version

Summary of OsREG423 (All List)

OrganismOryza sativa  
IDOsREG423  
SequenceAACGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
AAACG(C/G)  function unknown  
PLACE Motif 
Total Entry Count864  

Entry Sequences (864 entries)

LocusGene modelSequenceDescription
Os01g0146200J090080H03AAACGGCCCConserved hypothetical protein. 
Os01g0148700006-099-B04CATGGGCCGTTTNONE 
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein. 
AK109379CATGGGCCGTTTNONE 
J023101J18CATGGGCCGTTTNONE 
J033036D19CATGGGCCGTTTNONE 
J033051P05CATGGGCCGTTTNONE 
J033061D21CATGGGCCGTTTNONE 
J033071M06CATGGGCCGTTTNONE 
J033072D18CATGGGCCGTTTNONE 
J033073M13CATGGGCCGTTTNONE 
J033084N02CATGGGCCGTTTNONE 
J065092C13CATGGGCCGTTTNONE 
J080017H24CATGGGCCGTTTNONE 
J080032E16CATGGGCCGTTTNONE 
J080077J07CATGGGCCGTTTNONE 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0219500AK106863TTTTGGGCCGTTNONE 
AK109524TTTTGGGCCGTTPlant lipid transfer protein/Par allergen family protein. 
J075053J18TTTTGGGCCGTTNONE 
J080023G09TTTTGGGCCGTTNONE 
J080051F19TTTTGGGCCGTTNONE 
J080085H15TTTTGGGCCGTTNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
Os01g0593700Os01g0593700AAACGGCCCAATSulphate anion transporter family protein. 
Os01g0642900009-109-F01AAACGGCCCATATNONE 
AK063836AAACGGCCCATATSingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560AAACGGCCCATATNONE 
J033043K18AAACGGCCCATATNONE 
J100023C05AAACGGCCCATATNONE 
J100038C15AAACGGCCCATATNONE 
J100039C23AAACGGCCCATATNONE 
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein. 
Os01g0732200015-078-D03GGGCCGTTTNONE 
AK067563GGGCCGTTTGTP-binding protein, HSR1-related domain containing protein. 
J013111I12GGGCCGTTTNONE 
J033113N16GGGCCGTTTNONE 
J033124C05GGGCCGTTTNONE 
Os01g0786900AK101857CCAACGGCCCCACCACWD40-like domain containing protein. 
Os01g0838300J090017B22AGTGGGCCGTTGNONE 
J090061B04AGTGGGCCGTTGNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0885200AK059113AACGGCCCNONE 
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14AAACGGCCCAAAANONE 
J013063O14AAACGGCCCAAAANONE 
J023023D20AAACGGCCCAAAANONE 
J075121J02AAACGGCCCAAAANONE 
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein. 
Os02g0103700009-031-C12AACGGCCCACCANONE 
AK062502AACGGCCCACCANONE 
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17AACGGCCCACCANONE 
J065161I07AACGGCCCACCANONE 
J065184G15AACGGCCCACCANONE 
J075123E02AACGGCCCACCANONE 
Os02g0123200016-017-F04AAACGGCCCGGTNONE 
J033057C03AAACGGCCCGGTNONE 
J033087C11AAACGGCCCGGTNONE 
J033108J20AAACGGCCCGGTNONE 
J043015P08AAACGGCCCGGTNONE 
Os02g0186500AK068056AAACGGCCCACTSimilar to Protein kinase-like protein. 
AK099031AAACGGCCCACTNONE 
J013111A12AAACGGCCCACTNONE 
J013127K13AAACGGCCCACTNONE 
J013132O11AAACGGCCCACTNONE 
J023056A11AAACGGCCCACTNONE 
J023078M08AAACGGCCCACTNONE 
J033081F07AAACGGCCCACTNONE 
J090079E24AAACGGCCCACTNONE 
J090097I02AAACGGCCCACTNONE 
Os02g0188500AK102004AAACGGCCCAAAANONE 
AK106917AAACGGCCCAAAAUbiquitin domain containing protein. 
J090039N13AAACGGCCCAAAANONE 
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein. 
Os02g0321000AK121840TAATGGGCCGTTTTetratricopeptide-like helical domain containing protein. 
Os02g0628600J100044L04AACGGCCCGTranscriptional factor B3 family protein. 
Os02g0629900AK108563AGCCCAAAAACGGCCCConserved hypothetical protein. 
J065138O07AGCCCAAAAACGGCCCNONE 
Os02g0646200009-031-C03AACGGCCCATGNONE 
AK071507AACGGCCCATGZinc finger, B-box domain containing protein. 
J023090D24AACGGCCCATGNONE 
Os02g0646400AK067828AGTGGGCCGTTSimilar to Glutaredoxin. 
