTTNONE 
Os04g0401700AJ427970GCCCATTTNONE 
AK100669GCCCATTTNONE 
AK101722GCCCATTTNONE 
AK119883GCCCATTTPotassium transporter 1 (OsHAK1). Splice isoform 2. 
AK119891GCCCATTTNONE 
AY324878GCCCATTTNONE 
J033061B08GCCCATTTNONE 
J043024L09GCCCATTTNONE 
J065039D24GCCCATTTNONE 
J065178I21GCCCATTTNONE 
J075149G12GCCCATTTNONE 
J075173J10GCCCATTTNONE 
J090061H21GCCCATTTNONE 
J100023C11GCCCATTTNONE 
J100031C06GCCCATTTNONE 
J100041B05GCCCATTTNONE 
J100042B11GCCCATTTNONE 
J100043K17GCCCATTTNONE 
J100045J07GCCCATTTNONE 
J100081F11GCCCATTTNONE 
J100085N11GCCCATTTNONE 
J100088C14GCCCATTTNONE 
J100090F23GCCCATTTNONE 
Os04g0418000006-025-C05AAACGGCCCATTTNONE 
006-025-D11AAACGGCCCATTTNONE 
006-045-F02AAACGGCCCATTTNONE 
006-060-B04AAACGGCCCATTTNONE 
006-063-E03AAACGGCCCATTTNONE 
006-070-G08AAACGGCCCATTTNONE 
006-072-H05AAACGGCCCATTTNONE 
AK061030AAACGGCCCATTTNONE 
AK099124AAACGGCCCATTTNONE 
AK106155AAACGGCCCATTTConserved hypothetical protein. 
AK119714AAACGGCCCATTTNONE 
J023039I07AAACGGCCCATTTNONE 
J065025N03AAACGGCCCATTTNONE 
Os04g0450200006-064-F01GCCCATTTNONE 
AK061063GCCCATTTPentatricopeptide repeat containing protein. 
Os04g0462900006-094-A02AGCCCATTTNONE 
006-097-F05AGCCCATTTNONE 
009-129-A10AGCCCATTTNONE 
015-042-F07AGCCCATTTNONE 
AK058481AGCCCATTTNONE 
AK059483AGCCCATTTNONE 
AK061324AGCCCATTTNONE 
AK099100AGCCCATTTNONE 
AK102579AGCCCATTTNONE 
AK106322AGCCCATTTSimilar to Prohibitin. 
J065059J20AGCCCATTTNONE 
J065085I02AGCCCATTTNONE 
J065118N23AGCCCATTTNONE 
J065208K24AGCCCATTTNONE 
J075053B14AGCCCATTTNONE 
J075097M22AGCCCATTTNONE 
J075184B07AGCCCATTTNONE 
J075194A15AGCCCATTTNONE 
J080315G03AGCCCATTTNONE 
J090088H19AGCCCATTTNONE 
Os04g0473400AK067896AAATGGGCCAASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20AAATGGGCCAANONE 
J033108A09AAATGGGCCAANONE 
J065196E24AAATGGGCCAANONE 
J100066B16AAATGGGCCAANONE 
Os04g0530000009-106-E11TCGGCCCATTTNONE 
011-012-E12TCGGCCCATTTNONE 
AK066169TCGGCCCATTTConserved hypothetical protein. 
J013052P20TCGGCCCATTTNONE 
J090060G12TCGGCCCATTTNONE 
J100073H10TCGGCCCATTTNONE 
Os04g0555900009-154-G03AAATGGGCTNONE 
AK063168AAATGGGCTPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11AAATGGGCTNONE 
Os04g0556900015-052-H08AAATGGGCTNONE 
AK064112AAATGGGCTConserved hypothetical protein. 
Os04g0562000006-096-A05AAATGGGCCGGANONE 
006-105-B08AAATGGGCCGGANONE 
AK060894AAATGGGCCGGANONE 
AK072630AAATGGGCCGGAZinc finger, DHHC-type domain containing protein. 
AK104521AAATGGGCCGGANONE 
J023038A11AAATGGGCCGGANONE 
J023130P03AAATGGGCCGGANONE 
J090006F10AAATGGGCCGGANONE 
J090007M22AAATGGGCCGGANONE 
Os04g0592500AK066893AAATGGGCTPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18AAATGGGCTNONE 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0625600AK070994AAATGGGCTTRAF-like domain containing protein. 
J023080H04AAATGGGCTNONE 
J023086H15AAATGGGCTNONE 
J033037L21AAATGGGCTNONE 
J033044P14AAATGGGCTNONE 
J065075C23AAATGGGCTNONE 
J065167C18AAATGGGCTNONE 
J100024E02AAATGGGCTNONE 
J100068N24AAATGGGCTNONE 
J100070G20AAATGGGCTNONE 
Os04g0636400006-064-G07AAATGGGCCGTGGNONE 
006-097-D05AAATGGGCCGTGGNONE 
AK061848AAATGGGCCGTGGSimilar to Senescence-associated protein 6. 
AK099573AAATGGGCCGTGGNONE 
J013035J20AAATGGGCCGTGGNONE 
Os04g0643700AK072261GCCCATTTNONE 
AK101087GCCCATTTProtein prenyltransferase domain containing protein. 
AK108565GCCCATTTNONE 
J033024K07GCCCATTTNONE 
Os04g0647800AK065350AAATGGGCSimilar to Glycerol kinase 2 (EC 2.7.1.30). 
