version

Summary of OsREG425 (All List)

OrganismOryza sativa  
IDOsREG425  
SequenceAACTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count834  

Entry Sequences (834 entries)

LocusGene modelSequenceDescription
Os01g0266600AK058396GCCCAGTTNONE 
AK069749GCCCAGTTRedoxin domain containing protein. 
J023030N01GCCCAGTTNONE 
J065065E03GCCCAGTTNONE 
J075006N11GCCCAGTTNONE 
J075017G04GCCCAGTTNONE 
J075023L15GCCCAGTTNONE 
J075126F05GCCCAGTTNONE 
Os01g0276700011-014-A12AACTGGGCNONE 
012-092-G12AACTGGGCNONE 
AK103164AACTGGGCNONE 
AK103465AACTGGGCSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09AACTGGGCNONE 
J023084I02AACTGGGCNONE 
J033027F20AACTGGGCNONE 
J033029M06AACTGGGCNONE 
J033039K13AACTGGGCNONE 
J033057C24AACTGGGCNONE 
J033058G20AACTGGGCNONE 
J033060A14AACTGGGCNONE 
J033061M21AACTGGGCNONE 
J033068M10AACTGGGCNONE 
J033074K16AACTGGGCNONE 
J033076C11AACTGGGCNONE 
J033093O13AACTGGGCNONE 
J033119H20AACTGGGCNONE 
J033121D22AACTGGGCNONE 
J033129N11AACTGGGCNONE 
J033131E12AACTGGGCNONE 
J033150L07AACTGGGCNONE 
J053024N17AACTGGGCNONE 
J053034G19AACTGGGCNONE 
J053035E18AACTGGGCNONE 
J053046M01AACTGGGCNONE 
J053047P04AACTGGGCNONE 
J053048B06AACTGGGCNONE 
J053050M22AACTGGGCNONE 
J053053E09AACTGGGCNONE 
J053053I07AACTGGGCNONE 
J053059K03AACTGGGCNONE 
J053059P12AACTGGGCNONE 
J053060C12AACTGGGCNONE 
J053060H24AACTGGGCNONE 
J053064D19AACTGGGCNONE 
J053066L15AACTGGGCNONE 
J053073I02AACTGGGCNONE 
J053083E15AACTGGGCNONE 
J053094D05AACTGGGCNONE 
J053094P18AACTGGGCNONE 
J053095C15AACTGGGCNONE 
J053095C21AACTGGGCNONE 
J053099N16AACTGGGCNONE 
J090025O19AACTGGGCNONE 
J090049N22AACTGGGCNONE 
J090050F17AACTGGGCNONE 
Os01g0337700015-049-E12GCCCAGTTNONE 
AK106340GCCCAGTTNONE 
AK106939GCCCAGTTConserved hypothetical protein. 
AK109210GCCCAGTTNONE 
J075198P18GCCCAGTTNONE 
J100031N01GCCCAGTTNONE 
J100073P13GCCCAGTTNONE 
Os01g0348700009-125-H02GCAGCCCAGTTNONE 
009-156-F08GCAGCCCAGTTNONE 
009-177-A11GCAGCCCAGTTNONE 
009-195-D02GCAGCCCAGTTNONE 
013-040-B06GCAGCCCAGTTNONE 
013-051-B09GCAGCCCAGTTNONE 
AK120842GCAGCCCAGTTSimilar to 60S ribosomal protein L23a (L25). 
J013071O22GCAGCCCAGTTNONE 
J023022J07GCAGCCCAGTTNONE 
J033028J08GCAGCCCAGTTNONE 
J033109M11GCAGCCCAGTTNONE 
J043022K15GCAGCCCAGTTNONE 
J043031N11GCAGCCCAGTTNONE 
J053023I10GCAGCCCAGTTNONE 
J053045F16GCAGCCCAGTTNONE 
J053054F22GCAGCCCAGTTNONE 
J053094P15GCAGCCCAGTTNONE 
J065048F01GCAGCCCAGTTNONE 
J075012F16GCAGCCCAGTTNONE 
J075089C09GCAGCCCAGTTNONE 
J075179J20GCAGCCCAGTTNONE 
J080305E19GCAGCCCAGTTNONE 
J080309B21GCAGCCCAGTTNONE 
J090017L05GCAGCCCAGTTNONE 
J090058B11GCAGCCCAGTTNONE 
Os01g0502400004-005-F01AACTGGGCNONE 
AK065149AACTGGGCProlyl 4-hydroxylase, alpha subunit domain containing protein. 
AK104357AACTGGGCNONE 
AK106095AACTGGGCNONE 
J013002B07AACTGGGCNONE 
J013098G12AACTGGGCNONE 
J033149E15AACTGGGCNONE 
J075012L21AACTGGGCNONE 
J075065B15AACTGGGCNONE 
J075091B11AACTGGGCNONE 
J100043F16AACTGGGCNONE 
Os01g0530366J075001P06AACGGGCCCAGTTNONE 
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein. 
