version

Summary of OsREG424 (All List)

OrganismOryza sativa  
IDOsREG424  
SequenceAACGGGCC  
Annotation  
PPDB MotifAAACG(C/G)  function unknown  
ACGGGC  function unknown  
CCAACGG  function unknown  
PLACE Motif 
Total Entry Count1384  

Entry Sequences (1384 entries)

LocusGene modelSequenceDescription
Os01g0184500AK060699GGCCCGTTDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0219100J065130F20AACGGGCCNONE 
J065208O10AACGGGCCSFT2-like family protein. 
Os01g0246100AK120732CACGGCCCGTTProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0276500006-030-E04AACGGGCCNONE 
AK061002AACGGGCCSimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335AACGGGCCNONE 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
Os01g0295900J065076G19GGCCCGTTNONE 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0530366J075001P06AACGGGCCCAGTTNONE 
J075001P06GCCGGCCCATATAACGGGCCNONE 
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein. 
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein. 
J075030G13AACGGGCCCAGTTNONE 
J075030G13GCCGGCCCATATAACGGGCCNONE 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0596700AK107371AACGGGCCCCACGFBD domain containing protein. 
Os01g0611000003-117-E07GGCCCGTTNONE 
006-051-D01GGCCCGTTNONE 
006-085-B10GGCCCGTTNONE 
012-092-F03GGCCCGTTNONE 
AK060682GGCCCGTTNONE 
AK072500GGCCCGTTSimilar to Unidentified precursor. 
AK105921GGCCCGTTNONE 
J023001D07GGCCCGTTNONE 
J023075J23GGCCCGTTNONE 
J023127H12GGCCCGTTNONE 
J033024H20GGCCCGTTNONE 
J033025H03GGCCCGTTNONE 
J065057F11GGCCCGTTNONE 
J065096C07GGCCCGTTNONE 
J065103A08GGCCCGTTNONE 
J065137L11GGCCCGTTNONE 
J065179I16GGCCCGTTNONE 
J065197P22GGCCCGTTNONE 
J075089M08GGCCCGTTNONE 
J090008N14GGCCCGTTNONE 
J090011K16GGCCCGTTNONE 
J090075K24GGCCCGTTNONE 
J090079E08GGCCCGTTNONE 
Os01g0636500012-066-G03GGGGCCCGTTNONE 
AK073853GGGGCCCGTTSimilar to Polygalacturonase PG2. 
AK104990GGGGCCCGTTNONE 
J033072D05GGGGCCCGTTNONE 
Os01g0640800AK065688TCTGGCCCGTTConserved hypothetical protein 48 family protein. 
J013042L10TCTGGCCCGTTNONE 
J013121H08TCTGGCCCGTTNONE 
Os01g0685900AK064024AACGGGCCNONE 
AK102005AACGGGCCSimilar to 65kD microtubule associated protein. 
Os01g0704700AK100296GGCCCGTTSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os01g0752300AK121755GGCCCGTTSimilar to 60S ribosomal protein L18a-1. 
J013049F10GGCCCGTTNONE 
J013088L10GGCCCGTTNONE 
J023020B21GGCCCGTTNONE 
J023038M01GGCCCGTTNONE 
J033058H15GGCCCGTTNONE 
J033088C04GGCCCGTTNONE 
J033115N19GGCCCGTTNONE 
J033131H04GGCCCGTTNONE 
J065067E05GGCCCGTTNONE 
J065085C07GGCCCGTTNONE 
J065095D12GGCCCGTTNONE 
J065124B19GGCCCGTTNONE 
J065181H07GGCCCGTTNONE 
J065197B09GGCCCGTTNONE 
J075090K22GGCCCGTTNONE 
J075101P17GGCCCGTTNONE 
J075181F13GGCCCGTTNONE 
J075190H19GGCCCGTTNONE 
J090004P17GGCCCGTTNONE 
J090066I03GGCCCGTTNONE 
Os01g0836400AK073540TCAGGCCCGTTSAC3/GANP family protein. 
J023019D11TCAGGCCCGTTNONE 
J023139O22TCAGGCCCGTTNONE 
J033042J20TCAGGCCCGTTNONE 
J033046M18TCAGGCCCGTTNONE 
J033124J09TCAGGCCCGTTNONE 
J090015E05TCAGGCCCGTTNONE 
J090076J09TCAGGCCCGTTNONE 
Os01g0853600AK107747AACGGGCCGTANONE 
AK108628AACGGGCCGTANONE 
AK120975AACGGGCCGTAConserved hypothetical protein. 
J023041K02AACGGGCCGTANONE 
Os01g0863166J065007F23AACGGGCCGTGNONE 
J065007F23AACGGGCCGTGNONE 
J065007F23CACGGCCCGTTNONE 
J065124H21AACGGGCCGTGConserved hypothetical protein. 
J065124H21AACGGGCCGTGConserved hypothetical protein. 
J065124H21CACGGCCCGTTConserved hypothetical protein. 
Os02g0104800AK070860AACGGGCCConserved hypothetical protein. 
J023002G20AACGGGCCNONE 
J023022J19AACGGGCCNONE 
J023067K03AACGGGCCNONE 
J023108G24AACGGGCCNONE 
J033075B01AACGGGCCNONE 
J033087I15AACGGGCCNONE 
J065087I11AACGGGCCNONE 
J065194E02AACGGGCCNONE 
Os02g0115900AF006825ATCTCGGCCCGTTNONE 
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein. 
AK119653ATCTCGGCCCGTTNONE 
Os02g0122000AK121653AACGGGCCSimilar to P18. 
J023034M04AACGGGCCNONE 
J033023M01AACGGGCCNONE 
J033061I03AACGGGCCNONE 
J033075B04AACGGGCCNONE 
J065035D09AACGGGCCNONE 
J065103D15AACGGGCCNONE 
J065146O07AACGGGCCNONE 
J065193L20AACGGGCCNONE 
J090015G02AACGGGCCNONE 
J090059G13AACGGGCCNONE 
J090068F14AACGGGCCNONE 
J090087H22AACGGGCCNONE 
J100017D08AACGGGCCNONE 
J100029H10AACGGGCCNONE 
J100029I17AACGGGCCNONE 
J100059H12AACGGGCCNONE 
J100060H07AACGGGCCNONE 
Os02g0163600AK068043AACGGGCCCGCConserved hypothetical protein. 