AK069876AAATGGGCNONE 
AK104069AAATGGGCNONE 
Os04g0658200J075021C22AAATGGGCTGCConserved hypothetical protein. 
Os04g0659000009-172-A09ATGGCCCATTTNONE 
AK063095ATGGCCCATTTConserved hypothetical protein. 
J065062J07ATGGCCCATTTNONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0677800AK102572GCCCATTTZinc finger, RanBP2-type domain containing protein. 
AK110947GCCCATTTNONE 
Os04g0678800AK072212AAATGGGCCGAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065AAATGGGCCGANONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os05g0103100AK103317AAATGGGCTGATGGGCTranslocon-associated beta family protein. 
J033125H15AAATGGGCTGATGGGCNONE 
J065021L01AAATGGGCTGATGGGCNONE 
J065029M01AAATGGGCTGATGGGCNONE 
J065089F17AAATGGGCTGATGGGCNONE 
J065112N04AAATGGGCTGATGGGCNONE 
J065163L03AAATGGGCTGATGGGCNONE 
J065175B04AAATGGGCTGATGGGCNONE 
J065192E02AAATGGGCTGATGGGCNONE 
J075046C20AAATGGGCTGATGGGCNONE 
J075192A01AAATGGGCTGATGGGCNONE 
J100018H13AAATGGGCTGATGGGCNONE 
J100067K20AAATGGGCTGATGGGCNONE 
J100080N03AAATGGGCTGATGGGCNONE 
Os05g0128100009-051-B07ACAGCCCATTTNONE 
009-127-B08ACAGCCCATTTNONE 
009-144-H03ACAGCCCATTTNONE 
009-176-B05ACAGCCCATTTNONE 
AK108556ACAGCCCATTTNONE 
AK119308ACAGCCCATTTNONE 
AK120934ACAGCCCATTTConserved hypothetical protein. 
J023036J15ACAGCCCATTTNONE 
J065122L01ACAGCCCATTTNONE 
J075104P10ACAGCCCATTTNONE 
Os05g0132800AK108629AAATGGGCTConserved hypothetical protein. 
Os05g0152400Os05g0152400AAATGGGCCACGlycosyl transferase, family 14 protein. 
Os05g0169400AK073439AAATGGGCCGAAProtein of unknown function DUF1421 family protein. 
J013110E15AAATGGGCCGAANONE 
J033044H02AAATGGGCCGAANONE 
Os05g0196700AK069743GCCCATTTConserved hypothetical protein. 
Os05g0223300AK069616ACCGGCCCATTTSimilar to RNA-binding protein. 
J080093O15ACCGGCCCATTTNONE 
J090061N02ACCGGCCCATTTNONE 
Os05g0325200J090038J19GGGCTGGGCGGCCCATTTGGGCCyclin-like domain containing protein. 
Os05g0364300009-036-C07GCCCATTTNONE 
AK062440GCCCATTTConserved hypothetical protein. 
Os05g0378900AK103841TCGGCCCATTTConserved hypothetical protein. 
J033148I18TCGGCCCATTTNONE 
J065085F12TCGGCCCATTTNONE 
J075041H24TCGGCCCATTTNONE 
J075180P06TCGGCCCATTTNONE 
Os05g0435400AK109595TAGGCCCATTTConserved hypothetical protein. 
Os05g0443300Os05g0443300AAATGGGCCTGASec23/Sec24 trunk region domain containing protein. 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK111268AAGGCCCATTTAGCCCAGCCCNONE 
J013129N08AAGGCCCATTTAGCCCAGCCCNONE 
J065191E01AAGGCCCATTTAGCCCAGCCCNONE 
J065216P03AAGGCCCATTTAGCCCAGCCCNONE 
J075089K21AAGGCCCATTTAGCCCAGCCCNONE 
Os05g0469900AK109700AAATGGGCTGGGConserved hypothetical protein. 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0497300009-074-C05GCCCATTTNONE 
AK111755GCCCATTTSimilar to Ethylene response factor 2. 
AY576527GCCCATTTNONE 
J023061G02GCCCATTTNONE 
J075112G23GCCCATTTNONE 
Os05g0512500009-036-D05AAATGGGCTTCNONE 
AK062441AAATGGGCTTCCT20 family protein. 
J080003C10AAATGGGCTTCNONE 
J080046G11AAATGGGCTTCNONE 
Os05g0542600AK060408AGCCCATTTNONE 
AK101373AGCCCATTTMov34/MPN/PAD-1 family protein. 
J023081F17AGCCCATTTNONE 
J033035N15AGCCCATTTNONE 
J033124K20AGCCCATTTNONE 
Os05g0554100AK073023AAATGGGCCCTRibosomal protein L7/L12 family protein. 
AK101756AAATGGGCCCTNONE 
Os05g0559900AK067197AAATGGGCCTAtRNA-binding arm domain containing protein. 
J013074C15AAATGGGCCTANONE 
J013098O16AAATGGGCCTANONE 
J033030M01AAATGGGCCTANONE 
J090058H12AAATGGGCCTANONE 
J090075M06AAATGGGCCTANONE 
Os05g0567500AK073046AAATGGGCCTCNONE 
AK121133AAATGGGCCTCDNA glycosylase family protein. 
J023075P20AAATGGGCCTCNONE 
Os05g0577900016-028-C02TGTGGGCCCATTTNONE 
AK064201TGTGGGCCCATTTConserved hypothetical protein. 