J075030G13AACGGGCCCAGTTNONE 
Os01g0550000AK058505GCCCAGTTNONE 
Os01g0603700AK068313GCCCAGTTNONE 
Os01g0660100AK108487AACTGGGCCTTConserved hypothetical protein. 
Os01g0715800011-061-G06GCCCAGTTNONE 
AK063369GCCCAGTTConserved hypothetical protein. 
J065194O22GCCCAGTTNONE 
Os01g0842500011-030-F11GCCCAGTTNONE 
AK066513GCCCAGTTSimilar to Laccase (EC 1.10.3.2). 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
AK102882CCACCAACTGGGCCCCACANONE 
AK103686CCACCAACTGGGCCCCACANONE 
Os01g0871800AK064787GTGGCCCAGTTNONE 
AK067087GTGGCCCAGTTTGF-beta receptor, type I/II extracellular region family protein. 
AK120109GTGGCCCAGTTNONE 
J013023O17GTGGCCCAGTTNONE 
J013108P12GTGGCCCAGTTNONE 
J013110E18GTGGCCCAGTTNONE 
J013110E22GTGGCCCAGTTNONE 
J013132E24GTGGCCCAGTTNONE 
J013160C03GTGGCCCAGTTNONE 
Os01g0913800011-060-B02AACTGGGCCCACCANONE 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
Os01g0949200AK102412AACTGGGCCAGANONE 
J033093A04AACTGGGCCAGANONE 
J065053P06AACTGGGCCAGANONE 
J100086D18AACTGGGCCAGANONE 
Os01g0965800AK107795AACTGGGCCCCACTCTConserved hypothetical protein. 
Os02g0106100AK072245AACTGGGCCAASimilar to Fructosyltransferase. 
Os02g0120000AK067383AACTGGGCCCCAProtein prenyltransferase domain containing protein. 
AK101590AACTGGGCCCCANONE 
J013100B15AACTGGGCCCCANONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0178400009-151-B08AACTGGGCCCACTNONE 
009-151-B08AACTGGGCCGCNONE 
AK063815AACTGGGCCCACTProtein transport protein SEC61 gamma subunit. 
AK063815AACTGGGCCGCProtein transport protein SEC61 gamma subunit. 
AK121516AACTGGGCCCACTNONE 
AK121516AACTGGGCCGCNONE 
J033026A17AACTGGGCCCACTNONE 
J033026A17AACTGGGCCGCNONE 
J065011K14AACTGGGCCCACTNONE 
J065011K14AACTGGGCCGCNONE 
J065056D01AACTGGGCCCACTNONE 
J065056D01AACTGGGCCGCNONE 
J065061L22AACTGGGCCCACTNONE 
J065061L22AACTGGGCCGCNONE 
J065076M01AACTGGGCCCACTNONE 
J065076M01AACTGGGCCGCNONE 
J075092E14AACTGGGCCCACTNONE 
J075092E14AACTGGGCCGCNONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0192700004-020-H12AACTGGGCTGGNONE 
006-024-H06AACTGGGCTGGNONE 
006-042-F06AACTGGGCTGGNONE 
006-050-D04AACTGGGCTGGNONE 
006-059-E10AACTGGGCTGGNONE 
006-070-B02AACTGGGCTGGNONE 
006-084-A09AACTGGGCTGGNONE 
006-114-E11AACTGGGCTGGNONE 
006-117-E05AACTGGGCTGGNONE 
009-126-D11AACTGGGCTGGNONE 
AK061629AACTGGGCTGGSimilar to Thioredoxin peroxidase. 
AK065909AACTGGGCTGGNONE 
J013043E11AACTGGGCTGGNONE 
J065038I09AACTGGGCTGGNONE 
J065078C12AACTGGGCTGGNONE 
J065122O14AACTGGGCTGGNONE 
J065198H04AACTGGGCTGGNONE 
Os02g0681100AK100584GCCCAGTTProtein of unknown function DUF604 family protein. 
J023106A15GCCCAGTTNONE 
Os02g0775200AB038319AAGGCCCAGTTNONE 
AK069984AAGGCCCAGTTSimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAGGCCCAGTTNONE 
Os02g0795200AK059349AACTGGGCCACConserved hypothetical protein. 
Os02g0819100AK100156TTGGCCCAGTTZinc finger, DHHC-type domain containing protein. 
J013088C21TTGGCCCAGTTNONE 
Os02g0819700AK067374CTCGGCCCAGTTZinc finger, Zim17-type family protein. 
AK099160CTCGGCCCAGTTNONE 
J100086K17CTCGGCCCAGTTNONE 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
Os02g0829900009-044-G07AACTGGGCCGAANONE 
AK120917AACTGGGCCGAASimilar to BRICK1. 
AY224582AACTGGGCCGAANONE 
J023034L01AACTGGGCCGAANONE 
J023034M01AACTGGGCCGAANONE 
J090010G06AACTGGGCCGAANONE 
J090020D07AACTGGGCCGAANONE 
J100041L04AACTGGGCCGAANONE 
J100061D05AACTGGGCCGAANONE 
J100070L18AACTGGGCCGAANONE 
Os02g0830000011-075-D11TTCGGCCCAGTTNONE 
AK101841TTCGGCCCAGTTProtein prenyltransferase domain containing protein. 