J013120N01AGTGGGCCGTTNONE 
J065021N01AGTGGGCCGTTNONE 
J065021N02AGTGGGCCGTTNONE 
J065053O18AGTGGGCCGTTNONE 
J090067J17AGTGGGCCGTTNONE 
Os02g0668500006-056-A05CCAACGGCCCAGGNONE 
AK060958CCAACGGCCCAGGNONE 
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAACGGCCCAGGNONE 
J065013J03CCAACGGCCCAGGNONE 
J065021P16CCAACGGCCCAGGNONE 
J065044B07CCAACGGCCCAGGNONE 
J065059E23CCAACGGCCCAGGNONE 
J065087N20CCAACGGCCCAGGNONE 
J065185I04CCAACGGCCCAGGNONE 
J065190G19CCAACGGCCCAGGNONE 
J065199C15CCAACGGCCCAGGNONE 
J065213L12CCAACGGCCCAGGNONE 
J080305C01CCAACGGCCCAGGNONE 
J080308C07CCAACGGCCCAGGNONE 
J080310F02CCAACGGCCCAGGNONE 
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein. 
Os02g0678300J075035C01AACGGCCCATGGlucose-methanol-choline oxidoreductase domain containing protein. 
J075148E09AACGGCCCATGNONE 
J080024A08AACGGCCCATGNONE 
J080063C14AACGGCCCATGNONE 
J080072L04AACGGCCCATGNONE 
J080074H15AACGGCCCATGNONE 
J080080E22AACGGCCCATGNONE 
J080086H10AACGGCCCATGNONE 
J080093B21AACGGCCCATGNONE 
J080094G01AACGGCCCATGNONE 
J080306H24AACGGCCCATGNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0717800009-009-B02AAATGGGCCGTTTNONE 
J065185P06AAATGGGCCGTTTNONE 
J100061J04AAATGGGCCGTTTNONE 
J100064M21AAATGGGCCGTTTNONE 
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein. 
J023132N16AACGGCCCAACCNONE 
J033069F17AACGGCCCAACCNONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0777950J090078H24AAACGGCCCATAAConserved hypothetical protein. 
Os02g0788500006-024-A02AAACGGCCCAAGNONE 
006-031-G02AAACGGCCCAAGNONE 
006-081-F11AAACGGCCCAAGNONE 
006-082-H05AAACGGCCCAAGNONE 
AK061452AAACGGCCCAAGConserved hypothetical protein. 
AK104117AAACGGCCCAAGNONE 
AK104526AAACGGCCCAAGNONE 
J075024D11AAACGGCCCAAGNONE 
J075056B12AAACGGCCCAAGNONE 
J075108H12AAACGGCCCAAGNONE 
J075156P10AAACGGCCCAAGNONE 
J075197A19AAACGGCCCAAGNONE 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
J065055C02AGTTGGGCCGTTGGNONE 
J065098A17AGTTGGGCCGTTGGNONE 
J065119B13AGTTGGGCCGTTGGNONE 
J065146F10AGTTGGGCCGTTGGNONE 
J065209G06AGTTGGGCCGTTGGNONE 
J080001K12AGTTGGGCCGTTGGNONE 
J080004O17AGTTGGGCCGTTGGNONE 
J080005P21AGTTGGGCCGTTGGNONE 
J080009M18AGTTGGGCCGTTGGNONE 
J080013O18AGTTGGGCCGTTGGNONE 
J080014B04AGTTGGGCCGTTGGNONE 
J080014O21AGTTGGGCCGTTGGNONE 
J080015B04AGTTGGGCCGTTGGNONE 
J080016B17AGTTGGGCCGTTGGNONE 
J080017G09AGTTGGGCCGTTGGNONE 
J080022A17AGTTGGGCCGTTGGNONE 
J080024M10AGTTGGGCCGTTGGNONE 
J080025F17AGTTGGGCCGTTGGNONE 
J080025O16AGTTGGGCCGTTGGNONE 
J080029H09AGTTGGGCCGTTGGNONE 
J080030G24AGTTGGGCCGTTGGNONE 
J080031E02AGTTGGGCCGTTGGNONE 
J080032A18AGTTGGGCCGTTGGNONE 
J080032G24AGTTGGGCCGTTGGNONE 
J080033C05AGTTGGGCCGTTGGNONE 
J080033N19AGTTGGGCCGTTGGNONE 
J080035H10AGTTGGGCCGTTGGNONE 
J080035L05AGTTGGGCCGTTGGNONE 
J080042N09AGTTGGGCCGTTGGNONE 
J080044C14AGTTGGGCCGTTGGNONE 
J080048K16AGTTGGGCCGTTGGNONE 
J080050L07AGTTGGGCCGTTGGNONE 
J080051L06AGTTGGGCCGTTGGNONE 
J080051P22AGTTGGGCCGTTGGNONE 
J080053D09AGTTGGGCCGTTGGNONE 
J080053J15AGTTGGGCCGTTGGNONE 
J080053O12AGTTGGGCCGTTGGNONE 
J080057L01AGTTGGGCCGTTGGNONE 
J080062E08AGTTGGGCCGTTGGNONE 
J080062I09AGTTGGGCCGTTGGNONE 
J080063A21AGTTGGGCCGTTGGNONE 
J080063E04AGTTGGGCCGTTGGNONE 
J080063E08AGTTGGGCCGTTGGNONE 
J080064D15AGTTGGGCCGTTGGNONE 
J080064N15AGTTGGGCCGTTGGNONE 
J080068F13AGTTGGGCCGTTGGNONE 
J080070L16AGTTGGGCCGTTGGNONE 
J080072O17AGTTGGGCCGTTGGNONE 
J080075A07AGTTGGGCCGTTGGNONE 
J080076H10AGTTGGGCCGTTGGNONE 
J080077K19AGTTGGGCCGTTGGNONE 
J080078E19AGTTGGGCCGTTGGNONE 
J080082A02AGTTGGGCCGTTGGNONE 
J080083O05AGTTGGGCCGTTGGNONE 
J080091I07AGTTGGGCCGTTGGNONE 
J080094K10AGTTGGGCCGTTGGNONE 
J080094N03AGTTGGGCCGTTGGNONE 
J080096F09AGTTGGGCCGTTGGNONE 
J080097O04AGTTGGGCCGTTGGNONE 
J090037B19AGTTGGGCCGTTGGNONE 
J100017A13AGTTGGGCCGTTGGNONE 
J100068N22AGTTGGGCCGTTGGNONE 
J100072C06AGTTGGGCCGTTGGNONE 
Os03g0142900011-054-A05CAACGGCCCATTNONE 
AK067103CAACGGCCCATTNONE 
AK120438CAACGGCCCATTProtein of unknown function DUF946, plant family protein. 