Os05g0588200AK109323TTGGCCCATTTRuvA domain 2-like containing protein. 
Os06g0106100009-197-E09CTGGGCTGGCCCATTTNONE 
AK111784CTGGGCTGGCCCATTTCwf15/Cwc15 cell cycle control protein family protein. 
AK112060CTGGGCTGGCCCATTTNONE 
Os06g0132600006-104-C03TAGGCCCATTTNONE 
AK061226TAGGCCCATTTConserved hypothetical protein. 
AK074010TAGGCCCATTTNONE 
J033076A22TAGGCCCATTTNONE 
Os06g0134300AK071534AAATGGGCTConserved hypothetical protein. 
J023106E03AAATGGGCTNONE 
J075172D02AAATGGGCTNONE 
J100047B13AAATGGGCTNONE 
Os06g0156900AK110688TAGGCCCATTTGlycosyl transferase, family 31 protein. 
Os06g0172000AK068738AAATGGGCCCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0225200005-009-B07AAATGGGCCGTTNONE 
AK067095AAATGGGCCGTTMitochodrial transcription termination factor-related family protein. 
AK104692AAATGGGCCGTTNONE 
J013096A05AAATGGGCCGTTNONE 
J090092C03AAATGGGCCGTTNONE 
Os06g0257200J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
Os06g0258900AK060181GCCCATTTNONE 
Os06g0326900009-065-B02GCCCATTTNONE 
J075145I05GCCCATTTProtein of unknown function DUF296 domain containing protein. 
Os06g0542200AK058589AGCCCATTTNADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0555500016-056-B08AAATGGGCCGTANONE 
AK102375AAATGGGCCGTANONE 
AK106546AAATGGGCCGTAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08AAATGGGCCGTANONE 
J033091P04AAATGGGCCGTANONE 
J090082P16AAATGGGCCGTANONE 
Os06g0561200AK120422AAATGGGCCCTSimilar to Potassium/proton antiporter-like protein. 
Os06g0601000AK071330AAATGGGCCCAGAHomeodomain-like containing protein. 
AY224485AAATGGGCCCAGANONE 
Os06g0603400AK060002AGCCCATTTNONE 
AK102325AGCCCATTTNONE 
AK106905AGCCCATTTSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22AGCCCATTTNONE 
J100022N15AGCCCATTTNONE 
J100023E09AGCCCATTTNONE 
J100052D21AGCCCATTTNONE 
Os06g0607800012-010-G03AAATGGGCCAANONE 
012-010-G03AAATGGGCTGANONE 
AB070254AAATGGGCCAANONE 
AB070254AAATGGGCTGANONE 
AK063158AAATGGGCCAASimilar to 26S proteasome regulatory complex subunit p42D. 
AK063158AAATGGGCTGASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AAATGGGCCAANONE 
AK066695AAATGGGCTGANONE 
J013074G13AAATGGGCCAANONE 
J013074G13AAATGGGCTGANONE 
J090015C16AAATGGGCCAANONE 
J090015C16AAATGGGCTGANONE 
J090069H10AAATGGGCCAANONE 
J090069H10AAATGGGCTGANONE 
Os06g0646600AB061818AAATGGGCTKNOX family class 2 homeodomain protein. 
J023088C09AAATGGGCTNONE 
J065162G03AAATGGGCTNONE 
Os06g0656800AK109762GCGGCCCATTTBeta-Ig-H3/fasciclin domain containing protein. 
Os06g0676700009-185-F09GCCCATTTNONE 
AK063175GCCCATTTNONE 
AK105449GCCCATTTSimilar to High pI alpha-glucosidase. 
AK121588GCCCATTTNONE 
Os06g0682800011-092-E01GAGGCCCATTTNONE 
AK064816GAGGCCCATTTZinc finger, CCCH-type domain containing protein. 
J013000E13GAGGCCCATTTNONE 
J013035J22GAGGCCCATTTNONE 
J013045M06GAGGCCCATTTNONE 
J013120A07GAGGCCCATTTNONE 
J033144H15GAGGCCCATTTNONE 
J033145H15GAGGCCCATTTNONE 
J033145N16GAGGCCCATTTNONE 
J090019J02GAGGCCCATTTNONE 
Os06g0683200AK060024GAGGCCCATTTSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432GAGGCCCATTTNONE 
J023002B12GAGGCCCATTTNONE 
J023054E10GAGGCCCATTTNONE 
J023123F19GAGGCCCATTTNONE 
J065035K13GAGGCCCATTTNONE 
J065129P09GAGGCCCATTTNONE 
J065184B14GAGGCCCATTTNONE 
Os06g0708900AK100402AAATGGGCCGAConserved hypothetical protein. 
Os06g0712500AK068531AAATGGGCCTASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
AK068531AAATGGGCTTTTSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0714800006-033-C09AGGGCCCATTTNONE 
006-042-G10AGGGCCCATTTNONE 
006-081-G10AGGGCCCATTTNONE 
006-120-F12AGGGCCCATTTNONE 
009-149-F08AGGGCCCATTTNONE 
AK059793AGGGCCCATTTProtein of unknown function DUF581 family protein. 
AK071528AGGGCCCATTTNONE 
J023102E22AGGGCCCATTTNONE 
J065099H06AGGGCCCATTTNONE 
J065127G22AGGGCCCATTTNONE 
J075089J03AGGGCCCATTTNONE 
J075109B02AGGGCCCATTTNONE 
J075179K22AGGGCCCATTTNONE 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os06g0731800012-049-D10AAATGGGCCGAANONE 
AK069288AAATGGGCCGAAClathrin light chain family protein. 