J013131O20AACGGGCCCGCNONE 
J065006E03AACGGGCCCGCNONE 
Os02g0180700AK070746GGCCCGTTSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
Os02g0220600AK061944CAAGGCCCGTTElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK103901GGCCCGTTACAGCCCAACANONE 
AK104946CAAGGCCCGTTNONE 
D89802CAAGGCCCGTTNONE 
J013042L22CAAGGCCCGTTNONE 
J013056A14CAAGGCCCGTTNONE 
J013058O03GGCCCGTTACAGCCCAACANONE 
J013120G13CAAGGCCCGTTNONE 
J013124E21GGCCCGTTACAGCCCAACANONE 
J013155K19CAAGGCCCGTTNONE 
J023002B10CAAGGCCCGTTNONE 
J023023L03GGCCCGTTACAGCCCAACANONE 
J023023L21GGCCCGTTACAGCCCAACANONE 
J023061N01GGCCCGTTACAGCCCAACANONE 
J023065O09GGCCCGTTACAGCCCAACANONE 
J023080J19CAAGGCCCGTTNONE 
J023081C08CAAGGCCCGTTNONE 
J023090H05CAAGGCCCGTTNONE 
J023091M07CAAGGCCCGTTNONE 
J023106J17GGCCCGTTACAGCCCAACANONE 
J023115F09CAAGGCCCGTTNONE 
J023119N08GGCCCGTTACAGCCCAACANONE 
J033025I23CAAGGCCCGTTNONE 
J033026G12CAAGGCCCGTTNONE 
J033035E15CAAGGCCCGTTNONE 
J033040N13CAAGGCCCGTTNONE 
J033046C17CAAGGCCCGTTNONE 
J033058A19GGCCCGTTACAGCCCAACANONE 
J033069F02CAAGGCCCGTTNONE 
J033071B16CAAGGCCCGTTNONE 
J033071N22CAAGGCCCGTTNONE 
J033088J02CAAGGCCCGTTNONE 
J033092N24CAAGGCCCGTTNONE 
J033093I09CAAGGCCCGTTNONE 
J033098O13GGCCCGTTACAGCCCAACANONE 
J033100M18GGCCCGTTACAGCCCAACANONE 
J033125A21GGCCCGTTACAGCCCAACANONE 
J033126G06CAAGGCCCGTTNONE 
J033148C12GGCCCGTTACAGCCCAACANONE 
J043003G15CAAGGCCCGTTNONE 
J043010M11CAAGGCCCGTTNONE 
J043017F03GGCCCGTTACAGCCCAACANONE 
J043024O20CAAGGCCCGTTNONE 
J043032J02GGCCCGTTACAGCCCAACANONE 
J053047N10GGCCCGTTACAGCCCAACANONE 
J053089P04GGCCCGTTACAGCCCAACANONE 
J065051K09GGCCCGTTACAGCCCAACANONE 
J065064H24GGCCCGTTACAGCCCAACANONE 
J065092N03CAAGGCCCGTTNONE 
J080004D17CAAGGCCCGTTNONE 
J080010L09CAAGGCCCGTTNONE 
J080021I11CAAGGCCCGTTNONE 
J080022L01CAAGGCCCGTTNONE 
J080029B01CAAGGCCCGTTNONE 
J080032D11CAAGGCCCGTTNONE 
J080039B11CAAGGCCCGTTNONE 
J080040K17CAAGGCCCGTTNONE 
J080041B21CAAGGCCCGTTNONE 
J080052L24CAAGGCCCGTTNONE 
J080054M12CAAGGCCCGTTNONE 
J080057B15CAAGGCCCGTTNONE 
J080078G15CAAGGCCCGTTNONE 
J080078H06CAAGGCCCGTTNONE 
J080079M03CAAGGCCCGTTNONE 
J080088H16CAAGGCCCGTTNONE 
J080093C11CAAGGCCCGTTNONE 
J080095K09CAAGGCCCGTTNONE 
J080095O20CAAGGCCCGTTNONE 
J090001L06GGCCCGTTACAGCCCAACANONE 
J090009J19CAAGGCCCGTTNONE 
J090017C24GGCCCGTTACAGCCCAACANONE 
J090040D04CAAGGCCCGTTNONE 
J090052E14CAAGGCCCGTTNONE 
J090058G15GGCCCGTTACAGCCCAACANONE 
J090058H23GGCCCGTTACAGCCCAACANONE 
J090061G20GGCCCGTTACAGCCCAACANONE 
J090063B14CAAGGCCCGTTNONE 
J090069N23GGCCCGTTACAGCCCAACANONE 
J090071A08GGCCCGTTACAGCCCAACANONE 
J090071K04CAAGGCCCGTTNONE 
J090074A08GGCCCGTTACAGCCCAACANONE 
J090075E12CAAGGCCCGTTNONE 
J090077B15GGCCCGTTACAGCCCAACANONE 
J090081K06GGCCCGTTACAGCCCAACANONE 
J090083I05GGCCCGTTACAGCCCAACANONE 
J090087A06CAAGGCCCGTTNONE 
J090091O22GGCCCGTTACAGCCCAACANONE 
J090094P03CAAGGCCCGTTNONE 
J090097L10GGCCCGTTACAGCCCAACANONE 
J090098M14CAAGGCCCGTTNONE 
J100026B11GGCCCGTTACAGCCCAACANONE 
J100044M01GGCCCGTTACAGCCCAACANONE 
J100046F10GGCCCGTTACAGCCCAACANONE 
J100051K14GGCCCGTTACAGCCCAACANONE 
J100060D22GGCCCGTTACAGCCCAACANONE 
J100060H18GGCCCGTTACAGCCCAACANONE 
J100070I06GGCCCGTTACAGCCCAACANONE 
J100071C04GGCCCGTTACAGCCCAACANONE 
J100078M13GGCCCGTTACAGCCCAACANONE 
J100080E17GGCCCGTTACAGCCCAACANONE 
J100083I09GGCCCGTTACAGCCCAACANONE 
Os02g0245000AK119770GGCCGGGCGGCCCGTTNONE 
AK119874GGCCGGGCGGCCCGTTSWAP/Surp domain containing protein. 
J065038L11GGCCGGGCGGCCCGTTNONE 
J100059I06GGCCGGGCGGCCCGTTNONE 
J100076C23GGCCGGGCGGCCCGTTNONE 
J100081P08GGCCGGGCGGCCCGTTNONE 
J100084C13GGCCGGGCGGCCCGTTNONE 
Os02g0445700011-046-C10AACGGGCCGTGNONE 
011-046-C10CACGGCCCGTTNONE 
011-046-C10GGCCCGGCCCGTTNONE 
Os02g0467200014-053-H06GGCCCGTTNONE 
AK063704GGCCCGTTConserved hypothetical protein. 
J065197J05GGCCCGTTNONE 
Os02g0565000AK120665AACGGGCCHomeodomain-like containing protein. 
J100070C12AACGGGCCNONE 
J100074L08AACGGGCCNONE 
Os02g0586900013-044-D08AACGGGCCCAGANONE 
014-087-D07AACGGGCCCAGANONE 
AK063583AACGGGCCCAGASimilar to Glycine rich protein (Fragment). 
AK105378AACGGGCCCAGANONE 
Os02g0602300AK065609AACGGGCCGTGNONE 
AK065609AACGGGCCGTGNONE 
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08AACGGGCCGTGNONE 
J013092L08AACGGGCCGTGNONE 
J090040I23AACGGGCCGTGNONE 
J090040I23AACGGGCCGTGNONE 
Os02g0606900J023065M01AACGGGCCNONE 
J075046E14AACGGGCCNONE 
Os02g0697200015-013-B10AACGGGCCCACANONE 
AK059475AACGGGCCCACANONE 
AK102993AACGGGCCCACAConserved hypothetical protein. 
J033079I18AACGGGCCCACANONE 
J033082A14AACGGGCCCACANONE 
J065047H08AACGGGCCCACANONE 
J065131M14AACGGGCCCACANONE 
Os02g0708300009-007-C06GGCCCGTTNONE 
009-007-C06GGCCCGTTNONE 
009-162-G06GGCCCGTTNONE 
009-162-G06GGCCCGTTNONE 
014-048-F12GGCCCGTTNONE 
014-048-F12GGCCCGTTNONE 
AK066348GGCCCGTTConserved hypothetical protein. 
AK066348GGCCCGTTConserved hypothetical protein. 
J013059F24GGCCCGTTNONE 
J013059F24GGCCCGTTNONE 
J023104H14GGCCCGTTNONE 
J023104H14GGCCCGTTNONE 
J053052O22GGCCCGTTNONE 
J053052O22GGCCCGTTNONE 
J053063A05GGCCCGTTNONE 
J053063A05GGCCCGTTNONE 
J053093P09GGCCCGTTNONE 
J053093P09GGCCCGTTNONE 
J065012F24GGCCCGTTNONE 
J065012F24GGCCCGTTNONE 
J065063P09GGCCCGTTNONE 
J065063P09GGCCCGTTNONE 
J065088F12GGCCCGTTNONE 
J065088F12GGCCCGTTNONE 
J065094I11GGCCCGTTNONE 
J065094I11GGCCCGTTNONE 
J065099H19GGCCCGTTNONE 
J065099H19GGCCCGTTNONE 
J065116H07GGCCCGTTNONE 
J065116H07GGCCCGTTNONE 
J065137N07GGCCCGTTNONE 
J065137N07GGCCCGTTNONE 
J065137N11GGCCCGTTNONE 
J065137N11GGCCCGTTNONE 
J065159L22GGCCCGTTNONE 
J065159L22GGCCCGTTNONE 
J065159P11GGCCCGTTNONE 
J065159P11GGCCCGTTNONE 
J065178F17GGCCCGTTNONE 
J065178F17GGCCCGTTNONE 
J065181E07GGCCCGTTNONE 
J065181E07GGCCCGTTNONE 
J075014L16GGCCCGTTNONE 
J075014L16GGCCCGTTNONE 
J075030P11GGCCCGTTNONE 
J075030P11GGCCCGTTNONE 
J075042K24GGCCCGTTNONE 
J075042K24GGCCCGTTNONE 
J075077I15GGCCCGTTNONE 
J075077I15GGCCCGTTNONE 
J075087P06GGCCCGTTNONE 
J075087P06GGCCCGTTNONE 
J075089F20GGCCCGTTNONE 
J075089F20GGCCCGTTNONE 
J075093B07GGCCCGTTNONE 
J075093B07GGCCCGTTNONE 
J075115J23GGCCCGTTNONE 
J075115J23GGCCCGTTNONE 
J075176O19GGCCCGTTNONE 
J075176O19GGCCCGTTNONE 
J075178A04GGCCCGTTNONE 
J075178A04GGCCCGTTNONE 
J075178J02GGCCCGTTNONE 
J075178J02GGCCCGTTNONE 
J090027L02GGCCCGTTNONE 
J090027L02GGCCCGTTNONE 
J100033M12GGCCCGTTNONE 
J100033M12GGCCCGTTNONE 
J100065O08GGCCCGTTNONE 
J100065O08GGCCCGTTNONE 
Os02g0717100014-089-G06TACGGCCCGTTNONE 
AK063741TACGGCCCGTTEsterase/lipase/thioesterase domain containing protein. 