J033069G13TTCGGCCCAGTTNONE 
Os02g0830700AK101172AAGGCCCAGTTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0102200AK120183TAGGCCCAGTTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TAGGCCCAGTTNONE 
J065116C05TAGGCCCAGTTNONE 
J065120N21TAGGCCCAGTTNONE 
J090049D24TAGGCCCAGTTNONE 
Os03g0127000AK068479TTGGCCCAGTTConserved hypothetical protein. 
J013152D10TTGGCCCAGTTNONE 
J075167I20TTGGCCCAGTTNONE 
J090067O04TTGGCCCAGTTNONE 
Os03g0135600J065183G03AACTGGGCAnkyrin repeat containing protein. 
Os03g0266000AK068775AACTGGGCCCCOvarian tumour, otubain domain containing protein. 
AK104949AACTGGGCCCCNONE 
J075149K24AACTGGGCCCCNONE 
J075184C19AACTGGGCCCCNONE 
Os03g0301200AK119578GCCCAGTTNONE 
J013027D03GCCCAGTTNONE 
J075035F14GCCCAGTTNONE 
J090075I19GCCCAGTTNONE 
J090081E22GCCCAGTTNONE 
J100035I20GCCCAGTTNONE 
J100051E18GCCCAGTTNONE 
J100053H11GCCCAGTTNONE 
J100081P07GCCCAGTTNONE 
Os03g0410700J065102A22AACTGGGCCCGNONE 
J065102A22AACTGGGCCGTGNONE 
Os03g0410900J065067F10CACGGCCCAGTTNONE 
J065067F10CGGGCCCAGTTNONE 
J065073D08CACGGCCCAGTTNONE 
J065073D08CGGGCCCAGTTNONE 
J065176C06CACGGCCCAGTTNONE 
J065176C06CGGGCCCAGTTNONE 
J065189O13CACGGCCCAGTTNONE 
J065189O13CGGGCCCAGTTNONE 
J065214E05CACGGCCCAGTTNONE 
J065214E05CGGGCCCAGTTNONE 
J080007H09CACGGCCCAGTTNONE 
J080007H09CGGGCCCAGTTNONE 
J080012B19CACGGCCCAGTTNONE 
J080012B19CGGGCCCAGTTNONE 
J080020J16CACGGCCCAGTTNONE 
J080020J16CGGGCCCAGTTNONE 
J080038J22CACGGCCCAGTTNONE 
J080038J22CGGGCCCAGTTNONE 
J080045I09CACGGCCCAGTTNONE 
J080045I09CGGGCCCAGTTNONE 
J080059M16CACGGCCCAGTTNONE 
J080059M16CGGGCCCAGTTNONE 
J080060C19CACGGCCCAGTTNONE 
J080060C19CGGGCCCAGTTNONE 
J080080P22CACGGCCCAGTTNONE 
J080080P22CGGGCCCAGTTNONE 
J080083C03CACGGCCCAGTTNONE 
J080083C03CGGGCCCAGTTNONE 
J080093M17CACGGCCCAGTTNONE 
J080093M17CGGGCCCAGTTNONE 
J100029F12CACGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
J100029F12CGGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
Os03g0439800009-197-D03GACGGCCCAGTTNONE 
AK058503GACGGCCCAGTTNONE 
AK066154GACGGCCCAGTTConserved hypothetical protein. 
J065017G24GACGGCCCAGTTNONE 
J090084E18GACGGCCCAGTTNONE 
Os03g0442400Os03g0442400TAAGCCCAGTTNONE 
Os03g0604600J090093K23AGGGCCCAGTTConserved hypothetical protein. 
Os03g0639700AK099587AACTGGGCTGASimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0668400AK119454GCCCAGTTProtein of unknown function DUF860, plant family protein. 
Os03g0684400AK100086AACTGGGCCCCACCMg2+ transporter protein, CorA-like family protein. 
Os03g0699900J065025K07AACTGGGCSomatomedin B domain containing protein. 
J065025K08AACTGGGCNONE 
Os03g0701100014-015-E11AACTGGGCCAANONE 
AK109455AACTGGGCCAANONE 
AK110740AACTGGGCCAANONE 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0755000AK068540GCCCAGTTSimilar to Serine/threonine kinase (Fragment). 
Os03g0769600AK100054TCCGGCCCAGTTResB-like family protein. 
Os04g0129300AK109511AACTGGGCCAAYT521-B-like protein family protein. 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0564600009-038-A02AACTGGGCCTCNONE 
AK105145AACTGGGCCTCNONE 
AK120614AACTGGGCCTCSimilar to HMG1 protein. 