J023014P04AAATGGGCCGAANONE 
J023058N12AAATGGGCCGAANONE 
J053035L13AAATGGGCCGAANONE 
J065097L21AAATGGGCCGAANONE 
J065099F07AAATGGGCCGAANONE 
J065144L02AAATGGGCCGAANONE 
J065161J11AAATGGGCCGAANONE 
J065181N05AAATGGGCCGAANONE 
J075087D09AAATGGGCCGAANONE 
J075088H19AAATGGGCCGAANONE 
J075116E21AAATGGGCCGAANONE 
J075147K03AAATGGGCCGAANONE 
J090083H22AAATGGGCCGAANONE 
J100079M09AAATGGGCCGAANONE 
Os07g0105300AK107419CACGGCCCATTTConserved hypothetical protein. 
AK109521CACGGCCCATTTNONE 
Os07g0112800AK058206CCCGGCCCATTTSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13CCCGGCCCATTTNONE 
J033064G11CCCGGCCCATTTNONE 
J065044F12CCCGGCCCATTTNONE 
J065047I05CCCGGCCCATTTNONE 
J065059P17CCCGGCCCATTTNONE 
J065180P17CCCGGCCCATTTNONE 
J075131M22CCCGGCCCATTTNONE 
Os07g0124500012-092-F01GAGGCCCATTTNONE 
AK070529GAGGCCCATTTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GAGGCCCATTTNONE 
J090007O11GAGGCCCATTTNONE 
J090010E02GAGGCCCATTTNONE 
J090078C04GAGGCCCATTTNONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0133700J065005A21AAATGGGCTAATTGGGCCTTHypothetical protein. 
J065096D02AAATGGGCTAATTGGGCCTTNONE 
J065097G13AAATGGGCTAATTGGGCCTTNONE 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0158900AK064980GGCCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os07g0213400003-104-B01AAATGGGCNONE 
AK062273AAATGGGCConserved hypothetical protein. 
J065122P17AAATGGGCNONE 
J065160A01AAATGGGCNONE 
J090065M11AAATGGGCNONE 
Os07g0242600AK065752AGCCCATTTAAGCCCACACyclin-like F-box domain containing protein. 
J013037K22AGCCCATTTAAGCCCACANONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0408100AK108466TCCGGCCCATTTNONE 
AK111780TCCGGCCCATTTWD40-like domain containing protein. 
Os07g0435400AK111603AAATGGGCCAASimilar to WD40. 
Os07g0472400AK105684GCTGGGCCAAATGGGCProtein kinase domain containing protein. 
Os07g0486000AK069343AAATGGGCCCAGGCCCSimilar to MSH4. 
Os07g0507300015-011-B09AGCCCATTTNONE 
AK102538AGCCCATTTSimilar to GCK-like kinase MIK. 
AK106514AGCCCATTTNONE 
J033033M12AGCCCATTTNONE 
J033044C06AGCCCATTTNONE 
J033129B15AGCCCATTTNONE 
Os07g0535100AK100978GCCCATTTCyclin-like F-box domain containing protein. 
J075005D04GCCCATTTNONE 
J075137I02GCCCATTTNONE 
J075183B17GCCCATTTNONE 
J090084L09GCCCATTTNONE 
J100052C02GCCCATTTNONE 
Os07g0555400AK070977GCTGGGCCGGGCCGCCCATTTConserved hypothetical protein. 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0598300AK073674AAAAGCCCGCCCATTTDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK101648AAAAGCCCGCCCATTTNONE 
AK122151AAAAGCCCGCCCATTTNONE 
J090007H05AAAAGCCCGCCCATTTNONE 
J090066O03AAAAGCCCGCCCATTTNONE 
Os07g0606500AK068811ATCTCGGCCCATTTNONE 
AK121873ATCTCGGCCCATTTNONE 
J013159C05ATCTCGGCCCATTTNONE 
J075158B14ATCTCGGCCCATTTNONE 
Os07g0607200AK065746ACCGGCCCATTTProtein of unknown function DUF751 family protein. 
J065037B15ACCGGCCCATTTNONE 
J065042E20ACCGGCCCATTTNONE 
J065161I08ACCGGCCCATTTNONE 
Os07g0639800AK074012AAATGGGCCGCASimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592AAATGGGCCGCANONE 
AK104739AAATGGGCCGCANONE 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0107500013-094-H02GCGGCCCATTTNONE 
013-095-E07GCGGCCCATTTNONE 
AK064053GCGGCCCATTTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418GCGGCCCATTTNONE 
J033037P14GCGGCCCATTTNONE 
J090025I15GCGGCCCATTTNONE 
J100022F23GCGGCCCATTTNONE 
Os08g0113800J033069I12AAAAGCCCATTTNONE 
J053050I07AAAAGCCCATTTNONE 
J065006J11AAAAGCCCATTTNONE 
J065013D02AAAAGCCCATTTNONE 
J065055L24AAAAGCCCATTTNONE 
J065071I11AAAAGCCCATTTConserved hypothetical protein. 
J065093G12AAAAGCCCATTTNONE 
J065101N03AAAAGCCCATTTNONE 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0150800AK101530AAATGGGCTCGGCCCACASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0158900AK067062AAATGGGCCCGCAGTP1/OBG domain containing protein. 