J065052A22TACGGCCCGTTNONE 
Os02g0740300AK067833GGCCCGTTAAA ATPase domain containing protein. 
Os02g0744000AK064898AACGGGCCConserved hypothetical protein. 
AK104827AACGGGCCNONE 
J013000L12AACGGGCCNONE 
J013156N02AACGGGCCNONE 
J065001H14AACGGGCCNONE 
J065038D18AACGGGCCNONE 
J065039I18AACGGGCCNONE 
J065047C13AACGGGCCNONE 
J065053J09AACGGGCCNONE 
J065064G03AACGGGCCNONE 
J065066M05AACGGGCCNONE 
J065068O10AACGGGCCNONE 
J065090H22AACGGGCCNONE 
J065113L19AACGGGCCNONE 
J065121M02AACGGGCCNONE 
J065122K23AACGGGCCNONE 
J065138C12AACGGGCCNONE 
J065153E14AACGGGCCNONE 
J065156N12AACGGGCCNONE 
J065158L20AACGGGCCNONE 
J065166I06AACGGGCCNONE 
J065174L15AACGGGCCNONE 
J065175N03AACGGGCCNONE 
J090092C23AACGGGCCNONE 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0767500005-017-F10AACGGGCCCCACACGNONE 
AB016065AACGGGCCCCACACGNONE 
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter. 
J013020K11AACGGGCCCCACACGNONE 
J013066I18AACGGGCCCCACACGNONE 
J023012D02AACGGGCCCCACACGNONE 
J023020J16AACGGGCCCCACACGNONE 
J023022H13AACGGGCCCCACACGNONE 
J023044N15AACGGGCCCCACACGNONE 
J023067E15AACGGGCCCCACACGNONE 
J023079C06AACGGGCCCCACACGNONE 
J023080B07AACGGGCCCCACACGNONE 
J023081G11AACGGGCCCCACACGNONE 
J023091H22AACGGGCCCCACACGNONE 
J023092J03AACGGGCCCCACACGNONE 
J023114D02AACGGGCCCCACACGNONE 
J023121J15AACGGGCCCCACACGNONE 
J023128G10AACGGGCCCCACACGNONE 
J023132B15AACGGGCCCCACACGNONE 
J023140G10AACGGGCCCCACACGNONE 
J023142B10AACGGGCCCCACACGNONE 
J033026C15AACGGGCCCCACACGNONE 
J033029F21AACGGGCCCCACACGNONE 
J033037I09AACGGGCCCCACACGNONE 
J033046D11AACGGGCCCCACACGNONE 
J033081L20AACGGGCCCCACACGNONE 
J033097J19AACGGGCCCCACACGNONE 
J033125D19AACGGGCCCCACACGNONE 
J033125I04AACGGGCCCCACACGNONE 
J033141M21AACGGGCCCCACACGNONE 
J033143K08AACGGGCCCCACACGNONE 
J053091N01AACGGGCCCCACACGNONE 
J065093C20AACGGGCCCCACACGNONE 
J065104K11AACGGGCCCCACACGNONE 
J065143L16AACGGGCCCCACACGNONE 
J065205I23AACGGGCCCCACACGNONE 
J090057C12AACGGGCCCCACACGNONE 
J090075P11AACGGGCCCCACACGNONE 
Os02g0788800AK066747AACGGGCCAmino acid/polyamine transporter II family protein. 
Os02g0791400009-106-F11AACGGGCCGGANONE 
AK062787AACGGGCCGGACytochrome oxidase c, subunit VIb family protein. 
Os02g0801900006-113-E02AACGGGCCGTGNONE 
006-113-E02AACGGGCCGTGNONE 
006-113-E02CACGGCCCGTTNONE 
AK109488AACGGGCCGTGNONE 
AK109488AACGGGCCGTGNONE 
AK109488CACGGCCCGTTNONE 
AK109498AACGGGCCGTGConserved hypothetical protein. 
AK109498AACGGGCCGTGConserved hypothetical protein. 
AK109498CACGGCCCGTTConserved hypothetical protein. 
J065007D19AACGGGCCGTGNONE 
J065007D19AACGGGCCGTGNONE 
J065007D19CACGGCCCGTTNONE 
J065035G11AACGGGCCGTGNONE 
J065035G11AACGGGCCGTGNONE 
J065035G11CACGGCCCGTTNONE 
J065044E05AACGGGCCGTGNONE 
J065044E05AACGGGCCGTGNONE 
J065044E05CACGGCCCGTTNONE 
J065112N01AACGGGCCGTGNONE 
J065112N01AACGGGCCGTGNONE 
J065112N01CACGGCCCGTTNONE 
J065143B03AACGGGCCGTGNONE 
J065143B03AACGGGCCGTGNONE 
J065143B03CACGGCCCGTTNONE 
J065159A16AACGGGCCGTGNONE 
J065159A16AACGGGCCGTGNONE 
J065159A16CACGGCCCGTTNONE 
J090007K23AACGGGCCGTGNONE 
J090007K23AACGGGCCGTGNONE 
J090007K23CACGGCCCGTTNONE 
J090045N09AACGGGCCGTGNONE 
J090045N09AACGGGCCGTGNONE 
J090045N09CACGGCCCGTTNONE 
J090049L20AACGGGCCGTGNONE 
J090049L20AACGGGCCGTGNONE 
J090049L20CACGGCCCGTTNONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os03g0108000014-001-C09AACGGGCCGAGNONE 
AK102520AACGGGCCGAGSimilar to Dual specificity phosphatase Cdc25 (EC 3.1.3.48) (Arath;CDC25). 
J023083K07AACGGGCCGAGNONE 
J023110F13AACGGGCCGAGNONE 
J033095O09AACGGGCCGAGNONE 
J065219M15AACGGGCCGAGNONE 
J075009G03AACGGGCCGAGNONE 
J080301C17AACGGGCCGAGNONE 
J080301I02AACGGGCCGAGNONE 
J080301O05AACGGGCCGAGNONE 
J080305C08AACGGGCCGAGNONE 
J080305D11AACGGGCCGAGNONE 
J080311B05AACGGGCCGAGNONE 
J080316A17AACGGGCCGAGNONE 
J080317K12AACGGGCCGAGNONE 
J100087M06AACGGGCCGAGNONE 
Os03g0136200004-011-E10AACGGGCCTTGNONE 
006-067-A08AACGGGCCTTGNONE 
011-007-E02AACGGGCCTTGNONE 
011-099-H10AACGGGCCTTGNONE 
012-044-D08AACGGGCCTTGNONE 
013-045-G12AACGGGCCTTGNONE 
013-062-C09AACGGGCCTTGNONE 
013-072-F09AACGGGCCTTGNONE 
013-085-B12AACGGGCCTTGNONE 
013-097-E09AACGGGCCTTGNONE 
013-097-F09AACGGGCCTTGNONE 
014-013-C09AACGGGCCTTGNONE 
014-082-D08AACGGGCCTTGNONE 
015-071-A09AACGGGCCTTGNONE 
AF042333AACGGGCCTTGNONE 
AK060887AACGGGCCTTGNONE 
AK121681AACGGGCCTTG24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14AACGGGCCTTGNONE 
J013123F01AACGGGCCTTGNONE 
J023050A02AACGGGCCTTGNONE 
J033046H22AACGGGCCTTGNONE 
J033070A11AACGGGCCTTGNONE 
J065059G11AACGGGCCTTGNONE 
J065068F10AACGGGCCTTGNONE 
J065164A10AACGGGCCTTGNONE 
J075031F07AACGGGCCTTGNONE 
J075054J01AACGGGCCTTGNONE 
J075086M04AACGGGCCTTGNONE 
J075118K23AACGGGCCTTGNONE 
J075122A09AACGGGCCTTGNONE 
J075123D06AACGGGCCTTGNONE 
J075129A22AACGGGCCTTGNONE 
J075161E07AACGGGCCTTGNONE 
J075179H04AACGGGCCTTGNONE 
J075181C06AACGGGCCTTGNONE 
J075186A12AACGGGCCTTGNONE 
J090014H16AACGGGCCTTGNONE 
J090045G17AACGGGCCTTGNONE 
J090048B09AACGGGCCTTGNONE 
J090052J23AACGGGCCTTGNONE 
J090052K22AACGGGCCTTGNONE 
J090059F10AACGGGCCTTGNONE 
J090080F19AACGGGCCTTGNONE 
J100039J08AACGGGCCTTGNONE 
J100044K02AACGGGCCTTGNONE 
J100051E16AACGGGCCTTGNONE 
J100053F08AACGGGCCTTGNONE 
J100056F07AACGGGCCTTGNONE 
J100058A10AACGGGCCTTGNONE 
Os03g0143000AK073102AAACGGCCCGTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24AAACGGCCCGTTNONE 
Os03g0145600015-010-B10GGCCCGTTNONE 
AK106243GGCCCGTTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0146400AK111974CACGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment). 