J013097D18CAACGGCCCATTNONE 
J013098E18CAACGGCCCATTNONE 
J013099I17CAACGGCCCATTNONE 
J013108C09CAACGGCCCATTNONE 
J023045J15CAACGGCCCATTNONE 
J033034E13CAACGGCCCATTNONE 
J033095F07CAACGGCCCATTNONE 
J033102N22CAACGGCCCATTNONE 
J065016C14CAACGGCCCATTNONE 
J065034E13CAACGGCCCATTNONE 
J065065F21CAACGGCCCATTNONE 
J065159M09CAACGGCCCATTNONE 
J075012C13CAACGGCCCATTNONE 
J075017P18CAACGGCCCATTNONE 
J075018M03CAACGGCCCATTNONE 
J075021H19CAACGGCCCATTNONE 
J075070K23CAACGGCCCATTNONE 
J075077B18CAACGGCCCATTNONE 
J075085E20CAACGGCCCATTNONE 
J075090N23CAACGGCCCATTNONE 
J075137M16CAACGGCCCATTNONE 
J075151E03CAACGGCCCATTNONE 
J090042L02CAACGGCCCATTNONE 
J090060C21CAACGGCCCATTNONE 
J090089I17CAACGGCCCATTNONE 
J100024L19CAACGGCCCATTNONE 
J100025A06CAACGGCCCATTNONE 
J100033C24CAACGGCCCATTNONE 
J100052J17CAACGGCCCATTNONE 
J100063H10CAACGGCCCATTNONE 
J100073P04CAACGGCCCATTNONE 
J100075D01CAACGGCCCATTNONE 
J100077J17CAACGGCCCATTNONE 
J100087F03CAACGGCCCATTNONE 
J100087F09CAACGGCCCATTNONE 
Os03g0143000AK073102AAACGGCCCGTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24AAACGGCCCGTTNONE 
Os03g0213600AK100407AAACGGCCCGConserved hypothetical protein. 
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein. 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0248600AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CCAACGGCCCGGCNONE 
AK104877CCAACGGCCCGGCNONE 
J013026L10CCAACGGCCCGGCNONE 
J013055P12CCAACGGCCCGGCNONE 
J023091A14CCAACGGCCCGGCNONE 
J033034G07CCAACGGCCCGGCNONE 
J033048H19CCAACGGCCCGGCNONE 
J033128D07CCAACGGCCCGGCNONE 
J065060L24CCAACGGCCCGGCNONE 
J065176A19CCAACGGCCCGGCNONE 
J090018K08CCAACGGCCCGGCNONE 
J090023C03CCAACGGCCCGGCNONE 
Os03g0252800AK065537AAACGGCCCNONE 
AK067765AAACGGCCCAminotransferase, class I and II domain containing protein. 
Os03g0265400006-022-A01TAATGGGCCGTTTNONE 
006-033-E05TAATGGGCCGTTTNONE 
006-035-A03TAATGGGCCGTTTNONE 
006-057-D09TAATGGGCCGTTTNONE 
006-058-D03TAATGGGCCGTTTNONE 
006-061-B04TAATGGGCCGTTTNONE 
006-076-C01TAATGGGCCGTTTNONE 
006-089-C09TAATGGGCCGTTTNONE 
006-092-D01TAATGGGCCGTTTNONE 
006-100-D06TAATGGGCCGTTTNONE 
009-014-G04TAATGGGCCGTTTNONE 
009-060-C06TAATGGGCCGTTTNONE 
009-098-A06TAATGGGCCGTTTNONE 
AK061468TAATGGGCCGTTTNONE 
AK104116TAATGGGCCGTTTNONE 
AK104424TAATGGGCCGTTTNONE 
AK120527TAATGGGCCGTTTSimilar to 50S ribosomal protein L4, chloroplast precursor (R-protein L4). 