J013089F04AAATGGGCCCGCANONE 
J013092D16AAATGGGCCCGCANONE 
J033120K14AAATGGGCCCGCANONE 
J033133F24AAATGGGCCCGCANONE 
J033145A10AAATGGGCCCGCANONE 
J033145A11AAATGGGCCCGCANONE 
J053048H24AAATGGGCCCGCANONE 
J053075H10AAATGGGCCCGCANONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0322400AK120116AAATGGGCTTGGNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20AAATGGGCTTGGNONE 
J013096J15AAATGGGCTTGGNONE 
Os08g0323000AK064573AAATGGGCConserved hypothetical protein. 
Os08g0328300AK102227GGCCCGGCCCATTTNONE 
AK105392GGCCCGGCCCATTTENT domain containing protein. 
Os08g0366000AK061683AAATGGGCNONE 
J075038P08AAATGGGCNONE 
J075078A19AAATGGGCNONE 
J075116L15AAATGGGCNONE 
J075117E22AAATGGGCNONE 
J075118D04AAATGGGCNONE 
J075139A08AAATGGGCNONE 
J075175J19AAATGGGCNONE 
J075197N24AAATGGGCNONE 
Os08g0412100AK072641AAATGGGCCGTCDisease resistance protein family protein. 
Os08g0412200006-028-H07AAATGGGCCAANONE 
AJ575234AAATGGGCCAANONE 
AK059631AAATGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAATGGGCCAANONE 
AK104578AAATGGGCCAANONE 
J033071L08AAATGGGCCAANONE 
J065197K18AAATGGGCCAANONE 
Os08g0431500009-186-D05GGCCCGGCCCATTTNONE 
AK058993GGCCCGGCCCATTTNONE 
AK100797GGCCCGGCCCATTTConserved hypothetical protein. 
J023121F15GGCCCGGCCCATTTNONE 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
Os08g0493900AK101284AAATGGGCCGGANONE 
AK111820AAATGGGCCGGAWD40-like domain containing protein. 
Os08g0522500006-026-A04AAATGGGCCTTNONE 
006-037-B02AAATGGGCCTTNONE 
006-047-E11AAATGGGCCTTNONE 
015-049-E10AAATGGGCCTTNONE 
AK060080AAATGGGCCTTNONE 
AK102814AAATGGGCCTTNONE 
AK104718AAATGGGCCTTNONE 
AK106190AAATGGGCCTTGlycoside hydrolase, family 19 protein. 
J013068H02AAATGGGCCTTNONE 
J033108M05AAATGGGCCTTNONE 
J033116M13AAATGGGCCTTNONE 
J065211H04AAATGGGCCTTNONE 
J075195H03AAATGGGCCTTNONE 
J075195I24AAATGGGCCTTNONE 
Os08g0530200009-166-A09AAATGGGCCTANONE 
AK062052AAATGGGCCTANONE 
AK120448AAATGGGCCTASimilar to 60S ribosomal protein L17. 
J013100M19AAATGGGCCTANONE 
J023045K22AAATGGGCCTANONE 
J033046D13AAATGGGCCTANONE 
J033066N01AAATGGGCCTANONE 
J033143N05AAATGGGCCTANONE 
J053070P13AAATGGGCCTANONE 
J065011C18AAATGGGCCTANONE 
J065013C23AAATGGGCCTANONE 
J065016B09AAATGGGCCTANONE 
J065016C21AAATGGGCCTANONE 
J065023K18AAATGGGCCTANONE 
J065028F12AAATGGGCCTANONE 
J065030L02AAATGGGCCTANONE 
J065042H15AAATGGGCCTANONE 
J065078H02AAATGGGCCTANONE 
J065092D07AAATGGGCCTANONE 
J065092E01AAATGGGCCTANONE 
J065104M21AAATGGGCCTANONE 
J065119P21AAATGGGCCTANONE 
J065124B15AAATGGGCCTANONE 
J065146H09AAATGGGCCTANONE 
J065149L09AAATGGGCCTANONE 
J065156A09AAATGGGCCTANONE 
J065157H23AAATGGGCCTANONE 
J065165L14AAATGGGCCTANONE 
J065165M18AAATGGGCCTANONE 
J065172O03AAATGGGCCTANONE 
J065192M18AAATGGGCCTANONE 
J065198D21AAATGGGCCTANONE 
J065200D05AAATGGGCCTANONE 
J065202B20AAATGGGCCTANONE 
J065212P11AAATGGGCCTANONE 
J065215E08AAATGGGCCTANONE 
J065217P19AAATGGGCCTANONE 
J075005I19AAATGGGCCTANONE 
J075134J06AAATGGGCCTANONE 
J075162G12AAATGGGCCTANONE 
J075178H07AAATGGGCCTANONE 
J075186K01AAATGGGCCTANONE 
J080315I17AAATGGGCCTANONE 
J080318P19AAATGGGCCTANONE 
J090004H16AAATGGGCCTANONE 
J090020A16AAATGGGCCTANONE 
J090047J12AAATGGGCCTANONE 
J090080E07AAATGGGCCTANONE 
J090090H23AAATGGGCCTANONE 
J100021G24AAATGGGCCTANONE 
J100037L04AAATGGGCCTANONE 
J100043L09AAATGGGCCTANONE 
J100044A10AAATGGGCCTANONE 
Os08g0557100AK070743AAATGGGCCGGANONE 
AK101214AAATGGGCCGGASimilar to Nucleic acid-binding protein precursor. 