AK111974GGCCCGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554CACGGCCCGTTNONE 
AK120554GGCCCGGCCCGTTNONE 
J075060J10CACGGCCCGTTNONE 
J075060J10GGCCCGGCCCGTTNONE 
Os03g0210400AK065966AACGGGCCProtein prenyltransferase domain containing protein. 
Os03g0242300AK065146GGCCCGTTConserved hypothetical protein. 
J013002A22GGCCCGTTNONE 
J023088H11GGCCCGTTNONE 
J065083M12GGCCCGTTNONE 
J065169P06GGCCCGTTNONE 
J100037B08GGCCCGTTNONE 
Os03g0245200003-116-E09AACGGGCCNONE 
AK062288AACGGGCCProtein of unknown function DUF1210 family protein. 
J075022G03AACGGGCCNONE 
J075088C24AACGGGCCNONE 
J075110L07AACGGGCCNONE 
J075112K01AACGGGCCNONE 
J075131F24AACGGGCCNONE 
J075149D10AACGGGCCNONE 
Os03g0248600AK073611AACGGGCCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342AACGGGCCNONE 
AK104877AACGGGCCNONE 
J013026L10AACGGGCCNONE 
J013055P12AACGGGCCNONE 
J023091A14AACGGGCCNONE 
J033034G07AACGGGCCNONE 
J033048H19AACGGGCCNONE 
J033128D07AACGGGCCNONE 
J065060L24AACGGGCCNONE 
J065176A19AACGGGCCNONE 
J090018K08AACGGGCCNONE 
J090023C03AACGGGCCNONE 
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein. 
Os03g0278900006-049-H12TACGGCCCGTTNONE 
006-082-A07TACGGCCCGTTNONE 
009-169-C04TACGGCCCGTTNONE 
AK066019TACGGCCCGTTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TACGGCCCGTTNONE 
AY224460TACGGCCCGTTNONE 
J065021K17TACGGCCCGTTNONE 
J065141H24TACGGCCCGTTNONE 
J065142J20TACGGCCCGTTNONE 
J065152J03TACGGCCCGTTNONE 
J065163A13TACGGCCCGTTNONE 
J065191I21TACGGCCCGTTNONE 
J065193K12TACGGCCCGTTNONE 
J075003D01TACGGCCCGTTNONE 
J075017D24TACGGCCCGTTNONE 
J075060F20TACGGCCCGTTNONE 
J075154C11TACGGCCCGTTNONE 
J075173F04TACGGCCCGTTNONE 
Os03g0302200AK120853AACGGGCCZinc finger, RING-type domain containing protein. 
J023023P20AACGGGCCNONE 
J023064E11AACGGGCCNONE 
J033036C20AACGGGCCNONE 
J043029P08AACGGGCCNONE 
J065124C11AACGGGCCNONE 
J090001K02AACGGGCCNONE 
J090021D03AACGGGCCNONE 
J090034D03AACGGGCCNONE 
J090062J10AACGGGCCNONE 
J100037A15AACGGGCCNONE 
J100067M23AACGGGCCNONE 
Os03g0319300006-021-E05AACGGGCCGGTNONE 
006-022-H12AACGGGCCGGTNONE 
009-187-E02AACGGGCCGGTNONE 
AF042840AACGGGCCGGTNONE 
AK059756AACGGGCCGGTCalmodulin (CaM). 
AK070090AACGGGCCGGTNONE 
J065017J02AACGGGCCGGTNONE 
J065028G17AACGGGCCGGTNONE 
J065045N09AACGGGCCGGTNONE 
J065078F21AACGGGCCGGTNONE 
J065091H01AACGGGCCGGTNONE 
J065112B19AACGGGCCGGTNONE 
J065186E08AACGGGCCGGTNONE 
J065199G12AACGGGCCGGTNONE 
J075030K07AACGGGCCGGTNONE 
J075050B02AACGGGCCGGTNONE 
J075057G07AACGGGCCGGTNONE 
J075070F01AACGGGCCGGTNONE 
J075093N12AACGGGCCGGTNONE 
J075095K13AACGGGCCGGTNONE 
J075102D14AACGGGCCGGTNONE 
J075103B17AACGGGCCGGTNONE 
J075114K05AACGGGCCGGTNONE 
J075142F18AACGGGCCGGTNONE 
J075154L11AACGGGCCGGTNONE 
J075185F08AACGGGCCGGTNONE 
J090012A14AACGGGCCGGTNONE 
J090044L10AACGGGCCGGTNONE 
J100044C12AACGGGCCGGTNONE 
J100088J19AACGGGCCGGTNONE 
Os03g0322600009-180-H12AACGGGCCNONE 
AK067222AACGGGCCHypothetical protein. 
J065017H05AACGGGCCNONE 
J065118G12AACGGGCCNONE 
J065175F07AACGGGCCNONE 
J065175N14AACGGGCCNONE 
Os03g0338600AK066604AACGGGCCGAtRNA pseudouridine synthase family protein. 
Os03g0344100009-166-F10TCCAACGGGCCNONE 
AK061903TCCAACGGGCCNONE 
AK065547TCCAACGGGCCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24TCCAACGGGCCNONE 
J033087C06TCCAACGGGCCNONE 
J053073I09TCCAACGGGCCNONE 
J065189D11TCCAACGGGCCNONE 
J090032B15TCCAACGGGCCNONE 
Os03g0360700006-032-A11GGCCCGTTNONE 
AK068764GGCCCGTTSimilar to Protein-methionine-S-oxide reductase, PilB family. 
AK109429GGCCCGTTNONE 
AY224463GGCCCGTTNONE 
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GACAGGTGGGCCCGTTNONE 
J013159M16GACAGGTGGGCCCGTTNONE 
J090067F01GACAGGTGGGCCCGTTNONE 
J090083F21GACAGGTGGGCCCGTTNONE 
J100040M08GACAGGTGGGCCCGTTNONE 
J100048C03GACAGGTGGGCCCGTTNONE 
J100056M07GACAGGTGGGCCCGTTNONE 
J100062N22GACAGGTGGGCCCGTTNONE 
J100086L07GACAGGTGGGCCCGTTNONE 
Os03g0598200AK068322AACGGGCCNop14-like protein family protein. 
Os03g0726900AK072553GGCCCGTTTGGGCCACConserved hypothetical protein. 
AK100280GGCCCGTTTGGGCCACNONE 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE 
Os03g0792500011-040-A04GGCCCGTTNONE 
013-014-E06GGCCCGTTNONE 
AK068848GGCCCGTTSimilar to Zinc finger POZ domain protein (Fragment). 
AK100829GGCCCGTTNONE 
Os03g0797000AK073440AACGGGCCSimilar to Indole synthase. 
Os03g0822900AK099787AACGGGCCZinc finger, BED-type predicted domain containing protein. 
J013042C24AACGGGCCNONE 
J013096O21AACGGGCCNONE 
J023109I23AACGGGCCNONE 
J033106N09AACGGGCCNONE 
J033107H03AACGGGCCNONE 
J033118G03AACGGGCCNONE 
J033145I24AACGGGCCNONE 
J065138D15AACGGGCCNONE 
J065140L13AACGGGCCNONE 
J065179M13AACGGGCCNONE 
J065200F05AACGGGCCNONE 
J075104F20AACGGGCCNONE 
J075143A15AACGGGCCNONE 
J075197J11AACGGGCCNONE 
Os04g0208400AK069629AACGGGCCGTGCyclin-like F-box domain containing protein. 
Os04g0418000006-025-C05AACGGGCCNONE 
006-025-D11AACGGGCCNONE 
006-045-F02AACGGGCCNONE 
006-060-B04AACGGGCCNONE 
006-063-E03AACGGGCCNONE 
006-070-G08AACGGGCCNONE 
006-072-H05AACGGGCCNONE 
AK061030AACGGGCCNONE 
AK099124AACGGGCCNONE 
AK106155AACGGGCCConserved hypothetical protein. 
AK119714AACGGGCCNONE 
J023039I07AACGGGCCNONE 
J065025N03AACGGGCCNONE 
Os04g0444900AK063657GGCCCGTTSimilar to Alfin-1. 