J013127C20TAATGGGCCGTTTNONE 
J023031E11TAATGGGCCGTTTNONE 
J023150F18TAATGGGCCGTTTNONE 
J033037G14TAATGGGCCGTTTNONE 
J065073K02TAATGGGCCGTTTNONE 
J065085P13TAATGGGCCGTTTNONE 
J065161B21TAATGGGCCGTTTNONE 
J065197G23TAATGGGCCGTTTNONE 
Os03g0276500011-014-A06AACGGCCCAAGNONE 
012-043-E04AACGGCCCAAGNONE 
012-096-G01AACGGCCCAAGNONE 
014-005-A07AACGGCCCAAGNONE 
014-031-F09AACGGCCCAAGNONE 
014-040-C09AACGGCCCAAGNONE 
014-092-G02AACGGCCCAAGNONE 
AK072830AACGGCCCAAGNONE 
AK099275AACGGCCCAAGNONE 
AK109474AACGGCCCAAGSimilar to Heat shock protein 70. 
J013036E08AACGGCCCAAGNONE 
J013047P03AACGGCCCAAGNONE 
J013048H14AACGGCCCAAGNONE 
J013060E24AACGGCCCAAGNONE 
J013093N10AACGGCCCAAGNONE 
J013123K11AACGGCCCAAGNONE 
J013153C09AACGGCCCAAGNONE 
J023010D20AACGGCCCAAGNONE 
J023027O13AACGGCCCAAGNONE 
J023029B01AACGGCCCAAGNONE 
J023063G14AACGGCCCAAGNONE 
J023083D09AACGGCCCAAGNONE 
J023091M13AACGGCCCAAGNONE 
J023121M10AACGGCCCAAGNONE 
J023126D10AACGGCCCAAGNONE 
J023139H01AACGGCCCAAGNONE 
J023145B18AACGGCCCAAGNONE 
J033029G15AACGGCCCAAGNONE 
J033050K13AACGGCCCAAGNONE 
J033057L09AACGGCCCAAGNONE 
J033092M15AACGGCCCAAGNONE 
J065007N14AACGGCCCAAGNONE 
J065038E07AACGGCCCAAGNONE 
J065043A09AACGGCCCAAGNONE 
J065100C19AACGGCCCAAGNONE 
J065117C02AACGGCCCAAGNONE 
J065213I04AACGGCCCAAGNONE 
J090001F01AACGGCCCAAGNONE 
J090025D07AACGGCCCAAGNONE 
J090037C11AACGGCCCAAGNONE 
J090047N11AACGGCCCAAGNONE 
J090053O05AACGGCCCAAGNONE 
J090070F11AACGGCCCAAGNONE 
J090082O16AACGGCCCAAGNONE 
J090085F20AACGGCCCAAGNONE 
J090096N08AACGGCCCAAGNONE 
Os03g0278200AK103544AAACGGCCCGNAD-dependent epimerase/dehydratase family protein. 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0332700AK072820AAACGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0335100AK107094CTTGGGCCGTTConserved hypothetical protein. 
Os03g0359700AK060778AAACGGCCCArmadillo-like helical domain containing protein. 
AK109309AAACGGCCCNONE 
J013106M15AAACGGCCCNONE 
J023099J09AAACGGCCCNONE 
J023112C23AAACGGCCCNONE 
J065190A21AAACGGCCCNONE 
J065206O20AAACGGCCCNONE 
J090027N12AAACGGCCCNONE 
Os03g0381000AK069332CAACGGCCCCACATGTCAGTGGSimilar to Aldose 1-epimerase-like protein. 
J023010L17CAACGGCCCCACATGTCAGTGGNONE 
Os03g0639800AK103237AGTGGGCCGTTSnf7 family protein. 
J023036L02AGTGGGCCGTTNONE 
J033108L13AGTGGGCCGTTNONE 
Os03g0685600AK111863GGGCCGTTWD40-like domain containing protein. 
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit. 
Os03g0770100AK108776AACGGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0772800009-023-E05CAACGGCCCAACANONE 
009-059-F12CAACGGCCCAACANONE 
009-114-B08CAACGGCCCAACANONE 
009-115-G09CAACGGCCCAACANONE 
009-151-D08CAACGGCCCAACANONE 
009-158-A10CAACGGCCCAACANONE 
009-191-H02CAACGGCCCAACANONE 
009-192-E05CAACGGCCCAACANONE 
009-197-F11CAACGGCCCAACANONE 
AK059576CAACGGCCCAACANONE 
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein. 
J023087H20CAACGGCCCAACANONE 
J023105P14CAACGGCCCAACANONE 
J033026P15CAACGGCCCAACANONE 
J033042K10CAACGGCCCAACANONE 
J033133C09CAACGGCCCAACANONE 
J065123K13CAACGGCCCAACANONE 
J075190D03CAACGGCCCAACANONE 
J080310M14CAACGGCCCAACANONE 
J080317L14CAACGGCCCAACANONE 
J100067J19CAACGGCCCAACANONE 
J100079H21CAACGGCCCAACANONE 
Os03g0831100AK103115AACGGCCCGGCCArmadillo-like helical domain containing protein. 