AK105901AAATGGGCCGGANONE 
J033031B04AAATGGGCCGGANONE 
J080004F08AAATGGGCCGGANONE 
J080004H12AAATGGGCCGGANONE 
J080005H08AAATGGGCCGGANONE 
J080005I02AAATGGGCCGGANONE 
J080008N16AAATGGGCCGGANONE 
J080009H23AAATGGGCCGGANONE 
J080012H17AAATGGGCCGGANONE 
J080012J21AAATGGGCCGGANONE 
J080013I20AAATGGGCCGGANONE 
J080016E07AAATGGGCCGGANONE 
J080018O04AAATGGGCCGGANONE 
J080020B18AAATGGGCCGGANONE 
J080021I16AAATGGGCCGGANONE 
J080022N01AAATGGGCCGGANONE 
J080023G08AAATGGGCCGGANONE 
J080023N09AAATGGGCCGGANONE 
J080024J24AAATGGGCCGGANONE 
J080025M12AAATGGGCCGGANONE 
J080028A22AAATGGGCCGGANONE 
J080028I01AAATGGGCCGGANONE 
J080029D22AAATGGGCCGGANONE 
J080030M02AAATGGGCCGGANONE 
J080031B06AAATGGGCCGGANONE 
J080035G08AAATGGGCCGGANONE 
J080036F19AAATGGGCCGGANONE 
J080038P14AAATGGGCCGGANONE 
J080039C17AAATGGGCCGGANONE 
J080043A10AAATGGGCCGGANONE 
J080044H02AAATGGGCCGGANONE 
J080044P12AAATGGGCCGGANONE 
J080047L06AAATGGGCCGGANONE 
J080050L06AAATGGGCCGGANONE 
J080052J11AAATGGGCCGGANONE 
J080052M10AAATGGGCCGGANONE 
J080053E20AAATGGGCCGGANONE 
J080054J01AAATGGGCCGGANONE 
J080059N09AAATGGGCCGGANONE 
J080064F19AAATGGGCCGGANONE 
J080064N22AAATGGGCCGGANONE 
J080065K14AAATGGGCCGGANONE 
J080065M12AAATGGGCCGGANONE 
J080068O07AAATGGGCCGGANONE 
J080076P20AAATGGGCCGGANONE 
J080087D08AAATGGGCCGGANONE 
J080087H16AAATGGGCCGGANONE 
J080090N23AAATGGGCCGGANONE 
J080091H04AAATGGGCCGGANONE 
J080091P13AAATGGGCCGGANONE 
J080094O15AAATGGGCCGGANONE 
J080094P14AAATGGGCCGGANONE 
J080095I07AAATGGGCCGGANONE 
J080097E22AAATGGGCCGGANONE 
Os08g0567200AK067161CAAGGCCCATTTNONE 
J013094H15CAAGGCCCATTTNONE 
J065209H08CAAGGCCCATTTNONE 
Os09g0127300AK100234AAATGGGCCCTNAD-dependent epimerase/dehydratase family protein. 
J065025J06AAATGGGCCCTNONE 
J065026I05AAATGGGCCCTNONE 
J065042L03AAATGGGCCCTNONE 
J065061B18AAATGGGCCCTNONE 
J065121H13AAATGGGCCCTNONE 
J065183N10AAATGGGCCCTNONE 
Os09g0132600006-066-H01AAATGGGCNONE 
011-038-E04AAATGGGCNONE 
016-074-D05AAATGGGCNONE 
AK072233AAATGGGCConserved hypothetical protein. 
AK098936AAATGGGCNONE 
AK109362AAATGGGCNONE 
J065162N04AAATGGGCNONE 
J100065B13AAATGGGCNONE 
J100071G24AAATGGGCNONE 
Os09g0341500AK073913GCAGCCCATTTConserved hypothetical protein. 
J033076F19GCAGCCCATTTNONE 
J100085E04GCAGCCCATTTNONE 
Os09g0344500AK072740AAATGGGCSimilar to O-methyltransferase ZRP4 (EC 2.1.1.-) (OMT). 
J013102G08AAATGGGCNONE 
J023001I05AAATGGGCNONE 
J023134H21AAATGGGCNONE 
Os09g0370300AK108199AAATGGGCCAGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
AK108199AAATGGGCCTGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0392400AK106799TAAGCCCATTTNONE 
Os09g0394600AK065379GCCCATTTInositol polyphosphate related phosphatase domain containing protein. 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0421200AK059290GCCCATTTtRNA-binding arm domain containing protein. 
J033117F11GCCCATTTNONE 
J090060B01GCCCATTTNONE 
J090067N17GCCCATTTNONE 
Os09g0437900AK107833TTGGCCCATTTSimilar to Adrenodoxin. 
Os09g0439100AK110960AAATGGGCSimilar to Cellulose synthase-like A4. 
J065015H17AAATGGGCNONE 
J065111P09AAATGGGCNONE 
J065148I01AAATGGGCNONE 
J080050I03AAATGGGCNONE 
J080084D18AAATGGGCNONE 
Os09g0478400AK107794AAATGGGCCTAConserved hypothetical protein. 
J065082F04AAATGGGCCTANONE 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0513900AK107699AAAGCCCATTTConserved hypothetical protein. 
Os09g0531900AK073015CCTCGCCCACAAATGGGCCGAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0539100AK071977ACCGGGCCCATTTSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ACCGGGCCCATTTNONE 
Os09g0552300AK111721GCGGCCCATTTProtein kinase-like domain containing protein. 