AK098960GGCCCGTTNONE 
J065037L14GGCCCGTTNONE 
J065037P22GGCCCGTTNONE 
J065173O15GGCCCGTTNONE 
Os04g0462900006-094-A02CACGGCCCGTTNONE 
006-097-F05CACGGCCCGTTNONE 
009-129-A10CACGGCCCGTTNONE 
015-042-F07CACGGCCCGTTNONE 
AK058481CACGGCCCGTTNONE 
AK059483CACGGCCCGTTNONE 
AK061324CACGGCCCGTTNONE 
AK099100CACGGCCCGTTNONE 
AK102579CACGGCCCGTTNONE 
AK106322CACGGCCCGTTSimilar to Prohibitin. 
J065059J20CACGGCCCGTTNONE 
J065085I02CACGGCCCGTTNONE 
J065118N23CACGGCCCGTTNONE 
J065208K24CACGGCCCGTTNONE 
J075053B14CACGGCCCGTTNONE 
J075097M22CACGGCCCGTTNONE 
J075184B07CACGGCCCGTTNONE 
J075194A15CACGGCCCGTTNONE 
J080315G03CACGGCCCGTTNONE 
J090088H19CACGGCCCGTTNONE 
Os04g0508000AK071432AACGGGCCProtein of unknown function DUF231, plant domain containing protein. 
Os04g0508100009-180-A02GGCCCGTTNONE 
AK121759GGCCCGTTConserved hypothetical protein. 
J023007G10GGCCCGTTNONE 
J033089A17GGCCCGTTNONE 
J065193E13GGCCCGTTNONE 
J075025M02GGCCCGTTNONE 
J075027J10GGCCCGTTNONE 
J075030N03GGCCCGTTNONE 
J075045I20GGCCCGTTNONE 
J075065E04GGCCCGTTNONE 
J075134M16GGCCCGTTNONE 
J075140B10GGCCCGTTNONE 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0591000006-090-E02AACGGGCCGAANONE 
AK072902AACGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23AACGGGCCGAANONE 
Os04g0612600AB042115AACGGGCCAGANONE 
AK060707AACGGGCCAGASimilar to Coatomer-like protein, epsilon subunit. 
AK099008AACGGGCCAGANONE 
AK104427AACGGGCCAGANONE 
J023043H02AACGGGCCAGANONE 
J033033I23AACGGGCCAGANONE 
J033067P21AACGGGCCAGANONE 
J033088M21AACGGGCCAGANONE 
J033133M08AACGGGCCAGANONE 
J043030I16AACGGGCCAGANONE 
J075049H08AACGGGCCAGANONE 
Os04g0635800006-033-E07CACGGCCCGTTNONE 
011-067-A08CACGGCCCGTTNONE 
AK060110CACGGCCCGTTNONE 
AK099507CACGGCCCGTTGCN5-related N-acetyltransferase domain containing protein. 
AK104741CACGGCCCGTTNONE 
AK120021CACGGCCCGTTNONE 
J013029B17CACGGCCCGTTNONE 
J013134M07CACGGCCCGTTNONE 
J013149N18CACGGCCCGTTNONE 
J013153L10CACGGCCCGTTNONE 
J033131F08CACGGCCCGTTNONE 
J043010E02CACGGCCCGTTNONE 
J065031J05CACGGCCCGTTNONE 
J065031J06CACGGCCCGTTNONE 
J075030K04CACGGCCCGTTNONE 
J075178K05CACGGCCCGTTNONE 
J080001B10CACGGCCCGTTNONE 
J080003N19CACGGCCCGTTNONE 
J080005F20CACGGCCCGTTNONE 
J080005G16CACGGCCCGTTNONE 
J080007N02CACGGCCCGTTNONE 
J080009J04CACGGCCCGTTNONE 
J080017D04CACGGCCCGTTNONE 
J080020M22CACGGCCCGTTNONE 
J080021A15CACGGCCCGTTNONE 
J080021F21CACGGCCCGTTNONE 
J080023P05CACGGCCCGTTNONE 
J080024P22CACGGCCCGTTNONE 
J080027C20CACGGCCCGTTNONE 
J080029K03CACGGCCCGTTNONE 
J080035M18CACGGCCCGTTNONE 
J080039F22CACGGCCCGTTNONE 
J080039J03CACGGCCCGTTNONE 
J080039L03CACGGCCCGTTNONE 
J080039P14CACGGCCCGTTNONE 
J080042E12CACGGCCCGTTNONE 
J080047D19CACGGCCCGTTNONE 
J080047M21CACGGCCCGTTNONE 
J080049N03CACGGCCCGTTNONE 
J080056J12CACGGCCCGTTNONE 
J080060B10CACGGCCCGTTNONE 
J080062K08CACGGCCCGTTNONE 
J080064L07CACGGCCCGTTNONE 
J080069C15CACGGCCCGTTNONE 
J080074H06CACGGCCCGTTNONE 
J080086O14CACGGCCCGTTNONE 
J080090C20CACGGCCCGTTNONE 
J080090L14CACGGCCCGTTNONE 
J080095G08CACGGCCCGTTNONE 
J080097C07CACGGCCCGTTNONE 
J090011F03CACGGCCCGTTNONE 
J090082O17CACGGCCCGTTNONE 
Os04g0678800AK072212ACCGGCCCGTTN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065ACCGGCCCGTTNONE 
Os04g0692200006-047-H10AACGGGCCNONE 
006-107-D08AACGGGCCNONE 
009-122-B09AACGGGCCNONE 
AK059807AACGGGCCNONE 
AK060875AACGGGCCNONE 
AK071726AACGGGCCConserved hypothetical protein. 
J023110I24AACGGGCCNONE 
J033091O06AACGGGCCNONE 
J053027N16AACGGGCCNONE 
J053089E19AACGGGCCNONE 
J053098H12AACGGGCCNONE 
J053099N13AACGGGCCNONE 
J075031B15AACGGGCCNONE 
J080013D12AACGGGCCNONE 
J080013H05AACGGGCCNONE 
J080013H07AACGGGCCNONE 
J080088I03AACGGGCCNONE 
Os05g0116100006-049-G01AACGGGCCNONE 
006-064-F09AACGGGCCNONE 
006-082-A03AACGGGCCNONE 
006-092-G06AACGGGCCNONE 
006-102-F09AACGGGCCNONE 
AB037970AACGGGCCNONE 
AK061836AACGGGCCNONE 
AK070895AACGGGCCDehydroascorbate reductase. 
AY074786AACGGGCCNONE 
J013022K21AACGGGCCNONE 
J013154A03AACGGGCCNONE 
J023074C02AACGGGCCNONE 
J023091I19AACGGGCCNONE 
J023135M05AACGGGCCNONE 
J065027L11AACGGGCCNONE 
J065065A08AACGGGCCNONE 
J065120A08AACGGGCCNONE 
J065174A05AACGGGCCNONE 
J065184O22AACGGGCCNONE 
J065191D07AACGGGCCNONE 
J065209D04AACGGGCCNONE 
J075014F11AACGGGCCNONE 
J075036D03AACGGGCCNONE 
J075157D23AACGGGCCNONE 
J080007F15AACGGGCCNONE 
J080008N12AACGGGCCNONE 
J080010F22AACGGGCCNONE 
J080011C19AACGGGCCNONE 
J080011F12AACGGGCCNONE 
J080012E11AACGGGCCNONE 
J080015B12AACGGGCCNONE 
J080015O16AACGGGCCNONE 
J080016G24AACGGGCCNONE 
J080016K13AACGGGCCNONE 
J080018A02AACGGGCCNONE 
J080018H03AACGGGCCNONE 
J080022M01AACGGGCCNONE 
J080023D20AACGGGCCNONE 
J080023I01AACGGGCCNONE 
J080023J05AACGGGCCNONE 
J080024A09AACGGGCCNONE 
J080024I09AACGGGCCNONE 
J080025A10AACGGGCCNONE 
J080025G04AACGGGCCNONE 
J080027D21AACGGGCCNONE 
J080029M05AACGGGCCNONE 
J080030J01AACGGGCCNONE 
J080034D10AACGGGCCNONE 
J080036F18AACGGGCCNONE 
J080038N11AACGGGCCNONE 
J080039B07AACGGGCCNONE 
J080039E01AACGGGCCNONE 
J080039K11AACGGGCCNONE 
J080040B09AACGGGCCNONE 
J080040G11AACGGGCCNONE 
J080041H08AACGGGCCNONE 
J080041H19AACGGGCCNONE 
J080041O20AACGGGCCNONE 
J080042C15AACGGGCCNONE 
J080043C16AACGGGCCNONE 
J080043F18AACGGGCCNONE 
J080044B17AACGGGCCNONE 
J080044N10AACGGGCCNONE 
J080044O07AACGGGCCNONE 
J080045H15AACGGGCCNONE 
J080045I03AACGGGCCNONE 
J080046A05AACGGGCCNONE 
J080048I06AACGGGCCNONE 
J080049L04AACGGGCCNONE 
J080049M09AACGGGCCNONE 
J080050G11AACGGGCCNONE 
J080051G20AACGGGCCNONE 
J080053C09AACGGGCCNONE 
J080053I05AACGGGCCNONE 
J080053P18AACGGGCCNONE 
J080054K10AACGGGCCNONE 
J080054P14AACGGGCCNONE 
J080057L05AACGGGCCNONE 
J080062K11AACGGGCCNONE 
J080063C19AACGGGCCNONE 
J080065B03AACGGGCCNONE 
J080066E15AACGGGCCNONE 
J080066H05AACGGGCCNONE 
J080066I05AACGGGCCNONE 
J080068O11AACGGGCCNONE 
J080070L22AACGGGCCNONE 
J080071I12AACGGGCCNONE 
J080071N20AACGGGCCNONE 
J080072D10AACGGGCCNONE 
J080072I10AACGGGCCNONE 
J080074G03AACGGGCCNONE 
J080076E23AACGGGCCNONE 
J080076N03AACGGGCCNONE 
J080077N23AACGGGCCNONE 
J080084B13AACGGGCCNONE 
J080084F07AACGGGCCNONE 
J080085J15AACGGGCCNONE 
J080085P20AACGGGCCNONE 
J080090F21AACGGGCCNONE 
J080093H16AACGGGCCNONE 
J080093J01AACGGGCCNONE 
J080093L04AACGGGCCNONE 
J080097E24AACGGGCCNONE 
J090012G04AACGGGCCNONE 
J090054K05AACGGGCCNONE 
Os05g0148600003-016-C11GGTGGGGCCCGTTNONE 
AK066168GGTGGGGCCCGTTNONE 
AK104336GGTGGGGCCCGTTSimilar to Na+/H+ antiporter. 