J033119F15AACGGCCCGGCCNONE 
J065011M19AACGGCCCGGCCNONE 
J075019I08AACGGCCCGGCCNONE 
J075047A01AACGGCCCGGCCNONE 
J075096P21AACGGCCCGGCCNONE 
J075121I05AACGGCCCGGCCNONE 
J075121I07AACGGCCCGGCCNONE 
J090063F13AACGGCCCGGCCNONE 
J090068F16AACGGCCCGGCCNONE 
J090094E14AACGGCCCGGCCNONE 
Os03g0833700011-060-A10TCATGGGCCGTTTNONE 
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein. 
Os04g0194500AK121164CAACGGCCCCCACSimilar to ABC transporter-like protein. 
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110ATCCAACGGCCCCACCNONE 
AK099145ATCCAACGGCCCCACCNONE 
J065045A03ATCCAACGGCCCCACCNONE 
Os04g0272400AK121455GGGCCGTTProtein of unknown function DUF266, plant family protein. 
J023142P15GGGCCGTTNONE 
Os04g0418000006-025-C05AAACGGCCCATTTNONE 
006-025-D11AAACGGCCCATTTNONE 
006-045-F02AAACGGCCCATTTNONE 
006-060-B04AAACGGCCCATTTNONE 
006-063-E03AAACGGCCCATTTNONE 
006-070-G08AAACGGCCCATTTNONE 
006-072-H05AAACGGCCCATTTNONE 
AK061030AAACGGCCCATTTNONE 
AK099124AAACGGCCCATTTNONE 
AK106155AAACGGCCCATTTConserved hypothetical protein. 
AK119714AAACGGCCCATTTNONE 
J023039I07AAACGGCCCATTTNONE 
J065025N03AAACGGCCCATTTNONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0551300AK103502AACGGCCCAGCSimilar to Growth regulator like protein. 
Os04g0560100006-090-B07CCAACGGCCCNONE 
AK071033CCAACGGCCCNONE 
AK106001CCAACGGCCCCytochrome P450 family protein. 
J023063N21CCAACGGCCCNONE 
J023078O09CCAACGGCCCNONE 
J090062K20CCAACGGCCCNONE 
Os04g0626400006-050-B09AACGGCCCGCANONE 
006-072-C12AACGGCCCGCANONE 
006-092-C11AACGGCCCGCANONE 
AK059851AACGGCCCGCACalycin-like family protein. 
AK100069AACGGCCCGCANONE 
AK104062AACGGCCCGCANONE 
AK104663AACGGCCCGCANONE 
Os04g0636900011-028-G03AAACGGCCCAGTTNONE 
012-040-G03AAACGGCCCAGTTNONE 
AK058405AAACGGCCCAGTTNONE 
AK065789AAACGGCCCAGTTNONE 
AK101408AAACGGCCCAGTTNONE 
AK119286AAACGGCCCAGTTNONE 
J013042J24AAACGGCCCAGTTNONE 
J033037I12AAACGGCCCAGTTNONE 
J043031B12AAACGGCCCAGTTNONE 
J065152N10AAACGGCCCAGTTNONE 
J090060K17AAACGGCCCAGTTNONE 
J090083K14AAACGGCCCAGTTNONE 
J100046O13AAACGGCCCAGTTNONE 
J100066G22AAACGGCCCAGTTNONE 
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein. 
J013021B22CAACGGCCCAAAANONE 
J065054D12CAACGGCCCAAAANONE 
J065135I05CAACGGCCCAAAANONE 
J065198F14CAACGGCCCAAAANONE 
J090027O06CAACGGCCCAAAANONE 
Os05g0120800AK066865AAACGGCCCATATConserved hypothetical protein. 
Os05g0148300009-031-A08TGTTGGGCCGTTNONE 
AK062421TGTTGGGCCGTTRibosomal protein S27, mitochondrial family protein. 
Os05g0156200AK071622TCCGGGCCGTTConserved hypothetical protein. 
J023099E19TCCGGGCCGTTNONE 
J090025C09TCCGGGCCGTTNONE 
J090071K23TCCGGGCCGTTNONE 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0501300006-075-B11ATCTGGGCCGTTGNONE 
006-083-H08ATCTGGGCCGTTGNONE 
AK059889ATCTGGGCCGTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02ATCTGGGCCGTTGNONE 
Os05g0567500AK073046CGGGCCGTTGNONE 
AK121133CGGGCCGTTGDNA glycosylase family protein. 
J023075P20CGGGCCGTTGNONE 
Os05g0592800AK067627CAACGGCCCAGASimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CAACGGCCCAGANONE 
AK104323CAACGGCCCAGANONE 
Os05g0594100006-034-F04TCCGGGCCGTTGNONE 
006-061-A02TCCGGGCCGTTGNONE 
009-081-E02TCCGGGCCGTTGNONE 
AK060122TCCGGGCCGTTGNONE 
AK106130TCCGGGCCGTTGSimilar to GDA2 protein. 
J023010C07TCCGGGCCGTTGNONE 
J023098J20TCCGGGCCGTTGNONE 
J023117G22TCCGGGCCGTTGNONE 
J023127J08TCCGGGCCGTTGNONE 
J033117G03TCCGGGCCGTTGNONE 
J033124I03TCCGGGCCGTTGNONE 
J043015K15TCCGGGCCGTTGNONE 
Os06g0104000AK068490ACTGGGCCGTTConserved hypothetical protein. 