J013102D16AACTGGGCCTCNONE 
J013151P06AACTGGGCCTCNONE 
J033082C11AACTGGGCCTCNONE 
J065073N13AACTGGGCCTCNONE 
J065142E11AACTGGGCCTCNONE 
J065187I19AACTGGGCCTCNONE 
J065204K02AACTGGGCCTCNONE 
J090089P22AACTGGGCCTCNONE 
J100060B16AACTGGGCCTCNONE 
Os04g0577000AK073711AACTGGGCCGGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AACTGGGCCGGANONE 
J013127H04AACTGGGCCGGANONE 
J033035G06AACTGGGCCGGANONE 
J033061G23AACTGGGCCGGANONE 
J033127L07AACTGGGCCGGANONE 
J065015F17AACTGGGCCGGANONE 
J065062G08AACTGGGCCGGANONE 
J065132M07AACTGGGCCGGANONE 
J065155C12AACTGGGCCGGANONE 
J075055I08AACTGGGCCGGANONE 
J075140D07AACTGGGCCGGANONE 
J090055B21AACTGGGCCGGANONE 
J100031D23AACTGGGCCGGANONE 
Os04g0589200AK068571GCCCAGTTConserved hypothetical protein. 
AK102463GCCCAGTTNONE 
J075083K10GCCCAGTTNONE 
Os04g0636900011-028-G03AAACGGCCCAGTTNONE 
012-040-G03AAACGGCCCAGTTNONE 
AK058405AAACGGCCCAGTTNONE 
AK065789AAACGGCCCAGTTNONE 
AK101408AAACGGCCCAGTTNONE 
AK119286AAACGGCCCAGTTNONE 
J013042J24AAACGGCCCAGTTNONE 
J033037I12AAACGGCCCAGTTNONE 
J043031B12AAACGGCCCAGTTNONE 
J065152N10AAACGGCCCAGTTNONE 
J090060K17AAACGGCCCAGTTNONE 
J090083K14AAACGGCCCAGTTNONE 
J100046O13AAACGGCCCAGTTNONE 
J100066G22AAACGGCCCAGTTNONE 
Os04g0649600009-019-A10GCCCAGTTNONE 
009-019-A10GCCCAGTTGCCCACCCGCGCNONE 
009-059-G07GCCCAGTTNONE 
009-059-G07GCCCAGTTGCCCACCCGCGCNONE 
009-068-D06GCCCAGTTNONE 
009-068-D06GCCCAGTTGCCCACCCGCGCNONE 
AK105164GCCCAGTTConserved hypothetical protein. 
AK105164GCCCAGTTGCCCACCCGCGCConserved hypothetical protein. 
J100056J15GCCCAGTTNONE 
J100056J15GCCCAGTTGCCCACCCGCGCNONE 
Os04g0654700006-097-D06AACTGGGCNONE 
013-016-H01AACTGGGCNONE 
AB055495AACTGGGCNONE 
AF072849AACTGGGCNONE 
AK062107AACTGGGCNONE 
AK099088AACTGGGCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16AACTGGGCNONE 
J013038J23AACTGGGCNONE 
J013038L17AACTGGGCNONE 
J013038N18AACTGGGCNONE 
J013038O18AACTGGGCNONE 
J013124A09AACTGGGCNONE 
J023007N04AACTGGGCNONE 
J033023C02AACTGGGCNONE 
J033030M18AACTGGGCNONE 
J033068I09AACTGGGCNONE 
J033100E04AACTGGGCNONE 
J065153E19AACTGGGCNONE 
J065207I02AACTGGGCNONE 
J075007A07AACTGGGCNONE 
J075036M04AACTGGGCNONE 
J075147I03AACTGGGCNONE 
J075197L11AACTGGGCNONE 
Os04g0670600AK064255AAAAGCCCGGCCCAGTTNONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0103300009-149-B02AACTGGGCNONE 
AK062996AACTGGGCNONE 
AK071540AACTGGGCSimilar to AT.I.24-5 protein (Fragment). 
J065041E04AACTGGGCNONE 
J065053J17AACTGGGCNONE 
J065092B22AACTGGGCNONE 
J065102J24AACTGGGCNONE 
J065113A08AACTGGGCNONE 
J065149D07AACTGGGCNONE 
J065169B02AACTGGGCNONE 
J075150C06AACTGGGCNONE 
Os05g0104800006-022-G08AACTGGGCTGCNONE 
AK070215AACTGGGCTGCSimilar to Eukaryotic translation initiation factor 3 subunit 5 (eIF-3 epsilon) (eIF3 p32 subunit) (eIF3f). 
AK104207AACTGGGCTGCNONE 
AK104554AACTGGGCTGCNONE 
J023043K07AACTGGGCTGCNONE 
J023079C24AACTGGGCTGCNONE 
J033050A14AACTGGGCTGCNONE 
J033095G11AACTGGGCTGCNONE 
J033097D16AACTGGGCTGCNONE 
J033108J11AACTGGGCTGCNONE 
J053037E01AACTGGGCTGCNONE 
J053061I17AACTGGGCTGCNONE 
J065040F22AACTGGGCTGCNONE 
J065055B15AACTGGGCTGCNONE 
J065091N23AACTGGGCTGCNONE 
J090062J16AACTGGGCTGCNONE 
J100065J21AACTGGGCTGCNONE 
Os05g0184901Os05g0184901CCTGGGCCCAGTTSigma factor, regions 3 and 4 domain containing protein. 