AY360145GGTGGGGCCCGTTNONE 
J013055J22GGTGGGGCCCGTTNONE 
J013057M24GGTGGGGCCCGTTNONE 
J013074N03GGTGGGGCCCGTTNONE 
J013158A22GGTGGGGCCCGTTNONE 
J075118H09GGTGGGGCCCGTTNONE 
Os05g0149900AK072901AACGGGCCNONE 
AK101105AACGGGCCNONE 
AK105677AACGGGCCNONE 
J023145E04AACGGGCCNONE 
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein. 
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE 
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE 
Os05g0227800AK110997AACGGGCCGGTCCAAGCCCAAHomeodomain-like containing protein. 
Os05g0297900AK071238AACGGGCCSimilar to Signal peptidase 18 subunit (Fragment). 
J013159C03AACGGGCCNONE 
J023041J06AACGGGCCNONE 
J023085B09AACGGGCCNONE 
J033031J11AACGGGCCNONE 
J065010C22AACGGGCCNONE 
J065032E10AACGGGCCNONE 
J065141O18AACGGGCCNONE 
J065155K04AACGGGCCNONE 
Os05g0304200009-059-H05TCGGCCCGTTNONE 
AK099372TCGGCCCGTTNONE 
AK112073TCGGCCCGTTPAP fibrillin family protein. 
Os05g0328000AK107977TCTGGCCCGTTCGGCCCGConserved hypothetical protein. 
J065005I02TCTGGCCCGTTCGGCCCGNONE 
J065049M05TCTGGCCCGTTCGGCCCGNONE 
J080005F01TCTGGCCCGTTCGGCCCGNONE 
J080005H15TCTGGCCCGTTCGGCCCGNONE 
J080005K23TCTGGCCCGTTCGGCCCGNONE 
J080007O03TCTGGCCCGTTCGGCCCGNONE 
J080013H09TCTGGCCCGTTCGGCCCGNONE 
J080024C02TCTGGCCCGTTCGGCCCGNONE 
J080026M22TCTGGCCCGTTCGGCCCGNONE 
J080029K21TCTGGCCCGTTCGGCCCGNONE 
J080032K04TCTGGCCCGTTCGGCCCGNONE 
J080034M16TCTGGCCCGTTCGGCCCGNONE 
J080037G11TCTGGCCCGTTCGGCCCGNONE 
J080040L01TCTGGCCCGTTCGGCCCGNONE 
J080041D13TCTGGCCCGTTCGGCCCGNONE 
J080043G20TCTGGCCCGTTCGGCCCGNONE 
J080046H17TCTGGCCCGTTCGGCCCGNONE 
J080048A05TCTGGCCCGTTCGGCCCGNONE 
J080064C21TCTGGCCCGTTCGGCCCGNONE 
J080067E15TCTGGCCCGTTCGGCCCGNONE 
J080071P05TCTGGCCCGTTCGGCCCGNONE 
J080074H16TCTGGCCCGTTCGGCCCGNONE 
J080076A18TCTGGCCCGTTCGGCCCGNONE 
J080076D20TCTGGCCCGTTCGGCCCGNONE 
J080077J15TCTGGCCCGTTCGGCCCGNONE 
J080085J11TCTGGCCCGTTCGGCCCGNONE 
J080086E08TCTGGCCCGTTCGGCCCGNONE 
J080088I23TCTGGCCCGTTCGGCCCGNONE 
J080088I24TCTGGCCCGTTCGGCCCGNONE 
J080089D05TCTGGCCCGTTCGGCCCGNONE 
J080093B04TCTGGCCCGTTCGGCCCGNONE 
J080093D07TCTGGCCCGTTCGGCCCGNONE 
J080094A09TCTGGCCCGTTCGGCCCGNONE 
J080096I12TCTGGCCCGTTCGGCCCGNONE 
J080097L23TCTGGCCCGTTCGGCCCGNONE 
Os05g0408900006-053-D03CCCGGCCCGTTNONE 
AF024512CCCGGCCCGTTNONE 
AK058950CCCGGCCCGTTNONE 
AK059821CCCGGCCCGTTNONE 
AK064944CCCGGCCCGTTSimilar to 1-D-deoxyxylulose 5-phosphate synthase. 
AK104851CCCGGCCCGTTNONE 
AK106750CCCGGCCCGTTNONE 
Os05g0413200006-067-C03AACGGGCCNONE 
006-080-C03AACGGGCCNONE 
006-095-G10AACGGGCCNONE 
006-115-G11AACGGGCCNONE 
013-040-E05AACGGGCCNONE 
AB104732AACGGGCCNONE 
AK122099AACGGGCCBeta-tubulin. 
J033087H20AACGGGCCNONE 
J033117C18AACGGGCCNONE 
J033125G10AACGGGCCNONE 
Os05g0443300Os05g0443300GGCCCGTTSec23/Sec24 trunk region domain containing protein. 
Os05g0526300AK099438AACGGGCCNONE 
Os05g0536900009-033-D11AATGGGCCCGTTNONE 
AK105140AATGGGCCCGTTSimilar to RAB7A. 
Os05g0571600Os05g0571600GGGGCCCGTTConserved hypothetical protein. 
Os06g0128400AK064390AACGGGCCCAGATNONE 
AK121983AACGGGCCCAGATWD40-like domain containing protein. 
Os06g0136000AK060303AACGGGCCGTGSimilar to Hypersensitive-induced reaction protein 4. 
AK102678AACGGGCCGTGNONE 
J075185K19AACGGGCCGTGNONE 
J090028C16AACGGGCCGTGNONE 
J090099N12AACGGGCCGTGNONE 
J100070O10AACGGGCCGTGNONE 
Os06g0140100011-063-A02TCCAACGGCCCGTTNONE 
AK063371TCCAACGGCCCGTTLeucine carboxyl methyltransferase family protein. 
Os06g0248200Os06g0248200AACGGGCCCAAAANONE 
Os06g0248300AK070175GGCCCGTTNONE 
AK070362GGCCCGTTConserved hypothetical protein. 
J023025O21GGCCCGTTNONE 
J023049B05GGCCCGTTNONE 
J023133G04GGCCCGTTNONE 
Os06g0573600AK105619GGCCCGTTNONE 
Os06g0585200016-065-C02AACGGGCCGTGNONE 
016-065-C02AACGGGCCGTGNONE 
016-065-C02CACGGCCCGTTNONE 
AK068592AACGGGCCGTGNONE 
AK068592AACGGGCCGTGNONE 
AK068592CACGGCCCGTTNONE 
AK073844AACGGGCCGTGNONE 
AK073844AACGGGCCGTGNONE 
AK073844CACGGCCCGTTNONE 
AK106549AACGGGCCGTGConserved hypothetical protein. 
AK106549AACGGGCCGTGConserved hypothetical protein. 
AK106549CACGGCCCGTTConserved hypothetical protein. 