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0115300009-165-C05CCACCAACGGCCCNONE 
AK058833CCACCAACGGCCCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
J065135L09CCACCAACGGCCCNONE 
J075002E09CCACCAACGGCCCNONE 
J075015K23CCACCAACGGCCCNONE 
J075043B06CCACCAACGGCCCNONE 
J075057O21CCACCAACGGCCCNONE 
J075085L21CCACCAACGGCCCNONE 
J075134N20CCACCAACGGCCCNONE 
J075155O22CCACCAACGGCCCNONE 
J075198N22CCACCAACGGCCCNONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0140100011-063-A02TCCAACGGCCCGTTNONE 
AK063371TCCAACGGCCCGTTLeucine carboxyl methyltransferase family protein. 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0225200005-009-B07AAATGGGCCGTTNONE 
AK067095AAATGGGCCGTTMitochodrial transcription termination factor-related family protein. 
AK104692AAATGGGCCGTTNONE 
J013096A05AAATGGGCCGTTNONE 
J090092C03AAATGGGCCGTTNONE 
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE 
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23CCAACGGCCCAGATCTCTCCGCNONE 
J013129K13CCAACGGCCCAGATCTCTCCGCNONE 
J023010F22CCAACGGCCCAGATCTCTCCGCNONE 
J023120K19CCAACGGCCCAGATCTCTCCGCNONE 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CAACGGCCCAAAANONE 
Os06g0593100AK060274AACGGCCCATGASimilar to UDP-galactose/UDP-glucose transporter. 
AK071175AACGGCCCATGANONE 
Os06g0607800012-010-G03CAACGGCCCGNONE 
AB070254CAACGGCCCGNONE 
AK063158CAACGGCCCGSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAACGGCCCGNONE 
J013074G13CAACGGCCCGNONE 
J090015C16CAACGGCCCGNONE 
J090069H10CAACGGCCCGNONE 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os07g0114550J090025L18AACGGCCCATGTHypothetical protein. 
Os07g0142000AK059877AAACGGCCCReticulon family protein. 
AK099414AAACGGCCCNONE 
Os07g0169600006-027-F04AGATGGGCCGTTGNONE 
006-043-C10AGATGGGCCGTTGNONE 
006-070-A04AGATGGGCCGTTGNONE 
006-081-F03AGATGGGCCGTTGNONE 
006-104-F02AGATGGGCCGTTGNONE 
012-006-D12AGATGGGCCGTTGNONE 
AK060318AGATGGGCCGTTGNONE 
AK121818AGATGGGCCGTTG2OG-Fe(II) oxygenase domain containing protein. 
J023065K01AGATGGGCCGTTGNONE 
J023086G17AGATGGGCCGTTGNONE 
J023093G16AGATGGGCCGTTGNONE 
J033024N04AGATGGGCCGTTGNONE 
J033099A15AGATGGGCCGTTGNONE 
J033107B14AGATGGGCCGTTGNONE 
J043026F14AGATGGGCCGTTGNONE 
J065043P20AGATGGGCCGTTGNONE 
J075118L16AGATGGGCCGTTGNONE 
J075162M22AGATGGGCCGTTGNONE 
J080004K13AGATGGGCCGTTGNONE 
J080024D10AGATGGGCCGTTGNONE 
J080037C21AGATGGGCCGTTGNONE 
J080039M17AGATGGGCCGTTGNONE 
J080040A03AGATGGGCCGTTGNONE 
J080044A07AGATGGGCCGTTGNONE 
J080045I07AGATGGGCCGTTGNONE 
J080052L06AGATGGGCCGTTGNONE 
J080053A20AGATGGGCCGTTGNONE 
J080060L15AGATGGGCCGTTGNONE 
J080060N22AGATGGGCCGTTGNONE 
J080062L23AGATGGGCCGTTGNONE 
J080069B19AGATGGGCCGTTGNONE 
J080086K15AGATGGGCCGTTGNONE 
J080089H16AGATGGGCCGTTGNONE 
J080089I23AGATGGGCCGTTGNONE 
J080094P07AGATGGGCCGTTGNONE 
J090032L18AGATGGGCCGTTGNONE 
J100044E09AGATGGGCCGTTGNONE 
J100045O03AGATGGGCCGTTGNONE 
J100066B11AGATGGGCCGTTGNONE 
J100069J24AGATGGGCCGTTGNONE 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0222800009-072-E05AAACGGCCCAGCNONE 
AK060442AAACGGCCCAGCNONE 
AK100823AAACGGCCCAGCAcyl carrier protein-like protein. 
AK103131AAACGGCCCAGCNONE 
AY224456AAACGGCCCAGCNONE 
J075026H13AAACGGCCCAGCNONE 
J075142G06AAACGGCCCAGCNONE 
J100033K08AAACGGCCCAGCNONE 
Os07g0565600AK071983CCTGGGCCGTTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CCTGGGCCGTTNONE 
Os07g0570700AK065242AAACGGCCCATTARibosome recycling factor family protein. 