Os05g0295900AK069962AACTGGGCCGGTConserved hypothetical protein. 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
Os05g0480700AK100850AACTGGGCCGTCCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AACTGGGCCGTCCNONE 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0545500AK101095AACTGGGCCACConserved hypothetical protein. 
AK119499AACTGGGCCACNONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0589000AK061980AACTGGGCCAANONE 
AK099181AACTGGGCCAAConserved hypothetical protein. 
Os06g0128500AK058563AAAGCCCAGTTRibosomal protein L47, mitochondrial family protein. 
AK122132AAAGCCCAGTTNONE 
J033133F04AAAGCCCAGTTNONE 
J065094M24AAAGCCCAGTTNONE 
J065122J07AAAGCCCAGTTNONE 
J065137G10AAAGCCCAGTTNONE 
J065178L09AAAGCCCAGTTNONE 
J080011E11AAAGCCCAGTTNONE 
J080020G21AAAGCCCAGTTNONE 
J080039H03AAAGCCCAGTTNONE 
J080039J04AAAGCCCAGTTNONE 
Os06g0134000AJ417525AACTGGGCCCACTNONE 
AJ417525AACTGGGCCTANONE 
AK062184AACTGGGCCCACTNONE 
AK062184AACTGGGCCTANONE 
AK106717AACTGGGCCCACTSimilar to 40S ribosomal protein S20. 
AK106717AACTGGGCCTASimilar to 40S ribosomal protein S20. 
AK120319AACTGGGCCCACTNONE 
AK120319AACTGGGCCTANONE 
D10402AACTGGGCCCACTNONE 
D10402AACTGGGCCTANONE 
D12632AACTGGGCCCACTNONE 
D12632AACTGGGCCTANONE 
J013056N13AACTGGGCCCACTNONE 
J013056N13AACTGGGCCTANONE 
J023100G01AACTGGGCCCACTNONE 
J023100G01AACTGGGCCTANONE 
J053059F04AACTGGGCCCACTNONE 
J053059F04AACTGGGCCTANONE 
J053068M21AACTGGGCCCACTNONE 
J053068M21AACTGGGCCTANONE 
J053078H15AACTGGGCCCACTNONE 
J053078H15AACTGGGCCTANONE 
J065050O15AACTGGGCCCACTNONE 
J065050O15AACTGGGCCTANONE 
J065060G15AACTGGGCCCACTNONE 
J065060G15AACTGGGCCTANONE 
J065080K10AACTGGGCCCACTNONE 
J065080K10AACTGGGCCTANONE 
J065108G05AACTGGGCCCACTNONE 
J065108G05AACTGGGCCTANONE 
J065186K16AACTGGGCCCACTNONE 
J065186K16AACTGGGCCTANONE 
J075150J12AACTGGGCCCACTNONE 
J075150J12AACTGGGCCTANONE 
J080002I18AACTGGGCCCACTNONE 
J080002I18AACTGGGCCTANONE 
J080005H04AACTGGGCCCACTNONE 
J080005H04AACTGGGCCTANONE 
J080008I06AACTGGGCCCACTNONE 
J080008I06AACTGGGCCTANONE 
J080010G20AACTGGGCCCACTNONE 
J080010G20AACTGGGCCTANONE 
J080010N10AACTGGGCCCACTNONE 
J080010N10AACTGGGCCTANONE 
J080018H02AACTGGGCCCACTNONE 
J080018H02AACTGGGCCTANONE 
J080022O14AACTGGGCCCACTNONE 
J080022O14AACTGGGCCTANONE 
J080023F23AACTGGGCCCACTNONE 
J080023F23AACTGGGCCTANONE 
J080025D16AACTGGGCCCACTNONE 
J080025D16AACTGGGCCTANONE 
J080027L12AACTGGGCCCACTNONE 
J080027L12AACTGGGCCTANONE 
J080030F16AACTGGGCCCACTNONE 
J080030F16AACTGGGCCTANONE 
J080038N04AACTGGGCCCACTNONE 
J080038N04AACTGGGCCTANONE 
J080048O17AACTGGGCCCACTNONE 
J080048O17AACTGGGCCTANONE 
J080056B05AACTGGGCCCACTNONE 
J080056B05AACTGGGCCTANONE 
J080061D02AACTGGGCCCACTNONE 
J080061D02AACTGGGCCTANONE 
J080062H18AACTGGGCCCACTNONE 
J080062H18AACTGGGCCTANONE 
J080064E06AACTGGGCCCACTNONE 
J080064E06AACTGGGCCTANONE 
J080066D23AACTGGGCCCACTNONE 
J080066D23AACTGGGCCTANONE 
J080071F08AACTGGGCCCACTNONE 
J080071F08AACTGGGCCTANONE 
J080089E06AACTGGGCCCACTNONE 
J080089E06AACTGGGCCTANONE 
J080089K22AACTGGGCCCACTNONE 
J080089K22AACTGGGCCTANONE 
J080091C18AACTGGGCCCACTNONE 
J080091C18AACTGGGCCTANONE 
J080095G10AACTGGGCCCACTNONE 
J080095G10AACTGGGCCTANONE 
J090038G01AACTGGGCCCACTNONE 
J090038G01AACTGGGCCTANONE 
J090062K07AACTGGGCCCACTNONE 
J090062K07AACTGGGCCTANONE 
J100051G19AACTGGGCCCACTNONE 
J100051G19AACTGGGCCTANONE 
Os06g0157800AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0595900AK066655AACTGGGCTranscription elongation factor S-II, central region domain containing protein. 