J043013E21GCGGCCCATTTNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os11g0139500AK121845AAATGGGCCGAAANONE 
Os11g0148600AK100066AAATGGGCCGAGAConserved hypothetical protein. 
AK100066AAATGGGCCTAConserved hypothetical protein. 
AK102442AAATGGGCCGAGANONE 
AK102442AAATGGGCCTANONE 
J065167F17AAATGGGCCGAGANONE 
J065167F17AAATGGGCCTANONE 
Os11g0156200AK100124AAATGGGCCTAPeptidase S28 family protein. 
Os11g0171700AK099115AAATGGGCTSMAD/FHA domain containing protein. 
Os11g0175500015-087-F02AAATGGGCCCACCCNONE 
AK064320AAATGGGCCCACCCZinc finger, RING-type domain containing protein. 
AK101592AAATGGGCCCACCCNONE 
Os11g0209100016-063-F03AAATGGGCCCAGCNONE 
AK064391AAATGGGCCCAGCCyclin-like F-box domain containing protein. 
J075027K02AAATGGGCCCAGCNONE 
J075154K15AAATGGGCCCAGCNONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0557900009-196-H11CAAGGCCCATTTNONE 
AK063232CAAGGCCCATTTARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0602600006-046-H02AAGGCCCATTTNONE 
006-046-H02ATCTCGGCCCATTTNONE 
006-056-H08AAGGCCCATTTNONE 
006-056-H08ATCTCGGCCCATTTNONE 
009-116-D05AAGGCCCATTTNONE 
009-116-D05ATCTCGGCCCATTTNONE 
AK072671AAGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK072671ATCTCGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK104660AAGGCCCATTTNONE 
AK104660ATCTCGGCCCATTTNONE 
J023134P20AAGGCCCATTTNONE 
J023134P20ATCTCGGCCCATTTNONE 
J023141O13AAGGCCCATTTNONE 
J023141O13ATCTCGGCCCATTTNONE 
J033066I15AAGGCCCATTTNONE 
J033066I15ATCTCGGCCCATTTNONE 
J033076A08AAGGCCCATTTNONE 
J033076A08ATCTCGGCCCATTTNONE 
J033150J23AAGGCCCATTTNONE 
J033150J23ATCTCGGCCCATTTNONE 
J065114P19AAGGCCCATTTNONE 
J065114P19ATCTCGGCCCATTTNONE 
J065176B01AAGGCCCATTTNONE 
J065176B01ATCTCGGCCCATTTNONE 
J065207H21AAGGCCCATTTNONE 
J065207H21ATCTCGGCCCATTTNONE 
J080301L21AAGGCCCATTTNONE 
J080301L21ATCTCGGCCCATTTNONE 
J080308A08AAGGCCCATTTNONE 
J080308A08ATCTCGGCCCATTTNONE 
J080318K23AAGGCCCATTTNONE 
J080318K23ATCTCGGCCCATTTNONE 
J080319F17AAGGCCCATTTNONE 
J080319F17ATCTCGGCCCATTTNONE 
J080319I10AAGGCCCATTTNONE 
J080319I10ATCTCGGCCCATTTNONE 
J090028C08AAGGCCCATTTNONE 
J090028C08ATCTCGGCCCATTTNONE 
J090051I24AAGGCCCATTTNONE 
J090051I24ATCTCGGCCCATTTNONE 
J090053L21AAGGCCCATTTNONE 
J090053L21ATCTCGGCCCATTTNONE 
J090069C20AAGGCCCATTTNONE 
J090069C20ATCTCGGCCCATTTNONE 
J100017G08AAGGCCCATTTNONE 
J100017G08ATCTCGGCCCATTTNONE 
J100042B06AAGGCCCATTTNONE 
J100042B06ATCTCGGCCCATTTNONE 
J100045G24AAGGCCCATTTNONE 
J100045G24ATCTCGGCCCATTTNONE 
J100050J19AAGGCCCATTTNONE 
J100050J19ATCTCGGCCCATTTNONE 
J100052D23AAGGCCCATTTNONE 
J100052D23ATCTCGGCCCATTTNONE 
J100053M03AAGGCCCATTTNONE 
J100053M03ATCTCGGCCCATTTNONE 
J100056D08AAGGCCCATTTNONE 
J100056D08ATCTCGGCCCATTTNONE 
J100066B19AAGGCCCATTTNONE 
J100066B19ATCTCGGCCCATTTNONE 
J100071N23AAGGCCCATTTNONE 
J100071N23ATCTCGGCCCATTTNONE 
J100074H01AAGGCCCATTTNONE 
J100074H01ATCTCGGCCCATTTNONE 
J100074H19AAGGCCCATTTNONE 
J100074H19ATCTCGGCCCATTTNONE 
J100077C06AAGGCCCATTTNONE 
J100077C06ATCTCGGCCCATTTNONE 
Os11g0621400009-043-B05AAATGGGCTNONE 
AK062468AAATGGGCTConserved hypothetical protein. 
Os11g0642100AK107010AGCCCATTTCyclin-like F-box domain containing protein. 
Os11g0657200AK059959ACAGCCCATTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAATGGGCTGTNONE 
AK062752AAATGGGCTGTSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0664700012-064-D03AAATGGGCNONE 
AK100084AAATGGGCConserved hypothetical protein. 