J013154A14AACGGGCCGTGNONE 
J013154A14AACGGGCCGTGNONE 
J013154A14CACGGCCCGTTNONE 
J100049K24AACGGGCCGTGNONE 
J100049K24AACGGGCCGTGNONE 
J100049K24CACGGCCCGTTNONE 
J100059C18AACGGGCCGTGNONE 
J100059C18AACGGGCCGTGNONE 
J100059C18CACGGCCCGTTNONE 
J100082N13AACGGGCCGTGNONE 
J100082N13AACGGGCCGTGNONE 
J100082N13CACGGCCCGTTNONE 
Os06g0622700AK107021CCAGGCCCGTTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CCAGGCCCGTTNONE 
J065100L18CCAGGCCCGTTNONE 
J065129N15CCAGGCCCGTTNONE 
J065152M08CCAGGCCCGTTNONE 
J065198M12CCAGGCCCGTTNONE 
J090077J22CCAGGCCCGTTNONE 
J100024G23CCAGGCCCGTTNONE 
J100027L01CCAGGCCCGTTNONE 
J100047C06CCAGGCCCGTTNONE 
J100055D01CCAGGCCCGTTNONE 
J100067M05CCAGGCCCGTTNONE 
J100077M16CCAGGCCCGTTNONE 
J100078M22CCAGGCCCGTTNONE 
Os06g0648200009-150-E06CTCGGCCCGTTNONE 
014-034-H10CTCGGCCCGTTNONE 
015-035-E11CTCGGCCCGTTNONE 
AK063001CTCGGCCCGTTNONE 
AK063675CTCGGCCCGTTNONE 
AK106303CTCGGCCCGTTConserved hypothetical protein. 
Os06g0660400AK111110AACGGGCCConserved hypothetical protein. 
Os06g0681000009-105-G11CCAGGCCCGTTNONE 
AK062780CCAGGCCCGTTConserved hypothetical protein. 
J100021E01CCAGGCCCGTTNONE 
Os06g0715000AK107114AACGGGCCCGGTConserved hypothetical protein. 
Os07g0105300AK107419AACGGGCCConserved hypothetical protein. 
AK109521AACGGGCCNONE 
Os07g0158900AK064980CACGGCCCGTTCyclin-like F-box domain containing protein. 
Os07g0164500J013094M18AACGGGCCNONE 
J013153L05AACGGGCCNONE 
J023011J18AACGGGCCNONE 
J023106H21AACGGGCCNONE 
J033105F10AACGGGCCNONE 
J065210M20AACGGGCCSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05AACGGGCCNONE 
J090061C13AACGGGCCNONE 
J090074K15AACGGGCCNONE 
Os07g0301200AB110202AACGGGCCGTGNONE 
AK073463AACGGGCCGTGSimilar to RNA helicase (Fragment). 
Os07g0516200AK061373AACGGGCCSimilar to Endoribonuclease, L-PSP family. 
AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0565700006-106-C01AACGGGCCNONE 
AK111937AACGGGCCNONE 
AK112115AACGGGCCAlpha/beta hydrolase family protein. 
Os07g0589400AK072501GGCCCGTTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617GGCCCGTTNONE 
AK104756GGCCCGTTNONE 
Os07g0623300AK070292AACTGGGCCCGTTSimilar to Splicing factor SC35. 
J023050C05AACTGGGCCCGTTNONE 
J090025O12AACTGGGCCCGTTNONE 
Os07g0626100009-127-G03AACGGGCCAGANONE 
AK062899AACGGGCCAGASimilar to 50S ribosomal protein L7/L12. 
Os08g0116500009-007-E05AACGGGCCGGANONE 
009-074-C07AACGGGCCGGANONE 
009-098-A07AACGGGCCGGANONE 
009-100-C03AACGGGCCGGANONE 
009-136-E04AACGGGCCGGANONE 
009-138-B08AACGGGCCGGANONE 
009-144-B06AACGGGCCGGANONE 
009-184-E04AACGGGCCGGANONE 
009-189-F01AACGGGCCGGANONE 
013-006-E05AACGGGCCGGANONE 
013-015-C10AACGGGCCGGANONE 
013-019-F09AACGGGCCGGANONE 
013-020-C01AACGGGCCGGANONE 
013-021-F05AACGGGCCGGANONE 
013-035-D08AACGGGCCGGANONE 
013-038-C09AACGGGCCGGANONE 
013-054-B07AACGGGCCGGANONE 
013-061-G10AACGGGCCGGANONE 
013-074-B01AACGGGCCGGANONE 
013-079-B06AACGGGCCGGANONE 
013-099-B09AACGGGCCGGANONE 
013-099-G11AACGGGCCGGANONE 
014-023-F04AACGGGCCGGANONE 
014-032-C07AACGGGCCGGANONE 
014-045-E02AACGGGCCGGANONE 
014-085-C02AACGGGCCGGANONE 
014-087-F04AACGGGCCGGANONE 
014-089-C04AACGGGCCGGANONE 
014-090-E01AACGGGCCGGANONE 
014-094-G11AACGGGCCGGANONE 
014-097-B07AACGGGCCGGANONE 
015-024-A12AACGGGCCGGANONE 
015-032-C06AACGGGCCGGANONE 
016-053-E09AACGGGCCGGANONE 
016-081-F10AACGGGCCGGANONE 
AK058240AACGGGCCGGASimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09AACGGGCCGGANONE 
J023107O19AACGGGCCGGANONE 
J053029K21AACGGGCCGGANONE 
J053073P11AACGGGCCGGANONE 
J053074B04AACGGGCCGGANONE 
J053078M14AACGGGCCGGANONE 
J065001E12AACGGGCCGGANONE 
J065006J12AACGGGCCGGANONE 
J065015C06AACGGGCCGGANONE 
J065025D13AACGGGCCGGANONE 
J065029A04AACGGGCCGGANONE 
J065031D23AACGGGCCGGANONE 
J065032E24AACGGGCCGGANONE 
J065034P16AACGGGCCGGANONE 
J065043B04AACGGGCCGGANONE 
J065044A15AACGGGCCGGANONE 
J065062D18AACGGGCCGGANONE 
J065079G13AACGGGCCGGANONE 
J065080A19AACGGGCCGGANONE 
J065080A20AACGGGCCGGANONE 
J065089N19AACGGGCCGGANONE 
J065111O07AACGGGCCGGANONE 
J065115N15AACGGGCCGGANONE 
J065131A04AACGGGCCGGANONE 
J065138H02AACGGGCCGGANONE 
J065139K10AACGGGCCGGANONE 
J065144A02AACGGGCCGGANONE 
J065155J17AACGGGCCGGANONE 
J065159D18AACGGGCCGGANONE 
J065159I18AACGGGCCGGANONE 
J065167H12AACGGGCCGGANONE 
J065174C22AACGGGCCGGANONE 
J065184A05AACGGGCCGGANONE 
J065188M15AACGGGCCGGANONE 
J065191D23AACGGGCCGGANONE 
J065203C07AACGGGCCGGANONE 
J065207C23AACGGGCCGGANONE 
J065207L16AACGGGCCGGANONE 
J065212F01AACGGGCCGGANONE 
J065212F05AACGGGCCGGANONE 
J075037B07AACGGGCCGGANONE 
J075042F15AACGGGCCGGANONE 
J075059J03AACGGGCCGGANONE 
J075068M18AACGGGCCGGANONE 
J075079E13AACGGGCCGGANONE 
J075081F12AACGGGCCGGANONE 
J075083I05AACGGGCCGGANONE 
J075123K23AACGGGCCGGANONE 
J075142F16AACGGGCCGGANONE 
J075156N03AACGGGCCGGANONE 
J075162K05AACGGGCCGGANONE 
J075171E08AACGGGCCGGANONE 
J075177N03AACGGGCCGGANONE 
J075182K17AACGGGCCGGANONE 
J075186K02AACGGGCCGGANONE 
J075191K05AACGGGCCGGANONE 
J080011E10AACGGGCCGGANONE 
J080016M21AACGGGCCGGANONE 
J080017A17AACGGGCCGGANONE 
J080031O09AACGGGCCGGANONE 
J080039G21AACGGGCCGGANONE 
J080041B01AACGGGCCGGANONE 
J080050G20AACGGGCCGGANONE 
J080054A12AACGGGCCGGANONE 
J080058O08AACGGGCCGGANONE 
J080061N04AACGGGCCGGANONE 
J080064L23AACGGGCCGGANONE 
J080064P05AACGGGCCGGANONE 
J080069I17AACGGGCCGGANONE 
J080070E07AACGGGCCGGANONE 
J080071B20AACGGGCCGGANONE 
J080074L08AACGGGCCGGANONE 
J080076N08AACGGGCCGGANONE 
J080081A14AACGGGCCGGANONE 
J080081J17AACGGGCCGGANONE 
J080085N14AACGGGCCGGANONE 
J080090B09AACGGGCCGGANONE 
J080097L11AACGGGCCGGANONE 
J080306H13AACGGGCCGGANONE 
J080307H13AACGGGCCGGANONE 
J080311F12AACGGGCCGGANONE 
J080316L23AACGGGCCGGANONE 
J080318H02AACGGGCCGGANONE 
J090016L15AACGGGCCGGANONE 
J090019I02AACGGGCCGGANONE 
J090031G21AACGGGCCGGANONE 
J090066C15AACGGGCCGGANONE 
J100032I02AACGGGCCGGANONE 
J100032N07AACGGGCCGGANONE 
J100032N16AACGGGCCGGANONE 
J100041P21AACGGGCCGGANONE 
J100048M04AACGGGCCGGANONE 
J100048M14AACGGGCCGGANONE 
J100063B08AACGGGCCGGANONE 
J100088E20AACGGGCCGGANONE 
J100090I08AACGGGCCGGANONE 
Os08g0133600AK073987AACGGGCCCAGGNONE 
AK105436AACGGGCCCAGGConserved hypothetical protein. 