J013002I12AAACGGCCCATTANONE 
Os07g0602000AK071832GGGCCGTTTCCACGCCACSimilar to NADPH HC toxin reductase (Fragment). 
J023121D11GGGCCGTTTCCACGCCACNONE 
J023138E01GGGCCGTTTCCACGCCACNONE 
J023149O13GGGCCGTTTCCACGCCACNONE 
J090074M19GGGCCGTTTCCACGCCACNONE 
Os07g0656400011-061-F11CAACGGCCCATAConserved hypothetical protein. 
Os07g0668200AK059051CAACGGCCCATCANONE 
AK101682CAACGGCCCATCAConserved hypothetical protein. 
AK102839CAACGGCCCATCANONE 
Os07g0674100AB183706AACGGCCCACGGUDP-glucuronic acid decarboxylase. 
AK099614AACGGCCCACGGNONE 
J013050E02AACGGCCCACGGNONE 
J065162F06AACGGCCCACGGNONE 
J065180F10AACGGCCCACGGNONE 
J090049F09AACGGCCCACGGNONE 
J100064L11AACGGCCCACGGNONE 
Os08g0120000006-042-E02AAACGGCCCAACANONE 
006-051-F06AAACGGCCCAACANONE 
006-052-G03AAACGGCCCAACANONE 
006-095-B11AAACGGCCCAACANONE 
AB017427AAACGGCCCAACANONE 
AB017428AAACGGCCCAACANONE 
AK059789AAACGGCCCAACANONE 
AK059815AAACGGCCCAACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077AAACGGCCCAACANONE 
AK102607AAACGGCCCAACANONE 
AK104303AAACGGCCCAACANONE 
AK104304AAACGGCCCAACANONE 
AK104421AAACGGCCCAACANONE 
D10414AAACGGCCCAACANONE 
J013170D08AAACGGCCCAACANONE 
J023086D16AAACGGCCCAACANONE 
J033099B04AAACGGCCCAACANONE 
J065042P05AAACGGCCCAACANONE 
J065144E22AAACGGCCCAACANONE 
J065162J20AAACGGCCCAACANONE 
J065196N13AAACGGCCCAACANONE 
J090013B11AAACGGCCCAACANONE 
Os08g0143500006-072-G06TTTTGGGCCGTTNONE 
016-053-H02TTTTGGGCCGTTNONE 
AK061094TTTTGGGCCGTTNONE 
AK071122TTTTGGGCCGTTGlycosyl transferase, family 14 protein. 
J023081E17TTTTGGGCCGTTNONE 
J023106O18TTTTGGGCCGTTNONE 
J043001N22TTTTGGGCCGTTNONE 
J065062D05TTTTGGGCCGTTNONE 
J065099M15TTTTGGGCCGTTNONE 
J065180K12TTTTGGGCCGTTNONE 
J090045L23TTTTGGGCCGTTNONE 
J100088K05TTTTGGGCCGTTNONE 
Os08g0302000AK106760AAACGGCCCAACSimilar to Peroxidase 40 precursor (EC 1.11.1.7) (Atperox P40). 
Os08g0463900AK120178TTCGTGGGCCGTTTConserved hypothetical protein. 
J013033H06TTCGTGGGCCGTTTNONE 
J075006G17TTCGTGGGCCGTTTNONE 
Os08g0465300AK108076AACTGGGCCGTTConserved hypothetical protein. 
Os08g0507400015-083-F04GGGCCGTTNONE 
AK067905GGGCCGTTCytochrome P450 family protein. 
AK099637GGGCCGTTNONE 
J013059L23GGGCCGTTNONE 
J013124B09GGGCCGTTNONE 
Os08g0525600AK103172TCCGGGCCGTTSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0535400004-001-H10CGGGCCGTTNONE 
AK071527CGGGCCGTTZinc finger, DHHC-type domain containing protein. 
J023107B02CGGGCCGTTNONE 
Os08g0546300AK064717TGATGGGCCGTTTConserved hypothetical protein. 
AK119794TGATGGGCCGTTTNONE 
D10982TGATGGGCCGTTTNONE 
J080044B21TGATGGGCCGTTTNONE 
Os08g0548300AK073266TGATGGGCCGTTTZinc finger, RING-type domain containing protein. 
J013030C19TGATGGGCCGTTTNONE 
J033029A20TGATGGGCCGTTTNONE 
J033050L14TGATGGGCCGTTTNONE 
J033058F03TGATGGGCCGTTTNONE 
J033110K01TGATGGGCCGTTTNONE 
J033123D21TGATGGGCCGTTTNONE 
Os08g0549300009-008-F01AAACGGCCCATCCNONE 
009-033-G10AAACGGCCCATCCNONE 
AK120938AAACGGCCCATCCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420AAACGGCCCATCCNONE 
J023037A21AAACGGCCCATCCNONE 
J023066D20AAACGGCCCATCCNONE 
J033099K13AAACGGCCCATCCNONE 
J065116C14AAACGGCCCATCCNONE 
J075009K15AAACGGCCCATCCNONE 
J075071P13AAACGGCCCATCCNONE 
J075080D18AAACGGCCCATCCNONE 
J075124F24AAACGGCCCATCCNONE 
J075198F23AAACGGCCCATCCNONE 
J080006B15AAACGGCCCATCCNONE 
J090078H13AAACGGCCCATCCNONE 
J090089J09AAACGGCCCATCCNONE 
J100017A03AAACGGCCCATCCNONE 
J100023G03AAACGGCCCATCCNONE 
Os09g0454900011-052-B02AAACGGCCCGNONE 
016-025-D09AAACGGCCCGNONE 
AK102152AAACGGCCCGCurculin-like (mannose-binding) lectin domain containing protein. 