J075022F02AACTGGGCNONE 
J075055H13AACTGGGCNONE 
J075188H14AACTGGGCNONE 
Os07g0164100AK111557TCTGGCCCAGTTHistone deacetylase superfamily protein. 
Os07g0164200009-038-C11AACTGGGCCAGANONE 
AK059382AACTGGGCCAGATranslation factor domain containing protein. 
AK107096AACTGGGCCAGANONE 
Os07g0180900006-055-B11AACTGGGCNONE 
006-103-F09AACTGGGCNONE 
011-009-E03AACTGGGCNONE 
011-035-H08AACTGGGCNONE 
014-043-F08AACTGGGCNONE 
AK060711AACTGGGCRibosomal protein L4/L1e family protein. 
AK060963AACTGGGCNONE 
AK104447AACTGGGCNONE 
AK104504AACTGGGCNONE 
AK104629AACTGGGCNONE 
J023003P15AACTGGGCNONE 
J023075H14AACTGGGCNONE 
J033101N17AACTGGGCNONE 
J033132M11AACTGGGCNONE 
J065081C24AACTGGGCNONE 
J080004L10AACTGGGCNONE 
J080009H21AACTGGGCNONE 
J080013F01AACTGGGCNONE 
J080022K24AACTGGGCNONE 
J080023C22AACTGGGCNONE 
J080024M16AACTGGGCNONE 
J080026K06AACTGGGCNONE 
J080030J23AACTGGGCNONE 
J080030L05AACTGGGCNONE 
J080031G03AACTGGGCNONE 
J080033C03AACTGGGCNONE 
J080033D02AACTGGGCNONE 
J080035A11AACTGGGCNONE 
J080035A14AACTGGGCNONE 
J080039E08AACTGGGCNONE 
J080040L15AACTGGGCNONE 
J080040M03AACTGGGCNONE 
J080041L21AACTGGGCNONE 
J080043E09AACTGGGCNONE 
J080048B14AACTGGGCNONE 
J080048O09AACTGGGCNONE 
J080051H01AACTGGGCNONE 
J080052H06AACTGGGCNONE 
J080065K05AACTGGGCNONE 
J080066D10AACTGGGCNONE 
J080066E23AACTGGGCNONE 
J080069F10AACTGGGCNONE 
J080074M06AACTGGGCNONE 
J080075D13AACTGGGCNONE 
J080076G02AACTGGGCNONE 
J080082G15AACTGGGCNONE 
J080082K06AACTGGGCNONE 
J080082P12AACTGGGCNONE 
J080085F01AACTGGGCNONE 
J080090H22AACTGGGCNONE 
J080092D07AACTGGGCNONE 
J080094M03AACTGGGCNONE 
J080094O10AACTGGGCNONE 
J090008I06AACTGGGCNONE 
J100058N20AACTGGGCNONE 
J100060M07AACTGGGCNONE 
J100062M08AACTGGGCNONE 
J100064L07AACTGGGCNONE 
J100073H16AACTGGGCNONE 
J100074C10AACTGGGCNONE 
J100075N06AACTGGGCNONE 
J100087P11AACTGGGCNONE 
J100088B13AACTGGGCNONE 
J100088J16AACTGGGCNONE 
J100088L17AACTGGGCNONE 
J100088O12AACTGGGCNONE 
Os07g0184200AK106871AACTGGGCProtein of unknown function DUF295 family protein. 
Os07g0205700AK120553GCGGCCCAGTTSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24GCGGCCCAGTTNONE 
Os07g0225100016-021-E05AACTGGGCCTCNONE 
AK064193AACTGGGCCTCAromatic amino acid permease family protein. 
Os07g0258400AK121534AACTGGGCCCATTNONE 
L41217AACTGGGCCCATTNONE 
S81897AACTGGGCCCATTOsNramp1 (Integral membrane protein). 
Os07g0297400AK059367GCCCAGTTTGGGCNONE 
AK101219GCCCAGTTTGGGCConserved hypothetical protein. 
J033031C14GCCCAGTTTGGGCNONE 
J033133E01GCCCAGTTTGGGCNONE 
J100053J24GCCCAGTTTGGGCNONE 
J100058N23GCCCAGTTTGGGCNONE 
Os07g0438300AK106732GCCCAGTTConserved hypothetical protein. 
AK106732GCCCAGTTConserved hypothetical protein. 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0516900AK061900AACTGGGCTTCSimilar to RNA Binding Protein 45. 