Os08g0172800AK111113AACGGGCCGGGConserved hypothetical protein. 
Os08g0328300AK102227CACGGCCCGTTNONE 
AK105392CACGGCCCGTTENT domain containing protein. 
Os08g0346400003-103-D08AACGGGCCNONE 
009-135-G12AACGGGCCNONE 
AK059644AACGGGCCNONE 
AK062928AACGGGCCNONE 
AK103873AACGGGCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11AACGGGCCNONE 
J065137E08AACGGGCCNONE 
J065194M22AACGGGCCNONE 
J075083O16AACGGGCCNONE 
Os08g0406500016-001-C06AGGTGGGCCCGTTNONE 
AK064160AGGTGGGCCCGTTTRAF-like domain containing protein. 
Os08g0442300006-067-F05AACGGGCCNONE 
AK059843AACGGGCCNONE 
AK071719AACGGGCCSimilar to Calcineurin-like protein. 
AK102411AACGGGCCNONE 
J023108H11AACGGGCCNONE 
J033092P05AACGGGCCNONE 
J075109C09AACGGGCCNONE 
J090070B02AACGGGCCNONE 
J090076M14AACGGGCCNONE 
J100064B16AACGGGCCNONE 
Os08g0535600AK121683CCCGGCCCGGCCCGTTZinc finger, Tim10/DDP-type family protein. 
J065077E05CCCGGCCCGGCCCGTTNONE 
J075088M24CCCGGCCCGGCCCGTTNONE 
J075140B03CCCGGCCCGGCCCGTTNONE 
J090014B14CCCGGCCCGGCCCGTTNONE 
Os09g0129600J065058B14GGCCCGTTSite-specific recombinase family protein. 
J065215K24GGCCCGTTNONE 
Os09g0319701009-048-G04GGCCCGTTConserved hypothetical protein. 
009-189-D04GGCCCGTTNONE 
J065037N18GGCCCGTTNONE 
J065093P03GGCCCGTTNONE 
J065184L12GGCCCGTTNONE 
J075002G04GGCCCGTTNONE 
J075033A17GGCCCGTTNONE 
J075095M15GGCCCGTTNONE 
J075180N24GGCCCGTTNONE 
Os09g0325300011-005-H08TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
AK068435TCGGCCCAAACTTGGGCCGGCCCGTTConserved hypothetical protein. 
AK073998TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J033071H21TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J065214H05TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
Os09g0338400AK059171AACGGGCCGAANONE 
AK068798AACGGGCCGAANONE 
AK072043AACGGGCCGAANONE 
AK098947AACGGGCCGAASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0397100J075141L14AACGGGCCGGANONE 
J100063H17AACGGGCCGGAConserved hypothetical protein. 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0437900AK107833GGCCCGTTSimilar to Adrenodoxin. 
Os09g0439500AK067780AACGGGCCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
Os09g0498600AK066995CCCGGCCCGTTNONE 
Os11g0115800AK106102TCGGCCCGTTConserved hypothetical protein. 
J065057N13TCGGCCCGTTNONE 
Os11g0157100012-010-F03GGAGTGGGCCTGAAACGGGCCNONE 
J013028H01GGAGTGGGCCTGAAACGGGCCNONE 
J013061L19GGAGTGGGCCTGAAACGGGCCNONE 
J033044L03GGAGTGGGCCTGAAACGGGCCNONE 
J033064P09GGAGTGGGCCTGAAACGGGCCNONE 
J033076A10GGAGTGGGCCTGAAACGGGCCNONE 
J033076K22GGAGTGGGCCTGAAACGGGCCNONE 
J033084J05GGAGTGGGCCTGAAACGGGCCNONE 
J033145A22GGAGTGGGCCTGAAACGGGCCNONE 
J033148L19GGAGTGGGCCTGAAACGGGCCNONE 
J065027P20GGAGTGGGCCTGAAACGGGCCNONE 
J065085D16GGAGTGGGCCTGAAACGGGCCNONE 
J065091L03GGAGTGGGCCTGAAACGGGCCNONE 
J065195C18GGAGTGGGCCTGAAACGGGCCNONE 
J090018N23GGAGTGGGCCTGAAACGGGCCNONE 
J090048A10GGAGTGGGCCTGAAACGGGCCNONE 
J090048M03GGAGTGGGCCTGAAACGGGCCNONE 
J090066L11GGAGTGGGCCTGAAACGGGCCNONE 
J090075G16GGAGTGGGCCTGAAACGGGCCNONE 
J090083G23GGAGTGGGCCTGAAACGGGCCNONE 
J090087E24GGAGTGGGCCTGAAACGGGCCNONE 
J090096H16GGAGTGGGCCTGAAACGGGCCNONE 
Os11g0209100016-063-F03TCCGGCCCGTTNONE 
AK064391TCCGGCCCGTTCyclin-like F-box domain containing protein. 
J075027K02TCCGGCCCGTTNONE 
J075154K15TCCGGCCCGTTNONE 
Os11g0216400Os11g0216400AACGGGCCCCACTCTProteinase inhibitor, propeptide domain containing protein. 
Os11g0484500AK059546AACGGGCCNONE 
Os11g0544700AF464904AACGGGCCGGANONE 
AK072844AACGGGCCGGARepressor protein. 
J023143I16AACGGGCCGGANONE 
Os11g0657200AK059959GGCCCGTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AACGGGCCNONE 
AK062752AACGGGCCSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0660000AK066709CACGGCCCGTTSodium/calcium exchanger membrane region domain containing protein. 
AK066709GGCCCGGCCCGTTSodium/calcium exchanger membrane region domain containing protein. 
J013074O18CACGGCCCGTTNONE 
J013074O18GGCCCGGCCCGTTNONE 
J023081H12CACGGCCCGTTNONE 
J023081H12GGCCCGGCCCGTTNONE 
J065072E24CACGGCCCGTTNONE 
J065072E24GGCCCGGCCCGTTNONE 
J065186K08CACGGCCCGTTNONE 
J065186K08GGCCCGGCCCGTTNONE 
J075079E19CACGGCCCGTTNONE 
J075079E19GGCCCGGCCCGTTNONE 
J075093J05CACGGCCCGTTNONE 
J075093J05GGCCCGGCCCGTTNONE 
J075124I21CACGGCCCGTTNONE 
J075124I21GGCCCGGCCCGTTNONE 
J075187F09CACGGCCCGTTNONE 
J075187F09GGCCCGGCCCGTTNONE 
J090037O16CACGGCCCGTTNONE 
J090037O16GGCCCGGCCCGTTNONE 
Os12g0124400AK071024AACGGGCCExostosin-like family protein. 
Os12g0190100AK109819AACGGGCCSimilar to Auxin-independent growth promoter-like protein. 
Os12g0231000AK120737AACGGGCCTGF-beta receptor, type I/II extracellular region family protein. 
Os12g0540900AK060440TCCGGCCCGTTNONE 
AK102417TCCGGCCCGTTSimilar to Tryptophanyl-tRNA synthetase (EC 6.1.1.2) (Tryptophan--tRNA ligase) (TrpRS). 
D10401TCCGGCCCGTTNONE 
J023088E16TCCGGCCCGTTNONE 
Os12g0557800AK121691AACGGGCCGTGProtein prenyltransferase domain containing protein. 
J013095M03AACGGGCCGTGNONE 
J033071H11AACGGGCCGTGNONE 
J065101B02AACGGGCCGTGNONE 
Os12g0636600AK111056GGCCCGTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.