J033086D22AAACGGCCCGNONE 
Os09g0461800009-087-C07CGGGCCGTTTNONE 
AK062676CGGGCCGTTTEsterase/lipase/thioesterase domain containing protein. 
Os09g0477700AK121644CTTGGGCCGTTConserved hypothetical protein. 
Os09g0485800AK108749GTTTGGGCCGTTTConserved hypothetical protein. 
J065137H03GTTTGGGCCGTTTNONE 
Os09g0559800AK071542CGGGCCGTTSimilar to Transporter-like protein. 
J013063N24CGGGCCGTTNONE 
Os11g0139100009-099-H06AAACGGCCCAGTTNONE 
AK121443AAACGGCCCAGTTSimilar to 50S ribosomal protein L24. 
J023140O18AAACGGCCCAGTTNONE 
J023143M23AAACGGCCCAGTTNONE 
J033079G04AAACGGCCCAGTTNONE 
J043004D20AAACGGCCCAGTTNONE 
J065097F05AAACGGCCCAGTTNONE 
Os11g0199600AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein. 
AK120040TCGGCCCATTAACGGCCCACGTNONE 
J023047I06TCGGCCCATTAACGGCCCACGTNONE 
J033064L23TCGGCCCATTAACGGCCCACGTNONE 
J033117I01TCGGCCCATTAACGGCCCACGTNONE 
J033123I18TCGGCCCATTAACGGCCCACGTNONE 
J053026H17TCGGCCCATTAACGGCCCACGTNONE 
J053078G05TCGGCCCATTAACGGCCCACGTNONE 
J065102A09TCGGCCCATTAACGGCCCACGTNONE 
J065113G11TCGGCCCATTAACGGCCCACGTNONE 
J065207F20TCGGCCCATTAACGGCCCACGTNONE 
J075027K21TCGGCCCATTAACGGCCCACGTNONE 
Os11g0206300016-010-D02CGGGCCGTTGGATNONE 
AK064170CGGGCCGTTGGATMitochodrial transcription termination factor-related family protein. 
Os11g0231400AK108047GGGCCGTTCCAGCCCAACCProtein of unknown function DUF295 family protein. 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0497000AK111924GCTGGGCCGTTSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GCTGGGCCGTTNONE 
J065097A08GCTGGGCCGTTNONE 
J065123J10GCTGGGCCGTTNONE 
J075096F04GCTGGGCCGTTNONE 
J080065C15GCTGGGCCGTTNONE 
J090033J04GCTGGGCCGTTNONE 
J090072N23GCTGGGCCGTTNONE 
J100021E08GCTGGGCCGTTNONE 
J100063H21GCTGGGCCGTTNONE 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os11g0615700AB026561AACGGCCCGNONE 
AK059521AACGGCCCGNONE 
AK103487AACGGCCCGProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14AACGGCCCGNONE 
J065044A11AACGGCCCGNONE 
J065090I02AACGGCCCGNONE 
J065104I09AACGGCCCGNONE 
J065187J10AACGGCCCGNONE 
J075024E07AACGGCCCGNONE 
J075025O13AACGGCCCGNONE 
J090062N12AACGGCCCGNONE 
J090087G06AACGGCCCGNONE 
J090098K11AACGGCCCGNONE 
Os11g0689100AK073759CCATGGGCCGTTDisease resistance protein family protein. 
AK108692CCATGGGCCGTTNONE 
Os12g0141400AK071576AAACGGCCCGHypothetical protein. 
J023105A17AAACGGCCCGNONE 
Os12g0165200AK110577AAACGGCCCAAAHSP20-like chaperone domain containing protein. 
Os12g0194700AK121912AACGGCCCAGATDNA-directed RNA polymerase, 13 to 16 kDa subunit family protein. 
J033106A07AACGGCCCAGATNONE 
Os12g0194800011-016-B07ATCTGGGCCGTTNONE 
AK101810ATCTGGGCCGTTtRNA pseudouridine synthase family protein. 
AK107780ATCTGGGCCGTTNONE 
J043034C07ATCTGGGCCGTTNONE 
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein. 
J033065K09TCCAACGGCCCACGAANONE 
Os12g0235800AK071066CAACGGCCCACCCSimilar to Argininosuccinate synthase (Fragment). 
Os12g0573000AK067552AACGGCCCACGGCCCACGTHypothetical protein. 
AK069292AACGGCCCACGGCCCACGTNONE 
Os12g0614300J100063C15CGGGCCGTTGConserved hypothetical protein. 
Os12g0636600AK111056AATTGGGCCGTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.