Os07g0539900AK071889GCCCGGCCCAGTTSimilar to Beta-1,3-glucanase-like protein. 
AK098943GCCCGGCCCAGTTNONE 
J013047P11GCCCGGCCCAGTTNONE 
Os07g0549800AK120874AACTGGGCCTASimilar to RGP-3 (Fragment). 
J023026P08AACTGGGCCTANONE 
J065205C05AACTGGGCCTANONE 
J065219M14AACTGGGCCTANONE 
J080010N21AACTGGGCCTANONE 
J080016K09AACTGGGCCTANONE 
J080017M18AACTGGGCCTANONE 
J080024C07AACTGGGCCTANONE 
J080027K09AACTGGGCCTANONE 
J080028E12AACTGGGCCTANONE 
J080028I22AACTGGGCCTANONE 
J080029C01AACTGGGCCTANONE 
J080030I18AACTGGGCCTANONE 
J080030M03AACTGGGCCTANONE 
J080032B11AACTGGGCCTANONE 
J080035B15AACTGGGCCTANONE 
J080038I09AACTGGGCCTANONE 
J080041C15AACTGGGCCTANONE 
J080042B01AACTGGGCCTANONE 
J080042F04AACTGGGCCTANONE 
J080048H05AACTGGGCCTANONE 
J080057F02AACTGGGCCTANONE 
J080069D04AACTGGGCCTANONE 
J080077K01AACTGGGCCTANONE 
J080085N11AACTGGGCCTANONE 
J080093P13AACTGGGCCTANONE 
J080097G10AACTGGGCCTANONE 
J080097L17AACTGGGCCTANONE 
J090026L10AACTGGGCCTANONE 
J090075O05AACTGGGCCTANONE 
Os07g0564400Os07g0564400GTGGCCCAGTTNucleic acid-binding, OB-fold domain containing protein. 
Os07g0568100AK099778CAAGCCCAGTTSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
009-083-H02CCAGCCCAGTTNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
AK062660CCAGCCCAGTTConserved hypothetical protein. 
Os07g0569000AK073915AACTGGGCTGGConserved hypothetical protein. 
AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0585800006-106-A05AACTGGGCCCAGCNONE 
AK066419AACTGGGCCCAGCNONE 
AK105064AACTGGGCCCAGCSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01AACTGGGCCCAGCNONE 
J065085B08AACTGGGCCCAGCNONE 
J065099I23AACTGGGCCCAGCNONE 
J065169A01AACTGGGCCCAGCNONE 
J065187N13AACTGGGCCCAGCNONE 
J065191L18AACTGGGCCCAGCNONE 
J065194D04AACTGGGCCCAGCNONE 
J065211M09AACTGGGCCCAGCNONE 
J065212I02AACTGGGCCCAGCNONE 
J090003C10AACTGGGCCCAGCNONE 
J090025O11AACTGGGCCCAGCNONE 
J090092F10AACTGGGCCCAGCNONE 
J100055A04AACTGGGCCCAGCNONE 
J100064A01AACTGGGCCCAGCNONE 
J100080L02AACTGGGCCCAGCNONE 
Os07g0589400AK072501AACTGGGCCGCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617AACTGGGCCGCANONE 
AK104756AACTGGGCCGCANONE 
Os07g0621300006-055-E10CTGGCCCAGTTNONE 
AK059824CTGGCCCAGTTNONE 
AK071567CTGGCCCAGTTGRAM domain containing protein. 
Os07g0623300AK070292AACTGGGCCCGTTSimilar to Splicing factor SC35. 
J023050C05AACTGGGCCCGTTNONE 
J090025O12AACTGGGCCCGTTNONE 
Os07g0681600AK073504AACTGGGCCTCATP-dependent DNA helicase RecQ family protein. 
Os08g0126700AK111805AACTGGGCCAANONE 
AK111902AACTGGGCCAAZinc finger, CCCH-type domain containing protein. 
Os08g0233300AK067421AACTGGGCCGAANONE 
AK120342AACTGGGCCGAAConserved hypothetical protein. 
J013061K19AACTGGGCCGAANONE 
J013106J20AACTGGGCCGAANONE 
J023022P16AACTGGGCCGAANONE 
J090015I03AACTGGGCCGAANONE 
Os08g0243600AB110183AACTGGGCNONE 
AK101443AACTGGGCHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0260600AK108529GCCCAGTTCD9/CD37/CD63 antigen family protein. 
Os08g0439900AK110628AACTGGGCCCATTMitochondrial glycoprotein family protein. 
J065118D13AACTGGGCCCATTNONE 
Os08g0440000006-056-A06TCTCGGCCCAGTTNONE 
AK060959TCTCGGCCCAGTTNONE 
AK102539TCTCGGCCCAGTTVesicle transport v-SNARE family protein. 
J065012O03TCTCGGCCCAGTTNONE 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0465300AK108076AACTGGGCCGTTConserved hypothetical protein. 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0538100AK108432GCCCAGTTProtein of unknown function DUF247, plant family protein. 