J023002K05AAATGGGCNONE 
J023037C21AAATGGGCNONE 
J033029N10AAATGGGCNONE 
J090047F07AAATGGGCNONE 
Os11g0669100AK068628AGCCCATTTCalmodulin binding protein-like family protein. 
Os12g0150100009-047-B11AAATGGGCCCAATNONE 
AK105075AAATGGGCCCAATSimilar to 60S ribosomal protein L26A. 
J013067G22AAATGGGCCCAATNONE 
J033103F08AAATGGGCCCAATNONE 
J065029P11AAATGGGCCCAATNONE 
J065043B18AAATGGGCCCAATNONE 
J065123E16AAATGGGCCCAATNONE 
J065141O20AAATGGGCCCAATNONE 
J065161O04AAATGGGCCCAATNONE 
J065201M07AAATGGGCCCAATNONE 
J075058I23AAATGGGCCCAATNONE 
J075172J08AAATGGGCCCAATNONE 
J100040L13AAATGGGCCCAATNONE 
Os12g0156400012-065-D02CCAGGCCCATTTNONE 
AK072086CCAGGCCCATTTNONE 
AK099278CCAGGCCCATTTDcp1-like decapping family protein. 
J013063H09CCAGGCCCATTTNONE 
J023125D09CCAGGCCCATTTNONE 
J023149G21CCAGGCCCATTTNONE 
J033064E07CCAGGCCCATTTNONE 
J033093C07CCAGGCCCATTTNONE 
J033107E06CCAGGCCCATTTNONE 
J075172A11CCAGGCCCATTTNONE 
J090009E07CCAGGCCCATTTNONE 
J090023F13CCAGGCCCATTTNONE 
J090071N18CCAGGCCCATTTNONE 
Os12g0287200009-067-B11GCCGGCCCATTTGGGCCCAATTNONE 
009-130-F06GCCGGCCCATTTGGGCCCAATTNONE 
009-185-H10GCCGGCCCATTTGGGCCCAATTNONE 
AF338343GCCGGCCCATTTGGGCCCAATTNONE 
AK063847GCCGGCCCATTTGGGCCCAATTSimilar to Mago nashi protein. 
AK121477GCCGGCCCATTTGGGCCCAATTNONE 
J023149H05GCCGGCCCATTTGGGCCCAATTNONE 
J065019G18GCCGGCCCATTTGGGCCCAATTNONE 
J065049J18GCCGGCCCATTTGGGCCCAATTNONE 
J065143C22GCCGGCCCATTTGGGCCCAATTNONE 
J075130D23GCCGGCCCATTTGGGCCCAATTNONE 
J090014I22GCCGGCCCATTTGGGCCCAATTNONE 
J090018A06GCCGGCCCATTTGGGCCCAATTNONE 
J090053H11GCCGGCCCATTTGGGCCCAATTNONE 
J090080N13GCCGGCCCATTTGGGCCCAATTNONE 
J100019H19GCCGGCCCATTTGGGCCCAATTNONE 
Os12g0443700AK069541GCCCATTTSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881GCCCATTTNONE 
Os12g0488800015-085-F11AAATGGGCTGTNONE 
AK064347AAATGGGCTGTRNA polymerase II, RPB4 domain containing protein. 
J033065H11AAATGGGCTGTNONE 
J033145P10AAATGGGCTGTNONE 
J065137L04AAATGGGCTGTNONE 
J065171P08AAATGGGCTGTNONE 
Os12g0517100012-071-A03AAATGGGCCAGNONE 
AK073020AAATGGGCCAGCyclin-like F-box domain containing protein. 
J023149K21AAATGGGCCAGNONE 
Os12g0556400009-129-D04AGGGCCCATTTNONE 
AK062903AGGGCCCATTTNONE 
AK108690AGGGCCCATTTConserved hypothetical protein. 
J080027A03AGGGCCCATTTNONE 
J100074F22AGGGCCCATTTNONE 
Os12g0557800AK121691AAATGGGCCGGTGGGCCGTGProtein prenyltransferase domain containing protein. 
J013095M03AAATGGGCCGGTGGGCCGTGNONE 
J033071H11AAATGGGCCGGTGGGCCGTGNONE 
J065101B02AAATGGGCCGGTGGGCCGTGNONE 
Os12g0588900AK069966AAATGGGCCTAConserved hypothetical protein. 
J023038A10AAATGGGCCTANONE 
J065061J23AAATGGGCCTANONE 
J065176O08AAATGGGCCTANONE 
J075143K13AAATGGGCCTANONE 
Os12g0599900AK101252AAATGGGCCCTTetratricopeptide region domain containing protein. 
AK101252TAAGCCCATTTTetratricopeptide region domain containing protein. 
J033032F05AAATGGGCCCTNONE 
J033032F05TAAGCCCATTTNONE 
Os12g0610950J075157D04AAGGCCCATTTHypothetical protein. 
Os12g0612500Os12g0612500ATTGGGCCGGCCCATTTModification methylase HemK family protein. 
Os12g0612500CCCGGCCCATTTModification methylase HemK family protein. 
Os12g0615300AK119448AAATGGGCCGCAEGF-like calcium-binding domain containing protein. 
Os12g0617100AK101044GCCCATTTSimilar to Translation initiation factor eIF-2B delta subunit (eIF-2B GDP-GTP exchange factor) (Guanine nucleotide exchange factor subunit GCD2) (GCD complex subunit GCD2). 
AK103148GCCCATTTNONE 
Os12g0623700009-168-F09GTGGCCCATTTNONE 
AK063876GTGGCCCATTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.