Os08g0542100AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK101416AACTGGGCCACNONE 
AK101416AACTGGGCCACNONE 
J033037N08AACTGGGCCACNONE 
J033037N08AACTGGGCCACNONE 
J033086B16AACTGGGCCACNONE 
J033086B16AACTGGGCCACNONE 
J043036J02AACTGGGCCACNONE 
J043036J02AACTGGGCCACNONE 
J065137E02AACTGGGCCACNONE 
J065137E02AACTGGGCCACNONE 
J090015L07AACTGGGCCACNONE 
J090015L07AACTGGGCCACNONE 
J100036D02AACTGGGCCACNONE 
J100036D02AACTGGGCCACNONE 
Os08g0550100AB070258CAAGCCCAGTTNONE 
AK061287CAAGCCCAGTTSimilar to 26S proteasome subunit RPN3a. 
Os09g0338400AK059171GTGGCCCAGTTNONE 
AK068798GTGGCCCAGTTNONE 
AK072043GTGGCCCAGTTNONE 
AK098947GTGGCCCAGTTSimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0411700005-017-C05AACTGGGCNONE 
009-163-B01AACTGGGCNONE 
AK058290AACTGGGCPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919AACTGGGCNONE 
AK121091AACTGGGCNONE 
J013039D20AACTGGGCNONE 
J023066F16AACTGGGCNONE 
J023082H09AACTGGGCNONE 
J023088H05AACTGGGCNONE 
J065013G09AACTGGGCNONE 
J065065C12AACTGGGCNONE 
J065111I04AACTGGGCNONE 
J065179H22AACTGGGCNONE 
J075023N14AACTGGGCNONE 
J090041J17AACTGGGCNONE 
J100031J21AACTGGGCNONE 
J100057A18AACTGGGCNONE 
J100068P22AACTGGGCNONE 
Os09g0451500AK062254GTGTGGGCCCAGTTThioredoxin domain 2 containing protein. 
AK072941GTGTGGGCCCAGTTNONE 
Os09g0464000AK060777GCCCAGTTNONE 
AK069530GCCCAGTTSimilar to Carbonate dehydratase-like protein. 
Os09g0482740006-098-F12GCCCAGTTNONE 
AK061852GCCCAGTTProtein of unknown function DUF1664 family protein. 
J013032I17GCCCAGTTNONE 
J013119L22GCCCAGTTNONE 
J065114C06GCCCAGTTNONE 
J090059O06GCCCAGTTNONE 
J090062K09GCCCAGTTNONE 
J100031O03GCCCAGTTNONE 
J100038P06GCCCAGTTNONE 
J100051M18GCCCAGTTNONE 
J100075H20GCCCAGTTNONE 
J100077O11GCCCAGTTNONE 
Os09g0548700Os09g0548700AACTGGGCFAD dependent oxidoreductase family protein. 
Os11g0139100009-099-H06AAACGGCCCAGTTNONE 
AK121443AAACGGCCCAGTTSimilar to 50S ribosomal protein L24. 
J023140O18AAACGGCCCAGTTNONE 
J023143M23AAACGGCCCAGTTNONE 
J033079G04AAACGGCCCAGTTNONE 
J043004D20AAACGGCCCAGTTNONE 
J065097F05AAACGGCCCAGTTNONE 
Os11g0484300AK121422AACTGGGCCAGASimilar to Mcm2-prov protein. 
Os11g0527100AK101702GCCCAGTTHypothetical protein. 
J033060F02GCCCAGTTNONE 
Os11g0545800AK073687CCAGCCCAGTTRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCAGCCCAGTTNONE 
Os11g0629500AK072665GCCCAGTTSimilar to Phosphoserine phosphatase, chloroplast precursor (EC 3.1.3.3) (PSP) (O-phosphoserine phosphohydrolase) (PSPase). 
Os12g0115900AK058318AACTGGGCElongation factor P/YeiP family protein. 
J065078K17AACTGGGCNONE 
J065102G03AACTGGGCNONE 
J065122B14AACTGGGCNONE 
J065122C10AACTGGGCNONE 
J065134I23AACTGGGCNONE 
J065176B12AACTGGGCNONE 
Os12g0124700AK073156AACTGGGCCGGACDC45-like protein family protein. 
J090013O22AACTGGGCCGGANONE 
Os12g0149100AK062909GCCCAGTTHypothetical protein. 
Os12g0168200015-027-H11AACTGGGCCGGCCCAGGNONE 
AK069543AACTGGGCCGGCCCAGGSsu72-like protein family protein. 
J023025N02AACTGGGCCGGCCCAGGNONE 
Os12g0244000AK106408CCAGCCCAGTTHypothetical protein. 
Os12g0533600J065106H15AACTGGGCCTAConserved hypothetical protein. 
J065194D13AACTGGGCCTANONE 
Os12g0596300AK109146CCAGCCCAGTTDC1 domain containing protein. 
AK109146CCAGCCCAGTTDC1 domain containing protein. 
Os12g0630600J100033A04CAAGCCCAGTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.